>Feature sequence01 150 566 gene locus_tag LOCUS_00010 150 566 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174928.1 protein_id gnl|my_center|LOCUS_00010 677 1885 gene locus_tag LOCUS_00020 677 1885 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525384.1 protein_id gnl|my_center|LOCUS_00020 2220 1966 gene locus_tag LOCUS_00030 2220 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3447 2419 gene locus_tag LOCUS_00040 3447 2419 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083714.1 protein_id gnl|my_center|LOCUS_00040 3859 4527 gene locus_tag LOCUS_00050 3859 4527 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173384.1 protein_id gnl|my_center|LOCUS_00050 4524 5405 gene locus_tag LOCUS_00060 4524 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5730 6134 gene locus_tag LOCUS_00070 5730 6134 CDS product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083514136.1 protein_id gnl|my_center|LOCUS_00070 6291 6689 gene locus_tag LOCUS_00080 6291 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7419 6709 gene locus_tag LOCUS_00090 7419 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444153.1 protein_id gnl|my_center|LOCUS_00090 7531 8088 gene locus_tag LOCUS_00100 7531 8088 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089582.1 protein_id gnl|my_center|LOCUS_00100 9410 8124 gene locus_tag LOCUS_00110 9410 8124 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090554.1 protein_id gnl|my_center|LOCUS_00110 11864 9801 gene locus_tag LOCUS_00120 11864 9801 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965357.1 protein_id gnl|my_center|LOCUS_00120 12677 14162 gene locus_tag LOCUS_r00010 12677 14162 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 14365 14441 gene locus_tag LOCUS_t00010 14365 14441 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 14474 14549 gene locus_tag LOCUS_t00020 14474 14549 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14977 17787 gene locus_tag LOCUS_r00020 14977 17787 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 17863 17971 gene locus_tag LOCUS_r00030 17863 17971 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 18208 18804 gene locus_tag LOCUS_00130 18208 18804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084225.1 protein_id gnl|my_center|LOCUS_00130 19448 19119 gene locus_tag LOCUS_00140 19448 19119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 19338 20747 gene locus_tag LOCUS_00150 19338 20747 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965761.1 protein_id gnl|my_center|LOCUS_00150 20795 21349 gene locus_tag LOCUS_00160 20795 21349 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090532.1 protein_id gnl|my_center|LOCUS_00160 21576 24059 gene locus_tag LOCUS_00170 21576 24059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 24438 24046 gene locus_tag LOCUS_00180 24438 24046 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084205.1 protein_id gnl|my_center|LOCUS_00180 25299 24442 gene locus_tag LOCUS_00190 25299 24442 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965355.1 protein_id gnl|my_center|LOCUS_00190 25454 26113 gene locus_tag LOCUS_00200 gene ftsE 25454 26113 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544305.1 protein_id gnl|my_center|LOCUS_00200 26106 27077 gene locus_tag LOCUS_00210 26106 27077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084208.1 protein_id gnl|my_center|LOCUS_00210 27225 27878 gene locus_tag LOCUS_00220 27225 27878 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084209.1 protein_id gnl|my_center|LOCUS_00220 28046 28819 gene locus_tag LOCUS_00230 28046 28819 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084210.1 protein_id gnl|my_center|LOCUS_00230 29516 28932 gene locus_tag LOCUS_00240 29516 28932 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173537.1 protein_id gnl|my_center|LOCUS_00240 29757 30944 gene locus_tag LOCUS_00250 29757 30944 CDS product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084212.1 protein_id gnl|my_center|LOCUS_00250 32007 31066 gene locus_tag LOCUS_00260 32007 31066 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084213.1 protein_id gnl|my_center|LOCUS_00260 33101 32004 gene locus_tag LOCUS_00270 gene hisC 33101 32004 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084214.1 protein_id gnl|my_center|LOCUS_00270 34079 33228 gene locus_tag LOCUS_00280 34079 33228 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084215.1 protein_id gnl|my_center|LOCUS_00280 34403 35602 gene locus_tag LOCUS_00290 34403 35602 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084216.1 protein_id gnl|my_center|LOCUS_00290 35604 36272 gene locus_tag LOCUS_00300 gene metW 35604 36272 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173533.1 protein_id gnl|my_center|LOCUS_00300 36678 37292 gene locus_tag LOCUS_00310 36678 37292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 38138 37362 gene locus_tag LOCUS_00320 38138 37362 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_00320 38422 41058 gene locus_tag LOCUS_00330 gene clpB 38422 41058 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084221.1 protein_id gnl|my_center|LOCUS_00330 41446 43281 gene locus_tag LOCUS_00340 41446 43281 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_00340 43292 45022 gene locus_tag LOCUS_00350 gene cysI 43292 45022 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_00350 45259 46443 gene locus_tag LOCUS_00360 gene metB 45259 46443 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844963.1 protein_id gnl|my_center|LOCUS_00360 46926 46543 gene locus_tag LOCUS_00370 46926 46543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 48384 47269 gene locus_tag LOCUS_00380 48384 47269 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173081.1 protein_id gnl|my_center|LOCUS_00380 49975 48596 gene locus_tag LOCUS_00390 49975 48596 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089740.1 protein_id gnl|my_center|LOCUS_00390 50370 50020 gene locus_tag LOCUS_00400 gene fliN 50370 50020 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089739.1 protein_id gnl|my_center|LOCUS_00400 51017 50388 gene locus_tag LOCUS_00410 51017 50388 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089738.1 protein_id gnl|my_center|LOCUS_00410 52105 51017 gene locus_tag LOCUS_00420 gene fliG 52105 51017 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089737.1 protein_id gnl|my_center|LOCUS_00420 53737 52112 gene locus_tag LOCUS_00430 gene fliF 53737 52112 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089736.1 protein_id gnl|my_center|LOCUS_00430 54183 53908 gene locus_tag LOCUS_00440 54183 53908 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 protein_id gnl|my_center|LOCUS_00440 55059 54367 gene locus_tag LOCUS_00450 55059 54367 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089735.1 protein_id gnl|my_center|LOCUS_00450 56329 55070 gene locus_tag LOCUS_00460 56329 55070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 56942 58144 gene locus_tag LOCUS_00470 gene mnmA 56942 58144 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089733.1 protein_id gnl|my_center|LOCUS_00470 58167 58805 gene locus_tag LOCUS_00480 58167 58805 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089732.1 protein_id gnl|my_center|LOCUS_00480 58848 59192 gene locus_tag LOCUS_00490 58848 59192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 59299 59375 gene locus_tag LOCUS_t00030 59299 59375 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 60945 59332 gene locus_tag LOCUS_00500 60945 59332 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339453.1 protein_id gnl|my_center|LOCUS_00500 61288 61476 gene locus_tag LOCUS_00510 61288 61476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 62036 61473 gene locus_tag LOCUS_00520 62036 61473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63482 62694 gene locus_tag LOCUS_00530 63482 62694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 63658 63479 gene locus_tag LOCUS_00540 63658 63479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 64016 63792 gene locus_tag LOCUS_00550 64016 63792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 64309 64013 gene locus_tag LOCUS_00560 64309 64013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 64833 65066 gene locus_tag LOCUS_00570 64833 65066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 65344 65069 gene locus_tag LOCUS_00580 65344 65069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 65539 65835 gene locus_tag LOCUS_00590 65539 65835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 65835 66455 gene locus_tag LOCUS_00600 65835 66455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 66455 66940 gene locus_tag LOCUS_00610 66455 66940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 66937 67116 gene locus_tag LOCUS_00620 66937 67116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 67077 70433 gene locus_tag LOCUS_00630 67077 70433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 70451 70834 gene locus_tag LOCUS_00640 70451 70834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272167.1 protein_id gnl|my_center|LOCUS_00640 70831 71040 gene locus_tag LOCUS_00650 70831 71040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 71477 71695 gene locus_tag LOCUS_00660 71477 71695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 71692 72081 gene locus_tag LOCUS_00670 71692 72081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 72084 73268 gene locus_tag LOCUS_00680 72084 73268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 73265 73969 gene locus_tag LOCUS_00690 73265 73969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 74189 74590 gene locus_tag LOCUS_00700 74189 74590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 74794 75264 gene locus_tag LOCUS_00710 74794 75264 CDS product P27 family phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336919.1 protein_id gnl|my_center|LOCUS_00710 75245 76651 gene locus_tag LOCUS_00720 75245 76651 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_00720 76584 78437 gene locus_tag LOCUS_00730 76584 78437 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_00730 78449 79672 gene locus_tag LOCUS_00740 78449 79672 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975496.1 protein_id gnl|my_center|LOCUS_00740 79675 80361 gene locus_tag LOCUS_00750 79675 80361 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138387483.1 protein_id gnl|my_center|LOCUS_00750 80371 81654 gene locus_tag LOCUS_00760 80371 81654 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640585.1 protein_id gnl|my_center|LOCUS_00760 81721 82107 gene locus_tag LOCUS_00770 81721 82107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975493.1 protein_id gnl|my_center|LOCUS_00770 82156 82752 gene locus_tag LOCUS_00780 82156 82752 CDS product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 protein_id gnl|my_center|LOCUS_00780 82992 82768 gene locus_tag LOCUS_00790 82992 82768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 83067 83411 gene locus_tag LOCUS_00800 83067 83411 CDS product head-tail adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975487.1 protein_id gnl|my_center|LOCUS_00800 83426 83836 gene locus_tag LOCUS_00810 83426 83836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975488.1 protein_id gnl|my_center|LOCUS_00810 83978 84442 gene locus_tag LOCUS_00820 83978 84442 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975486.1 protein_id gnl|my_center|LOCUS_00820 84439 84735 gene locus_tag LOCUS_00830 84439 84735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 84732 85136 gene locus_tag LOCUS_00840 84732 85136 CDS product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975485.1 protein_id gnl|my_center|LOCUS_00840 85149 85592 gene locus_tag LOCUS_00850 85149 85592 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975484.1 protein_id gnl|my_center|LOCUS_00850 85589 86008 gene locus_tag LOCUS_00860 85589 86008 CDS product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975483.1 protein_id gnl|my_center|LOCUS_00860 86170 88224 gene locus_tag LOCUS_00870 86170 88224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 88224 88571 gene locus_tag LOCUS_00880 88224 88571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 88568 89302 gene locus_tag LOCUS_00890 88568 89302 CDS product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055651.1 protein_id gnl|my_center|LOCUS_00890 89306 90001 gene locus_tag LOCUS_00900 89306 90001 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211708.1 protein_id gnl|my_center|LOCUS_00900 90005 90685 gene locus_tag LOCUS_00910 90005 90685 CDS product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014072014.1 protein_id gnl|my_center|LOCUS_00910 90707 94087 gene locus_tag LOCUS_00920 90707 94087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 94104 95525 gene locus_tag LOCUS_00930 94104 95525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 95548 97485 gene locus_tag LOCUS_00940 95548 97485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 97856 98674 gene locus_tag LOCUS_00950 97856 98674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 98671 99033 gene locus_tag LOCUS_00960 98671 99033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 99030 99359 gene locus_tag LOCUS_00970 99030 99359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 99359 99757 gene locus_tag LOCUS_00980 99359 99757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 99754 99987 gene locus_tag LOCUS_00990 99754 99987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 99991 100179 gene locus_tag LOCUS_01000 99991 100179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 101931 101656 gene locus_tag LOCUS_01010 101931 101656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 102161 101898 gene locus_tag LOCUS_01020 102161 101898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087305.1 protein_id gnl|my_center|LOCUS_01020 102514 102194 gene locus_tag LOCUS_01030 102514 102194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 102707 104431 gene locus_tag LOCUS_01040 102707 104431 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085400.1 protein_id gnl|my_center|LOCUS_01040 104571 105647 gene locus_tag LOCUS_01050 gene ribB 104571 105647 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085401.1 protein_id gnl|my_center|LOCUS_01050 105735 106949 gene locus_tag LOCUS_01060 105735 106949 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085402.1 protein_id gnl|my_center|LOCUS_01060 107099 108016 gene locus_tag LOCUS_01070 107099 108016 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965893.1 protein_id gnl|my_center|LOCUS_01070 108874 108020 gene locus_tag LOCUS_01080 108874 108020 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085404.1 protein_id gnl|my_center|LOCUS_01080 109850 108924 gene locus_tag LOCUS_01090 109850 108924 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197652.1 protein_id gnl|my_center|LOCUS_01090 109966 110847 gene locus_tag LOCUS_01100 109966 110847 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191946.1 protein_id gnl|my_center|LOCUS_01100 112518 110896 gene locus_tag LOCUS_01110 112518 110896 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085405.1 protein_id gnl|my_center|LOCUS_01110 112703 113698 gene locus_tag LOCUS_01120 112703 113698 CDS product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085406.1 protein_id gnl|my_center|LOCUS_01120 114560 113895 gene locus_tag LOCUS_01130 114560 113895 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085407.1 protein_id gnl|my_center|LOCUS_01130 115061 116041 gene locus_tag LOCUS_01140 115061 116041 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085408.1 protein_id gnl|my_center|LOCUS_01140 117320 116529 gene locus_tag LOCUS_01150 117320 116529 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085409.1 protein_id gnl|my_center|LOCUS_01150 117958 117317 gene locus_tag LOCUS_01160 gene pdxH 117958 117317 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085410.1 protein_id gnl|my_center|LOCUS_01160 118154 118480 gene locus_tag LOCUS_01170 118154 118480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 118599 119540 gene locus_tag LOCUS_01180 118599 119540 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085412.1 protein_id gnl|my_center|LOCUS_01180 120055 119849 gene locus_tag LOCUS_01190 120055 119849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 120784 120152 gene locus_tag LOCUS_01200 120784 120152 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533650.1 protein_id gnl|my_center|LOCUS_01200 121251 120865 gene locus_tag LOCUS_01210 121251 120865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 122216 122809 gene locus_tag LOCUS_01220 122216 122809 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085416.1 protein_id gnl|my_center|LOCUS_01220 123024 124133 gene locus_tag LOCUS_01230 gene aroC 123024 124133 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_01230 124679 124311 gene locus_tag LOCUS_01240 124679 124311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 124911 126467 gene locus_tag LOCUS_01250 gene glpK 124911 126467 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084227.1 protein_id gnl|my_center|LOCUS_01250 126937 126464 gene locus_tag LOCUS_01260 126937 126464 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726705.1 protein_id gnl|my_center|LOCUS_01260 130761 126889 gene locus_tag LOCUS_01270 gene metH 130761 126889 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084235.1 protein_id gnl|my_center|LOCUS_01270 131746 130832 gene locus_tag LOCUS_01280 gene metF 131746 130832 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173518.1 protein_id gnl|my_center|LOCUS_01280 132935 132075 gene locus_tag LOCUS_01290 132935 132075 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_01290 133711 132944 gene locus_tag LOCUS_01300 133711 132944 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084239.1 protein_id gnl|my_center|LOCUS_01300 133887 134441 gene locus_tag LOCUS_01310 133887 134441 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084240.1 protein_id gnl|my_center|LOCUS_01310 134903 136738 gene locus_tag LOCUS_01320 134903 136738 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084241.1 protein_id gnl|my_center|LOCUS_01320 136753 138615 gene locus_tag LOCUS_01330 136753 138615 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173514.1 protein_id gnl|my_center|LOCUS_01330 138619 139728 gene locus_tag LOCUS_01340 138619 139728 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084243.1 protein_id gnl|my_center|LOCUS_01340 139728 140906 gene locus_tag LOCUS_01350 139728 140906 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173513.1 protein_id gnl|my_center|LOCUS_01350 140915 142546 gene locus_tag LOCUS_01360 140915 142546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965361.1 protein_id gnl|my_center|LOCUS_01360 143414 142572 gene locus_tag LOCUS_01370 143414 142572 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_01370 144789 143407 gene locus_tag LOCUS_01380 144789 143407 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084248.1 protein_id gnl|my_center|LOCUS_01380 145119 145913 gene locus_tag LOCUS_01390 145119 145913 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084250.1 protein_id gnl|my_center|LOCUS_01390 147034 146057 gene locus_tag LOCUS_01400 147034 146057 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084251.1 protein_id gnl|my_center|LOCUS_01400 148018 147044 gene locus_tag LOCUS_01410 148018 147044 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173506.1 protein_id gnl|my_center|LOCUS_01410 149497 148031 gene locus_tag LOCUS_01420 149497 148031 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084253.1 protein_id gnl|my_center|LOCUS_01420 150784 149519 gene locus_tag LOCUS_01430 150784 149519 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084254.1 protein_id gnl|my_center|LOCUS_01430 151518 150781 gene locus_tag LOCUS_01440 151518 150781 CDS product pilus assembly protein CpaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084255.1 protein_id gnl|my_center|LOCUS_01440 153038 151539 gene locus_tag LOCUS_01450 153038 151539 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173504.1 protein_id gnl|my_center|LOCUS_01450 153836 153054 gene locus_tag LOCUS_01460 gene cpaB 153836 153054 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965364.1 protein_id gnl|my_center|LOCUS_01460 154479 153955 gene locus_tag LOCUS_01470 154479 153955 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084258.1 protein_id gnl|my_center|LOCUS_01470 154991 154821 gene locus_tag LOCUS_01480 154991 154821 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173014.1 protein_id gnl|my_center|LOCUS_01480 155387 155878 gene locus_tag LOCUS_01490 155387 155878 CDS product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084261.1 protein_id gnl|my_center|LOCUS_01490 156063 156626 gene locus_tag LOCUS_01500 156063 156626 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086719.1 protein_id gnl|my_center|LOCUS_01500 156822 157391 gene locus_tag LOCUS_01510 156822 157391 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086720.1 protein_id gnl|my_center|LOCUS_01510 157706 157500 gene locus_tag LOCUS_01520 157706 157500 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084262.1 protein_id gnl|my_center|LOCUS_01520 158247 157966 gene locus_tag LOCUS_01530 gene infA 158247 157966 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084263.1 protein_id gnl|my_center|LOCUS_01530 159904 158483 gene locus_tag LOCUS_01540 159904 158483 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084264.1 protein_id gnl|my_center|LOCUS_01540 161122 160220 gene locus_tag LOCUS_01550 161122 160220 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174878.1 protein_id gnl|my_center|LOCUS_01550 161365 162219 gene locus_tag LOCUS_01560 gene ftsY 161365 162219 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083304.1 protein_id gnl|my_center|LOCUS_01560 162222 162824 gene locus_tag LOCUS_01570 162222 162824 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083303.1 protein_id gnl|my_center|LOCUS_01570 163463 162870 gene locus_tag LOCUS_01580 163463 162870 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083302.1 protein_id gnl|my_center|LOCUS_01580 163648 163460 gene locus_tag LOCUS_01590 gene ccmD 163648 163460 CDS product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083301.1 protein_id gnl|my_center|LOCUS_01590 164376 163645 gene locus_tag LOCUS_01600 164376 163645 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083300.1 protein_id gnl|my_center|LOCUS_01600 165149 164481 gene locus_tag LOCUS_01610 gene ccmB 165149 164481 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083299.1 protein_id gnl|my_center|LOCUS_01610 165855 165343 gene locus_tag LOCUS_01620 gene ccmA 165855 165343 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083298.1 protein_id gnl|my_center|LOCUS_01620 166173 168890 gene locus_tag LOCUS_01630 gene acnA 166173 168890 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083297.1 protein_id gnl|my_center|LOCUS_01630 169274 169933 gene locus_tag LOCUS_01640 169274 169933 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083296.1 protein_id gnl|my_center|LOCUS_01640 170352 170723 gene locus_tag LOCUS_01650 170352 170723 CDS product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083295.1 protein_id gnl|my_center|LOCUS_01650 171013 171639 gene locus_tag LOCUS_01660 171013 171639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 171677 171829 gene locus_tag LOCUS_01670 171677 171829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 172893 171826 gene locus_tag LOCUS_01680 172893 171826 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174754.1 protein_id gnl|my_center|LOCUS_01680 173332 174975 gene locus_tag LOCUS_01690 173332 174975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085538.1 protein_id gnl|my_center|LOCUS_01690 175051 177249 gene locus_tag LOCUS_01700 175051 177249 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085539.1 protein_id gnl|my_center|LOCUS_01700 177477 177983 gene locus_tag LOCUS_01710 177477 177983 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174756.1 protein_id gnl|my_center|LOCUS_01710 178024 179307 gene locus_tag LOCUS_01720 178024 179307 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965827.1 protein_id gnl|my_center|LOCUS_01720 181421 179415 gene locus_tag LOCUS_01730 181421 179415 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966621.1 protein_id gnl|my_center|LOCUS_01730 182547 181729 gene locus_tag LOCUS_01740 182547 181729 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082924.1 protein_id gnl|my_center|LOCUS_01740 182795 183817 gene locus_tag LOCUS_01750 182795 183817 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_01750 183890 184630 gene locus_tag LOCUS_01760 183890 184630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082922.1 protein_id gnl|my_center|LOCUS_01760 184627 185466 gene locus_tag LOCUS_01770 184627 185466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082921.1 protein_id gnl|my_center|LOCUS_01770 185598 186206 gene locus_tag LOCUS_01780 185598 186206 CDS product AprI/Inh family metalloprotease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082919.1 protein_id gnl|my_center|LOCUS_01780 >Feature sequence02 633 82 gene locus_tag LOCUS_01790 633 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 1815 2102 gene locus_tag LOCUS_01800 1815 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 2955 2605 gene locus_tag LOCUS_01810 2955 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 3717 7361 gene locus_tag LOCUS_01820 3717 7361 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 protein_id gnl|my_center|LOCUS_01820 9892 9692 gene locus_tag LOCUS_01830 9892 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 10554 10111 gene locus_tag LOCUS_01840 10554 10111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 11169 10954 gene locus_tag LOCUS_01850 11169 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 11623 12075 gene locus_tag LOCUS_01860 11623 12075 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 protein_id gnl|my_center|LOCUS_01860 12072 12989 gene locus_tag LOCUS_01870 12072 12989 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_01870 13283 14503 gene locus_tag LOCUS_01880 13283 14503 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085615.1 protein_id gnl|my_center|LOCUS_01880 14600 15859 gene locus_tag LOCUS_01890 14600 15859 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_01890 16004 16690 gene locus_tag LOCUS_01900 16004 16690 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185826.1 protein_id gnl|my_center|LOCUS_01900 16692 17903 gene locus_tag LOCUS_01910 16692 17903 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172437.1 protein_id gnl|my_center|LOCUS_01910 18007 21102 gene locus_tag LOCUS_01920 18007 21102 CDS product MexW/MexI family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085645.1 protein_id gnl|my_center|LOCUS_01920 21231 22484 gene locus_tag LOCUS_01930 21231 22484 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523157.1 protein_id gnl|my_center|LOCUS_01930 22719 22967 gene locus_tag LOCUS_01940 22719 22967 CDS product DUF6489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085662.1 protein_id gnl|my_center|LOCUS_01940 24276 23056 gene locus_tag LOCUS_01950 24276 23056 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_01950 25593 24397 gene locus_tag LOCUS_01960 25593 24397 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_01960 25867 25658 gene locus_tag LOCUS_01970 25867 25658 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085690.1 protein_id gnl|my_center|LOCUS_01970 26227 29013 gene locus_tag LOCUS_01980 gene ppc 26227 29013 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085739.1 protein_id gnl|my_center|LOCUS_01980 29047 30396 gene locus_tag LOCUS_01990 29047 30396 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085744.1 protein_id gnl|my_center|LOCUS_01990 30646 32238 gene locus_tag LOCUS_02000 30646 32238 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172333.1 protein_id gnl|my_center|LOCUS_02000 32594 34960 gene locus_tag LOCUS_02010 32594 34960 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085781.1 protein_id gnl|my_center|LOCUS_02010 35519 35019 gene locus_tag LOCUS_02020 35519 35019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173939.1 protein_id gnl|my_center|LOCUS_02020 36647 37525 gene locus_tag LOCUS_02030 gene hpnC 36647 37525 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965749.1 protein_id gnl|my_center|LOCUS_02030 37522 38358 gene locus_tag LOCUS_02040 gene hpnD 37522 38358 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085786.1 protein_id gnl|my_center|LOCUS_02040 38358 39611 gene locus_tag LOCUS_02050 gene hpnE 38358 39611 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085787.1 protein_id gnl|my_center|LOCUS_02050 39634 41589 gene locus_tag LOCUS_02060 gene shc 39634 41589 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085788.1 protein_id gnl|my_center|LOCUS_02060 41586 42443 gene locus_tag LOCUS_02070 41586 42443 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172326.1 protein_id gnl|my_center|LOCUS_02070 43878 42709 gene locus_tag LOCUS_02080 gene hpnH 43878 42709 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085790.1 protein_id gnl|my_center|LOCUS_02080 44851 43925 gene locus_tag LOCUS_02090 gene ispH 44851 43925 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085791.1 protein_id gnl|my_center|LOCUS_02090 45321 47909 gene locus_tag LOCUS_02100 45321 47909 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085792.1 protein_id gnl|my_center|LOCUS_02100 48500 47877 gene locus_tag LOCUS_02110 48500 47877 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965759.1 protein_id gnl|my_center|LOCUS_02110 48632 50023 gene locus_tag LOCUS_02120 gene hpnO 48632 50023 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_02120 50204 51373 gene locus_tag LOCUS_02130 50204 51373 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085805.1 protein_id gnl|my_center|LOCUS_02130 52066 51452 gene locus_tag LOCUS_02140 52066 51452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 51953 52201 gene locus_tag LOCUS_02150 51953 52201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 52305 53123 gene locus_tag LOCUS_02160 52305 53123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085808.1 protein_id gnl|my_center|LOCUS_02160 53032 54669 gene locus_tag LOCUS_02170 53032 54669 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921433.1 protein_id gnl|my_center|LOCUS_02170 54666 58169 gene locus_tag LOCUS_02180 54666 58169 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085810.1 protein_id gnl|my_center|LOCUS_02180 58269 59516 gene locus_tag LOCUS_02190 58269 59516 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_02190 59609 61492 gene locus_tag LOCUS_02200 59609 61492 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123719.1 protein_id gnl|my_center|LOCUS_02200 62279 61500 gene locus_tag LOCUS_02210 62279 61500 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085820.1 protein_id gnl|my_center|LOCUS_02210 63184 62468 gene locus_tag LOCUS_02220 63184 62468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085821.1 protein_id gnl|my_center|LOCUS_02220 64561 63434 gene locus_tag LOCUS_02230 64561 63434 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085824.1 protein_id gnl|my_center|LOCUS_02230 64988 65557 gene locus_tag LOCUS_02240 64988 65557 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965738.1 protein_id gnl|my_center|LOCUS_02240 65554 66246 gene locus_tag LOCUS_02250 65554 66246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085827.1 protein_id gnl|my_center|LOCUS_02250 66305 68182 gene locus_tag LOCUS_02260 66305 68182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 68541 68338 gene locus_tag LOCUS_02270 68541 68338 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974103.1 protein_id gnl|my_center|LOCUS_02270 69055 69549 gene locus_tag LOCUS_02280 69055 69549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 70963 69596 gene locus_tag LOCUS_02290 70963 69596 CDS product TIGR03808 family TAT-translocated repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085830.1 protein_id gnl|my_center|LOCUS_02290 72426 71164 gene locus_tag LOCUS_02300 72426 71164 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921631.1 protein_id gnl|my_center|LOCUS_02300 73188 72544 gene locus_tag LOCUS_02310 73188 72544 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085831.1 protein_id gnl|my_center|LOCUS_02310 74234 73254 gene locus_tag LOCUS_02320 gene meaB 74234 73254 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_02320 75043 74231 gene locus_tag LOCUS_02330 75043 74231 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085836.1 protein_id gnl|my_center|LOCUS_02330 77339 75171 gene locus_tag LOCUS_02340 gene scpA 77339 75171 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085838.1 protein_id gnl|my_center|LOCUS_02340 77807 77343 gene locus_tag LOCUS_02350 77807 77343 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085839.1 protein_id gnl|my_center|LOCUS_02350 79723 77804 gene locus_tag LOCUS_02360 79723 77804 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085840.1 protein_id gnl|my_center|LOCUS_02360 80293 79802 gene locus_tag LOCUS_02370 gene folK 80293 79802 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085841.1 protein_id gnl|my_center|LOCUS_02370 80667 80302 gene locus_tag LOCUS_02380 gene folB 80667 80302 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544155.1 protein_id gnl|my_center|LOCUS_02380 81448 80684 gene locus_tag LOCUS_02390 gene folP 81448 80684 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172291.1 protein_id gnl|my_center|LOCUS_02390 82032 81625 gene locus_tag LOCUS_02400 82032 81625 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085844.1 protein_id gnl|my_center|LOCUS_02400 82259 82029 gene locus_tag LOCUS_02410 82259 82029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 82585 84150 gene locus_tag LOCUS_02420 82585 84150 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085846.1 protein_id gnl|my_center|LOCUS_02420 84374 85666 gene locus_tag LOCUS_02430 84374 85666 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965735.1 protein_id gnl|my_center|LOCUS_02430 85700 87106 gene locus_tag LOCUS_02440 85700 87106 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085848.1 protein_id gnl|my_center|LOCUS_02440 87524 88348 gene locus_tag LOCUS_02450 87524 88348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172288.1 protein_id gnl|my_center|LOCUS_02450 88481 88894 gene locus_tag LOCUS_02460 88481 88894 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085852.1 protein_id gnl|my_center|LOCUS_02460 89000 89947 gene locus_tag LOCUS_02470 89000 89947 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_02470 89960 90154 gene locus_tag LOCUS_02480 89960 90154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 90950 90114 gene locus_tag LOCUS_02490 90950 90114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 91132 91509 gene locus_tag LOCUS_02500 91132 91509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 91496 92119 gene locus_tag LOCUS_02510 91496 92119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 92653 92225 gene locus_tag LOCUS_02520 92653 92225 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085853.1 protein_id gnl|my_center|LOCUS_02520 93272 92730 gene locus_tag LOCUS_02530 93272 92730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 93563 95398 gene locus_tag LOCUS_02540 93563 95398 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085855.1 protein_id gnl|my_center|LOCUS_02540 95421 95975 gene locus_tag LOCUS_02550 95421 95975 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085856.1 protein_id gnl|my_center|LOCUS_02550 97837 96053 gene locus_tag LOCUS_02560 97837 96053 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_02560 99564 98863 gene locus_tag LOCUS_02570 gene rpe 99564 98863 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088426.1 protein_id gnl|my_center|LOCUS_02570 99755 99582 gene locus_tag LOCUS_02580 99755 99582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 99794 100996 gene locus_tag LOCUS_02590 99794 100996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 101254 100997 gene locus_tag LOCUS_02600 101254 100997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 102437 101439 gene locus_tag LOCUS_02610 102437 101439 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088424.1 protein_id gnl|my_center|LOCUS_02610 102588 103322 gene locus_tag LOCUS_02620 102588 103322 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085573.1 protein_id gnl|my_center|LOCUS_02620 104432 103500 gene locus_tag LOCUS_02630 104432 103500 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088421.1 protein_id gnl|my_center|LOCUS_02630 104319 104609 gene locus_tag LOCUS_02640 104319 104609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 105542 104799 gene locus_tag LOCUS_02650 105542 104799 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088420.1 protein_id gnl|my_center|LOCUS_02650 106375 105539 gene locus_tag LOCUS_02660 106375 105539 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088419.1 protein_id gnl|my_center|LOCUS_02660 107757 106372 gene locus_tag LOCUS_02670 gene livM 107757 106372 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088418.1 protein_id gnl|my_center|LOCUS_02670 108682 107768 gene locus_tag LOCUS_02680 108682 107768 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088417.1 protein_id gnl|my_center|LOCUS_02680 109027 109641 gene locus_tag LOCUS_02690 109027 109641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 110477 109695 gene locus_tag LOCUS_02700 gene pcaD 110477 109695 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088414.1 protein_id gnl|my_center|LOCUS_02700 110616 111062 gene locus_tag LOCUS_02710 110616 111062 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088412.1 protein_id gnl|my_center|LOCUS_02710 111176 111661 gene locus_tag LOCUS_02720 111176 111661 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027560187.1 protein_id gnl|my_center|LOCUS_02720 111707 112513 gene locus_tag LOCUS_02730 111707 112513 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088410.1 protein_id gnl|my_center|LOCUS_02730 112515 113459 gene locus_tag LOCUS_02740 112515 113459 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088409.1 protein_id gnl|my_center|LOCUS_02740 113472 114710 gene locus_tag LOCUS_02750 113472 114710 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967595.1 protein_id gnl|my_center|LOCUS_02750 114694 115017 gene locus_tag LOCUS_02760 114694 115017 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088407.1 protein_id gnl|my_center|LOCUS_02760 115233 115865 gene locus_tag LOCUS_02770 115233 115865 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088406.1 protein_id gnl|my_center|LOCUS_02770 115862 117466 gene locus_tag LOCUS_02780 115862 117466 CDS product molybdopterin-binding/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088405.1 protein_id gnl|my_center|LOCUS_02780 117745 118467 gene locus_tag LOCUS_02790 117745 118467 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088397.1 protein_id gnl|my_center|LOCUS_02790 118464 119237 gene locus_tag LOCUS_02800 118464 119237 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088396.1 protein_id gnl|my_center|LOCUS_02800 119248 120192 gene locus_tag LOCUS_02810 119248 120192 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_02810 120189 121346 gene locus_tag LOCUS_02820 120189 121346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088394.1 protein_id gnl|my_center|LOCUS_02820 122004 121480 gene locus_tag LOCUS_02830 122004 121480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 123287 122484 gene locus_tag LOCUS_02840 123287 122484 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088387.1 protein_id gnl|my_center|LOCUS_02840 123560 124690 gene locus_tag LOCUS_02850 123560 124690 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_02850 124698 126194 gene locus_tag LOCUS_02860 124698 126194 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_02860 126296 126709 gene locus_tag LOCUS_02870 126296 126709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 126709 127122 gene locus_tag LOCUS_02880 126709 127122 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651037.1 protein_id gnl|my_center|LOCUS_02880 128895 127255 gene locus_tag LOCUS_02890 gene groL 128895 127255 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088372.1 protein_id gnl|my_center|LOCUS_02890 129255 128938 gene locus_tag LOCUS_02900 129255 128938 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084856.1 protein_id gnl|my_center|LOCUS_02900 129660 129959 gene locus_tag LOCUS_02910 129660 129959 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088370.1 protein_id gnl|my_center|LOCUS_02910 130104 130844 gene locus_tag LOCUS_02920 130104 130844 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088357.1 protein_id gnl|my_center|LOCUS_02920 130909 131433 gene locus_tag LOCUS_02930 gene gpt 130909 131433 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175425.1 protein_id gnl|my_center|LOCUS_02930 131684 132289 gene locus_tag LOCUS_02940 131684 132289 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088352.1 protein_id gnl|my_center|LOCUS_02940 132702 132304 gene locus_tag LOCUS_02950 132702 132304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 132859 132947 gene locus_tag LOCUS_t00040 132859 132947 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 133020 133202 gene locus_tag LOCUS_02960 133020 133202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 133353 134609 gene locus_tag LOCUS_02970 133353 134609 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090664.1 protein_id gnl|my_center|LOCUS_02970 134711 135130 gene locus_tag LOCUS_02980 134711 135130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088338.1 protein_id gnl|my_center|LOCUS_02980 136376 135174 gene locus_tag LOCUS_02990 136376 135174 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088337.1 protein_id gnl|my_center|LOCUS_02990 136629 136384 gene locus_tag LOCUS_03000 136629 136384 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602543.1 protein_id gnl|my_center|LOCUS_03000 137393 138145 gene locus_tag LOCUS_03010 137393 138145 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967757.1 protein_id gnl|my_center|LOCUS_03010 139527 138103 gene locus_tag LOCUS_03020 139527 138103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967756.1 protein_id gnl|my_center|LOCUS_03020 139731 140603 gene locus_tag LOCUS_03030 gene cysE 139731 140603 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175407.1 protein_id gnl|my_center|LOCUS_03030 140979 141197 gene locus_tag LOCUS_03040 140979 141197 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602550.1 protein_id gnl|my_center|LOCUS_03040 141918 141208 gene locus_tag LOCUS_03050 141918 141208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088331.1 protein_id gnl|my_center|LOCUS_03050 142118 142447 gene locus_tag LOCUS_03060 142118 142447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088330.1 protein_id gnl|my_center|LOCUS_03060 142581 143111 gene locus_tag LOCUS_03070 142581 143111 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088329.1 protein_id gnl|my_center|LOCUS_03070 143184 143681 gene locus_tag LOCUS_03080 143184 143681 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085192.1 protein_id gnl|my_center|LOCUS_03080 144600 143980 gene locus_tag LOCUS_03090 144600 143980 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967896.1 protein_id gnl|my_center|LOCUS_03090 145518 144910 gene locus_tag LOCUS_03100 145518 144910 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176079.1 protein_id gnl|my_center|LOCUS_03100 147046 145739 gene locus_tag LOCUS_03110 gene purB 147046 145739 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088436.1 protein_id gnl|my_center|LOCUS_03110 147230 147574 gene locus_tag LOCUS_03120 147230 147574 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085858.1 protein_id gnl|my_center|LOCUS_03120 147659 148651 gene locus_tag LOCUS_03130 147659 148651 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088551.1 protein_id gnl|my_center|LOCUS_03130 149138 148779 gene locus_tag LOCUS_03140 149138 148779 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189643.1 protein_id gnl|my_center|LOCUS_03140 149860 149168 gene locus_tag LOCUS_03150 149860 149168 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088543.1 protein_id gnl|my_center|LOCUS_03150 150421 149951 gene locus_tag LOCUS_03160 150421 149951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088541.1 protein_id gnl|my_center|LOCUS_03160 151495 150554 gene locus_tag LOCUS_03170 151495 150554 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228672.1 protein_id gnl|my_center|LOCUS_03170 151701 152291 gene locus_tag LOCUS_03180 151701 152291 CDS product SET domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088531.1 protein_id gnl|my_center|LOCUS_03180 152401 152613 gene locus_tag LOCUS_03190 152401 152613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 152733 153902 gene locus_tag LOCUS_03200 152733 153902 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086701.1 protein_id gnl|my_center|LOCUS_03200 153998 155476 gene locus_tag LOCUS_03210 153998 155476 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086731.1 protein_id gnl|my_center|LOCUS_03210 155493 156638 gene locus_tag LOCUS_03220 155493 156638 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086732.1 protein_id gnl|my_center|LOCUS_03220 156635 157705 gene locus_tag LOCUS_03230 156635 157705 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086733.1 protein_id gnl|my_center|LOCUS_03230 157740 158636 gene locus_tag LOCUS_03240 gene mmsB 157740 158636 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086734.1 protein_id gnl|my_center|LOCUS_03240 158716 159192 gene locus_tag LOCUS_03250 158716 159192 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086736.1 protein_id gnl|my_center|LOCUS_03250 159221 160453 gene locus_tag LOCUS_03260 159221 160453 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086738.1 protein_id gnl|my_center|LOCUS_03260 162273 160462 gene locus_tag LOCUS_03270 162273 160462 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_03270 162751 162278 gene locus_tag LOCUS_03280 162751 162278 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 protein_id gnl|my_center|LOCUS_03280 163125 164186 gene locus_tag LOCUS_03290 163125 164186 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086746.1 protein_id gnl|my_center|LOCUS_03290 164347 164718 gene locus_tag LOCUS_03300 164347 164718 CDS product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171733.1 protein_id gnl|my_center|LOCUS_03300 165145 167193 gene locus_tag LOCUS_03310 gene pqqU 165145 167193 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_03310 167210 168418 gene locus_tag LOCUS_03320 167210 168418 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536056.1 protein_id gnl|my_center|LOCUS_03320 168415 168915 gene locus_tag LOCUS_03330 168415 168915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 169026 169493 gene locus_tag LOCUS_03340 169026 169493 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087647.1 protein_id gnl|my_center|LOCUS_03340 169883 169500 gene locus_tag LOCUS_03350 169883 169500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 170081 170533 gene locus_tag LOCUS_03360 170081 170533 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689877.1 protein_id gnl|my_center|LOCUS_03360 170592 171272 gene locus_tag LOCUS_03370 170592 171272 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086747.1 protein_id gnl|my_center|LOCUS_03370 172823 171351 gene locus_tag LOCUS_03380 172823 171351 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086748.1 protein_id gnl|my_center|LOCUS_03380 172942 173190 gene locus_tag LOCUS_03390 172942 173190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 173370 174866 gene locus_tag LOCUS_03400 gene guaB 173370 174866 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086749.1 protein_id gnl|my_center|LOCUS_03400 174920 175627 gene locus_tag LOCUS_03410 174920 175627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 175678 176097 gene locus_tag LOCUS_03420 175678 176097 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171008.1 protein_id gnl|my_center|LOCUS_03420 176126 177424 gene locus_tag LOCUS_03430 176126 177424 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086762.1 protein_id gnl|my_center|LOCUS_03430 177507 179156 gene locus_tag LOCUS_03440 gene guaA 177507 179156 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966922.1 protein_id gnl|my_center|LOCUS_03440 179378 179881 gene locus_tag LOCUS_03450 179378 179881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 180051 180593 gene locus_tag LOCUS_03460 180051 180593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03460 180876 180499 gene locus_tag LOCUS_03470 180876 180499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 180805 181035 gene locus_tag LOCUS_03480 180805 181035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03480 181227 181385 gene locus_tag LOCUS_03490 181227 181385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 181978 181559 gene locus_tag LOCUS_03500 181978 181559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 182223 181975 gene locus_tag LOCUS_03510 182223 181975 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384044.1 protein_id gnl|my_center|LOCUS_03510 182427 183224 gene locus_tag LOCUS_03520 182427 183224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03520 >Feature sequence03 393 731 gene locus_tag LOCUS_03530 393 731 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082989.1 protein_id gnl|my_center|LOCUS_03530 1334 915 gene locus_tag LOCUS_03540 1334 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 1300 1962 gene locus_tag LOCUS_03550 1300 1962 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532582.1 protein_id gnl|my_center|LOCUS_03550 3618 2173 gene locus_tag LOCUS_03560 3618 2173 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000324.1 protein_id gnl|my_center|LOCUS_03560 4403 3819 gene locus_tag LOCUS_03570 4403 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 4296 4568 gene locus_tag LOCUS_03580 4296 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 4959 4687 gene locus_tag LOCUS_03590 4959 4687 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532573.1 protein_id gnl|my_center|LOCUS_03590 5797 5048 gene locus_tag LOCUS_03600 5797 5048 CDS product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175139.1 protein_id gnl|my_center|LOCUS_03600 6002 6078 gene locus_tag LOCUS_t00050 6002 6078 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7347 6424 gene locus_tag LOCUS_03610 7347 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 8227 8138 gene locus_tag LOCUS_t00060 8227 8138 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9844 8717 gene locus_tag LOCUS_03620 9844 8717 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083251.1 protein_id gnl|my_center|LOCUS_03620 10278 13079 gene locus_tag LOCUS_03630 10278 13079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 13348 13806 gene locus_tag LOCUS_03640 gene rplU 13348 13806 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083252.1 protein_id gnl|my_center|LOCUS_03640 13892 14164 gene locus_tag LOCUS_03650 gene rpmA 13892 14164 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083253.1 protein_id gnl|my_center|LOCUS_03650 14299 14901 gene locus_tag LOCUS_03660 14299 14901 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965053.1 protein_id gnl|my_center|LOCUS_03660 15086 16162 gene locus_tag LOCUS_03670 gene obgE 15086 16162 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083257.1 protein_id gnl|my_center|LOCUS_03670 16306 17445 gene locus_tag LOCUS_03680 gene proB 16306 17445 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083260.1 protein_id gnl|my_center|LOCUS_03680 17690 18982 gene locus_tag LOCUS_03690 17690 18982 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083261.1 protein_id gnl|my_center|LOCUS_03690 19073 19687 gene locus_tag LOCUS_03700 19073 19687 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965055.1 protein_id gnl|my_center|LOCUS_03700 19939 20235 gene locus_tag LOCUS_03710 gene rsfS 19939 20235 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027523570.1 protein_id gnl|my_center|LOCUS_03710 20281 20763 gene locus_tag LOCUS_03720 gene rlmH 20281 20763 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083264.1 protein_id gnl|my_center|LOCUS_03720 20962 22209 gene locus_tag LOCUS_03730 20962 22209 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083265.1 protein_id gnl|my_center|LOCUS_03730 22206 23561 gene locus_tag LOCUS_03740 22206 23561 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083266.1 protein_id gnl|my_center|LOCUS_03740 23740 24915 gene locus_tag LOCUS_03750 23740 24915 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083267.1 protein_id gnl|my_center|LOCUS_03750 24953 25483 gene locus_tag LOCUS_03760 24953 25483 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083268.1 protein_id gnl|my_center|LOCUS_03760 26027 25617 gene locus_tag LOCUS_03770 26027 25617 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083271.1 protein_id gnl|my_center|LOCUS_03770 27576 26146 gene locus_tag LOCUS_03780 gene atpD 27576 26146 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083272.1 protein_id gnl|my_center|LOCUS_03780 28009 27605 gene locus_tag LOCUS_03790 28009 27605 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976410.1 protein_id gnl|my_center|LOCUS_03790 28904 28026 gene locus_tag LOCUS_03800 28904 28026 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083273.1 protein_id gnl|my_center|LOCUS_03800 30577 29045 gene locus_tag LOCUS_03810 gene atpA 30577 29045 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083274.1 protein_id gnl|my_center|LOCUS_03810 31140 30577 gene locus_tag LOCUS_03820 31140 30577 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083275.1 protein_id gnl|my_center|LOCUS_03820 32069 32332 gene locus_tag LOCUS_03830 32069 32332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 34629 32413 gene locus_tag LOCUS_03840 34629 32413 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083277.1 protein_id gnl|my_center|LOCUS_03840 34765 35733 gene locus_tag LOCUS_03850 34765 35733 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083278.1 protein_id gnl|my_center|LOCUS_03850 37376 35973 gene locus_tag LOCUS_03860 gene lpdA 37376 35973 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083281.1 protein_id gnl|my_center|LOCUS_03860 37887 37387 gene locus_tag LOCUS_03870 37887 37387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 39296 38010 gene locus_tag LOCUS_03880 gene odhB 39296 38010 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083283.1 protein_id gnl|my_center|LOCUS_03880 42318 39406 gene locus_tag LOCUS_03890 42318 39406 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083284.1 protein_id gnl|my_center|LOCUS_03890 43380 42496 gene locus_tag LOCUS_03900 gene sucD 43380 42496 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083285.1 protein_id gnl|my_center|LOCUS_03900 44579 43380 gene locus_tag LOCUS_03910 gene sucC 44579 43380 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083287.1 protein_id gnl|my_center|LOCUS_03910 45695 44727 gene locus_tag LOCUS_03920 gene mdh 45695 44727 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008145224.1 protein_id gnl|my_center|LOCUS_03920 46984 45800 gene locus_tag LOCUS_03930 gene zapE 46984 45800 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083288.1 protein_id gnl|my_center|LOCUS_03930 47593 47057 gene locus_tag LOCUS_03940 gene thpR 47593 47057 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083289.1 protein_id gnl|my_center|LOCUS_03940 48283 47732 gene locus_tag LOCUS_03950 48283 47732 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965065.1 protein_id gnl|my_center|LOCUS_03950 48561 49283 gene locus_tag LOCUS_03960 48561 49283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083291.1 protein_id gnl|my_center|LOCUS_03960 49402 51921 gene locus_tag LOCUS_03970 49402 51921 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083292.1 protein_id gnl|my_center|LOCUS_03970 52230 53021 gene locus_tag LOCUS_03980 52230 53021 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174871.1 protein_id gnl|my_center|LOCUS_03980 53208 54233 gene locus_tag LOCUS_03990 53208 54233 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083964.1 protein_id gnl|my_center|LOCUS_03990 54230 55981 gene locus_tag LOCUS_04000 54230 55981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 56227 56532 gene locus_tag LOCUS_04010 56227 56532 CDS product DUF6460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172810.1 protein_id gnl|my_center|LOCUS_04010 57693 56599 gene locus_tag LOCUS_04020 57693 56599 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083959.1 protein_id gnl|my_center|LOCUS_04020 58034 57690 gene locus_tag LOCUS_04030 58034 57690 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083958.1 protein_id gnl|my_center|LOCUS_04030 58248 58880 gene locus_tag LOCUS_04040 58248 58880 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083957.1 protein_id gnl|my_center|LOCUS_04040 60954 58996 gene locus_tag LOCUS_04050 gene acs 60954 58996 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174953.1 protein_id gnl|my_center|LOCUS_04050 61532 61119 gene locus_tag LOCUS_04060 61532 61119 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_04060 62515 61535 gene locus_tag LOCUS_04070 62515 61535 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083397.1 protein_id gnl|my_center|LOCUS_04070 63602 62529 gene locus_tag LOCUS_04080 gene tsaD 63602 62529 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083396.1 protein_id gnl|my_center|LOCUS_04080 63696 64646 gene locus_tag LOCUS_04090 gene hemC 63696 64646 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393857.1 protein_id gnl|my_center|LOCUS_04090 64650 65396 gene locus_tag LOCUS_04100 64650 65396 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083395.1 protein_id gnl|my_center|LOCUS_04100 65963 66883 gene locus_tag LOCUS_04110 65963 66883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 66891 68546 gene locus_tag LOCUS_04120 66891 68546 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083393.1 protein_id gnl|my_center|LOCUS_04120 68678 68753 gene locus_tag LOCUS_t00070 68678 68753 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 69188 69667 gene locus_tag LOCUS_04130 69188 69667 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083384.1 protein_id gnl|my_center|LOCUS_04130 69773 70555 gene locus_tag LOCUS_04140 69773 70555 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083383.1 protein_id gnl|my_center|LOCUS_04140 70725 70650 gene locus_tag LOCUS_t00080 70725 70650 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 71266 71595 gene locus_tag LOCUS_04150 71266 71595 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598721.1 protein_id gnl|my_center|LOCUS_04150 71607 71927 gene locus_tag LOCUS_04160 71607 71927 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174939.1 protein_id gnl|my_center|LOCUS_04160 71946 72830 gene locus_tag LOCUS_04170 71946 72830 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083379.1 protein_id gnl|my_center|LOCUS_04170 73592 73062 gene locus_tag LOCUS_04180 gene ppa 73592 73062 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083378.1 protein_id gnl|my_center|LOCUS_04180 74237 73686 gene locus_tag LOCUS_04190 74237 73686 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136728.1 protein_id gnl|my_center|LOCUS_04190 75948 74689 gene locus_tag LOCUS_04200 75948 74689 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083372.1 protein_id gnl|my_center|LOCUS_04200 78759 76033 gene locus_tag LOCUS_04210 gene mutS 78759 76033 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083746.1 protein_id gnl|my_center|LOCUS_04210 78653 78880 gene locus_tag LOCUS_04220 78653 78880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 79781 78915 gene locus_tag LOCUS_04230 79781 78915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 79850 80710 gene locus_tag LOCUS_04240 79850 80710 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530214.1 protein_id gnl|my_center|LOCUS_04240 81084 81581 gene locus_tag LOCUS_04250 81084 81581 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083756.1 protein_id gnl|my_center|LOCUS_04250 81846 83138 gene locus_tag LOCUS_04260 gene ispG 81846 83138 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083758.1 protein_id gnl|my_center|LOCUS_04260 84070 83144 gene locus_tag LOCUS_04270 84070 83144 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083768.1 protein_id gnl|my_center|LOCUS_04270 84331 85011 gene locus_tag LOCUS_04280 gene mtgA 84331 85011 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172627.1 protein_id gnl|my_center|LOCUS_04280 85111 85296 gene locus_tag LOCUS_04290 gene rpmF 85111 85296 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598106.1 protein_id gnl|my_center|LOCUS_04290 85412 86068 gene locus_tag LOCUS_04300 85412 86068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172628.1 protein_id gnl|my_center|LOCUS_04300 86688 88361 gene locus_tag LOCUS_04310 86688 88361 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965204.1 protein_id gnl|my_center|LOCUS_04310 89443 88493 gene locus_tag LOCUS_04320 89443 88493 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083903.1 protein_id gnl|my_center|LOCUS_04320 89815 91206 gene locus_tag LOCUS_04330 89815 91206 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083904.1 protein_id gnl|my_center|LOCUS_04330 91211 91549 gene locus_tag LOCUS_04340 91211 91549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172731.1 protein_id gnl|my_center|LOCUS_04340 91666 92721 gene locus_tag LOCUS_04350 91666 92721 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083909.1 protein_id gnl|my_center|LOCUS_04350 92702 94048 gene locus_tag LOCUS_04360 92702 94048 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083910.1 protein_id gnl|my_center|LOCUS_04360 94179 95204 gene locus_tag LOCUS_04370 gene pstS 94179 95204 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965256.1 protein_id gnl|my_center|LOCUS_04370 95230 96318 gene locus_tag LOCUS_04380 gene pstC 95230 96318 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172738.1 protein_id gnl|my_center|LOCUS_04380 96401 97246 gene locus_tag LOCUS_04390 gene pstA 96401 97246 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083913.1 protein_id gnl|my_center|LOCUS_04390 97243 98055 gene locus_tag LOCUS_04400 gene pstB 97243 98055 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083914.1 protein_id gnl|my_center|LOCUS_04400 98086 98802 gene locus_tag LOCUS_04410 gene phoU 98086 98802 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083915.1 protein_id gnl|my_center|LOCUS_04410 98824 99528 gene locus_tag LOCUS_04420 gene phoB 98824 99528 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143479.1 protein_id gnl|my_center|LOCUS_04420 100279 99773 gene locus_tag LOCUS_04430 100279 99773 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083916.1 protein_id gnl|my_center|LOCUS_04430 100736 101947 gene locus_tag LOCUS_04440 100736 101947 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965252.1 protein_id gnl|my_center|LOCUS_04440 101944 102870 gene locus_tag LOCUS_04450 gene argF 101944 102870 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083918.1 protein_id gnl|my_center|LOCUS_04450 104331 103060 gene locus_tag LOCUS_04460 104331 103060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084978.1 protein_id gnl|my_center|LOCUS_04460 105181 104579 gene locus_tag LOCUS_04470 105181 104579 CDS product DUF1134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084979.1 protein_id gnl|my_center|LOCUS_04470 105324 105800 gene locus_tag LOCUS_04480 105324 105800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 106666 105818 gene locus_tag LOCUS_04490 106666 105818 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084980.1 protein_id gnl|my_center|LOCUS_04490 106796 107443 gene locus_tag LOCUS_04500 106796 107443 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967810.1 protein_id gnl|my_center|LOCUS_04500 107653 110328 gene locus_tag LOCUS_04510 107653 110328 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083225.1 protein_id gnl|my_center|LOCUS_04510 110340 110810 gene locus_tag LOCUS_04520 110340 110810 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084983.1 protein_id gnl|my_center|LOCUS_04520 110868 111233 gene locus_tag LOCUS_04530 110868 111233 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007600538.1 protein_id gnl|my_center|LOCUS_04530 111294 112439 gene locus_tag LOCUS_04540 111294 112439 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197948963.1 protein_id gnl|my_center|LOCUS_04540 112436 113302 gene locus_tag LOCUS_04550 112436 113302 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_04550 114158 113457 gene locus_tag LOCUS_04560 114158 113457 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008138878.1 protein_id gnl|my_center|LOCUS_04560 114527 115852 gene locus_tag LOCUS_04570 gene fliI 114527 115852 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084989.1 protein_id gnl|my_center|LOCUS_04570 115960 116385 gene locus_tag LOCUS_04580 gene fliJ 115960 116385 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084990.1 protein_id gnl|my_center|LOCUS_04580 116896 116696 gene locus_tag LOCUS_04590 116896 116696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084994.1 protein_id gnl|my_center|LOCUS_04590 119350 117221 gene locus_tag LOCUS_04600 gene flhA 119350 117221 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966504.1 protein_id gnl|my_center|LOCUS_04600 119673 119748 gene locus_tag LOCUS_t00090 119673 119748 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 120564 120959 gene locus_tag LOCUS_04610 120564 120959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 121622 120999 gene locus_tag LOCUS_04620 gene parA 121622 120999 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 protein_id gnl|my_center|LOCUS_04620 122532 122155 gene locus_tag LOCUS_04630 122532 122155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 122745 122542 gene locus_tag LOCUS_04640 122745 122542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 122636 122869 gene locus_tag LOCUS_04650 122636 122869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 122899 123225 gene locus_tag LOCUS_04660 122899 123225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 123436 124062 gene locus_tag LOCUS_04670 123436 124062 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836185.1 protein_id gnl|my_center|LOCUS_04670 124523 126757 gene locus_tag LOCUS_04680 124523 126757 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_04680 126747 128096 gene locus_tag LOCUS_04690 126747 128096 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836186.1 protein_id gnl|my_center|LOCUS_04690 128174 130135 gene locus_tag LOCUS_04700 128174 130135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 130298 132502 gene locus_tag LOCUS_04710 130298 132502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 132514 133437 gene locus_tag LOCUS_04720 132514 133437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 133890 133645 gene locus_tag LOCUS_04730 133890 133645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 135034 136317 gene locus_tag LOCUS_04740 135034 136317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 137252 136602 gene locus_tag LOCUS_04750 137252 136602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 138531 137230 gene locus_tag LOCUS_04760 138531 137230 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090851.1 protein_id gnl|my_center|LOCUS_04760 139654 138590 gene locus_tag LOCUS_04770 gene rffG 139654 138590 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226625.1 protein_id gnl|my_center|LOCUS_04770 140555 139680 gene locus_tag LOCUS_04780 gene rfbA 140555 139680 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_04780 140660 141214 gene locus_tag LOCUS_04790 gene rfbC 140660 141214 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035866.1 protein_id gnl|my_center|LOCUS_04790 141214 142140 gene locus_tag LOCUS_04800 gene rfbD 141214 142140 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035867.1 protein_id gnl|my_center|LOCUS_04800 144674 142299 gene locus_tag LOCUS_04810 144674 142299 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234441.1 protein_id gnl|my_center|LOCUS_04810 147109 144656 gene locus_tag LOCUS_04820 147109 144656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 148086 147199 gene locus_tag LOCUS_04830 148086 147199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 148836 150227 gene locus_tag LOCUS_04840 148836 150227 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 protein_id gnl|my_center|LOCUS_04840 151163 150414 gene locus_tag LOCUS_04850 151163 150414 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965679.1 protein_id gnl|my_center|LOCUS_04850 153097 151271 gene locus_tag LOCUS_04860 gene typA 153097 151271 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083371.1 protein_id gnl|my_center|LOCUS_04860 154211 153420 gene locus_tag LOCUS_04870 154211 153420 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000234.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence04 812 312 gene locus_tag LOCUS_04880 812 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04880 997 809 gene locus_tag LOCUS_04890 997 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04890 1413 1114 gene locus_tag LOCUS_04900 1413 1114 CDS product DUF3572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087883.1 protein_id gnl|my_center|LOCUS_04900 1645 2010 gene locus_tag LOCUS_04910 1645 2010 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603272.1 protein_id gnl|my_center|LOCUS_04910 2021 3394 gene locus_tag LOCUS_04920 2021 3394 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_04920 3579 3503 gene locus_tag LOCUS_t00100 3579 3503 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4029 9248 gene locus_tag LOCUS_04930 4029 9248 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087210.1 protein_id gnl|my_center|LOCUS_04930 9245 11368 gene locus_tag LOCUS_04940 gene pbpC 9245 11368 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494094.1 protein_id gnl|my_center|LOCUS_04940 11420 13162 gene locus_tag LOCUS_04950 11420 13162 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087212.1 protein_id gnl|my_center|LOCUS_04950 13162 13911 gene locus_tag LOCUS_04960 13162 13911 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174100.1 protein_id gnl|my_center|LOCUS_04960 13904 14227 gene locus_tag LOCUS_04970 13904 14227 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087215.1 protein_id gnl|my_center|LOCUS_04970 15450 14254 gene locus_tag LOCUS_04980 gene metC 15450 14254 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087217.1 protein_id gnl|my_center|LOCUS_04980 15991 17025 gene locus_tag LOCUS_04990 15991 17025 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_04990 17290 18405 gene locus_tag LOCUS_05000 17290 18405 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087219.1 protein_id gnl|my_center|LOCUS_05000 18402 19922 gene locus_tag LOCUS_05010 18402 19922 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087220.1 protein_id gnl|my_center|LOCUS_05010 19938 20681 gene locus_tag LOCUS_05020 19938 20681 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087221.1 protein_id gnl|my_center|LOCUS_05020 21735 20695 gene locus_tag LOCUS_05030 21735 20695 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087225.1 protein_id gnl|my_center|LOCUS_05030 22248 23663 gene locus_tag LOCUS_05040 22248 23663 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494095.1 protein_id gnl|my_center|LOCUS_05040 23653 25035 gene locus_tag LOCUS_05050 23653 25035 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087228.1 protein_id gnl|my_center|LOCUS_05050 25102 28224 gene locus_tag LOCUS_05060 25102 28224 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087229.1 protein_id gnl|my_center|LOCUS_05060 28224 31319 gene locus_tag LOCUS_05070 28224 31319 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087230.1 protein_id gnl|my_center|LOCUS_05070 31445 32098 gene locus_tag LOCUS_05080 31445 32098 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087231.1 protein_id gnl|my_center|LOCUS_05080 32203 32276 gene locus_tag LOCUS_t00110 32203 32276 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 32546 32352 gene locus_tag LOCUS_05090 32546 32352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174084.1 protein_id gnl|my_center|LOCUS_05090 32971 34797 gene locus_tag LOCUS_05100 gene glmS 32971 34797 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087378.1 protein_id gnl|my_center|LOCUS_05100 34953 35675 gene locus_tag LOCUS_05110 34953 35675 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050423699.1 protein_id gnl|my_center|LOCUS_05110 37883 35784 gene locus_tag LOCUS_05120 gene recG 37883 35784 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087374.1 protein_id gnl|my_center|LOCUS_05120 38041 38328 gene locus_tag LOCUS_05130 38041 38328 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087373.1 protein_id gnl|my_center|LOCUS_05130 38325 41849 gene locus_tag LOCUS_05140 gene mfd 38325 41849 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087372.1 protein_id gnl|my_center|LOCUS_05140 43087 41858 gene locus_tag LOCUS_05150 43087 41858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087363.1 protein_id gnl|my_center|LOCUS_05150 44678 43173 gene locus_tag LOCUS_05160 44678 43173 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087362.1 protein_id gnl|my_center|LOCUS_05160 46476 44683 gene locus_tag LOCUS_05170 46476 44683 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967416.1 protein_id gnl|my_center|LOCUS_05170 46928 47665 gene locus_tag LOCUS_05180 46928 47665 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087360.1 protein_id gnl|my_center|LOCUS_05180 48067 47735 gene locus_tag LOCUS_05190 gene hspQ 48067 47735 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087359.1 protein_id gnl|my_center|LOCUS_05190 49485 48301 gene locus_tag LOCUS_05200 49485 48301 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087357.1 protein_id gnl|my_center|LOCUS_05200 49435 49659 gene locus_tag LOCUS_05210 49435 49659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 49672 50406 gene locus_tag LOCUS_05220 49672 50406 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173978.1 protein_id gnl|my_center|LOCUS_05220 50403 51128 gene locus_tag LOCUS_05230 50403 51128 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087355.1 protein_id gnl|my_center|LOCUS_05230 51224 52198 gene locus_tag LOCUS_05240 51224 52198 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087354.1 protein_id gnl|my_center|LOCUS_05240 52377 52523 gene locus_tag LOCUS_05250 52377 52523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 53299 52532 gene locus_tag LOCUS_05260 53299 52532 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087339.1 protein_id gnl|my_center|LOCUS_05260 54363 53326 gene locus_tag LOCUS_05270 54363 53326 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087338.1 protein_id gnl|my_center|LOCUS_05270 55094 54360 gene locus_tag LOCUS_05280 gene pxpB 55094 54360 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087337.1 protein_id gnl|my_center|LOCUS_05280 55229 55639 gene locus_tag LOCUS_05290 55229 55639 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_05290 56026 56805 gene locus_tag LOCUS_05300 56026 56805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_05300 56863 57618 gene locus_tag LOCUS_05310 56863 57618 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087915.1 protein_id gnl|my_center|LOCUS_05310 59606 57840 gene locus_tag LOCUS_05320 59606 57840 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087914.1 protein_id gnl|my_center|LOCUS_05320 59955 60293 gene locus_tag LOCUS_05330 59955 60293 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087913.1 protein_id gnl|my_center|LOCUS_05330 62057 60486 gene locus_tag LOCUS_05340 62057 60486 CDS product ubiquitin-activating E1 FCCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920578.1 protein_id gnl|my_center|LOCUS_05340 62702 63034 gene locus_tag LOCUS_05350 gene clpS 62702 63034 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548135.1 protein_id gnl|my_center|LOCUS_05350 63267 65675 gene locus_tag LOCUS_05360 gene clpA 63267 65675 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087911.1 protein_id gnl|my_center|LOCUS_05360 66009 66332 gene locus_tag LOCUS_05370 66009 66332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 67163 66558 gene locus_tag LOCUS_05380 gene rplI 67163 66558 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086852.1 protein_id gnl|my_center|LOCUS_05380 68180 67194 gene locus_tag LOCUS_05390 68180 67194 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086853.1 protein_id gnl|my_center|LOCUS_05390 68548 68309 gene locus_tag LOCUS_05400 gene rpsR 68548 68309 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007592020.1 protein_id gnl|my_center|LOCUS_05400 68973 68554 gene locus_tag LOCUS_05410 gene rpsF 68973 68554 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086854.1 protein_id gnl|my_center|LOCUS_05410 69350 70309 gene locus_tag LOCUS_05420 gene fabD 69350 70309 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086857.1 protein_id gnl|my_center|LOCUS_05420 70328 71065 gene locus_tag LOCUS_05430 gene fabG 70328 71065 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086858.1 protein_id gnl|my_center|LOCUS_05430 71341 71580 gene locus_tag LOCUS_05440 71341 71580 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130699.1 protein_id gnl|my_center|LOCUS_05440 71675 72940 gene locus_tag LOCUS_05450 gene fabF 71675 72940 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086859.1 protein_id gnl|my_center|LOCUS_05450 73068 74282 gene locus_tag LOCUS_05460 gene mltG 73068 74282 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086860.1 protein_id gnl|my_center|LOCUS_05460 74633 75520 gene locus_tag LOCUS_05470 74633 75520 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086861.1 protein_id gnl|my_center|LOCUS_05470 75524 76183 gene locus_tag LOCUS_05480 gene gmk 75524 76183 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086862.1 protein_id gnl|my_center|LOCUS_05480 76564 76286 gene locus_tag LOCUS_05490 76564 76286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 78314 77460 gene locus_tag LOCUS_05500 gene rsmA 78314 77460 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086876.1 protein_id gnl|my_center|LOCUS_05500 79381 78311 gene locus_tag LOCUS_05510 gene pdxA 79381 78311 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086877.1 protein_id gnl|my_center|LOCUS_05510 80457 79498 gene locus_tag LOCUS_05520 80457 79498 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171094.1 protein_id gnl|my_center|LOCUS_05520 83036 80541 gene locus_tag LOCUS_05530 83036 80541 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921454.1 protein_id gnl|my_center|LOCUS_05530 84133 83036 gene locus_tag LOCUS_05540 gene lptG 84133 83036 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966780.1 protein_id gnl|my_center|LOCUS_05540 85302 84130 gene locus_tag LOCUS_05550 gene lptF 85302 84130 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086881.1 protein_id gnl|my_center|LOCUS_05550 85663 87162 gene locus_tag LOCUS_05560 85663 87162 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171097.1 protein_id gnl|my_center|LOCUS_05560 87159 87611 gene locus_tag LOCUS_05570 87159 87611 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086883.1 protein_id gnl|my_center|LOCUS_05570 87780 88310 gene locus_tag LOCUS_05580 87780 88310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463844.1 protein_id gnl|my_center|LOCUS_05580 90320 88440 gene locus_tag LOCUS_05590 90320 88440 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086892.1 protein_id gnl|my_center|LOCUS_05590 90611 90438 gene locus_tag LOCUS_05600 90611 90438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 92025 90829 gene locus_tag LOCUS_05610 92025 90829 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463760.1 protein_id gnl|my_center|LOCUS_05610 92854 92291 gene locus_tag LOCUS_05620 92854 92291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 93318 96782 gene locus_tag LOCUS_05630 93318 96782 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171255.1 protein_id gnl|my_center|LOCUS_05630 98123 96867 gene locus_tag LOCUS_05640 gene tyrS 98123 96867 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087103.1 protein_id gnl|my_center|LOCUS_05640 98274 99371 gene locus_tag LOCUS_05650 98274 99371 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087104.1 protein_id gnl|my_center|LOCUS_05650 100130 99483 gene locus_tag LOCUS_05660 100130 99483 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143006.1 protein_id gnl|my_center|LOCUS_05660 100726 101490 gene locus_tag LOCUS_05670 100726 101490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 101572 103053 gene locus_tag LOCUS_05680 gene sufB 101572 103053 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087111.1 protein_id gnl|my_center|LOCUS_05680 103196 103948 gene locus_tag LOCUS_05690 gene sufC 103196 103948 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171266.1 protein_id gnl|my_center|LOCUS_05690 104013 105335 gene locus_tag LOCUS_05700 gene sufD 104013 105335 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087113.1 protein_id gnl|my_center|LOCUS_05700 105356 106600 gene locus_tag LOCUS_05710 105356 106600 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087114.1 protein_id gnl|my_center|LOCUS_05710 106597 106977 gene locus_tag LOCUS_05720 106597 106977 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087115.1 protein_id gnl|my_center|LOCUS_05720 107037 107441 gene locus_tag LOCUS_05730 107037 107441 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463761.1 protein_id gnl|my_center|LOCUS_05730 108636 107572 gene locus_tag LOCUS_05740 108636 107572 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_05740 110238 108790 gene locus_tag LOCUS_05750 110238 108790 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087120.1 protein_id gnl|my_center|LOCUS_05750 110632 112122 gene locus_tag LOCUS_05760 110632 112122 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967108.1 protein_id gnl|my_center|LOCUS_05760 112148 113419 gene locus_tag LOCUS_05770 112148 113419 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087123.1 protein_id gnl|my_center|LOCUS_05770 113940 113536 gene locus_tag LOCUS_05780 113940 113536 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085641.1 protein_id gnl|my_center|LOCUS_05780 116098 114053 gene locus_tag LOCUS_05790 gene parE 116098 114053 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087127.1 protein_id gnl|my_center|LOCUS_05790 116593 116297 gene locus_tag LOCUS_05800 116593 116297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 116780 117310 gene locus_tag LOCUS_05810 116780 117310 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087128.1 protein_id gnl|my_center|LOCUS_05810 117415 118413 gene locus_tag LOCUS_05820 gene argC 117415 118413 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_05820 118580 118999 gene locus_tag LOCUS_05830 118580 118999 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530912.1 protein_id gnl|my_center|LOCUS_05830 121008 119179 gene locus_tag LOCUS_05840 gene phaC 121008 119179 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967114.1 protein_id gnl|my_center|LOCUS_05840 121248 121553 gene locus_tag LOCUS_05850 121248 121553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 121779 122996 gene locus_tag LOCUS_05860 121779 122996 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171284.1 protein_id gnl|my_center|LOCUS_05860 123071 124393 gene locus_tag LOCUS_05870 123071 124393 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087134.1 protein_id gnl|my_center|LOCUS_05870 124441 125436 gene locus_tag LOCUS_05880 gene glpX 124441 125436 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087135.1 protein_id gnl|my_center|LOCUS_05880 125503 127344 gene locus_tag LOCUS_05890 gene recJ 125503 127344 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967117.1 protein_id gnl|my_center|LOCUS_05890 128646 127387 gene locus_tag LOCUS_05900 128646 127387 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087152.1 protein_id gnl|my_center|LOCUS_05900 129246 128680 gene locus_tag LOCUS_05910 gene efp 129246 128680 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087158.1 protein_id gnl|my_center|LOCUS_05910 129391 130434 gene locus_tag LOCUS_05920 gene epmA 129391 130434 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087159.1 protein_id gnl|my_center|LOCUS_05920 130431 131528 gene locus_tag LOCUS_05930 130431 131528 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087160.1 protein_id gnl|my_center|LOCUS_05930 131627 131884 gene locus_tag LOCUS_05940 131627 131884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 132594 132016 gene locus_tag LOCUS_05950 132594 132016 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087162.1 protein_id gnl|my_center|LOCUS_05950 133191 132889 gene locus_tag LOCUS_05960 133191 132889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 133570 134241 gene locus_tag LOCUS_05970 133570 134241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 134902 134399 gene locus_tag LOCUS_05980 134902 134399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 135617 136045 gene locus_tag LOCUS_05990 135617 136045 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090378.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence05 817 200 gene locus_tag LOCUS_06000 gene ruvA 817 200 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084352.1 protein_id gnl|my_center|LOCUS_06000 1643 1041 gene locus_tag LOCUS_06010 gene ruvC 1643 1041 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084351.1 protein_id gnl|my_center|LOCUS_06010 3123 1753 gene locus_tag LOCUS_06020 gene mgtE 3123 1753 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531663.1 protein_id gnl|my_center|LOCUS_06020 3864 3409 gene locus_tag LOCUS_06030 3864 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4607 3861 gene locus_tag LOCUS_06040 4607 3861 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084350.1 protein_id gnl|my_center|LOCUS_06040 5602 4781 gene locus_tag LOCUS_06050 5602 4781 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173440.1 protein_id gnl|my_center|LOCUS_06050 6363 5605 gene locus_tag LOCUS_06060 6363 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7074 6691 gene locus_tag LOCUS_06070 7074 6691 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084342.1 protein_id gnl|my_center|LOCUS_06070 7403 7071 gene locus_tag LOCUS_06080 7403 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 7641 9671 gene locus_tag LOCUS_06090 gene tkt 7641 9671 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921605.1 protein_id gnl|my_center|LOCUS_06090 9991 10998 gene locus_tag LOCUS_06100 gene gap 9991 10998 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084339.1 protein_id gnl|my_center|LOCUS_06100 11134 12330 gene locus_tag LOCUS_06110 11134 12330 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084338.1 protein_id gnl|my_center|LOCUS_06110 12432 13481 gene locus_tag LOCUS_06120 12432 13481 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_06120 13886 13584 gene locus_tag LOCUS_06130 13886 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 14258 14959 gene locus_tag LOCUS_06140 14258 14959 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921389.1 protein_id gnl|my_center|LOCUS_06140 14956 15984 gene locus_tag LOCUS_06150 14956 15984 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084334.1 protein_id gnl|my_center|LOCUS_06150 16046 16837 gene locus_tag LOCUS_06160 16046 16837 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084333.1 protein_id gnl|my_center|LOCUS_06160 20046 16882 gene locus_tag LOCUS_06170 20046 16882 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084332.1 protein_id gnl|my_center|LOCUS_06170 21261 20053 gene locus_tag LOCUS_06180 21261 20053 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084331.1 protein_id gnl|my_center|LOCUS_06180 21787 22854 gene locus_tag LOCUS_06190 21787 22854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965387.1 protein_id gnl|my_center|LOCUS_06190 22870 23898 gene locus_tag LOCUS_06200 22870 23898 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084326.1 protein_id gnl|my_center|LOCUS_06200 24057 24506 gene locus_tag LOCUS_06210 24057 24506 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084325.1 protein_id gnl|my_center|LOCUS_06210 26390 24519 gene locus_tag LOCUS_06220 26390 24519 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 protein_id gnl|my_center|LOCUS_06220 26553 26780 gene locus_tag LOCUS_06230 gene rpmE 26553 26780 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084323.1 protein_id gnl|my_center|LOCUS_06230 27623 27102 gene locus_tag LOCUS_06240 27623 27102 CDS product DUF1465 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084322.1 protein_id gnl|my_center|LOCUS_06240 28328 28137 gene locus_tag LOCUS_06250 28328 28137 CDS product DUF1192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084320.1 protein_id gnl|my_center|LOCUS_06250 28552 29529 gene locus_tag LOCUS_06260 28552 29529 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084319.1 protein_id gnl|my_center|LOCUS_06260 29727 32609 gene locus_tag LOCUS_06270 29727 32609 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173457.1 protein_id gnl|my_center|LOCUS_06270 33308 32652 gene locus_tag LOCUS_06280 33308 32652 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084308.1 protein_id gnl|my_center|LOCUS_06280 33445 34287 gene locus_tag LOCUS_06290 33445 34287 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084307.1 protein_id gnl|my_center|LOCUS_06290 34526 34335 gene locus_tag LOCUS_06300 34526 34335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 34465 35769 gene locus_tag LOCUS_06310 34465 35769 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965385.1 protein_id gnl|my_center|LOCUS_06310 36567 35779 gene locus_tag LOCUS_06320 36567 35779 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084304.1 protein_id gnl|my_center|LOCUS_06320 37084 36575 gene locus_tag LOCUS_06330 37084 36575 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965381.1 protein_id gnl|my_center|LOCUS_06330 38403 37354 gene locus_tag LOCUS_06340 38403 37354 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084301.1 protein_id gnl|my_center|LOCUS_06340 39262 38393 gene locus_tag LOCUS_06350 gene cysW 39262 38393 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084300.1 protein_id gnl|my_center|LOCUS_06350 40110 39274 gene locus_tag LOCUS_06360 gene cysT 40110 39274 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080584160.1 protein_id gnl|my_center|LOCUS_06360 41124 40135 gene locus_tag LOCUS_06370 41124 40135 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965384.1 protein_id gnl|my_center|LOCUS_06370 42015 41254 gene locus_tag LOCUS_06380 42015 41254 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084297.1 protein_id gnl|my_center|LOCUS_06380 43448 42012 gene locus_tag LOCUS_06390 gene cysG 43448 42012 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084293.1 protein_id gnl|my_center|LOCUS_06390 43702 44508 gene locus_tag LOCUS_06400 43702 44508 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084292.1 protein_id gnl|my_center|LOCUS_06400 44535 46460 gene locus_tag LOCUS_06410 gene cysC 44535 46460 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084291.1 protein_id gnl|my_center|LOCUS_06410 46676 48943 gene locus_tag LOCUS_06420 46676 48943 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084290.1 protein_id gnl|my_center|LOCUS_06420 49491 49859 gene locus_tag LOCUS_06430 49491 49859 CDS product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173485.1 protein_id gnl|my_center|LOCUS_06430 49978 50415 gene locus_tag LOCUS_06440 49978 50415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173486.1 protein_id gnl|my_center|LOCUS_06440 51968 51156 gene locus_tag LOCUS_06450 51968 51156 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966151.1 protein_id gnl|my_center|LOCUS_06450 52170 52421 gene locus_tag LOCUS_06460 52170 52421 CDS product NepR family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173820.1 protein_id gnl|my_center|LOCUS_06460 52422 52967 gene locus_tag LOCUS_06470 52422 52967 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090521.1 protein_id gnl|my_center|LOCUS_06470 54749 53097 gene locus_tag LOCUS_06480 54749 53097 CDS product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084277.1 protein_id gnl|my_center|LOCUS_06480 56323 55055 gene locus_tag LOCUS_06490 gene mtaB 56323 55055 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083307.1 protein_id gnl|my_center|LOCUS_06490 57228 56323 gene locus_tag LOCUS_06500 gene dapF 57228 56323 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083308.1 protein_id gnl|my_center|LOCUS_06500 57473 58201 gene locus_tag LOCUS_06510 57473 58201 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083309.1 protein_id gnl|my_center|LOCUS_06510 58210 58914 gene locus_tag LOCUS_06520 58210 58914 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965070.1 protein_id gnl|my_center|LOCUS_06520 59183 60718 gene locus_tag LOCUS_06530 gene ffh 59183 60718 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965072.1 protein_id gnl|my_center|LOCUS_06530 60815 61147 gene locus_tag LOCUS_06540 gene rpsP 60815 61147 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083313.1 protein_id gnl|my_center|LOCUS_06540 61267 61854 gene locus_tag LOCUS_06550 gene rimM 61267 61854 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083314.1 protein_id gnl|my_center|LOCUS_06550 61937 62656 gene locus_tag LOCUS_06560 gene trmD 61937 62656 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083317.1 protein_id gnl|my_center|LOCUS_06560 62877 63272 gene locus_tag LOCUS_06570 gene rplS 62877 63272 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083318.1 protein_id gnl|my_center|LOCUS_06570 63604 63425 gene locus_tag LOCUS_06580 63604 63425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 63603 65015 gene locus_tag LOCUS_06590 gene leuC 63603 65015 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083319.1 protein_id gnl|my_center|LOCUS_06590 65304 65810 gene locus_tag LOCUS_06600 65304 65810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 66146 65835 gene locus_tag LOCUS_06610 66146 65835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 66326 66553 gene locus_tag LOCUS_06620 66326 66553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 67152 66790 gene locus_tag LOCUS_06630 67152 66790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 67251 67652 gene locus_tag LOCUS_06640 67251 67652 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965074.1 protein_id gnl|my_center|LOCUS_06640 67722 68327 gene locus_tag LOCUS_06650 gene leuD 67722 68327 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083326.1 protein_id gnl|my_center|LOCUS_06650 69490 68456 gene locus_tag LOCUS_06660 69490 68456 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083332.1 protein_id gnl|my_center|LOCUS_06660 70181 70564 gene locus_tag LOCUS_06670 70181 70564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086492.1 protein_id gnl|my_center|LOCUS_06670 71824 70643 gene locus_tag LOCUS_06680 gene leuB 71824 70643 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083334.1 protein_id gnl|my_center|LOCUS_06680 72649 72140 gene locus_tag LOCUS_06690 72649 72140 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880100.1 protein_id gnl|my_center|LOCUS_06690 73523 72738 gene locus_tag LOCUS_06700 73523 72738 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083336.1 protein_id gnl|my_center|LOCUS_06700 74138 73539 gene locus_tag LOCUS_06710 74138 73539 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083337.1 protein_id gnl|my_center|LOCUS_06710 74413 75930 gene locus_tag LOCUS_06720 74413 75930 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083340.1 protein_id gnl|my_center|LOCUS_06720 76303 76704 gene locus_tag LOCUS_06730 gene sdhC 76303 76704 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_06730 76701 77108 gene locus_tag LOCUS_06740 gene sdhD 76701 77108 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083344.1 protein_id gnl|my_center|LOCUS_06740 77112 78935 gene locus_tag LOCUS_06750 gene sdhA 77112 78935 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083345.1 protein_id gnl|my_center|LOCUS_06750 79044 79826 gene locus_tag LOCUS_06760 79044 79826 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083346.1 protein_id gnl|my_center|LOCUS_06760 81360 82523 gene locus_tag LOCUS_06770 81360 82523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06770 83906 82677 gene locus_tag LOCUS_06780 83906 82677 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918018.1 protein_id gnl|my_center|LOCUS_06780 84767 83979 gene locus_tag LOCUS_06790 84767 83979 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965094.1 protein_id gnl|my_center|LOCUS_06790 85414 84938 gene locus_tag LOCUS_06800 85414 84938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083355.1 protein_id gnl|my_center|LOCUS_06800 86722 85451 gene locus_tag LOCUS_06810 gene rlmN 86722 85451 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083356.1 protein_id gnl|my_center|LOCUS_06810 87446 86907 gene locus_tag LOCUS_06820 87446 86907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 88088 87711 gene locus_tag LOCUS_06830 88088 87711 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965096.1 protein_id gnl|my_center|LOCUS_06830 88498 88193 gene locus_tag LOCUS_06840 88498 88193 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083363.1 protein_id gnl|my_center|LOCUS_06840 88918 89256 gene locus_tag LOCUS_06850 88918 89256 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082989.1 protein_id gnl|my_center|LOCUS_06850 89332 89703 gene locus_tag LOCUS_06860 89332 89703 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_06860 91632 89722 gene locus_tag LOCUS_06870 gene htpG 91632 89722 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391716.1 protein_id gnl|my_center|LOCUS_06870 92230 92892 gene locus_tag LOCUS_06880 92230 92892 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920895.1 protein_id gnl|my_center|LOCUS_06880 92903 93415 gene locus_tag LOCUS_06890 92903 93415 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930254.1 protein_id gnl|my_center|LOCUS_06890 93579 94388 gene locus_tag LOCUS_06900 93579 94388 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 protein_id gnl|my_center|LOCUS_06900 94397 95413 gene locus_tag LOCUS_06910 94397 95413 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265901.1 protein_id gnl|my_center|LOCUS_06910 96211 95525 gene locus_tag LOCUS_06920 96211 95525 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037901.1 protein_id gnl|my_center|LOCUS_06920 98698 96296 gene locus_tag LOCUS_06930 gene piuA 98698 96296 CDS product TonB-dependent siderophore receptor PiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_06930 99553 100218 gene locus_tag LOCUS_06940 99553 100218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 100231 100683 gene locus_tag LOCUS_06950 gene exbD 100231 100683 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212170.1 protein_id gnl|my_center|LOCUS_06950 100680 101435 gene locus_tag LOCUS_06960 100680 101435 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981091.1 protein_id gnl|my_center|LOCUS_06960 101432 103852 gene locus_tag LOCUS_06970 gene secA 101432 103852 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973108.1 protein_id gnl|my_center|LOCUS_06970 104957 103932 gene locus_tag LOCUS_06980 gene dusA 104957 103932 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086515.1 protein_id gnl|my_center|LOCUS_06980 105868 105485 gene locus_tag LOCUS_06990 105868 105485 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 protein_id gnl|my_center|LOCUS_06990 106122 105865 gene locus_tag LOCUS_07000 106122 105865 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537648.1 protein_id gnl|my_center|LOCUS_07000 106941 106276 gene locus_tag LOCUS_07010 106941 106276 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257125.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07010 107096 106938 gene locus_tag LOCUS_07020 107096 106938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07020 107952 108770 gene locus_tag LOCUS_07030 107952 108770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 108770 109432 gene locus_tag LOCUS_07040 108770 109432 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383693.1 protein_id gnl|my_center|LOCUS_07040 109513 110205 gene locus_tag LOCUS_07050 109513 110205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 110372 111427 gene locus_tag LOCUS_07060 gene pseI 110372 111427 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 protein_id gnl|my_center|LOCUS_07060 111540 112160 gene locus_tag LOCUS_07070 111540 112160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 112245 112970 gene locus_tag LOCUS_07080 112245 112970 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920693.1 protein_id gnl|my_center|LOCUS_07080 113264 114421 gene locus_tag LOCUS_07090 gene pseC 113264 114421 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_07090 114659 116251 gene locus_tag LOCUS_07100 114659 116251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 117136 117675 gene locus_tag LOCUS_07110 117136 117675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 118235 118972 gene locus_tag LOCUS_07120 118235 118972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 118920 119459 gene locus_tag LOCUS_07130 118920 119459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 119469 121667 gene locus_tag LOCUS_07140 119469 121667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 121877 121686 gene locus_tag LOCUS_07150 121877 121686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 123204 121936 gene locus_tag LOCUS_07160 123204 121936 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085434.1 protein_id gnl|my_center|LOCUS_07160 123952 123197 gene locus_tag LOCUS_07170 123952 123197 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965884.1 protein_id gnl|my_center|LOCUS_07170 126073 124145 gene locus_tag LOCUS_07180 gene dxs 126073 124145 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175335.1 protein_id gnl|my_center|LOCUS_07180 126852 126601 gene locus_tag LOCUS_07190 126852 126601 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008132970.1 protein_id gnl|my_center|LOCUS_07190 127862 126933 gene locus_tag LOCUS_07200 127862 126933 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085438.1 protein_id gnl|my_center|LOCUS_07200 128817 128050 gene locus_tag LOCUS_07210 128817 128050 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085440.1 protein_id gnl|my_center|LOCUS_07210 130730 128949 gene locus_tag LOCUS_07220 130730 128949 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_07220 131023 131097 gene locus_tag LOCUS_t00120 131023 131097 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 649 101 gene locus_tag LOCUS_07230 649 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2345 693 gene locus_tag LOCUS_07240 gene ettA 2345 693 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089425.1 protein_id gnl|my_center|LOCUS_07240 4443 3322 gene locus_tag LOCUS_07250 4443 3322 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921646.1 protein_id gnl|my_center|LOCUS_07250 4894 5694 gene locus_tag LOCUS_07260 4894 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372671.1 protein_id gnl|my_center|LOCUS_07260 6585 5731 gene locus_tag LOCUS_07270 gene sseA 6585 5731 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966391.1 protein_id gnl|my_center|LOCUS_07270 7260 6667 gene locus_tag LOCUS_07280 7260 6667 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967669.1 protein_id gnl|my_center|LOCUS_07280 7721 7395 gene locus_tag LOCUS_07290 7721 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 7943 8755 gene locus_tag LOCUS_07300 7943 8755 CDS product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090155.1 protein_id gnl|my_center|LOCUS_07300 9212 12145 gene locus_tag LOCUS_07310 gene uvrB 9212 12145 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090165.1 protein_id gnl|my_center|LOCUS_07310 12486 12827 gene locus_tag LOCUS_07320 12486 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 13355 13032 gene locus_tag LOCUS_07330 13355 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 13476 14327 gene locus_tag LOCUS_07340 13476 14327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921549.1 protein_id gnl|my_center|LOCUS_07340 14480 14908 gene locus_tag LOCUS_07350 14480 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090170.1 protein_id gnl|my_center|LOCUS_07350 15959 15006 gene locus_tag LOCUS_07360 15959 15006 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174674.1 protein_id gnl|my_center|LOCUS_07360 17126 16356 gene locus_tag LOCUS_07370 gene pgeF 17126 16356 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090180.1 protein_id gnl|my_center|LOCUS_07370 18247 17123 gene locus_tag LOCUS_07380 18247 17123 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 protein_id gnl|my_center|LOCUS_07380 19115 18240 gene locus_tag LOCUS_07390 gene lgt 19115 18240 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967285.1 protein_id gnl|my_center|LOCUS_07390 19350 19670 gene locus_tag LOCUS_07400 19350 19670 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090176.1 protein_id gnl|my_center|LOCUS_07400 19844 19692 gene locus_tag LOCUS_07410 19844 19692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 20442 20738 gene locus_tag LOCUS_07420 20442 20738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 21927 20830 gene locus_tag LOCUS_07430 gene ychF 21927 20830 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090173.1 protein_id gnl|my_center|LOCUS_07430 22619 22005 gene locus_tag LOCUS_07440 gene pth 22619 22005 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090174.1 protein_id gnl|my_center|LOCUS_07440 23336 22635 gene locus_tag LOCUS_07450 23336 22635 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090175.1 protein_id gnl|my_center|LOCUS_07450 24032 24532 gene locus_tag LOCUS_07460 24032 24532 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174670.1 protein_id gnl|my_center|LOCUS_07460 24716 25546 gene locus_tag LOCUS_07470 gene proC 24716 25546 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463862.1 protein_id gnl|my_center|LOCUS_07470 25703 27211 gene locus_tag LOCUS_07480 25703 27211 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973601.1 protein_id gnl|my_center|LOCUS_07480 28558 27341 gene locus_tag LOCUS_07490 gene rocD 28558 27341 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391213.1 protein_id gnl|my_center|LOCUS_07490 30175 28775 gene locus_tag LOCUS_07500 30175 28775 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090196.1 protein_id gnl|my_center|LOCUS_07500 30900 30172 gene locus_tag LOCUS_07510 30900 30172 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090195.1 protein_id gnl|my_center|LOCUS_07510 31415 30897 gene locus_tag LOCUS_07520 31415 30897 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000365.1 protein_id gnl|my_center|LOCUS_07520 31702 32814 gene locus_tag LOCUS_07530 31702 32814 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090193.1 protein_id gnl|my_center|LOCUS_07530 34304 32904 gene locus_tag LOCUS_07540 34304 32904 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812163.1 protein_id gnl|my_center|LOCUS_07540 35418 34396 gene locus_tag LOCUS_07550 gene prmB 35418 34396 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090207.1 protein_id gnl|my_center|LOCUS_07550 35894 35418 gene locus_tag LOCUS_07560 35894 35418 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090206.1 protein_id gnl|my_center|LOCUS_07560 36168 35917 gene locus_tag LOCUS_07570 gene moaD 36168 35917 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090205.1 protein_id gnl|my_center|LOCUS_07570 36782 36165 gene locus_tag LOCUS_07580 gene pgsA 36782 36165 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090204.1 protein_id gnl|my_center|LOCUS_07580 39001 36920 gene locus_tag LOCUS_07590 gene uvrC 39001 36920 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090203.1 protein_id gnl|my_center|LOCUS_07590 39268 39888 gene locus_tag LOCUS_07600 39268 39888 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967292.1 protein_id gnl|my_center|LOCUS_07600 40840 39986 gene locus_tag LOCUS_07610 gene rlmJ 40840 39986 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090201.1 protein_id gnl|my_center|LOCUS_07610 41625 40933 gene locus_tag LOCUS_07620 41625 40933 CDS product ribonuclease T2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090200.1 protein_id gnl|my_center|LOCUS_07620 42289 41834 gene locus_tag LOCUS_07630 42289 41834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174664.1 protein_id gnl|my_center|LOCUS_07630 42455 42745 gene locus_tag LOCUS_07640 42455 42745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090198.1 protein_id gnl|my_center|LOCUS_07640 42907 43434 gene locus_tag LOCUS_07650 42907 43434 CDS product DUF3617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090197.1 protein_id gnl|my_center|LOCUS_07650 43858 43607 gene locus_tag LOCUS_07660 43858 43607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 45270 43855 gene locus_tag LOCUS_07670 45270 43855 CDS product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969516.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07670 45722 45282 gene locus_tag LOCUS_07680 45722 45282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 46177 47514 gene locus_tag LOCUS_07690 46177 47514 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037500.1 protein_id gnl|my_center|LOCUS_07690 47626 49083 gene locus_tag LOCUS_07700 47626 49083 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090210.1 protein_id gnl|my_center|LOCUS_07700 49098 49952 gene locus_tag LOCUS_07710 49098 49952 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174657.1 protein_id gnl|my_center|LOCUS_07710 50556 50161 gene locus_tag LOCUS_07720 50556 50161 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 protein_id gnl|my_center|LOCUS_07720 50803 51786 gene locus_tag LOCUS_07730 50803 51786 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967295.1 protein_id gnl|my_center|LOCUS_07730 52011 55205 gene locus_tag LOCUS_07740 gene ileS 52011 55205 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090213.1 protein_id gnl|my_center|LOCUS_07740 55202 55699 gene locus_tag LOCUS_07750 gene lspA 55202 55699 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174654.1 protein_id gnl|my_center|LOCUS_07750 55779 56513 gene locus_tag LOCUS_07760 55779 56513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921550.1 protein_id gnl|my_center|LOCUS_07760 56915 58309 gene locus_tag LOCUS_07770 56915 58309 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463825.1 protein_id gnl|my_center|LOCUS_07770 58306 59700 gene locus_tag LOCUS_07780 58306 59700 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967298.1 protein_id gnl|my_center|LOCUS_07780 59924 60352 gene locus_tag LOCUS_07790 gene arfB 59924 60352 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_07790 60472 62283 gene locus_tag LOCUS_07800 gene mutL 60472 62283 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090225.1 protein_id gnl|my_center|LOCUS_07800 62840 62286 gene locus_tag LOCUS_07810 gene rsmD 62840 62286 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090226.1 protein_id gnl|my_center|LOCUS_07810 63939 62854 gene locus_tag LOCUS_07820 63939 62854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 64511 63936 gene locus_tag LOCUS_07830 64511 63936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 64947 65393 gene locus_tag LOCUS_07840 64947 65393 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090228.1 protein_id gnl|my_center|LOCUS_07840 66684 65404 gene locus_tag LOCUS_07850 gene purD 66684 65404 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090230.1 protein_id gnl|my_center|LOCUS_07850 66766 68391 gene locus_tag LOCUS_07860 gene xseA 66766 68391 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090239.1 protein_id gnl|my_center|LOCUS_07860 68644 68919 gene locus_tag LOCUS_07870 68644 68919 CDS product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090242.1 protein_id gnl|my_center|LOCUS_07870 69991 68984 gene locus_tag LOCUS_07880 gene lpxK 69991 68984 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090246.1 protein_id gnl|my_center|LOCUS_07880 71288 69984 gene locus_tag LOCUS_07890 71288 69984 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 protein_id gnl|my_center|LOCUS_07890 72015 71281 gene locus_tag LOCUS_07900 72015 71281 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532344.1 protein_id gnl|my_center|LOCUS_07900 72263 72012 gene locus_tag LOCUS_07910 72263 72012 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090249.1 protein_id gnl|my_center|LOCUS_07910 73140 72325 gene locus_tag LOCUS_07920 73140 72325 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174622.1 protein_id gnl|my_center|LOCUS_07920 74515 73127 gene locus_tag LOCUS_07930 74515 73127 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174621.1 protein_id gnl|my_center|LOCUS_07930 74802 75323 gene locus_tag LOCUS_07940 74802 75323 CDS product DUF6101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090252.1 protein_id gnl|my_center|LOCUS_07940 76312 75389 gene locus_tag LOCUS_07950 gene ubiA 76312 75389 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090253.1 protein_id gnl|my_center|LOCUS_07950 77039 76323 gene locus_tag LOCUS_07960 77039 76323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090254.1 protein_id gnl|my_center|LOCUS_07960 77332 78081 gene locus_tag LOCUS_07970 77332 78081 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967316.1 protein_id gnl|my_center|LOCUS_07970 78268 80424 gene locus_tag LOCUS_07980 78268 80424 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085247.1 protein_id gnl|my_center|LOCUS_07980 80629 81810 gene locus_tag LOCUS_07990 80629 81810 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090256.1 protein_id gnl|my_center|LOCUS_07990 81807 82784 gene locus_tag LOCUS_08000 gene hisG 81807 82784 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090257.1 protein_id gnl|my_center|LOCUS_08000 82870 83916 gene locus_tag LOCUS_08010 82870 83916 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090258.1 protein_id gnl|my_center|LOCUS_08010 83913 84758 gene locus_tag LOCUS_08020 83913 84758 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090259.1 protein_id gnl|my_center|LOCUS_08020 84850 85620 gene locus_tag LOCUS_08030 84850 85620 CDS product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090260.1 protein_id gnl|my_center|LOCUS_08030 86039 85689 gene locus_tag LOCUS_08040 86039 85689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08040 86141 86572 gene locus_tag LOCUS_08050 86141 86572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 86753 87532 gene locus_tag LOCUS_08060 86753 87532 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174613.1 protein_id gnl|my_center|LOCUS_08060 88088 87573 gene locus_tag LOCUS_08070 88088 87573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174612.1 protein_id gnl|my_center|LOCUS_08070 88410 88706 gene locus_tag LOCUS_08080 88410 88706 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090264.1 protein_id gnl|my_center|LOCUS_08080 89009 90652 gene locus_tag LOCUS_08090 gene groL 89009 90652 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090265.1 protein_id gnl|my_center|LOCUS_08090 90851 92047 gene locus_tag LOCUS_08100 90851 92047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174611.1 protein_id gnl|my_center|LOCUS_08100 92514 92107 gene locus_tag LOCUS_08110 92514 92107 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967314.1 protein_id gnl|my_center|LOCUS_08110 93010 92594 gene locus_tag LOCUS_08120 93010 92594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 94347 93034 gene locus_tag LOCUS_08130 gene glcF 94347 93034 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090272.1 protein_id gnl|my_center|LOCUS_08130 95597 94344 gene locus_tag LOCUS_08140 95597 94344 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090273.1 protein_id gnl|my_center|LOCUS_08140 97256 95763 gene locus_tag LOCUS_08150 97256 95763 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090275.1 protein_id gnl|my_center|LOCUS_08150 97629 98030 gene locus_tag LOCUS_08160 97629 98030 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090276.1 protein_id gnl|my_center|LOCUS_08160 98722 98039 gene locus_tag LOCUS_08170 98722 98039 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136878.1 protein_id gnl|my_center|LOCUS_08170 99127 98972 gene locus_tag LOCUS_08180 99127 98972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 99358 99735 gene locus_tag LOCUS_08190 99358 99735 CDS product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965925.1 protein_id gnl|my_center|LOCUS_08190 102459 99805 gene locus_tag LOCUS_08200 102459 99805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 102900 102463 gene locus_tag LOCUS_08210 102900 102463 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035690.1 protein_id gnl|my_center|LOCUS_08210 103966 103019 gene locus_tag LOCUS_08220 103966 103019 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085322.1 protein_id gnl|my_center|LOCUS_08220 104400 104209 gene locus_tag LOCUS_08230 104400 104209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 105324 104518 gene locus_tag LOCUS_08240 105324 104518 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085321.1 protein_id gnl|my_center|LOCUS_08240 106367 105582 gene locus_tag LOCUS_08250 106367 105582 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085320.1 protein_id gnl|my_center|LOCUS_08250 106587 106348 gene locus_tag LOCUS_08260 106587 106348 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085319.1 protein_id gnl|my_center|LOCUS_08260 106738 107748 gene locus_tag LOCUS_08270 106738 107748 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085318.1 protein_id gnl|my_center|LOCUS_08270 108831 107914 gene locus_tag LOCUS_08280 108831 107914 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965922.1 protein_id gnl|my_center|LOCUS_08280 110733 108952 gene locus_tag LOCUS_08290 110733 108952 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085312.1 protein_id gnl|my_center|LOCUS_08290 112571 110910 gene locus_tag LOCUS_08300 112571 110910 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085311.1 protein_id gnl|my_center|LOCUS_08300 112742 113587 gene locus_tag LOCUS_08310 112742 113587 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085310.1 protein_id gnl|my_center|LOCUS_08310 115139 113634 gene locus_tag LOCUS_08320 115139 113634 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085309.1 protein_id gnl|my_center|LOCUS_08320 115181 115417 gene locus_tag LOCUS_08330 115181 115417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 115989 115342 gene locus_tag LOCUS_08340 115989 115342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 117337 116177 gene locus_tag LOCUS_08350 117337 116177 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 protein_id gnl|my_center|LOCUS_08350 117958 117395 gene locus_tag LOCUS_08360 gene moaB 117958 117395 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965931.1 protein_id gnl|my_center|LOCUS_08360 118904 117981 gene locus_tag LOCUS_08370 118904 117981 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085297.1 protein_id gnl|my_center|LOCUS_08370 119437 120567 gene locus_tag LOCUS_08380 119437 120567 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085296.1 protein_id gnl|my_center|LOCUS_08380 120775 121461 gene locus_tag LOCUS_08390 120775 121461 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921418.1 protein_id gnl|my_center|LOCUS_08390 122646 121495 gene locus_tag LOCUS_08400 gene mutY 122646 121495 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921414.1 protein_id gnl|my_center|LOCUS_08400 122872 123351 gene locus_tag LOCUS_08410 122872 123351 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085285.1 protein_id gnl|my_center|LOCUS_08410 123459 124121 gene locus_tag LOCUS_08420 123459 124121 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967973.1 protein_id gnl|my_center|LOCUS_08420 124323 127829 gene locus_tag LOCUS_08430 gene smc 124323 127829 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085283.1 protein_id gnl|my_center|LOCUS_08430 127870 128916 gene locus_tag LOCUS_08440 127870 128916 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967972.1 protein_id gnl|my_center|LOCUS_08440 129392 128934 gene locus_tag LOCUS_08450 129392 128934 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314952.1 protein_id gnl|my_center|LOCUS_08450 129553 130113 gene locus_tag LOCUS_08460 129553 130113 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085281.1 protein_id gnl|my_center|LOCUS_08460 130275 131360 gene locus_tag LOCUS_08470 130275 131360 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085280.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence07 1362 853 gene locus_tag LOCUS_08480 1362 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1799 1359 gene locus_tag LOCUS_08490 1799 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 3232 3417 gene locus_tag LOCUS_08500 3232 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3828 3607 gene locus_tag LOCUS_08510 3828 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4170 4370 gene locus_tag LOCUS_08520 4170 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4385 5161 gene locus_tag LOCUS_08530 4385 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085860.1 protein_id gnl|my_center|LOCUS_08530 5760 5182 gene locus_tag LOCUS_08540 5760 5182 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085884.1 protein_id gnl|my_center|LOCUS_08540 6335 5757 gene locus_tag LOCUS_08550 6335 5757 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085885.1 protein_id gnl|my_center|LOCUS_08550 8841 6559 gene locus_tag LOCUS_08560 8841 6559 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085886.1 protein_id gnl|my_center|LOCUS_08560 9016 9681 gene locus_tag LOCUS_08570 9016 9681 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085887.1 protein_id gnl|my_center|LOCUS_08570 9964 11532 gene locus_tag LOCUS_08580 9964 11532 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921435.1 protein_id gnl|my_center|LOCUS_08580 11778 11951 gene locus_tag LOCUS_08590 11778 11951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 12361 13107 gene locus_tag LOCUS_08600 12361 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 14100 13171 gene locus_tag LOCUS_08610 14100 13171 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_08610 14742 15452 gene locus_tag LOCUS_08620 14742 15452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 15445 16713 gene locus_tag LOCUS_08630 15445 16713 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235776816.1 protein_id gnl|my_center|LOCUS_08630 16764 17939 gene locus_tag LOCUS_08640 16764 17939 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971283.1 protein_id gnl|my_center|LOCUS_08640 17982 18194 gene locus_tag LOCUS_08650 17982 18194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 18194 18382 gene locus_tag LOCUS_08660 18194 18382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 18486 18722 gene locus_tag LOCUS_08670 18486 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08670 18747 19139 gene locus_tag LOCUS_08680 18747 19139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08680 19416 19129 gene locus_tag LOCUS_08690 19416 19129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 19549 20802 gene locus_tag LOCUS_08700 19549 20802 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 protein_id gnl|my_center|LOCUS_08700 21125 21775 gene locus_tag LOCUS_08710 21125 21775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 21964 22149 gene locus_tag LOCUS_08720 21964 22149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 22861 22151 gene locus_tag LOCUS_08730 22861 22151 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965209.1 protein_id gnl|my_center|LOCUS_08730 22972 23535 gene locus_tag LOCUS_08740 22972 23535 CDS product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 protein_id gnl|my_center|LOCUS_08740 23568 23978 gene locus_tag LOCUS_08750 23568 23978 CDS product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971288.1 protein_id gnl|my_center|LOCUS_08750 23998 24405 gene locus_tag LOCUS_08760 23998 24405 CDS product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920622.1 protein_id gnl|my_center|LOCUS_08760 24421 24741 gene locus_tag LOCUS_08770 24421 24741 CDS product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719629.1 protein_id gnl|my_center|LOCUS_08770 24738 24950 gene locus_tag LOCUS_08780 24738 24950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 25045 25527 gene locus_tag LOCUS_08790 25045 25527 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383956.1 protein_id gnl|my_center|LOCUS_08790 25531 26172 gene locus_tag LOCUS_08800 25531 26172 CDS product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 protein_id gnl|my_center|LOCUS_08800 26326 27219 gene locus_tag LOCUS_08810 26326 27219 CDS product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 protein_id gnl|my_center|LOCUS_08810 27231 27677 gene locus_tag LOCUS_08820 27231 27677 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971294.1 protein_id gnl|my_center|LOCUS_08820 27677 31525 gene locus_tag LOCUS_08830 27677 31525 CDS product glycoside hydrolase TIM-barrel-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971295.1 protein_id gnl|my_center|LOCUS_08830 31532 32080 gene locus_tag LOCUS_08840 31532 32080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08840 32001 33458 gene locus_tag LOCUS_08850 32001 33458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 33639 34304 gene locus_tag LOCUS_08860 33639 34304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08860 34319 34618 gene locus_tag LOCUS_08870 34319 34618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 34676 34915 gene locus_tag LOCUS_08880 34676 34915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 34936 35328 gene locus_tag LOCUS_08890 34936 35328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 35332 35583 gene locus_tag LOCUS_08900 35332 35583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 35711 36382 gene locus_tag LOCUS_08910 35711 36382 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 protein_id gnl|my_center|LOCUS_08910 36372 37769 gene locus_tag LOCUS_08920 36372 37769 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_08920 37943 38473 gene locus_tag LOCUS_08930 37943 38473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974834.1 protein_id gnl|my_center|LOCUS_08930 38730 40121 gene locus_tag LOCUS_08940 38730 40121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965713.1 protein_id gnl|my_center|LOCUS_08940 40290 41387 gene locus_tag LOCUS_08950 gene ccmI 40290 41387 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085909.1 protein_id gnl|my_center|LOCUS_08950 41419 41907 gene locus_tag LOCUS_08960 gene ccmE 41419 41907 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085910.1 protein_id gnl|my_center|LOCUS_08960 41904 43886 gene locus_tag LOCUS_08970 41904 43886 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085911.1 protein_id gnl|my_center|LOCUS_08970 43984 44457 gene locus_tag LOCUS_08980 43984 44457 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085912.1 protein_id gnl|my_center|LOCUS_08980 44736 46286 gene locus_tag LOCUS_08990 44736 46286 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085914.1 protein_id gnl|my_center|LOCUS_08990 46612 47325 gene locus_tag LOCUS_09000 46612 47325 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965709.1 protein_id gnl|my_center|LOCUS_09000 47520 49004 gene locus_tag LOCUS_09010 47520 49004 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_09010 49001 51964 gene locus_tag LOCUS_09020 49001 51964 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085917.1 protein_id gnl|my_center|LOCUS_09020 54279 51913 gene locus_tag LOCUS_09030 54279 51913 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085924.1 protein_id gnl|my_center|LOCUS_09030 55803 54487 gene locus_tag LOCUS_09040 55803 54487 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085925.1 protein_id gnl|my_center|LOCUS_09040 56466 56110 gene locus_tag LOCUS_09050 56466 56110 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966059.1 protein_id gnl|my_center|LOCUS_09050 56751 57050 gene locus_tag LOCUS_09060 56751 57050 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008139488.1 protein_id gnl|my_center|LOCUS_09060 59725 57230 gene locus_tag LOCUS_09070 59725 57230 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967714.1 protein_id gnl|my_center|LOCUS_09070 61810 60047 gene locus_tag LOCUS_09080 gene treZ 61810 60047 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089509.1 protein_id gnl|my_center|LOCUS_09080 63885 61807 gene locus_tag LOCUS_09090 gene glgX 63885 61807 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089508.1 protein_id gnl|my_center|LOCUS_09090 66032 63882 gene locus_tag LOCUS_09100 gene glgB 66032 63882 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089507.1 protein_id gnl|my_center|LOCUS_09100 69313 66029 gene locus_tag LOCUS_09110 gene treS 69313 66029 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089506.1 protein_id gnl|my_center|LOCUS_09110 71058 69322 gene locus_tag LOCUS_09120 71058 69322 CDS product DUF3416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089505.1 protein_id gnl|my_center|LOCUS_09120 71447 73390 gene locus_tag LOCUS_09130 gene malQ 71447 73390 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089504.1 protein_id gnl|my_center|LOCUS_09130 73915 73403 gene locus_tag LOCUS_09140 73915 73403 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086517.1 protein_id gnl|my_center|LOCUS_09140 75572 73962 gene locus_tag LOCUS_09150 75572 73962 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966223.1 protein_id gnl|my_center|LOCUS_09150 76622 75753 gene locus_tag LOCUS_09160 76622 75753 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086521.1 protein_id gnl|my_center|LOCUS_09160 76851 77240 gene locus_tag LOCUS_09170 76851 77240 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 protein_id gnl|my_center|LOCUS_09170 77397 78536 gene locus_tag LOCUS_09180 77397 78536 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170828.1 protein_id gnl|my_center|LOCUS_09180 78726 79814 gene locus_tag LOCUS_09190 78726 79814 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 protein_id gnl|my_center|LOCUS_09190 81457 79847 gene locus_tag LOCUS_09200 81457 79847 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086531.1 protein_id gnl|my_center|LOCUS_09200 81993 81454 gene locus_tag LOCUS_09210 81993 81454 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086532.1 protein_id gnl|my_center|LOCUS_09210 83415 82384 gene locus_tag LOCUS_09220 gene moaA 83415 82384 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086533.1 protein_id gnl|my_center|LOCUS_09220 84354 83677 gene locus_tag LOCUS_09230 84354 83677 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086535.1 protein_id gnl|my_center|LOCUS_09230 84715 85413 gene locus_tag LOCUS_09240 gene rpiA 84715 85413 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086536.1 protein_id gnl|my_center|LOCUS_09240 85436 85945 gene locus_tag LOCUS_09250 85436 85945 CDS product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086537.1 protein_id gnl|my_center|LOCUS_09250 85964 87346 gene locus_tag LOCUS_09260 gene gor 85964 87346 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086538.1 protein_id gnl|my_center|LOCUS_09260 87739 89127 gene locus_tag LOCUS_09270 87739 89127 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086559.1 protein_id gnl|my_center|LOCUS_09270 89280 91031 gene locus_tag LOCUS_09280 89280 91031 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086561.1 protein_id gnl|my_center|LOCUS_09280 92178 91084 gene locus_tag LOCUS_09290 92178 91084 CDS product DUF2865 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086569.1 protein_id gnl|my_center|LOCUS_09290 93195 92929 gene locus_tag LOCUS_09300 93195 92929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 93082 94515 gene locus_tag LOCUS_09310 gene cysS 93082 94515 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532561.1 protein_id gnl|my_center|LOCUS_09310 94604 95143 gene locus_tag LOCUS_09320 94604 95143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 95148 95648 gene locus_tag LOCUS_09330 95148 95648 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966251.1 protein_id gnl|my_center|LOCUS_09330 95645 97243 gene locus_tag LOCUS_09340 gene cimA 95645 97243 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086573.1 protein_id gnl|my_center|LOCUS_09340 97997 97395 gene locus_tag LOCUS_09350 97997 97395 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170865.1 protein_id gnl|my_center|LOCUS_09350 98164 100164 gene locus_tag LOCUS_09360 98164 100164 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086576.1 protein_id gnl|my_center|LOCUS_09360 100408 101031 gene locus_tag LOCUS_09370 100408 101031 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086577.1 protein_id gnl|my_center|LOCUS_09370 101068 102015 gene locus_tag LOCUS_09380 101068 102015 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086578.1 protein_id gnl|my_center|LOCUS_09380 102448 103221 gene locus_tag LOCUS_09390 102448 103221 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086581.1 protein_id gnl|my_center|LOCUS_09390 103340 104170 gene locus_tag LOCUS_09400 103340 104170 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086582.1 protein_id gnl|my_center|LOCUS_09400 104316 106220 gene locus_tag LOCUS_09410 104316 106220 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921615.1 protein_id gnl|my_center|LOCUS_09410 106337 106672 gene locus_tag LOCUS_09420 106337 106672 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210342306.1 protein_id gnl|my_center|LOCUS_09420 106688 107842 gene locus_tag LOCUS_09430 106688 107842 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086586.1 protein_id gnl|my_center|LOCUS_09430 107856 108965 gene locus_tag LOCUS_09440 107856 108965 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086587.1 protein_id gnl|my_center|LOCUS_09440 110126 109194 gene locus_tag LOCUS_09450 110126 109194 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086588.1 protein_id gnl|my_center|LOCUS_09450 111489 110209 gene locus_tag LOCUS_09460 111489 110209 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086589.1 protein_id gnl|my_center|LOCUS_09460 112727 111522 gene locus_tag LOCUS_09470 112727 111522 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086590.1 protein_id gnl|my_center|LOCUS_09470 113193 112720 gene locus_tag LOCUS_09480 113193 112720 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086591.1 protein_id gnl|my_center|LOCUS_09480 113485 113204 gene locus_tag LOCUS_09490 113485 113204 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007592476.1 protein_id gnl|my_center|LOCUS_09490 113986 113672 gene locus_tag LOCUS_09500 113986 113672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 115896 114223 gene locus_tag LOCUS_09510 115896 114223 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966261.1 protein_id gnl|my_center|LOCUS_09510 116401 116328 gene locus_tag LOCUS_t00130 116401 116328 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 117728 116565 gene locus_tag LOCUS_09520 117728 116565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 120980 117849 gene locus_tag LOCUS_09530 120980 117849 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086679.1 protein_id gnl|my_center|LOCUS_09530 122130 120982 gene locus_tag LOCUS_09540 122130 120982 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966871.1 protein_id gnl|my_center|LOCUS_09540 122590 122159 gene locus_tag LOCUS_09550 122590 122159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 122621 123628 gene locus_tag LOCUS_09560 122621 123628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 123633 124103 gene locus_tag LOCUS_09570 gene exbD 123633 124103 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086684.1 protein_id gnl|my_center|LOCUS_09570 124107 124901 gene locus_tag LOCUS_09580 124107 124901 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086685.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence08 304 837 gene locus_tag LOCUS_09590 304 837 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967749.1 protein_id gnl|my_center|LOCUS_09590 977 1405 gene locus_tag LOCUS_09600 977 1405 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088599.1 protein_id gnl|my_center|LOCUS_09600 2023 1433 gene locus_tag LOCUS_09610 2023 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088603.1 protein_id gnl|my_center|LOCUS_09610 2127 2561 gene locus_tag LOCUS_09620 2127 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088604.1 protein_id gnl|my_center|LOCUS_09620 3220 4347 gene locus_tag LOCUS_09630 3220 4347 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088608.1 protein_id gnl|my_center|LOCUS_09630 4555 6594 gene locus_tag LOCUS_09640 4555 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088609.1 protein_id gnl|my_center|LOCUS_09640 7033 7815 gene locus_tag LOCUS_09650 7033 7815 CDS product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945868.1 protein_id gnl|my_center|LOCUS_09650 7998 8321 gene locus_tag LOCUS_09660 7998 8321 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141200.1 protein_id gnl|my_center|LOCUS_09660 8456 8845 gene locus_tag LOCUS_09670 8456 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 10219 9191 gene locus_tag LOCUS_09680 10219 9191 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088624.1 protein_id gnl|my_center|LOCUS_09680 10752 10432 gene locus_tag LOCUS_09690 10752 10432 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088626.1 protein_id gnl|my_center|LOCUS_09690 11254 10877 gene locus_tag LOCUS_09700 11254 10877 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088627.1 protein_id gnl|my_center|LOCUS_09700 11630 17038 gene locus_tag LOCUS_09710 11630 17038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088628.1 protein_id gnl|my_center|LOCUS_09710 17661 17176 gene locus_tag LOCUS_09720 17661 17176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 17677 18414 gene locus_tag LOCUS_09730 17677 18414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 18557 19711 gene locus_tag LOCUS_09740 18557 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967048.1 protein_id gnl|my_center|LOCUS_09740 20791 19742 gene locus_tag LOCUS_09750 20791 19742 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088644.1 protein_id gnl|my_center|LOCUS_09750 21601 20792 gene locus_tag LOCUS_09760 21601 20792 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088645.1 protein_id gnl|my_center|LOCUS_09760 22474 21665 gene locus_tag LOCUS_09770 gene thiD 22474 21665 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_09770 22738 22983 gene locus_tag LOCUS_09780 22738 22983 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014493934.1 protein_id gnl|my_center|LOCUS_09780 23059 23484 gene locus_tag LOCUS_09790 23059 23484 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 protein_id gnl|my_center|LOCUS_09790 25984 23678 gene locus_tag LOCUS_09800 25984 23678 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088655.1 protein_id gnl|my_center|LOCUS_09800 27594 26068 gene locus_tag LOCUS_09810 gene murJ 27594 26068 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088657.1 protein_id gnl|my_center|LOCUS_09810 28786 27638 gene locus_tag LOCUS_09820 28786 27638 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967037.1 protein_id gnl|my_center|LOCUS_09820 29840 28803 gene locus_tag LOCUS_09830 29840 28803 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088659.1 protein_id gnl|my_center|LOCUS_09830 31476 30064 gene locus_tag LOCUS_09840 31476 30064 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173221.1 protein_id gnl|my_center|LOCUS_09840 32642 31623 gene locus_tag LOCUS_09850 32642 31623 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088661.1 protein_id gnl|my_center|LOCUS_09850 32879 33790 gene locus_tag LOCUS_09860 32879 33790 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088662.1 protein_id gnl|my_center|LOCUS_09860 35683 33800 gene locus_tag LOCUS_09870 35683 33800 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967035.1 protein_id gnl|my_center|LOCUS_09870 37257 35788 gene locus_tag LOCUS_09880 gene rfaE1 37257 35788 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088668.1 protein_id gnl|my_center|LOCUS_09880 38522 37542 gene locus_tag LOCUS_09890 gene rfaD 38522 37542 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088669.1 protein_id gnl|my_center|LOCUS_09890 38916 39926 gene locus_tag LOCUS_09900 gene waaF 38916 39926 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088670.1 protein_id gnl|my_center|LOCUS_09900 39997 40590 gene locus_tag LOCUS_09910 gene gmhA 39997 40590 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194315.1 protein_id gnl|my_center|LOCUS_09910 40587 41141 gene locus_tag LOCUS_09920 40587 41141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 42082 41138 gene locus_tag LOCUS_09930 gene waaC 42082 41138 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530067.1 protein_id gnl|my_center|LOCUS_09930 42269 43279 gene locus_tag LOCUS_09940 gene galE 42269 43279 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173210.1 protein_id gnl|my_center|LOCUS_09940 43401 45209 gene locus_tag LOCUS_09950 43401 45209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088673.1 protein_id gnl|my_center|LOCUS_09950 45279 45983 gene locus_tag LOCUS_09960 45279 45983 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088674.1 protein_id gnl|my_center|LOCUS_09960 48131 46014 gene locus_tag LOCUS_09970 gene ligA 48131 46014 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966438.1 protein_id gnl|my_center|LOCUS_09970 49808 48138 gene locus_tag LOCUS_09980 gene recN 49808 48138 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089333.1 protein_id gnl|my_center|LOCUS_09980 50882 50010 gene locus_tag LOCUS_09990 50882 50010 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089334.1 protein_id gnl|my_center|LOCUS_09990 52187 51207 gene locus_tag LOCUS_10000 gene lpxC 52187 51207 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089335.1 protein_id gnl|my_center|LOCUS_10000 54319 52505 gene locus_tag LOCUS_10010 gene ftsZ 54319 52505 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089336.1 protein_id gnl|my_center|LOCUS_10010 55732 54410 gene locus_tag LOCUS_10020 gene ftsA 55732 54410 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089337.1 protein_id gnl|my_center|LOCUS_10020 56691 55729 gene locus_tag LOCUS_10030 56691 55729 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089338.1 protein_id gnl|my_center|LOCUS_10030 58105 57116 gene locus_tag LOCUS_10040 58105 57116 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966437.1 protein_id gnl|my_center|LOCUS_10040 59160 58207 gene locus_tag LOCUS_10050 gene murB 59160 58207 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089340.1 protein_id gnl|my_center|LOCUS_10050 60727 59324 gene locus_tag LOCUS_10060 gene murC 60727 59324 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089341.1 protein_id gnl|my_center|LOCUS_10060 61943 60837 gene locus_tag LOCUS_10070 gene murG 61943 60837 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089342.1 protein_id gnl|my_center|LOCUS_10070 63236 62085 gene locus_tag LOCUS_10080 63236 62085 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089343.1 protein_id gnl|my_center|LOCUS_10080 63644 64141 gene locus_tag LOCUS_10090 gene fpvI 63644 64141 CDS product pyoverdine signaling pathway sigma factor FpvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103620.1 protein_id gnl|my_center|LOCUS_10090 64248 65210 gene locus_tag LOCUS_10100 64248 65210 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969652.1 protein_id gnl|my_center|LOCUS_10100 65323 67830 gene locus_tag LOCUS_10110 65323 67830 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114936.1 protein_id gnl|my_center|LOCUS_10110 69355 67955 gene locus_tag LOCUS_10120 gene murD 69355 67955 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089344.1 protein_id gnl|my_center|LOCUS_10120 70472 69366 gene locus_tag LOCUS_10130 gene mraY 70472 69366 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089345.1 protein_id gnl|my_center|LOCUS_10130 71984 70554 gene locus_tag LOCUS_10140 71984 70554 CDS product UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530953.1 protein_id gnl|my_center|LOCUS_10140 73402 71981 gene locus_tag LOCUS_10150 73402 71981 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089347.1 protein_id gnl|my_center|LOCUS_10150 75204 73465 gene locus_tag LOCUS_10160 75204 73465 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089348.1 protein_id gnl|my_center|LOCUS_10160 75581 75201 gene locus_tag LOCUS_10170 75581 75201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089349.1 protein_id gnl|my_center|LOCUS_10170 76583 75585 gene locus_tag LOCUS_10180 gene rsmH 76583 75585 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966431.1 protein_id gnl|my_center|LOCUS_10180 77173 77961 gene locus_tag LOCUS_10190 77173 77961 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089351.1 protein_id gnl|my_center|LOCUS_10190 79016 78321 gene locus_tag LOCUS_10200 79016 78321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 79274 79516 gene locus_tag LOCUS_10210 79274 79516 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974103.1 protein_id gnl|my_center|LOCUS_10210 80016 79816 gene locus_tag LOCUS_10220 80016 79816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 80517 80798 gene locus_tag LOCUS_10230 80517 80798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 81140 80961 gene locus_tag LOCUS_10240 81140 80961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 81396 81809 gene locus_tag LOCUS_10250 81396 81809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 82339 82046 gene locus_tag LOCUS_10260 82339 82046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 82729 82409 gene locus_tag LOCUS_10270 82729 82409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 83182 83361 gene locus_tag LOCUS_10280 83182 83361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 83684 83481 gene locus_tag LOCUS_10290 83684 83481 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974103.1 protein_id gnl|my_center|LOCUS_10290 83811 84242 gene locus_tag LOCUS_10300 83811 84242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 84689 84537 gene locus_tag LOCUS_10310 84689 84537 CDS product aa3-type cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136857.1 protein_id gnl|my_center|LOCUS_10310 84920 85108 gene locus_tag LOCUS_10320 84920 85108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 85222 85467 gene locus_tag LOCUS_10330 85222 85467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 88894 86768 gene locus_tag LOCUS_10340 88894 86768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 89794 89165 gene locus_tag LOCUS_10350 89794 89165 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085204.1 protein_id gnl|my_center|LOCUS_10350 90197 92161 gene locus_tag LOCUS_10360 90197 92161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 93006 92689 gene locus_tag LOCUS_10370 93006 92689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 93752 93000 gene locus_tag LOCUS_10380 93752 93000 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296408.1 protein_id gnl|my_center|LOCUS_10380 94444 93749 gene locus_tag LOCUS_10390 94444 93749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10390 97279 94448 gene locus_tag LOCUS_10400 97279 94448 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054625.1 protein_id gnl|my_center|LOCUS_10400 98232 97393 gene locus_tag LOCUS_10410 98232 97393 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174472.1 protein_id gnl|my_center|LOCUS_10410 99202 98489 gene locus_tag LOCUS_10420 99202 98489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975248.1 protein_id gnl|my_center|LOCUS_10420 100434 99199 gene locus_tag LOCUS_10430 100434 99199 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975247.1 protein_id gnl|my_center|LOCUS_10430 101510 100431 gene locus_tag LOCUS_10440 101510 100431 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975246.1 protein_id gnl|my_center|LOCUS_10440 101746 101540 gene locus_tag LOCUS_10450 101746 101540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 102498 101803 gene locus_tag LOCUS_10460 102498 101803 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174758.1 protein_id gnl|my_center|LOCUS_10460 103653 102832 gene locus_tag LOCUS_10470 103653 102832 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087414.1 protein_id gnl|my_center|LOCUS_10470 104157 103702 gene locus_tag LOCUS_10480 104157 103702 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087415.1 protein_id gnl|my_center|LOCUS_10480 106244 104208 gene locus_tag LOCUS_10490 106244 104208 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087420.1 protein_id gnl|my_center|LOCUS_10490 106765 107616 gene locus_tag LOCUS_10500 106765 107616 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200942.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10500 108877 108404 gene locus_tag LOCUS_10510 108877 108404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086947.1 protein_id gnl|my_center|LOCUS_10510 110159 109050 gene locus_tag LOCUS_10520 110159 109050 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088804.1 protein_id gnl|my_center|LOCUS_10520 110942 110163 gene locus_tag LOCUS_10530 110942 110163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966693.1 protein_id gnl|my_center|LOCUS_10530 112075 110945 gene locus_tag LOCUS_10540 112075 110945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088806.1 protein_id gnl|my_center|LOCUS_10540 112245 112646 gene locus_tag LOCUS_10550 112245 112646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 115376 112683 gene locus_tag LOCUS_10560 115376 112683 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088809.1 protein_id gnl|my_center|LOCUS_10560 115992 115549 gene locus_tag LOCUS_10570 115992 115549 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085547.1 protein_id gnl|my_center|LOCUS_10570 116550 116077 gene locus_tag LOCUS_10580 116550 116077 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_10580 117080 116739 gene locus_tag LOCUS_10590 117080 116739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 117186 117698 gene locus_tag LOCUS_10600 117186 117698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 119722 118895 gene locus_tag LOCUS_10610 119722 118895 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085546.1 protein_id gnl|my_center|LOCUS_10610 119979 120707 gene locus_tag LOCUS_10620 119979 120707 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088815.1 protein_id gnl|my_center|LOCUS_10620 121147 120998 gene locus_tag LOCUS_10630 121147 120998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 121890 121429 gene locus_tag LOCUS_10640 121890 121429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 121774 122940 gene locus_tag LOCUS_10650 121774 122940 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085545.1 protein_id gnl|my_center|LOCUS_10650 122930 123547 gene locus_tag LOCUS_10660 gene fixJ 122930 123547 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085544.1 protein_id gnl|my_center|LOCUS_10660 123745 124008 gene locus_tag LOCUS_10670 123745 124008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence09 513 91 gene locus_tag LOCUS_10680 513 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 922 704 gene locus_tag LOCUS_10690 922 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1469 1227 gene locus_tag LOCUS_10700 1469 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1512 1745 gene locus_tag LOCUS_10710 1512 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1742 1951 gene locus_tag LOCUS_10720 1742 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2019 2351 gene locus_tag LOCUS_10730 2019 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2348 2818 gene locus_tag LOCUS_10740 2348 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 3070 3357 gene locus_tag LOCUS_10750 3070 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 4083 3481 gene locus_tag LOCUS_10760 4083 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 4523 4434 gene locus_tag LOCUS_t00140 4523 4434 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4954 5271 gene locus_tag LOCUS_10770 4954 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 5568 6356 gene locus_tag LOCUS_10780 5568 6356 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000380.1 protein_id gnl|my_center|LOCUS_10780 6536 7720 gene locus_tag LOCUS_10790 6536 7720 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967564.1 protein_id gnl|my_center|LOCUS_10790 7720 8412 gene locus_tag LOCUS_10800 gene tmk 7720 8412 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087289.1 protein_id gnl|my_center|LOCUS_10800 8409 9449 gene locus_tag LOCUS_10810 8409 9449 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087288.1 protein_id gnl|my_center|LOCUS_10810 9505 11553 gene locus_tag LOCUS_10820 gene metG 9505 11553 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097532087.1 protein_id gnl|my_center|LOCUS_10820 11568 12359 gene locus_tag LOCUS_10830 11568 12359 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087286.1 protein_id gnl|my_center|LOCUS_10830 12356 13159 gene locus_tag LOCUS_10840 12356 13159 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087285.1 protein_id gnl|my_center|LOCUS_10840 13220 13543 gene locus_tag LOCUS_10850 13220 13543 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254519.1 protein_id gnl|my_center|LOCUS_10850 14849 15190 gene locus_tag LOCUS_10860 14849 15190 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807759.1 protein_id gnl|my_center|LOCUS_10860 18504 15322 gene locus_tag LOCUS_10870 18504 15322 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087702.1 protein_id gnl|my_center|LOCUS_10870 19486 18494 gene locus_tag LOCUS_10880 19486 18494 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087701.1 protein_id gnl|my_center|LOCUS_10880 20754 19483 gene locus_tag LOCUS_10890 20754 19483 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087700.1 protein_id gnl|my_center|LOCUS_10890 22084 21332 gene locus_tag LOCUS_10900 gene queC 22084 21332 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174058.1 protein_id gnl|my_center|LOCUS_10900 22286 23134 gene locus_tag LOCUS_10910 gene mazG 22286 23134 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087265.1 protein_id gnl|my_center|LOCUS_10910 24648 23212 gene locus_tag LOCUS_10920 24648 23212 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_10920 26243 24870 gene locus_tag LOCUS_10930 gene hflX 26243 24870 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967571.1 protein_id gnl|my_center|LOCUS_10930 26515 26267 gene locus_tag LOCUS_10940 gene hfq 26515 26267 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007591126.1 protein_id gnl|my_center|LOCUS_10940 27553 26696 gene locus_tag LOCUS_10950 27553 26696 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531497.1 protein_id gnl|my_center|LOCUS_10950 28946 27576 gene locus_tag LOCUS_10960 28946 27576 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087262.1 protein_id gnl|my_center|LOCUS_10960 31264 28964 gene locus_tag LOCUS_10970 31264 28964 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967572.1 protein_id gnl|my_center|LOCUS_10970 32865 31426 gene locus_tag LOCUS_10980 gene ntrC 32865 31426 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087260.1 protein_id gnl|my_center|LOCUS_10980 34042 32873 gene locus_tag LOCUS_10990 34042 32873 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_10990 34809 34039 gene locus_tag LOCUS_11000 gene dusB 34809 34039 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161537076.1 protein_id gnl|my_center|LOCUS_11000 35307 36503 gene locus_tag LOCUS_11010 35307 36503 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_11010 36505 37131 gene locus_tag LOCUS_11020 36505 37131 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087256.1 protein_id gnl|my_center|LOCUS_11020 37712 37245 gene locus_tag LOCUS_11030 37712 37245 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087250.1 protein_id gnl|my_center|LOCUS_11030 38116 37712 gene locus_tag LOCUS_11040 38116 37712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 39210 38251 gene locus_tag LOCUS_11050 gene lipA 39210 38251 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087249.1 protein_id gnl|my_center|LOCUS_11050 39334 39960 gene locus_tag LOCUS_11060 39334 39960 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087248.1 protein_id gnl|my_center|LOCUS_11060 41107 39941 gene locus_tag LOCUS_11070 41107 39941 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_11070 43920 41104 gene locus_tag LOCUS_11080 43920 41104 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087247.1 protein_id gnl|my_center|LOCUS_11080 45148 44489 gene locus_tag LOCUS_11090 45148 44489 CDS product DUF2497 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967575.1 protein_id gnl|my_center|LOCUS_11090 46833 45415 gene locus_tag LOCUS_11100 46833 45415 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087245.1 protein_id gnl|my_center|LOCUS_11100 47321 47488 gene locus_tag LOCUS_11110 gene rpmG 47321 47488 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603295.1 protein_id gnl|my_center|LOCUS_11110 48121 47789 gene locus_tag LOCUS_11120 48121 47789 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 protein_id gnl|my_center|LOCUS_11120 48445 48242 gene locus_tag LOCUS_11130 48445 48242 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008141931.1 protein_id gnl|my_center|LOCUS_11130 49119 48628 gene locus_tag LOCUS_11140 49119 48628 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087466.1 protein_id gnl|my_center|LOCUS_11140 49508 50281 gene locus_tag LOCUS_11150 49508 50281 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087467.1 protein_id gnl|my_center|LOCUS_11150 50570 53668 gene locus_tag LOCUS_11160 gene uvrA 50570 53668 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087470.1 protein_id gnl|my_center|LOCUS_11160 53888 54418 gene locus_tag LOCUS_11170 53888 54418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 55274 59020 gene locus_tag LOCUS_11180 55274 59020 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087047.1 protein_id gnl|my_center|LOCUS_11180 59028 59300 gene locus_tag LOCUS_11190 59028 59300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 59281 59529 gene locus_tag LOCUS_11200 59281 59529 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517660.1 protein_id gnl|my_center|LOCUS_11200 59767 59612 gene locus_tag LOCUS_11210 59767 59612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 60503 59817 gene locus_tag LOCUS_11220 60503 59817 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_11220 60797 61669 gene locus_tag LOCUS_11230 gene yghU 60797 61669 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_11230 61716 62396 gene locus_tag LOCUS_11240 61716 62396 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_11240 62689 63231 gene locus_tag LOCUS_11250 gene fabA 62689 63231 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083591.1 protein_id gnl|my_center|LOCUS_11250 63268 63945 gene locus_tag LOCUS_11260 63268 63945 CDS product DUF2161 family putative PD-(D/E)XK-type phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086936.1 protein_id gnl|my_center|LOCUS_11260 64200 64499 gene locus_tag LOCUS_11270 64200 64499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 65695 65135 gene locus_tag LOCUS_11280 65695 65135 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086924.1 protein_id gnl|my_center|LOCUS_11280 65994 67340 gene locus_tag LOCUS_11290 65994 67340 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921455.1 protein_id gnl|my_center|LOCUS_11290 67500 68438 gene locus_tag LOCUS_11300 67500 68438 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086921.1 protein_id gnl|my_center|LOCUS_11300 68462 69016 gene locus_tag LOCUS_11310 68462 69016 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966788.1 protein_id gnl|my_center|LOCUS_11310 69149 70000 gene locus_tag LOCUS_11320 gene panC 69149 70000 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087920.1 protein_id gnl|my_center|LOCUS_11320 70582 70145 gene locus_tag LOCUS_11330 70582 70145 CDS product DUF1489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087921.1 protein_id gnl|my_center|LOCUS_11330 71503 70604 gene locus_tag LOCUS_11340 71503 70604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087922.1 protein_id gnl|my_center|LOCUS_11340 71864 71661 gene locus_tag LOCUS_11350 71864 71661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087923.1 protein_id gnl|my_center|LOCUS_11350 72780 72124 gene locus_tag LOCUS_11360 72780 72124 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966379.1 protein_id gnl|my_center|LOCUS_11360 73558 72851 gene locus_tag LOCUS_11370 73558 72851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 73673 73942 gene locus_tag LOCUS_11380 73673 73942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 74791 73955 gene locus_tag LOCUS_11390 74791 73955 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535747.1 protein_id gnl|my_center|LOCUS_11390 75344 75027 gene locus_tag LOCUS_11400 75344 75027 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088006.1 protein_id gnl|my_center|LOCUS_11400 76020 75637 gene locus_tag LOCUS_11410 76020 75637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 76051 76914 gene locus_tag LOCUS_11420 76051 76914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 77427 77194 gene locus_tag LOCUS_11430 77427 77194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 77669 80401 gene locus_tag LOCUS_11440 gene topA 77669 80401 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966363.1 protein_id gnl|my_center|LOCUS_11440 80403 82751 gene locus_tag LOCUS_11450 gene rnr 80403 82751 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087872.1 protein_id gnl|my_center|LOCUS_11450 82748 83188 gene locus_tag LOCUS_11460 82748 83188 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087873.1 protein_id gnl|my_center|LOCUS_11460 84157 83189 gene locus_tag LOCUS_11470 gene prfB 84157 83189 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097531964.1 protein_id gnl|my_center|LOCUS_11470 87129 84640 gene locus_tag LOCUS_11480 87129 84640 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087080.1 protein_id gnl|my_center|LOCUS_11480 88605 87328 gene locus_tag LOCUS_11490 88605 87328 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_11490 89304 92450 gene locus_tag LOCUS_11500 89304 92450 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087078.1 protein_id gnl|my_center|LOCUS_11500 93700 92732 gene locus_tag LOCUS_11510 gene thiL 93700 92732 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087788.1 protein_id gnl|my_center|LOCUS_11510 94335 93853 gene locus_tag LOCUS_11520 gene nusB 94335 93853 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087789.1 protein_id gnl|my_center|LOCUS_11520 94835 94344 gene locus_tag LOCUS_11530 gene ribH 94835 94344 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087790.1 protein_id gnl|my_center|LOCUS_11530 95534 94905 gene locus_tag LOCUS_11540 95534 94905 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087791.1 protein_id gnl|my_center|LOCUS_11540 96789 95638 gene locus_tag LOCUS_11550 gene ribD 96789 95638 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087792.1 protein_id gnl|my_center|LOCUS_11550 97268 96786 gene locus_tag LOCUS_11560 gene nrdR 97268 96786 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087793.1 protein_id gnl|my_center|LOCUS_11560 98733 97429 gene locus_tag LOCUS_11570 98733 97429 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087794.1 protein_id gnl|my_center|LOCUS_11570 99105 98914 gene locus_tag LOCUS_11580 99105 98914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 99488 99258 gene locus_tag LOCUS_11590 99488 99258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 99406 99603 gene locus_tag LOCUS_11600 99406 99603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 99658 100656 gene locus_tag LOCUS_11610 99658 100656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 100805 100721 gene locus_tag LOCUS_t00150 100805 100721 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101101 100934 gene locus_tag LOCUS_11620 101101 100934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 101241 101936 gene locus_tag LOCUS_11630 gene lipB 101241 101936 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088013.1 protein_id gnl|my_center|LOCUS_11630 102778 102005 gene locus_tag LOCUS_11640 102778 102005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 103871 102888 gene locus_tag LOCUS_11650 103871 102888 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969652.1 protein_id gnl|my_center|LOCUS_11650 104366 103968 gene locus_tag LOCUS_11660 104366 103968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence10 468 1226 gene locus_tag LOCUS_11670 468 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085279.1 protein_id gnl|my_center|LOCUS_11670 1311 2078 gene locus_tag LOCUS_11680 1311 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967970.1 protein_id gnl|my_center|LOCUS_11680 2658 2119 gene locus_tag LOCUS_11690 2658 2119 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085277.1 protein_id gnl|my_center|LOCUS_11690 4958 2772 gene locus_tag LOCUS_11700 4958 2772 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085276.1 protein_id gnl|my_center|LOCUS_11700 5334 5831 gene locus_tag LOCUS_11710 gene ybcL 5334 5831 CDS product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306955.1 protein_id gnl|my_center|LOCUS_11710 8026 5963 gene locus_tag LOCUS_11720 8026 5963 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085273.1 protein_id gnl|my_center|LOCUS_11720 8557 8078 gene locus_tag LOCUS_11730 gene petA 8557 8078 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085272.1 protein_id gnl|my_center|LOCUS_11730 8804 9274 gene locus_tag LOCUS_11740 8804 9274 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085271.1 protein_id gnl|my_center|LOCUS_11740 9271 9903 gene locus_tag LOCUS_11750 gene queE 9271 9903 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085270.1 protein_id gnl|my_center|LOCUS_11750 10103 9912 gene locus_tag LOCUS_11760 10103 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 10027 10392 gene locus_tag LOCUS_11770 10027 10392 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085269.1 protein_id gnl|my_center|LOCUS_11770 10540 11427 gene locus_tag LOCUS_11780 gene hemF 10540 11427 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175030.1 protein_id gnl|my_center|LOCUS_11780 12703 11447 gene locus_tag LOCUS_11790 12703 11447 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085256.1 protein_id gnl|my_center|LOCUS_11790 12963 12700 gene locus_tag LOCUS_11800 12963 12700 CDS product DUF6111 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085255.1 protein_id gnl|my_center|LOCUS_11800 13637 12960 gene locus_tag LOCUS_11810 13637 12960 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967402.1 protein_id gnl|my_center|LOCUS_11810 14239 13634 gene locus_tag LOCUS_11820 14239 13634 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175034.1 protein_id gnl|my_center|LOCUS_11820 14474 15484 gene locus_tag LOCUS_11830 14474 15484 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085252.1 protein_id gnl|my_center|LOCUS_11830 15484 16425 gene locus_tag LOCUS_11840 15484 16425 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085251.1 protein_id gnl|my_center|LOCUS_11840 16425 19238 gene locus_tag LOCUS_11850 16425 19238 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085250.1 protein_id gnl|my_center|LOCUS_11850 19248 21311 gene locus_tag LOCUS_11860 19248 21311 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085249.1 protein_id gnl|my_center|LOCUS_11860 21466 21915 gene locus_tag LOCUS_11870 21466 21915 CDS product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967401.1 protein_id gnl|my_center|LOCUS_11870 22044 24416 gene locus_tag LOCUS_11880 22044 24416 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085247.1 protein_id gnl|my_center|LOCUS_11880 25061 24474 gene locus_tag LOCUS_11890 25061 24474 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085246.1 protein_id gnl|my_center|LOCUS_11890 25584 25075 gene locus_tag LOCUS_11900 25584 25075 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085245.1 protein_id gnl|my_center|LOCUS_11900 25796 26701 gene locus_tag LOCUS_11910 25796 26701 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_11910 27110 26757 gene locus_tag LOCUS_11920 27110 26757 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719341.1 protein_id gnl|my_center|LOCUS_11920 27488 27231 gene locus_tag LOCUS_11930 27488 27231 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089470.1 protein_id gnl|my_center|LOCUS_11930 27961 27485 gene locus_tag LOCUS_11940 27961 27485 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089471.1 protein_id gnl|my_center|LOCUS_11940 28266 27997 gene locus_tag LOCUS_11950 28266 27997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174561.1 protein_id gnl|my_center|LOCUS_11950 28544 31396 gene locus_tag LOCUS_11960 28544 31396 CDS product bifunctional transaldolase/phosoglucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089497.1 protein_id gnl|my_center|LOCUS_11960 31679 32692 gene locus_tag LOCUS_11970 gene gnd 31679 32692 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089498.1 protein_id gnl|my_center|LOCUS_11970 32689 34206 gene locus_tag LOCUS_11980 gene zwf 32689 34206 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089499.1 protein_id gnl|my_center|LOCUS_11980 34203 34943 gene locus_tag LOCUS_11990 gene pgl 34203 34943 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174545.1 protein_id gnl|my_center|LOCUS_11990 34940 35473 gene locus_tag LOCUS_12000 34940 35473 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089501.1 protein_id gnl|my_center|LOCUS_12000 35613 35900 gene locus_tag LOCUS_12010 35613 35900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12010 37690 35897 gene locus_tag LOCUS_12020 37690 35897 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089503.1 protein_id gnl|my_center|LOCUS_12020 39708 38008 gene locus_tag LOCUS_12030 39708 38008 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965180.1 protein_id gnl|my_center|LOCUS_12030 39616 39885 gene locus_tag LOCUS_12040 39616 39885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 41254 40304 gene locus_tag LOCUS_12050 41254 40304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 41654 41298 gene locus_tag LOCUS_12060 41654 41298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 42331 41654 gene locus_tag LOCUS_12070 42331 41654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 43422 42355 gene locus_tag LOCUS_12080 43422 42355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 44312 43662 gene locus_tag LOCUS_12090 44312 43662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 45012 44584 gene locus_tag LOCUS_12100 45012 44584 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339224.1 protein_id gnl|my_center|LOCUS_12100 45457 48399 gene locus_tag LOCUS_12110 45457 48399 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972638.1 protein_id gnl|my_center|LOCUS_12110 48399 48737 gene locus_tag LOCUS_12120 48399 48737 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810969.1 protein_id gnl|my_center|LOCUS_12120 48740 50347 gene locus_tag LOCUS_12130 48740 50347 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054241.1 protein_id gnl|my_center|LOCUS_12130 50344 50832 gene locus_tag LOCUS_12140 50344 50832 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970946.1 protein_id gnl|my_center|LOCUS_12140 50829 51107 gene locus_tag LOCUS_12150 50829 51107 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383787.1 protein_id gnl|my_center|LOCUS_12150 51104 51472 gene locus_tag LOCUS_12160 gene mnhG 51104 51472 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394062.1 protein_id gnl|my_center|LOCUS_12160 51967 51749 gene locus_tag LOCUS_12170 51967 51749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 52918 52058 gene locus_tag LOCUS_12180 52918 52058 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329942.1 protein_id gnl|my_center|LOCUS_12180 53331 54080 gene locus_tag LOCUS_12190 53331 54080 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_12190 54282 54779 gene locus_tag LOCUS_12200 54282 54779 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525147.1 protein_id gnl|my_center|LOCUS_12200 54985 55131 gene locus_tag LOCUS_12210 54985 55131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 56353 55265 gene locus_tag LOCUS_12220 56353 55265 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083820.1 protein_id gnl|my_center|LOCUS_12220 58730 56343 gene locus_tag LOCUS_12230 58730 56343 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083821.1 protein_id gnl|my_center|LOCUS_12230 59455 58802 gene locus_tag LOCUS_12240 59455 58802 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083822.1 protein_id gnl|my_center|LOCUS_12240 60141 59650 gene locus_tag LOCUS_12250 60141 59650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 62028 60781 gene locus_tag LOCUS_12260 62028 60781 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_12260 64032 62032 gene locus_tag LOCUS_12270 64032 62032 CDS product LodA/GoxA family CTQ-dependent oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918443.1 protein_id gnl|my_center|LOCUS_12270 64431 64150 gene locus_tag LOCUS_12280 64431 64150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 66404 65226 gene locus_tag LOCUS_12290 66404 65226 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123927512.1 protein_id gnl|my_center|LOCUS_12290 67020 67379 gene locus_tag LOCUS_12300 67020 67379 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090378.1 protein_id gnl|my_center|LOCUS_12300 67425 67613 gene locus_tag LOCUS_12310 67425 67613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 67726 68778 gene locus_tag LOCUS_12320 67726 68778 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338084.1 protein_id gnl|my_center|LOCUS_12320 68775 69278 gene locus_tag LOCUS_12330 68775 69278 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338085.1 protein_id gnl|my_center|LOCUS_12330 69333 70289 gene locus_tag LOCUS_12340 69333 70289 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 protein_id gnl|my_center|LOCUS_12340 71013 70360 gene locus_tag LOCUS_12350 71013 70360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965342.1 protein_id gnl|my_center|LOCUS_12350 71394 71152 gene locus_tag LOCUS_12360 71394 71152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 71824 71636 gene locus_tag LOCUS_12370 71824 71636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 72593 71997 gene locus_tag LOCUS_12380 72593 71997 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 protein_id gnl|my_center|LOCUS_12380 72816 73877 gene locus_tag LOCUS_12390 72816 73877 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965336.1 protein_id gnl|my_center|LOCUS_12390 74019 75842 gene locus_tag LOCUS_12400 74019 75842 CDS product glucan ABC transporter ATP-binding protein/ permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084139.1 protein_id gnl|my_center|LOCUS_12400 76113 77516 gene locus_tag LOCUS_12410 76113 77516 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084138.1 protein_id gnl|my_center|LOCUS_12410 77649 79331 gene locus_tag LOCUS_12420 77649 79331 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084137.1 protein_id gnl|my_center|LOCUS_12420 79565 80050 gene locus_tag LOCUS_12430 79565 80050 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084135.1 protein_id gnl|my_center|LOCUS_12430 80249 80608 gene locus_tag LOCUS_12440 80249 80608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 82864 81233 gene locus_tag LOCUS_12450 82864 81233 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113374.1 protein_id gnl|my_center|LOCUS_12450 82871 83278 gene locus_tag LOCUS_12460 82871 83278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 84534 84079 gene locus_tag LOCUS_12470 gene rnhA 84534 84079 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_12470 85511 84531 gene locus_tag LOCUS_12480 85511 84531 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084133.1 protein_id gnl|my_center|LOCUS_12480 86656 85643 gene locus_tag LOCUS_12490 gene ispH 86656 85643 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084132.1 protein_id gnl|my_center|LOCUS_12490 86837 87538 gene locus_tag LOCUS_12500 86837 87538 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173595.1 protein_id gnl|my_center|LOCUS_12500 88004 87711 gene locus_tag LOCUS_12510 88004 87711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 89533 88448 gene locus_tag LOCUS_12520 gene fba 89533 88448 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085370.1 protein_id gnl|my_center|LOCUS_12520 90527 89655 gene locus_tag LOCUS_12530 90527 89655 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085368.1 protein_id gnl|my_center|LOCUS_12530 91577 90540 gene locus_tag LOCUS_12540 91577 90540 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085367.1 protein_id gnl|my_center|LOCUS_12540 91805 92641 gene locus_tag LOCUS_12550 91805 92641 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085366.1 protein_id gnl|my_center|LOCUS_12550 92934 92858 gene locus_tag LOCUS_t00160 92934 92858 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 93003 93989 gene locus_tag LOCUS_12560 93003 93989 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085356.1 protein_id gnl|my_center|LOCUS_12560 94003 95439 gene locus_tag LOCUS_12570 94003 95439 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085355.1 protein_id gnl|my_center|LOCUS_12570 96279 95512 gene locus_tag LOCUS_12580 96279 95512 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085350.1 protein_id gnl|my_center|LOCUS_12580 96343 96855 gene locus_tag LOCUS_12590 96343 96855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085349.1 protein_id gnl|my_center|LOCUS_12590 96956 97387 gene locus_tag LOCUS_12600 96956 97387 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085348.1 protein_id gnl|my_center|LOCUS_12600 97398 97850 gene locus_tag LOCUS_12610 97398 97850 CDS product TIGR02301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085347.1 protein_id gnl|my_center|LOCUS_12610 98115 98381 gene locus_tag LOCUS_12620 98115 98381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008135624.1 protein_id gnl|my_center|LOCUS_12620 99800 98460 gene locus_tag LOCUS_12630 99800 98460 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085342.1 protein_id gnl|my_center|LOCUS_12630 99954 100835 gene locus_tag LOCUS_12640 99954 100835 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085341.1 protein_id gnl|my_center|LOCUS_12640 100832 101458 gene locus_tag LOCUS_12650 100832 101458 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085340.1 protein_id gnl|my_center|LOCUS_12650 101455 102066 gene locus_tag LOCUS_12660 101455 102066 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085339.1 protein_id gnl|my_center|LOCUS_12660 102188 102694 gene locus_tag LOCUS_12670 102188 102694 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085338.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence11 317 544 gene locus_tag LOCUS_12680 317 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2855 2298 gene locus_tag LOCUS_12690 2855 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 3459 3998 gene locus_tag LOCUS_12700 3459 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3995 7255 gene locus_tag LOCUS_12710 3995 7255 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967470.1 protein_id gnl|my_center|LOCUS_12710 8020 7622 gene locus_tag LOCUS_12720 8020 7622 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971227.1 protein_id gnl|my_center|LOCUS_12720 8088 8708 gene locus_tag LOCUS_12730 8088 8708 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_12730 8701 8919 gene locus_tag LOCUS_12740 8701 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 9073 9405 gene locus_tag LOCUS_12750 9073 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 9421 9768 gene locus_tag LOCUS_12760 9421 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12760 9805 11097 gene locus_tag LOCUS_12770 9805 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 11617 11195 gene locus_tag LOCUS_12780 gene rnk 11617 11195 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836246.1 protein_id gnl|my_center|LOCUS_12780 11883 12887 gene locus_tag LOCUS_12790 11883 12887 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625945.1 protein_id gnl|my_center|LOCUS_12790 12920 13891 gene locus_tag LOCUS_12800 12920 13891 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385088.1 protein_id gnl|my_center|LOCUS_12800 13878 14663 gene locus_tag LOCUS_12810 13878 14663 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639872.1 protein_id gnl|my_center|LOCUS_12810 14678 15079 gene locus_tag LOCUS_12820 14678 15079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 15076 15366 gene locus_tag LOCUS_12830 15076 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 16181 15321 gene locus_tag LOCUS_12840 16181 15321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 16642 16340 gene locus_tag LOCUS_12850 16642 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 18636 17038 gene locus_tag LOCUS_12860 18636 17038 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 protein_id gnl|my_center|LOCUS_12860 19781 18987 gene locus_tag LOCUS_12870 19781 18987 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314962.1 protein_id gnl|my_center|LOCUS_12870 21501 19765 gene locus_tag LOCUS_12880 21501 19765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 21863 21498 gene locus_tag LOCUS_12890 21863 21498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 22688 22026 gene locus_tag LOCUS_12900 22688 22026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 22918 23217 gene locus_tag LOCUS_12910 22918 23217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 23217 23876 gene locus_tag LOCUS_12920 23217 23876 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_12920 23869 25428 gene locus_tag LOCUS_12930 23869 25428 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_12930 25421 27904 gene locus_tag LOCUS_12940 25421 27904 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492290.1 protein_id gnl|my_center|LOCUS_12940 28610 29086 gene locus_tag LOCUS_12950 28610 29086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 30696 29299 gene locus_tag LOCUS_12960 30696 29299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 32227 30665 gene locus_tag LOCUS_12970 32227 30665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 33541 32288 gene locus_tag LOCUS_12980 33541 32288 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_12980 33759 33541 gene locus_tag LOCUS_12990 33759 33541 CDS product type II toxin-antitoxin system Y4mF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875278.1 protein_id gnl|my_center|LOCUS_12990 34900 34016 gene locus_tag LOCUS_13000 34900 34016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 36023 35370 gene locus_tag LOCUS_13010 36023 35370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 36514 36023 gene locus_tag LOCUS_13020 36514 36023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 37337 37011 gene locus_tag LOCUS_13030 37337 37011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13030 37795 37370 gene locus_tag LOCUS_13040 37795 37370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13040 38371 37880 gene locus_tag LOCUS_13050 38371 37880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 39247 38654 gene locus_tag LOCUS_13060 39247 38654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 39949 39251 gene locus_tag LOCUS_13070 39949 39251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 41426 39936 gene locus_tag LOCUS_13080 41426 39936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 44528 41862 gene locus_tag LOCUS_13090 44528 41862 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 protein_id gnl|my_center|LOCUS_13090 47057 44823 gene locus_tag LOCUS_13100 47057 44823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 47359 47054 gene locus_tag LOCUS_13110 47359 47054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 48556 48948 gene locus_tag LOCUS_13120 48556 48948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 48941 49876 gene locus_tag LOCUS_13130 48941 49876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 49918 50808 gene locus_tag LOCUS_13140 49918 50808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 50891 51085 gene locus_tag LOCUS_13150 50891 51085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 52428 51133 gene locus_tag LOCUS_13160 52428 51133 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209929.1 protein_id gnl|my_center|LOCUS_13160 52870 52781 gene locus_tag LOCUS_t00170 52870 52781 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 54339 53446 gene locus_tag LOCUS_13170 54339 53446 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388398.1 protein_id gnl|my_center|LOCUS_13170 54440 55180 gene locus_tag LOCUS_13180 54440 55180 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337151.1 protein_id gnl|my_center|LOCUS_13180 55321 56502 gene locus_tag LOCUS_13190 55321 56502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 56554 57075 gene locus_tag LOCUS_13200 56554 57075 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396102.1 protein_id gnl|my_center|LOCUS_13200 57777 57097 gene locus_tag LOCUS_13210 57777 57097 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_13210 60164 57846 gene locus_tag LOCUS_13220 gene pnp 60164 57846 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917924.1 protein_id gnl|my_center|LOCUS_13220 60666 60397 gene locus_tag LOCUS_13230 gene rpsO 60666 60397 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_13230 61676 60672 gene locus_tag LOCUS_13240 gene truB 61676 60672 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917926.1 protein_id gnl|my_center|LOCUS_13240 62359 61673 gene locus_tag LOCUS_13250 62359 61673 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937452.1 protein_id gnl|my_center|LOCUS_13250 62960 62385 gene locus_tag LOCUS_13260 gene tdk 62960 62385 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705104.1 protein_id gnl|my_center|LOCUS_13260 63082 63531 gene locus_tag LOCUS_13270 63082 63531 CDS product DUF4126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275228.1 protein_id gnl|my_center|LOCUS_13270 63933 63535 gene locus_tag LOCUS_13280 gene rbfA 63933 63535 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083604.1 protein_id gnl|my_center|LOCUS_13280 66501 63952 gene locus_tag LOCUS_13290 gene infB 66501 63952 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097063504.1 protein_id gnl|my_center|LOCUS_13290 67272 66511 gene locus_tag LOCUS_13300 67272 66511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 68959 67253 gene locus_tag LOCUS_13310 gene nusA 68959 67253 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527896.1 protein_id gnl|my_center|LOCUS_13310 69610 69050 gene locus_tag LOCUS_13320 gene rimP 69610 69050 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639861.1 protein_id gnl|my_center|LOCUS_13320 70783 69743 gene locus_tag LOCUS_13330 gene pspF 70783 69743 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 protein_id gnl|my_center|LOCUS_13330 70927 71079 gene locus_tag LOCUS_13340 70927 71079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 71076 72056 gene locus_tag LOCUS_13350 71076 72056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 72061 72357 gene locus_tag LOCUS_13360 72061 72357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 72354 72728 gene locus_tag LOCUS_13370 gene pspC 72354 72728 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263198.1 protein_id gnl|my_center|LOCUS_13370 72771 73073 gene locus_tag LOCUS_13380 72771 73073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 73073 73411 gene locus_tag LOCUS_13390 73073 73411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 73408 73692 gene locus_tag LOCUS_13400 73408 73692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 73692 73967 gene locus_tag LOCUS_13410 73692 73967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 73993 74238 gene locus_tag LOCUS_13420 73993 74238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 74454 74873 gene locus_tag LOCUS_13430 74454 74873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 74875 75225 gene locus_tag LOCUS_13440 74875 75225 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456625.1 protein_id gnl|my_center|LOCUS_13440 75762 75244 gene locus_tag LOCUS_13450 75762 75244 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_13450 76125 75781 gene locus_tag LOCUS_13460 76125 75781 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_13460 76273 76464 gene locus_tag LOCUS_13470 76273 76464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 76527 77525 gene locus_tag LOCUS_13480 76527 77525 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 protein_id gnl|my_center|LOCUS_13480 77598 77924 gene locus_tag LOCUS_13490 77598 77924 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920348.1 protein_id gnl|my_center|LOCUS_13490 77929 78162 gene locus_tag LOCUS_13500 77929 78162 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 protein_id gnl|my_center|LOCUS_13500 78201 78533 gene locus_tag LOCUS_13510 gene grxD 78201 78533 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548651.1 protein_id gnl|my_center|LOCUS_13510 78727 79515 gene locus_tag LOCUS_13520 78727 79515 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 protein_id gnl|my_center|LOCUS_13520 79757 80557 gene locus_tag LOCUS_13530 79757 80557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 81870 81637 gene locus_tag LOCUS_13540 81870 81637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 84136 82133 gene locus_tag LOCUS_13550 84136 82133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 85023 84133 gene locus_tag LOCUS_13560 85023 84133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 87206 85020 gene locus_tag LOCUS_13570 87206 85020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 87800 87237 gene locus_tag LOCUS_13580 87800 87237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 87864 88079 gene locus_tag LOCUS_13590 87864 88079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 88495 88196 gene locus_tag LOCUS_13600 88495 88196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 89277 89825 gene locus_tag LOCUS_13610 89277 89825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 90892 89831 gene locus_tag LOCUS_13620 90892 89831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 91278 90814 gene locus_tag LOCUS_13630 91278 90814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 92357 91275 gene locus_tag LOCUS_13640 92357 91275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 92893 92621 gene locus_tag LOCUS_13650 92893 92621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 94414 92894 gene locus_tag LOCUS_13660 94414 92894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 95967 94411 gene locus_tag LOCUS_13670 95967 94411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445521.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence12 655 966 gene locus_tag LOCUS_13680 655 966 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110750833.1 protein_id gnl|my_center|LOCUS_13680 1171 977 gene locus_tag LOCUS_13690 1171 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084994.1 protein_id gnl|my_center|LOCUS_13690 1479 1844 gene locus_tag LOCUS_13700 1479 1844 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136158.1 protein_id gnl|my_center|LOCUS_13700 1835 2437 gene locus_tag LOCUS_13710 1835 2437 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211411592.1 protein_id gnl|my_center|LOCUS_13710 2448 3068 gene locus_tag LOCUS_13720 2448 3068 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087683.1 protein_id gnl|my_center|LOCUS_13720 3068 4276 gene locus_tag LOCUS_13730 3068 4276 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087682.1 protein_id gnl|my_center|LOCUS_13730 4273 5238 gene locus_tag LOCUS_13740 4273 5238 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966297.1 protein_id gnl|my_center|LOCUS_13740 5253 6008 gene locus_tag LOCUS_13750 gene nuoE 5253 6008 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087680.1 protein_id gnl|my_center|LOCUS_13750 6008 7333 gene locus_tag LOCUS_13760 gene nuoF 6008 7333 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087678.1 protein_id gnl|my_center|LOCUS_13760 7338 9416 gene locus_tag LOCUS_13770 gene nuoG 7338 9416 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087677.1 protein_id gnl|my_center|LOCUS_13770 9422 10492 gene locus_tag LOCUS_13780 gene nuoH 9422 10492 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087676.1 protein_id gnl|my_center|LOCUS_13780 10500 10988 gene locus_tag LOCUS_13790 gene nuoI 10500 10988 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191093171.1 protein_id gnl|my_center|LOCUS_13790 10998 11633 gene locus_tag LOCUS_13800 10998 11633 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087674.1 protein_id gnl|my_center|LOCUS_13800 11630 11938 gene locus_tag LOCUS_13810 gene nuoK 11630 11938 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008547737.1 protein_id gnl|my_center|LOCUS_13810 12022 14088 gene locus_tag LOCUS_13820 gene nuoL 12022 14088 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087673.1 protein_id gnl|my_center|LOCUS_13820 14091 15599 gene locus_tag LOCUS_13830 14091 15599 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087672.1 protein_id gnl|my_center|LOCUS_13830 15625 17061 gene locus_tag LOCUS_13840 gene nuoN 15625 17061 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087671.1 protein_id gnl|my_center|LOCUS_13840 17075 17887 gene locus_tag LOCUS_13850 17075 17887 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087670.1 protein_id gnl|my_center|LOCUS_13850 17884 19557 gene locus_tag LOCUS_13860 17884 19557 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171719.1 protein_id gnl|my_center|LOCUS_13860 19689 20132 gene locus_tag LOCUS_13870 gene mce 19689 20132 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087668.1 protein_id gnl|my_center|LOCUS_13870 20132 20401 gene locus_tag LOCUS_13880 20132 20401 CDS product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087667.1 protein_id gnl|my_center|LOCUS_13880 20576 20908 gene locus_tag LOCUS_13890 20576 20908 CDS product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171733.1 protein_id gnl|my_center|LOCUS_13890 21003 23210 gene locus_tag LOCUS_13900 21003 23210 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 protein_id gnl|my_center|LOCUS_13900 23305 23829 gene locus_tag LOCUS_13910 23305 23829 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087647.1 protein_id gnl|my_center|LOCUS_13910 23826 24356 gene locus_tag LOCUS_13920 23826 24356 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529535.1 protein_id gnl|my_center|LOCUS_13920 24613 25932 gene locus_tag LOCUS_13930 24613 25932 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087644.1 protein_id gnl|my_center|LOCUS_13930 26168 27448 gene locus_tag LOCUS_13940 26168 27448 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 protein_id gnl|my_center|LOCUS_13940 27456 28154 gene locus_tag LOCUS_13950 27456 28154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087642.1 protein_id gnl|my_center|LOCUS_13950 28666 29388 gene locus_tag LOCUS_13960 gene pyrF 28666 29388 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083509.1 protein_id gnl|my_center|LOCUS_13960 29493 29705 gene locus_tag LOCUS_13970 29493 29705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 30107 33610 gene locus_tag LOCUS_13980 gene dnaE 30107 33610 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087634.1 protein_id gnl|my_center|LOCUS_13980 33800 34798 gene locus_tag LOCUS_13990 33800 34798 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087629.1 protein_id gnl|my_center|LOCUS_13990 34924 35847 gene locus_tag LOCUS_14000 gene tsf 34924 35847 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087628.1 protein_id gnl|my_center|LOCUS_14000 35897 36613 gene locus_tag LOCUS_14010 gene pyrH 35897 36613 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027545778.1 protein_id gnl|my_center|LOCUS_14010 36665 37228 gene locus_tag LOCUS_14020 gene frr 36665 37228 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171750.1 protein_id gnl|my_center|LOCUS_14020 37247 38005 gene locus_tag LOCUS_14030 37247 38005 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087625.1 protein_id gnl|my_center|LOCUS_14030 38356 39144 gene locus_tag LOCUS_14040 38356 39144 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027545781.1 protein_id gnl|my_center|LOCUS_14040 39164 40372 gene locus_tag LOCUS_14050 gene dxr 39164 40372 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087623.1 protein_id gnl|my_center|LOCUS_14050 40526 41677 gene locus_tag LOCUS_14060 gene rseP 40526 41677 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087622.1 protein_id gnl|my_center|LOCUS_14060 41951 44479 gene locus_tag LOCUS_14070 gene bamA 41951 44479 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087621.1 protein_id gnl|my_center|LOCUS_14070 45402 44554 gene locus_tag LOCUS_14080 45402 44554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 45289 45600 gene locus_tag LOCUS_14090 45289 45600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 45620 46075 gene locus_tag LOCUS_14100 gene fabZ 45620 46075 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087619.1 protein_id gnl|my_center|LOCUS_14100 46075 46881 gene locus_tag LOCUS_14110 gene lpxA 46075 46881 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087617.1 protein_id gnl|my_center|LOCUS_14110 46901 47758 gene locus_tag LOCUS_14120 gene lpxI 46901 47758 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967850.1 protein_id gnl|my_center|LOCUS_14120 47758 48972 gene locus_tag LOCUS_14130 gene lpxB 47758 48972 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087615.1 protein_id gnl|my_center|LOCUS_14130 50321 49020 gene locus_tag LOCUS_14140 gene gltA 50321 49020 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087607.1 protein_id gnl|my_center|LOCUS_14140 51889 50465 gene locus_tag LOCUS_14150 gene gltX 51889 50465 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087606.1 protein_id gnl|my_center|LOCUS_14150 52122 53801 gene locus_tag LOCUS_14160 52122 53801 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_14160 54093 56399 gene locus_tag LOCUS_14170 54093 56399 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921625.1 protein_id gnl|my_center|LOCUS_14170 57139 56438 gene locus_tag LOCUS_14180 gene lexA 57139 56438 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087594.1 protein_id gnl|my_center|LOCUS_14180 58514 57300 gene locus_tag LOCUS_14190 58514 57300 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_14190 59161 58631 gene locus_tag LOCUS_14200 gene moaC 59161 58631 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087579.1 protein_id gnl|my_center|LOCUS_14200 60020 59226 gene locus_tag LOCUS_14210 gene trpC 60020 59226 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087578.1 protein_id gnl|my_center|LOCUS_14210 61057 60044 gene locus_tag LOCUS_14220 gene trpD 61057 60044 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087577.1 protein_id gnl|my_center|LOCUS_14220 62938 61094 gene locus_tag LOCUS_14230 62938 61094 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087576.1 protein_id gnl|my_center|LOCUS_14230 63255 64007 gene locus_tag LOCUS_14240 gene tpiA 63255 64007 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087575.1 protein_id gnl|my_center|LOCUS_14240 64309 64698 gene locus_tag LOCUS_14250 gene secG 64309 64698 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087574.1 protein_id gnl|my_center|LOCUS_14250 64868 66499 gene locus_tag LOCUS_14260 64868 66499 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087573.1 protein_id gnl|my_center|LOCUS_14260 66962 66606 gene locus_tag LOCUS_14270 66962 66606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 66937 67140 gene locus_tag LOCUS_14280 66937 67140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 67137 68000 gene locus_tag LOCUS_14290 gene kdsA 67137 68000 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087568.1 protein_id gnl|my_center|LOCUS_14290 67997 69208 gene locus_tag LOCUS_14300 67997 69208 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087567.1 protein_id gnl|my_center|LOCUS_14300 69649 69212 gene locus_tag LOCUS_14310 gene queF 69649 69212 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122403094.1 protein_id gnl|my_center|LOCUS_14310 70040 71323 gene locus_tag LOCUS_14320 gene eno 70040 71323 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087562.1 protein_id gnl|my_center|LOCUS_14320 72215 71541 gene locus_tag LOCUS_14330 72215 71541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089317.1 protein_id gnl|my_center|LOCUS_14330 72525 73691 gene locus_tag LOCUS_14340 72525 73691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 73666 74295 gene locus_tag LOCUS_14350 73666 74295 CDS product protein-S-isoprenylcysteine O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969325.1 protein_id gnl|my_center|LOCUS_14350 74458 74775 gene locus_tag LOCUS_14360 74458 74775 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087554.1 protein_id gnl|my_center|LOCUS_14360 74966 75988 gene locus_tag LOCUS_14370 gene pdhA 74966 75988 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087551.1 protein_id gnl|my_center|LOCUS_14370 76015 77430 gene locus_tag LOCUS_14380 76015 77430 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087550.1 protein_id gnl|my_center|LOCUS_14380 77443 78795 gene locus_tag LOCUS_14390 77443 78795 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087547.1 protein_id gnl|my_center|LOCUS_14390 78819 79034 gene locus_tag LOCUS_14400 78819 79034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 79347 80786 gene locus_tag LOCUS_14410 gene lpdA 79347 80786 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087546.1 protein_id gnl|my_center|LOCUS_14410 81075 81434 gene locus_tag LOCUS_14420 81075 81434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 81475 82242 gene locus_tag LOCUS_14430 81475 82242 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967247.1 protein_id gnl|my_center|LOCUS_14430 83156 82317 gene locus_tag LOCUS_14440 gene xth 83156 82317 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967248.1 protein_id gnl|my_center|LOCUS_14440 83543 83211 gene locus_tag LOCUS_14450 gene erpA 83543 83211 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 protein_id gnl|my_center|LOCUS_14450 83667 84869 gene locus_tag LOCUS_14460 83667 84869 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087526.1 protein_id gnl|my_center|LOCUS_14460 84908 86701 gene locus_tag LOCUS_14470 gene argS 84908 86701 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967253.1 protein_id gnl|my_center|LOCUS_14470 86803 88218 gene locus_tag LOCUS_14480 86803 88218 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921470.1 protein_id gnl|my_center|LOCUS_14480 88499 88296 gene locus_tag LOCUS_14490 88499 88296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 88476 89291 gene locus_tag LOCUS_14500 88476 89291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 89288 90121 gene locus_tag LOCUS_14510 89288 90121 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087521.1 protein_id gnl|my_center|LOCUS_14510 90142 90888 gene locus_tag LOCUS_14520 gene scpB 90142 90888 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171841.1 protein_id gnl|my_center|LOCUS_14520 91156 93897 gene locus_tag LOCUS_14530 gene gyrA 91156 93897 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087464.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence13 1125 241 gene locus_tag LOCUS_14540 1125 241 CDS product DUF4339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083434.1 protein_id gnl|my_center|LOCUS_14540 1369 1707 gene locus_tag LOCUS_14550 1369 1707 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008142802.1 protein_id gnl|my_center|LOCUS_14550 1809 3125 gene locus_tag LOCUS_14560 1809 3125 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965115.1 protein_id gnl|my_center|LOCUS_14560 3447 3247 gene locus_tag LOCUS_14570 3447 3247 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083431.1 protein_id gnl|my_center|LOCUS_14570 4250 3576 gene locus_tag LOCUS_14580 4250 3576 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_14580 5298 4366 gene locus_tag LOCUS_14590 gene trxA 5298 4366 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083423.1 protein_id gnl|my_center|LOCUS_14590 5811 5885 gene locus_tag LOCUS_t00180 5811 5885 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6405 8108 gene locus_tag LOCUS_14600 6405 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 8380 10620 gene locus_tag LOCUS_14610 8380 10620 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965347.1 protein_id gnl|my_center|LOCUS_14610 11559 10786 gene locus_tag LOCUS_14620 11559 10786 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083536.1 protein_id gnl|my_center|LOCUS_14620 11777 12292 gene locus_tag LOCUS_14630 gene infC 11777 12292 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083535.1 protein_id gnl|my_center|LOCUS_14630 12699 12899 gene locus_tag LOCUS_14640 gene rpmI 12699 12899 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008539890.1 protein_id gnl|my_center|LOCUS_14640 12965 13324 gene locus_tag LOCUS_14650 gene rplT 12965 13324 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083533.1 protein_id gnl|my_center|LOCUS_14650 13514 14596 gene locus_tag LOCUS_14660 gene pheS 13514 14596 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083532.1 protein_id gnl|my_center|LOCUS_14660 15186 17624 gene locus_tag LOCUS_14670 gene pheT 15186 17624 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083531.1 protein_id gnl|my_center|LOCUS_14670 18372 17704 gene locus_tag LOCUS_14680 18372 17704 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_14680 19799 18369 gene locus_tag LOCUS_14690 19799 18369 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083529.1 protein_id gnl|my_center|LOCUS_14690 20040 20969 gene locus_tag LOCUS_14700 20040 20969 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083528.1 protein_id gnl|my_center|LOCUS_14700 21147 21635 gene locus_tag LOCUS_14710 21147 21635 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063705.1 protein_id gnl|my_center|LOCUS_14710 21812 22552 gene locus_tag LOCUS_14720 21812 22552 CDS product sulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083518.1 protein_id gnl|my_center|LOCUS_14720 22883 23860 gene locus_tag LOCUS_14730 gene sppA 22883 23860 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083566.1 protein_id gnl|my_center|LOCUS_14730 24091 24396 gene locus_tag LOCUS_14740 24091 24396 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008539997.1 protein_id gnl|my_center|LOCUS_14740 24482 24829 gene locus_tag LOCUS_14750 24482 24829 CDS product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083567.1 protein_id gnl|my_center|LOCUS_14750 24993 25670 gene locus_tag LOCUS_14760 24993 25670 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083568.1 protein_id gnl|my_center|LOCUS_14760 25821 27065 gene locus_tag LOCUS_14770 gene trpB 25821 27065 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083569.1 protein_id gnl|my_center|LOCUS_14770 27062 27907 gene locus_tag LOCUS_14780 gene trpA 27062 27907 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083570.1 protein_id gnl|my_center|LOCUS_14780 28236 29195 gene locus_tag LOCUS_14790 gene accD 28236 29195 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083571.1 protein_id gnl|my_center|LOCUS_14790 29192 30514 gene locus_tag LOCUS_14800 29192 30514 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083572.1 protein_id gnl|my_center|LOCUS_14800 31064 30744 gene locus_tag LOCUS_14810 gene trxA 31064 30744 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598398.1 protein_id gnl|my_center|LOCUS_14810 34657 31163 gene locus_tag LOCUS_14820 gene addA 34657 31163 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921368.1 protein_id gnl|my_center|LOCUS_14820 37803 34657 gene locus_tag LOCUS_14830 gene addB 37803 34657 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083576.1 protein_id gnl|my_center|LOCUS_14830 38715 37981 gene locus_tag LOCUS_14840 38715 37981 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 protein_id gnl|my_center|LOCUS_14840 39197 38877 gene locus_tag LOCUS_14850 39197 38877 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083578.1 protein_id gnl|my_center|LOCUS_14850 40819 39296 gene locus_tag LOCUS_14860 40819 39296 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083579.1 protein_id gnl|my_center|LOCUS_14860 43281 40816 gene locus_tag LOCUS_14870 43281 40816 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965154.1 protein_id gnl|my_center|LOCUS_14870 44046 43588 gene locus_tag LOCUS_14880 gene dut 44046 43588 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_14880 45479 44043 gene locus_tag LOCUS_14890 gene coaBC 45479 44043 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083582.1 protein_id gnl|my_center|LOCUS_14890 47114 45546 gene locus_tag LOCUS_14900 gene ubiB 47114 45546 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083583.1 protein_id gnl|my_center|LOCUS_14900 47872 47111 gene locus_tag LOCUS_14910 gene ubiE 47872 47111 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083584.1 protein_id gnl|my_center|LOCUS_14910 48202 49083 gene locus_tag LOCUS_14920 gene mutM 48202 49083 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083585.1 protein_id gnl|my_center|LOCUS_14920 50464 49121 gene locus_tag LOCUS_14930 50464 49121 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965159.1 protein_id gnl|my_center|LOCUS_14930 50713 51513 gene locus_tag LOCUS_14940 gene moeB 50713 51513 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083588.1 protein_id gnl|my_center|LOCUS_14940 52703 51702 gene locus_tag LOCUS_14950 52703 51702 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083589.1 protein_id gnl|my_center|LOCUS_14950 53245 53730 gene locus_tag LOCUS_14960 53245 53730 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083590.1 protein_id gnl|my_center|LOCUS_14960 54467 53961 gene locus_tag LOCUS_14970 54467 53961 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008131763.1 protein_id gnl|my_center|LOCUS_14970 54965 55489 gene locus_tag LOCUS_14980 gene fabA 54965 55489 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083591.1 protein_id gnl|my_center|LOCUS_14980 55573 56796 gene locus_tag LOCUS_14990 gene fabB 55573 56796 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083592.1 protein_id gnl|my_center|LOCUS_14990 56969 57802 gene locus_tag LOCUS_15000 gene fabI 56969 57802 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083593.1 protein_id gnl|my_center|LOCUS_15000 60225 57967 gene locus_tag LOCUS_15010 gene katG 60225 57967 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965161.1 protein_id gnl|my_center|LOCUS_15010 60413 61339 gene locus_tag LOCUS_15020 60413 61339 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083599.1 protein_id gnl|my_center|LOCUS_15020 63572 61416 gene locus_tag LOCUS_15030 gene pnp 63572 61416 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083601.1 protein_id gnl|my_center|LOCUS_15030 64160 63891 gene locus_tag LOCUS_15040 gene rpsO 64160 63891 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083602.1 protein_id gnl|my_center|LOCUS_15040 65410 64163 gene locus_tag LOCUS_15050 gene truB 65410 64163 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172518.1 protein_id gnl|my_center|LOCUS_15050 65664 65410 gene locus_tag LOCUS_15060 65664 65410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 65578 65805 gene locus_tag LOCUS_15070 65578 65805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 68489 65967 gene locus_tag LOCUS_15080 gene infB 68489 65967 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083605.1 protein_id gnl|my_center|LOCUS_15080 69314 68649 gene locus_tag LOCUS_15090 69314 68649 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083606.1 protein_id gnl|my_center|LOCUS_15090 71145 69538 gene locus_tag LOCUS_15100 gene nusA 71145 69538 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083607.1 protein_id gnl|my_center|LOCUS_15100 71940 71149 gene locus_tag LOCUS_15110 gene rimP 71940 71149 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083608.1 protein_id gnl|my_center|LOCUS_15110 72879 72262 gene locus_tag LOCUS_15120 72879 72262 CDS product tRNA (guanine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083610.1 protein_id gnl|my_center|LOCUS_15120 73455 73036 gene locus_tag LOCUS_15130 73455 73036 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083612.1 protein_id gnl|my_center|LOCUS_15130 75279 73672 gene locus_tag LOCUS_15140 gene lnt 75279 73672 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 protein_id gnl|my_center|LOCUS_15140 76400 75276 gene locus_tag LOCUS_15150 76400 75276 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083614.1 protein_id gnl|my_center|LOCUS_15150 76973 76401 gene locus_tag LOCUS_15160 gene ybeY 76973 76401 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965162.1 protein_id gnl|my_center|LOCUS_15160 78022 76973 gene locus_tag LOCUS_15170 78022 76973 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083616.1 protein_id gnl|my_center|LOCUS_15170 79463 78027 gene locus_tag LOCUS_15180 gene miaB 79463 78027 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083617.1 protein_id gnl|my_center|LOCUS_15180 79913 79464 gene locus_tag LOCUS_15190 79913 79464 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083619.1 protein_id gnl|my_center|LOCUS_15190 80540 80061 gene locus_tag LOCUS_15200 gene rimI 80540 80061 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083620.1 protein_id gnl|my_center|LOCUS_15200 81238 80540 gene locus_tag LOCUS_15210 gene tsaB 81238 80540 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083621.1 protein_id gnl|my_center|LOCUS_15210 81534 82643 gene locus_tag LOCUS_15220 81534 82643 CDS product DUF2778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967584.1 protein_id gnl|my_center|LOCUS_15220 83342 82770 gene locus_tag LOCUS_15230 83342 82770 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083622.1 protein_id gnl|my_center|LOCUS_15230 84183 83689 gene locus_tag LOCUS_15240 84183 83689 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965167.1 protein_id gnl|my_center|LOCUS_15240 85392 84265 gene locus_tag LOCUS_15250 gene trpS 85392 84265 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083624.1 protein_id gnl|my_center|LOCUS_15250 87079 85520 gene locus_tag LOCUS_15260 gene murJ 87079 85520 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083625.1 protein_id gnl|my_center|LOCUS_15260 87200 88201 gene locus_tag LOCUS_15270 87200 88201 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083626.1 protein_id gnl|my_center|LOCUS_15270 89128 88208 gene locus_tag LOCUS_15280 89128 88208 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083635.1 protein_id gnl|my_center|LOCUS_15280 89331 90071 gene locus_tag LOCUS_15290 89331 90071 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_15290 90373 90107 gene locus_tag LOCUS_15300 90373 90107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 92525 91098 gene locus_tag LOCUS_15310 gene tldD 92525 91098 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965288.1 protein_id gnl|my_center|LOCUS_15310 93376 92825 gene locus_tag LOCUS_15320 93376 92825 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185888.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence14 349 110 gene locus_tag LOCUS_15330 349 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 628 1878 gene locus_tag LOCUS_15340 628 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1933 3549 gene locus_tag LOCUS_15350 1933 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 3549 5141 gene locus_tag LOCUS_15360 3549 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 5238 6758 gene locus_tag LOCUS_15370 5238 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 6873 7058 gene locus_tag LOCUS_15380 6873 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 7625 7098 gene locus_tag LOCUS_15390 7625 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 8706 8200 gene locus_tag LOCUS_15400 8706 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15400 9143 8793 gene locus_tag LOCUS_15410 9143 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15410 10957 11160 gene locus_tag LOCUS_15420 10957 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 11222 11677 gene locus_tag LOCUS_15430 11222 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 11674 13332 gene locus_tag LOCUS_15440 11674 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 13586 13512 gene locus_tag LOCUS_t00190 13586 13512 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14031 13660 gene locus_tag LOCUS_15450 14031 13660 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007597092.1 protein_id gnl|my_center|LOCUS_15450 14194 15081 gene locus_tag LOCUS_15460 14194 15081 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090455.1 protein_id gnl|my_center|LOCUS_15460 15603 16388 gene locus_tag LOCUS_15470 gene hisN 15603 16388 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_15470 17385 16522 gene locus_tag LOCUS_15480 17385 16522 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090464.1 protein_id gnl|my_center|LOCUS_15480 17680 18141 gene locus_tag LOCUS_15490 17680 18141 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173863.1 protein_id gnl|my_center|LOCUS_15490 18609 23357 gene locus_tag LOCUS_15500 gene gltB 18609 23357 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_15500 23494 24948 gene locus_tag LOCUS_15510 23494 24948 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 protein_id gnl|my_center|LOCUS_15510 25183 25509 gene locus_tag LOCUS_15520 25183 25509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 27376 25718 gene locus_tag LOCUS_15530 27376 25718 CDS product SGNH family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084313.1 protein_id gnl|my_center|LOCUS_15530 29089 27653 gene locus_tag LOCUS_15540 29089 27653 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463741.1 protein_id gnl|my_center|LOCUS_15540 29423 30298 gene locus_tag LOCUS_15550 29423 30298 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084315.1 protein_id gnl|my_center|LOCUS_15550 30303 30572 gene locus_tag LOCUS_15560 30303 30572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 30803 31522 gene locus_tag LOCUS_15570 gene msrA 30803 31522 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089780.1 protein_id gnl|my_center|LOCUS_15570 31540 31953 gene locus_tag LOCUS_15580 gene msrB 31540 31953 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089781.1 protein_id gnl|my_center|LOCUS_15580 32261 32548 gene locus_tag LOCUS_15590 32261 32548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 33252 32716 gene locus_tag LOCUS_15600 33252 32716 CDS product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089783.1 protein_id gnl|my_center|LOCUS_15600 33544 33759 gene locus_tag LOCUS_15610 33544 33759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 35438 33906 gene locus_tag LOCUS_15620 35438 33906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089788.1 protein_id gnl|my_center|LOCUS_15620 36781 35489 gene locus_tag LOCUS_15630 36781 35489 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089789.1 protein_id gnl|my_center|LOCUS_15630 37201 38754 gene locus_tag LOCUS_15640 37201 38754 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088262.1 protein_id gnl|my_center|LOCUS_15640 40493 38904 gene locus_tag LOCUS_15650 gene serA 40493 38904 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090136.1 protein_id gnl|my_center|LOCUS_15650 41867 40695 gene locus_tag LOCUS_15660 41867 40695 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090137.1 protein_id gnl|my_center|LOCUS_15660 42910 42080 gene locus_tag LOCUS_15670 42910 42080 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090140.1 protein_id gnl|my_center|LOCUS_15670 43963 43112 gene locus_tag LOCUS_15680 43963 43112 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174704.1 protein_id gnl|my_center|LOCUS_15680 45524 44277 gene locus_tag LOCUS_15690 45524 44277 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965428.1 protein_id gnl|my_center|LOCUS_15690 47102 45756 gene locus_tag LOCUS_15700 gene glmM 47102 45756 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174702.1 protein_id gnl|my_center|LOCUS_15700 47512 47333 gene locus_tag LOCUS_15710 47512 47333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 49743 47863 gene locus_tag LOCUS_15720 49743 47863 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089263.1 protein_id gnl|my_center|LOCUS_15720 50057 49740 gene locus_tag LOCUS_15730 50057 49740 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089262.1 protein_id gnl|my_center|LOCUS_15730 51035 50181 gene locus_tag LOCUS_15740 51035 50181 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039187079.1 protein_id gnl|my_center|LOCUS_15740 52366 51548 gene locus_tag LOCUS_15750 52366 51548 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_15750 55848 52606 gene locus_tag LOCUS_15760 55848 52606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 56071 56292 gene locus_tag LOCUS_15770 56071 56292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 56600 56313 gene locus_tag LOCUS_15780 56600 56313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 57326 56724 gene locus_tag LOCUS_15790 57326 56724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 57690 58676 gene locus_tag LOCUS_15800 57690 58676 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085392.1 protein_id gnl|my_center|LOCUS_15800 60041 58725 gene locus_tag LOCUS_15810 60041 58725 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089683.1 protein_id gnl|my_center|LOCUS_15810 60498 60286 gene locus_tag LOCUS_15820 60498 60286 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085189.1 protein_id gnl|my_center|LOCUS_15820 61258 60491 gene locus_tag LOCUS_15830 61258 60491 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085190.1 protein_id gnl|my_center|LOCUS_15830 61706 61491 gene locus_tag LOCUS_15840 61706 61491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 64010 61914 gene locus_tag LOCUS_15850 64010 61914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 64415 66697 gene locus_tag LOCUS_15860 64415 66697 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967383.1 protein_id gnl|my_center|LOCUS_15860 66697 67980 gene locus_tag LOCUS_15870 66697 67980 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085214.1 protein_id gnl|my_center|LOCUS_15870 68003 70078 gene locus_tag LOCUS_15880 68003 70078 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967384.1 protein_id gnl|my_center|LOCUS_15880 70122 70556 gene locus_tag LOCUS_15890 70122 70556 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085217.1 protein_id gnl|my_center|LOCUS_15890 70763 70999 gene locus_tag LOCUS_15900 70763 70999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 71279 72817 gene locus_tag LOCUS_15910 gene glpD 71279 72817 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085223.1 protein_id gnl|my_center|LOCUS_15910 73400 72897 gene locus_tag LOCUS_15920 73400 72897 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085233.1 protein_id gnl|my_center|LOCUS_15920 75162 73711 gene locus_tag LOCUS_15930 75162 73711 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_15930 75348 76655 gene locus_tag LOCUS_15940 gene aceA 75348 76655 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530245.1 protein_id gnl|my_center|LOCUS_15940 76652 76888 gene locus_tag LOCUS_15950 76652 76888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 77034 77660 gene locus_tag LOCUS_15960 77034 77660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921412.1 protein_id gnl|my_center|LOCUS_15960 78968 77790 gene locus_tag LOCUS_15970 78968 77790 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027989172.1 protein_id gnl|my_center|LOCUS_15970 79201 79022 gene locus_tag LOCUS_15980 79201 79022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 80000 79350 gene locus_tag LOCUS_15990 80000 79350 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090153.1 protein_id gnl|my_center|LOCUS_15990 81230 80283 gene locus_tag LOCUS_16000 81230 80283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16000 81499 81209 gene locus_tag LOCUS_16010 81499 81209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16010 81734 82936 gene locus_tag LOCUS_16020 81734 82936 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174694.1 protein_id gnl|my_center|LOCUS_16020 83093 83689 gene locus_tag LOCUS_16030 83093 83689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 84871 84185 gene locus_tag LOCUS_16040 84871 84185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084003.1 protein_id gnl|my_center|LOCUS_16040 85829 85206 gene locus_tag LOCUS_16050 85829 85206 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 protein_id gnl|my_center|LOCUS_16050 87155 85866 gene locus_tag LOCUS_16060 87155 85866 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084001.1 protein_id gnl|my_center|LOCUS_16060 88570 87152 gene locus_tag LOCUS_16070 gene thrC 88570 87152 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921382.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence15 392 102 gene locus_tag LOCUS_16080 392 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3860 474 gene locus_tag LOCUS_16090 3860 474 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082991.1 protein_id gnl|my_center|LOCUS_16090 5018 4239 gene locus_tag LOCUS_16100 5018 4239 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966645.1 protein_id gnl|my_center|LOCUS_16100 5604 5897 gene locus_tag LOCUS_16110 gene rpmB 5604 5897 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082994.1 protein_id gnl|my_center|LOCUS_16110 7252 6185 gene locus_tag LOCUS_16120 7252 6185 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083009.1 protein_id gnl|my_center|LOCUS_16120 9247 7340 gene locus_tag LOCUS_16130 gene cobT 9247 7340 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 protein_id gnl|my_center|LOCUS_16130 10401 9403 gene locus_tag LOCUS_16140 gene cobS 10401 9403 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175820.1 protein_id gnl|my_center|LOCUS_16140 10636 11292 gene locus_tag LOCUS_16150 10636 11292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 11984 11337 gene locus_tag LOCUS_16160 11984 11337 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083016.1 protein_id gnl|my_center|LOCUS_16160 12076 12372 gene locus_tag LOCUS_16170 12076 12372 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_16170 12614 13747 gene locus_tag LOCUS_16180 12614 13747 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083306.1 protein_id gnl|my_center|LOCUS_16180 13751 14074 gene locus_tag LOCUS_16190 13751 14074 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083578.1 protein_id gnl|my_center|LOCUS_16190 15553 14201 gene locus_tag LOCUS_16200 15553 14201 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083018.1 protein_id gnl|my_center|LOCUS_16200 16931 15780 gene locus_tag LOCUS_16210 gene aroB 16931 15780 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083019.1 protein_id gnl|my_center|LOCUS_16210 17584 16994 gene locus_tag LOCUS_16220 17584 16994 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175815.1 protein_id gnl|my_center|LOCUS_16220 17868 18014 gene locus_tag LOCUS_16230 17868 18014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083021.1 protein_id gnl|my_center|LOCUS_16230 18133 19092 gene locus_tag LOCUS_16240 gene xerD 18133 19092 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083022.1 protein_id gnl|my_center|LOCUS_16240 19334 20296 gene locus_tag LOCUS_16250 19334 20296 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083023.1 protein_id gnl|my_center|LOCUS_16250 20603 22078 gene locus_tag LOCUS_16260 20603 22078 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494184.1 protein_id gnl|my_center|LOCUS_16260 25325 22467 gene locus_tag LOCUS_16270 gene secA 25325 22467 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083036.1 protein_id gnl|my_center|LOCUS_16270 25870 26787 gene locus_tag LOCUS_16280 25870 26787 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175805.1 protein_id gnl|my_center|LOCUS_16280 27026 28264 gene locus_tag LOCUS_16290 gene argJ 27026 28264 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083038.1 protein_id gnl|my_center|LOCUS_16290 28261 28662 gene locus_tag LOCUS_16300 28261 28662 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083039.1 protein_id gnl|my_center|LOCUS_16300 29588 28737 gene locus_tag LOCUS_16310 29588 28737 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966655.1 protein_id gnl|my_center|LOCUS_16310 29694 30503 gene locus_tag LOCUS_16320 29694 30503 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083041.1 protein_id gnl|my_center|LOCUS_16320 30559 31440 gene locus_tag LOCUS_16330 30559 31440 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 protein_id gnl|my_center|LOCUS_16330 31437 31679 gene locus_tag LOCUS_16340 31437 31679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 31676 32119 gene locus_tag LOCUS_16350 31676 32119 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083044.1 protein_id gnl|my_center|LOCUS_16350 32837 32184 gene locus_tag LOCUS_16360 gene ubiG 32837 32184 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966657.1 protein_id gnl|my_center|LOCUS_16360 33353 34606 gene locus_tag LOCUS_16370 33353 34606 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083048.1 protein_id gnl|my_center|LOCUS_16370 34888 37152 gene locus_tag LOCUS_16380 gene ptsP 34888 37152 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083049.1 protein_id gnl|my_center|LOCUS_16380 37229 38395 gene locus_tag LOCUS_16390 gene prfA 37229 38395 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083050.1 protein_id gnl|my_center|LOCUS_16390 38577 39473 gene locus_tag LOCUS_16400 gene prmC 38577 39473 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083051.1 protein_id gnl|my_center|LOCUS_16400 39910 40611 gene locus_tag LOCUS_16410 39910 40611 CDS product DUF4167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083052.1 protein_id gnl|my_center|LOCUS_16410 41420 40671 gene locus_tag LOCUS_16420 41420 40671 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083053.1 protein_id gnl|my_center|LOCUS_16420 41740 42507 gene locus_tag LOCUS_16430 gene gloB 41740 42507 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083054.1 protein_id gnl|my_center|LOCUS_16430 43348 42611 gene locus_tag LOCUS_16440 gene truA 43348 42611 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966077.1 protein_id gnl|my_center|LOCUS_16440 44280 43348 gene locus_tag LOCUS_16450 gene fmt 44280 43348 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090830.1 protein_id gnl|my_center|LOCUS_16450 44839 44312 gene locus_tag LOCUS_16460 gene def 44839 44312 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090831.1 protein_id gnl|my_center|LOCUS_16460 45006 46202 gene locus_tag LOCUS_16470 gene rmuC 45006 46202 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175976.1 protein_id gnl|my_center|LOCUS_16470 46266 47624 gene locus_tag LOCUS_16480 46266 47624 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 protein_id gnl|my_center|LOCUS_16480 48569 47844 gene locus_tag LOCUS_16490 gene phbB 48569 47844 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083057.1 protein_id gnl|my_center|LOCUS_16490 49893 48715 gene locus_tag LOCUS_16500 49893 48715 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175239.1 protein_id gnl|my_center|LOCUS_16500 50195 50791 gene locus_tag LOCUS_16510 gene phaR 50195 50791 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083059.1 protein_id gnl|my_center|LOCUS_16510 52440 50974 gene locus_tag LOCUS_16520 52440 50974 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_16520 55719 52567 gene locus_tag LOCUS_16530 55719 52567 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085816.1 protein_id gnl|my_center|LOCUS_16530 56994 55738 gene locus_tag LOCUS_16540 56994 55738 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085815.1 protein_id gnl|my_center|LOCUS_16540 57290 57964 gene locus_tag LOCUS_16550 57290 57964 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086528.1 protein_id gnl|my_center|LOCUS_16550 58154 59503 gene locus_tag LOCUS_16560 58154 59503 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086529.1 protein_id gnl|my_center|LOCUS_16560 59627 59911 gene locus_tag LOCUS_16570 59627 59911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 60244 61263 gene locus_tag LOCUS_16580 60244 61263 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_16580 61260 62042 gene locus_tag LOCUS_16590 61260 62042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_16590 62048 62944 gene locus_tag LOCUS_16600 62048 62944 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 protein_id gnl|my_center|LOCUS_16600 63161 64039 gene locus_tag LOCUS_16610 63161 64039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 66576 64078 gene locus_tag LOCUS_16620 66576 64078 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103467.1 protein_id gnl|my_center|LOCUS_16620 67705 66701 gene locus_tag LOCUS_16630 67705 66701 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390126.1 protein_id gnl|my_center|LOCUS_16630 68455 67937 gene locus_tag LOCUS_16640 68455 67937 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626366.1 protein_id gnl|my_center|LOCUS_16640 69977 68790 gene locus_tag LOCUS_16650 69977 68790 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966145.1 protein_id gnl|my_center|LOCUS_16650 71277 70093 gene locus_tag LOCUS_16660 71277 70093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084116.1 protein_id gnl|my_center|LOCUS_16660 71637 72260 gene locus_tag LOCUS_16670 71637 72260 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084077.1 protein_id gnl|my_center|LOCUS_16670 72563 72638 gene locus_tag LOCUS_t00200 72563 72638 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 73808 72729 gene locus_tag LOCUS_16680 73808 72729 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337224.1 protein_id gnl|my_center|LOCUS_16680 74060 73821 gene locus_tag LOCUS_16690 74060 73821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530177.1 protein_id gnl|my_center|LOCUS_16690 74281 74559 gene locus_tag LOCUS_16700 74281 74559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 74621 74812 gene locus_tag LOCUS_16710 74621 74812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 74870 76144 gene locus_tag LOCUS_16720 74870 76144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 76593 76787 gene locus_tag LOCUS_16730 76593 76787 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263390.1 protein_id gnl|my_center|LOCUS_16730 76792 80355 gene locus_tag LOCUS_16740 76792 80355 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_16740 80411 83287 gene locus_tag LOCUS_16750 80411 83287 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_16750 83290 86580 gene locus_tag LOCUS_16760 83290 86580 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_16760 86785 87051 gene locus_tag LOCUS_16770 86785 87051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence16 127 339 gene locus_tag LOCUS_16780 127 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 510 1514 gene locus_tag LOCUS_16790 510 1514 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600889.1 protein_id gnl|my_center|LOCUS_16790 1671 2732 gene locus_tag LOCUS_16800 1671 2732 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403377.1 protein_id gnl|my_center|LOCUS_16800 2744 4132 gene locus_tag LOCUS_16810 2744 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4323 5597 gene locus_tag LOCUS_16820 4323 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 5640 7286 gene locus_tag LOCUS_16830 5640 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 8252 7311 gene locus_tag LOCUS_16840 8252 7311 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544985.1 protein_id gnl|my_center|LOCUS_16840 8396 9199 gene locus_tag LOCUS_16850 8396 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 10239 9232 gene locus_tag LOCUS_16860 10239 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 11672 10437 gene locus_tag LOCUS_16870 gene neuC 11672 10437 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403378.1 protein_id gnl|my_center|LOCUS_16870 12418 11669 gene locus_tag LOCUS_16880 12418 11669 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_16880 12556 13638 gene locus_tag LOCUS_16890 gene neuB 12556 13638 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403381.1 protein_id gnl|my_center|LOCUS_16890 13986 14273 gene locus_tag LOCUS_16900 13986 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 14270 15310 gene locus_tag LOCUS_16910 14270 15310 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_16910 15307 16119 gene locus_tag LOCUS_16920 15307 16119 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211232185.1 protein_id gnl|my_center|LOCUS_16920 16156 17334 gene locus_tag LOCUS_16930 16156 17334 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869425.1 protein_id gnl|my_center|LOCUS_16930 17360 17998 gene locus_tag LOCUS_16940 gene hisH 17360 17998 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083479.1 protein_id gnl|my_center|LOCUS_16940 18009 18785 gene locus_tag LOCUS_16950 gene hisF 18009 18785 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_16950 18787 19452 gene locus_tag LOCUS_16960 18787 19452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 20773 19460 gene locus_tag LOCUS_16970 20773 19460 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_16970 21885 20920 gene locus_tag LOCUS_16980 21885 20920 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088664.1 protein_id gnl|my_center|LOCUS_16980 23111 21882 gene locus_tag LOCUS_16990 23111 21882 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967036.1 protein_id gnl|my_center|LOCUS_16990 23339 24424 gene locus_tag LOCUS_17000 gene gmd 23339 24424 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498053.1 protein_id gnl|my_center|LOCUS_17000 24587 24402 gene locus_tag LOCUS_17010 24587 24402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 24543 25355 gene locus_tag LOCUS_17020 24543 25355 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088212.1 protein_id gnl|my_center|LOCUS_17020 26310 25408 gene locus_tag LOCUS_17030 26310 25408 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088663.1 protein_id gnl|my_center|LOCUS_17030 26201 26650 gene locus_tag LOCUS_17040 26201 26650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 27410 29371 gene locus_tag LOCUS_17050 27410 29371 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967035.1 protein_id gnl|my_center|LOCUS_17050 31330 30497 gene locus_tag LOCUS_17060 31330 30497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 31700 31924 gene locus_tag LOCUS_17070 31700 31924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 32834 31986 gene locus_tag LOCUS_17080 32834 31986 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088697.1 protein_id gnl|my_center|LOCUS_17080 32964 33821 gene locus_tag LOCUS_17090 gene purU 32964 33821 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088696.1 protein_id gnl|my_center|LOCUS_17090 34225 33845 gene locus_tag LOCUS_17100 34225 33845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 34403 35092 gene locus_tag LOCUS_17110 34403 35092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 35262 35705 gene locus_tag LOCUS_17120 35262 35705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 35775 36362 gene locus_tag LOCUS_17130 35775 36362 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967327.1 protein_id gnl|my_center|LOCUS_17130 36949 36779 gene locus_tag LOCUS_17140 36949 36779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 37744 37067 gene locus_tag LOCUS_17150 37744 37067 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175884.1 protein_id gnl|my_center|LOCUS_17150 38374 38219 gene locus_tag LOCUS_17160 38374 38219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 39944 38625 gene locus_tag LOCUS_17170 39944 38625 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085170.1 protein_id gnl|my_center|LOCUS_17170 40224 41576 gene locus_tag LOCUS_17180 40224 41576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173200.1 protein_id gnl|my_center|LOCUS_17180 41633 42829 gene locus_tag LOCUS_17190 gene metK 41633 42829 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088686.1 protein_id gnl|my_center|LOCUS_17190 43020 44471 gene locus_tag LOCUS_17200 gene ahcY 43020 44471 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088685.1 protein_id gnl|my_center|LOCUS_17200 44975 44739 gene locus_tag LOCUS_17210 44975 44739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 45258 45467 gene locus_tag LOCUS_17220 45258 45467 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085938.1 protein_id gnl|my_center|LOCUS_17220 45923 46642 gene locus_tag LOCUS_17230 45923 46642 CDS product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456605.1 protein_id gnl|my_center|LOCUS_17230 48767 46944 gene locus_tag LOCUS_17240 48767 46944 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966432.1 protein_id gnl|my_center|LOCUS_17240 49812 48916 gene locus_tag LOCUS_17250 49812 48916 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089328.1 protein_id gnl|my_center|LOCUS_17250 50131 49862 gene locus_tag LOCUS_17260 50131 49862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 52066 50459 gene locus_tag LOCUS_17270 52066 50459 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 protein_id gnl|my_center|LOCUS_17270 53125 52313 gene locus_tag LOCUS_17280 53125 52313 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171901122.1 protein_id gnl|my_center|LOCUS_17280 53411 53752 gene locus_tag LOCUS_17290 53411 53752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089320.1 protein_id gnl|my_center|LOCUS_17290 54586 53825 gene locus_tag LOCUS_17300 54586 53825 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 protein_id gnl|my_center|LOCUS_17300 55499 54588 gene locus_tag LOCUS_17310 55499 54588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089318.1 protein_id gnl|my_center|LOCUS_17310 58079 55635 gene locus_tag LOCUS_17320 58079 55635 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921530.1 protein_id gnl|my_center|LOCUS_17320 58347 58520 gene locus_tag LOCUS_17330 58347 58520 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089300.1 protein_id gnl|my_center|LOCUS_17330 58850 62455 gene locus_tag LOCUS_17340 58850 62455 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089276.1 protein_id gnl|my_center|LOCUS_17340 62849 62517 gene locus_tag LOCUS_17350 62849 62517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 63493 63242 gene locus_tag LOCUS_17360 63493 63242 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089261.1 protein_id gnl|my_center|LOCUS_17360 63678 63490 gene locus_tag LOCUS_17370 63678 63490 CDS product DUF4169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089260.1 protein_id gnl|my_center|LOCUS_17370 65309 63900 gene locus_tag LOCUS_17380 gene fumC 65309 63900 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089259.1 protein_id gnl|my_center|LOCUS_17380 65951 65406 gene locus_tag LOCUS_17390 65951 65406 CDS product ClpXP protease specificity-enhancing factor SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089258.1 protein_id gnl|my_center|LOCUS_17390 66414 66208 gene locus_tag LOCUS_17400 66414 66208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 66598 67392 gene locus_tag LOCUS_17410 66598 67392 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089252.1 protein_id gnl|my_center|LOCUS_17410 67389 67925 gene locus_tag LOCUS_17420 67389 67925 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089250.1 protein_id gnl|my_center|LOCUS_17420 68083 69228 gene locus_tag LOCUS_17430 gene hflK 68083 69228 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_17430 69225 70121 gene locus_tag LOCUS_17440 69225 70121 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089248.1 protein_id gnl|my_center|LOCUS_17440 70155 70355 gene locus_tag LOCUS_17450 70155 70355 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089247.1 protein_id gnl|my_center|LOCUS_17450 70615 72105 gene locus_tag LOCUS_17460 70615 72105 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089246.1 protein_id gnl|my_center|LOCUS_17460 73077 72181 gene locus_tag LOCUS_17470 gene serB 73077 72181 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089245.1 protein_id gnl|my_center|LOCUS_17470 73076 74020 gene locus_tag LOCUS_17480 gene miaA 73076 74020 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089244.1 protein_id gnl|my_center|LOCUS_17480 74364 76109 gene locus_tag LOCUS_17490 74364 76109 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089243.1 protein_id gnl|my_center|LOCUS_17490 76264 76806 gene locus_tag LOCUS_17500 gene ilvN 76264 76806 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089241.1 protein_id gnl|my_center|LOCUS_17500 76811 77515 gene locus_tag LOCUS_17510 76811 77515 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089240.1 protein_id gnl|my_center|LOCUS_17510 77714 78733 gene locus_tag LOCUS_17520 gene ilvC 77714 78733 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089237.1 protein_id gnl|my_center|LOCUS_17520 80404 78845 gene locus_tag LOCUS_17530 80404 78845 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089230.1 protein_id gnl|my_center|LOCUS_17530 81120 80401 gene locus_tag LOCUS_17540 81120 80401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966485.1 protein_id gnl|my_center|LOCUS_17540 81658 83217 gene locus_tag LOCUS_17550 81658 83217 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089175.1 protein_id gnl|my_center|LOCUS_17550 83459 84049 gene locus_tag LOCUS_17560 83459 84049 CDS product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176122.1 protein_id gnl|my_center|LOCUS_17560 84225 84300 gene locus_tag LOCUS_t00210 84225 84300 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 86134 84482 gene locus_tag LOCUS_17570 86134 84482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 86328 86131 gene locus_tag LOCUS_17580 86328 86131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 86281 86589 gene locus_tag LOCUS_17590 86281 86589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 87058 86648 gene locus_tag LOCUS_17600 87058 86648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence17 14652 4897 gene locus_tag LOCUS_17610 14652 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 15585 14716 gene locus_tag LOCUS_17620 15585 14716 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103869.1 protein_id gnl|my_center|LOCUS_17620 16408 15653 gene locus_tag LOCUS_17630 16408 15653 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267336.1 protein_id gnl|my_center|LOCUS_17630 16652 16425 gene locus_tag LOCUS_17640 16652 16425 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089636.1 protein_id gnl|my_center|LOCUS_17640 19831 17768 gene locus_tag LOCUS_17650 19831 17768 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114936.1 protein_id gnl|my_center|LOCUS_17650 20893 21669 gene locus_tag LOCUS_17660 20893 21669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 22643 21846 gene locus_tag LOCUS_17670 22643 21846 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175380.1 protein_id gnl|my_center|LOCUS_17670 22958 25075 gene locus_tag LOCUS_17680 gene pabB 22958 25075 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 protein_id gnl|my_center|LOCUS_17680 25461 25991 gene locus_tag LOCUS_17690 25461 25991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17690 26005 27552 gene locus_tag LOCUS_17700 26005 27552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 27549 28862 gene locus_tag LOCUS_17710 27549 28862 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061635.1 protein_id gnl|my_center|LOCUS_17710 29013 30107 gene locus_tag LOCUS_17720 29013 30107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 30104 30565 gene locus_tag LOCUS_17730 gene tagD 30104 30565 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880882.1 protein_id gnl|my_center|LOCUS_17730 30776 31642 gene locus_tag LOCUS_17740 30776 31642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 31692 32555 gene locus_tag LOCUS_17750 31692 32555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 32804 32568 gene locus_tag LOCUS_17760 32804 32568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 33130 32909 gene locus_tag LOCUS_17770 33130 32909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 33609 34058 gene locus_tag LOCUS_17780 33609 34058 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529160.1 protein_id gnl|my_center|LOCUS_17780 37074 34276 gene locus_tag LOCUS_17790 37074 34276 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337502.1 protein_id gnl|my_center|LOCUS_17790 38805 37288 gene locus_tag LOCUS_17800 38805 37288 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086915.1 protein_id gnl|my_center|LOCUS_17800 38943 39377 gene locus_tag LOCUS_17810 38943 39377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 40382 39456 gene locus_tag LOCUS_17820 40382 39456 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538117.1 protein_id gnl|my_center|LOCUS_17820 41037 40465 gene locus_tag LOCUS_17830 41037 40465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 43255 41108 gene locus_tag LOCUS_17840 43255 41108 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390968.1 protein_id gnl|my_center|LOCUS_17840 44632 43625 gene locus_tag LOCUS_17850 44632 43625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965459.1 protein_id gnl|my_center|LOCUS_17850 45226 44804 gene locus_tag LOCUS_17860 45226 44804 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17860 45624 45304 gene locus_tag LOCUS_17870 45624 45304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 46225 45683 gene locus_tag LOCUS_17880 46225 45683 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088836.1 protein_id gnl|my_center|LOCUS_17880 47463 46234 gene locus_tag LOCUS_17890 47463 46234 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174449.1 protein_id gnl|my_center|LOCUS_17890 47857 47582 gene locus_tag LOCUS_17900 47857 47582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 48317 50848 gene locus_tag LOCUS_17910 48317 50848 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968934.1 protein_id gnl|my_center|LOCUS_17910 51059 51322 gene locus_tag LOCUS_17920 51059 51322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 53133 51613 gene locus_tag LOCUS_17930 53133 51613 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090470.1 protein_id gnl|my_center|LOCUS_17930 53628 54605 gene locus_tag LOCUS_17940 53628 54605 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966168.1 protein_id gnl|my_center|LOCUS_17940 55115 54669 gene locus_tag LOCUS_17950 55115 54669 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090474.1 protein_id gnl|my_center|LOCUS_17950 56137 55139 gene locus_tag LOCUS_17960 56137 55139 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090475.1 protein_id gnl|my_center|LOCUS_17960 57377 56340 gene locus_tag LOCUS_17970 gene hemH 57377 56340 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090477.1 protein_id gnl|my_center|LOCUS_17970 57465 57863 gene locus_tag LOCUS_17980 57465 57863 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090478.1 protein_id gnl|my_center|LOCUS_17980 59990 57885 gene locus_tag LOCUS_17990 59990 57885 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090481.1 protein_id gnl|my_center|LOCUS_17990 60126 60401 gene locus_tag LOCUS_18000 60126 60401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090482.1 protein_id gnl|my_center|LOCUS_18000 61067 62209 gene locus_tag LOCUS_18010 61067 62209 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090484.1 protein_id gnl|my_center|LOCUS_18010 62470 62213 gene locus_tag LOCUS_18020 62470 62213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 62701 62525 gene locus_tag LOCUS_18030 62701 62525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 63294 63746 gene locus_tag LOCUS_18040 gene rnk 63294 63746 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968462.1 protein_id gnl|my_center|LOCUS_18040 64200 65636 gene locus_tag LOCUS_18050 64200 65636 CDS product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090487.1 protein_id gnl|my_center|LOCUS_18050 65982 65704 gene locus_tag LOCUS_18060 65982 65704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 67244 66231 gene locus_tag LOCUS_18070 67244 66231 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921554.1 protein_id gnl|my_center|LOCUS_18070 68269 67244 gene locus_tag LOCUS_18080 68269 67244 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 protein_id gnl|my_center|LOCUS_18080 69370 68432 gene locus_tag LOCUS_18090 69370 68432 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966160.1 protein_id gnl|my_center|LOCUS_18090 70239 69370 gene locus_tag LOCUS_18100 70239 69370 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090495.1 protein_id gnl|my_center|LOCUS_18100 71001 70246 gene locus_tag LOCUS_18110 71001 70246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173843.1 protein_id gnl|my_center|LOCUS_18110 72227 71622 gene locus_tag LOCUS_18120 72227 71622 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014491764.1 protein_id gnl|my_center|LOCUS_18120 72509 72946 gene locus_tag LOCUS_18130 72509 72946 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090502.1 protein_id gnl|my_center|LOCUS_18130 75232 72971 gene locus_tag LOCUS_18140 75232 72971 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921601.1 protein_id gnl|my_center|LOCUS_18140 75176 75376 gene locus_tag LOCUS_18150 75176 75376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 75504 75779 gene locus_tag LOCUS_18160 75504 75779 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083527.1 protein_id gnl|my_center|LOCUS_18160 77390 76023 gene locus_tag LOCUS_18170 gene nhaA 77390 76023 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_18170 77863 78168 gene locus_tag LOCUS_18180 77863 78168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 78288 78521 gene locus_tag LOCUS_18190 78288 78521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 78653 79735 gene locus_tag LOCUS_18200 78653 79735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 81921 79795 gene locus_tag LOCUS_18210 81921 79795 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933207.1 protein_id gnl|my_center|LOCUS_18210 82617 83525 gene locus_tag LOCUS_18220 82617 83525 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461413.1 protein_id gnl|my_center|LOCUS_18220 84362 83532 gene locus_tag LOCUS_18230 84362 83532 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933420.1 protein_id gnl|my_center|LOCUS_18230 85348 84359 gene locus_tag LOCUS_18240 85348 84359 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024407.1 protein_id gnl|my_center|LOCUS_18240 86009 85554 gene locus_tag LOCUS_18250 86009 85554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence18 1084 95 gene locus_tag LOCUS_18260 1084 95 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 protein_id gnl|my_center|LOCUS_18260 1543 1971 gene locus_tag LOCUS_18270 1543 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2822 1995 gene locus_tag LOCUS_18280 2822 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 3459 2827 gene locus_tag LOCUS_18290 3459 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124702.1 protein_id gnl|my_center|LOCUS_18290 5833 3473 gene locus_tag LOCUS_18300 5833 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 6849 5926 gene locus_tag LOCUS_18310 6849 5926 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_18310 7102 6869 gene locus_tag LOCUS_18320 7102 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 7734 7099 gene locus_tag LOCUS_18330 gene parA 7734 7099 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194446.1 protein_id gnl|my_center|LOCUS_18330 8004 7738 gene locus_tag LOCUS_18340 8004 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 8790 8440 gene locus_tag LOCUS_18350 8790 8440 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_18350 9128 8832 gene locus_tag LOCUS_18360 9128 8832 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_18360 9477 9229 gene locus_tag LOCUS_18370 9477 9229 CDS product carboxysome peptide B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124709.1 protein_id gnl|my_center|LOCUS_18370 9734 9477 gene locus_tag LOCUS_18380 9734 9477 CDS product carboxysome peptide A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124708.1 protein_id gnl|my_center|LOCUS_18380 11271 9748 gene locus_tag LOCUS_18390 11271 9748 CDS product carboxysome shell carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124707.1 protein_id gnl|my_center|LOCUS_18390 13976 11283 gene locus_tag LOCUS_18400 13976 11283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 14405 14079 gene locus_tag LOCUS_18410 14405 14079 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_18410 15918 14479 gene locus_tag LOCUS_18420 15918 14479 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_18420 15869 16027 gene locus_tag LOCUS_18430 15869 16027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 16133 17113 gene locus_tag LOCUS_18440 16133 17113 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_18440 17380 17054 gene locus_tag LOCUS_18450 17380 17054 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880524.1 protein_id gnl|my_center|LOCUS_18450 20490 17377 gene locus_tag LOCUS_18460 20490 17377 CDS product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880525.1 protein_id gnl|my_center|LOCUS_18460 21257 20475 gene locus_tag LOCUS_18470 21257 20475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 22939 21239 gene locus_tag LOCUS_18480 22939 21239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 23150 23443 gene locus_tag LOCUS_18490 23150 23443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 25594 24062 gene locus_tag LOCUS_18500 25594 24062 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088112.1 protein_id gnl|my_center|LOCUS_18500 26006 25737 gene locus_tag LOCUS_18510 26006 25737 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088117.1 protein_id gnl|my_center|LOCUS_18510 27679 26003 gene locus_tag LOCUS_18520 27679 26003 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167771412.1 protein_id gnl|my_center|LOCUS_18520 28510 27728 gene locus_tag LOCUS_18530 28510 27728 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088120.1 protein_id gnl|my_center|LOCUS_18530 29700 28579 gene locus_tag LOCUS_18540 29700 28579 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088122.1 protein_id gnl|my_center|LOCUS_18540 30945 30103 gene locus_tag LOCUS_18550 30945 30103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 32273 30942 gene locus_tag LOCUS_18560 32273 30942 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088123.1 protein_id gnl|my_center|LOCUS_18560 33666 32278 gene locus_tag LOCUS_18570 33666 32278 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967063.1 protein_id gnl|my_center|LOCUS_18570 34114 35550 gene locus_tag LOCUS_18580 34114 35550 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967062.1 protein_id gnl|my_center|LOCUS_18580 36055 35807 gene locus_tag LOCUS_18590 36055 35807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 36935 36519 gene locus_tag LOCUS_18600 gene rplQ 36935 36519 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088131.1 protein_id gnl|my_center|LOCUS_18600 38083 37052 gene locus_tag LOCUS_18610 38083 37052 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088132.1 protein_id gnl|my_center|LOCUS_18610 38575 38183 gene locus_tag LOCUS_18620 gene rpsK 38575 38183 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603045.1 protein_id gnl|my_center|LOCUS_18620 39053 38685 gene locus_tag LOCUS_18630 gene rpsM 39053 38685 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088133.1 protein_id gnl|my_center|LOCUS_18630 40093 39473 gene locus_tag LOCUS_18640 40093 39473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 41735 40563 gene locus_tag LOCUS_18650 41735 40563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556091.1 protein_id gnl|my_center|LOCUS_18650 43379 42048 gene locus_tag LOCUS_18660 gene secY 43379 42048 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088135.1 protein_id gnl|my_center|LOCUS_18660 44012 43527 gene locus_tag LOCUS_18670 gene rplO 44012 43527 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088136.1 protein_id gnl|my_center|LOCUS_18670 44326 44132 gene locus_tag LOCUS_18680 gene rpmD 44326 44132 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088137.1 protein_id gnl|my_center|LOCUS_18680 44979 44404 gene locus_tag LOCUS_18690 gene rpsE 44979 44404 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136332.1 protein_id gnl|my_center|LOCUS_18690 45453 45091 gene locus_tag LOCUS_18700 gene rplR 45453 45091 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603036.1 protein_id gnl|my_center|LOCUS_18700 45998 45465 gene locus_tag LOCUS_18710 gene rplF 45998 45465 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088138.1 protein_id gnl|my_center|LOCUS_18710 46467 46069 gene locus_tag LOCUS_18720 gene rpsH 46467 46069 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088139.1 protein_id gnl|my_center|LOCUS_18720 46786 46481 gene locus_tag LOCUS_18730 gene rpsN 46786 46481 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088140.1 protein_id gnl|my_center|LOCUS_18730 47387 46830 gene locus_tag LOCUS_18740 gene rplE 47387 46830 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088141.1 protein_id gnl|my_center|LOCUS_18740 47694 47380 gene locus_tag LOCUS_18750 gene rplX 47694 47380 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088142.1 protein_id gnl|my_center|LOCUS_18750 48062 47694 gene locus_tag LOCUS_18760 gene rplN 48062 47694 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603030.1 protein_id gnl|my_center|LOCUS_18760 48350 48102 gene locus_tag LOCUS_18770 gene rpsQ 48350 48102 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088143.1 protein_id gnl|my_center|LOCUS_18770 48568 48362 gene locus_tag LOCUS_18780 gene rpmC 48568 48362 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088144.1 protein_id gnl|my_center|LOCUS_18780 48987 48574 gene locus_tag LOCUS_18790 gene rplP 48987 48574 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008549252.1 protein_id gnl|my_center|LOCUS_18790 49762 49067 gene locus_tag LOCUS_18800 gene rpsC 49762 49067 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088146.1 protein_id gnl|my_center|LOCUS_18800 50168 49782 gene locus_tag LOCUS_18810 gene rplV 50168 49782 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088147.1 protein_id gnl|my_center|LOCUS_18810 50457 50179 gene locus_tag LOCUS_18820 gene rpsS 50457 50179 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136357.1 protein_id gnl|my_center|LOCUS_18820 51306 50473 gene locus_tag LOCUS_18830 gene rplB 51306 50473 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088148.1 protein_id gnl|my_center|LOCUS_18830 51631 51335 gene locus_tag LOCUS_18840 51631 51335 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088149.1 protein_id gnl|my_center|LOCUS_18840 52248 51628 gene locus_tag LOCUS_18850 gene rplD 52248 51628 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088150.1 protein_id gnl|my_center|LOCUS_18850 52993 52250 gene locus_tag LOCUS_18860 gene rplC 52993 52250 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088151.1 protein_id gnl|my_center|LOCUS_18860 53405 53097 gene locus_tag LOCUS_18870 gene rpsJ 53405 53097 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002712302.1 protein_id gnl|my_center|LOCUS_18870 54697 53507 gene locus_tag LOCUS_18880 gene tuf 54697 53507 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088152.1 protein_id gnl|my_center|LOCUS_18880 56809 54737 gene locus_tag LOCUS_18890 gene fusA 56809 54737 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088153.1 protein_id gnl|my_center|LOCUS_18890 57312 56842 gene locus_tag LOCUS_18900 gene rpsG 57312 56842 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088154.1 protein_id gnl|my_center|LOCUS_18900 57699 57328 gene locus_tag LOCUS_18910 gene rpsL 57699 57328 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603006.1 protein_id gnl|my_center|LOCUS_18910 59281 59036 gene locus_tag LOCUS_18920 59281 59036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 60075 59365 gene locus_tag LOCUS_18930 60075 59365 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_18930 61348 60230 gene locus_tag LOCUS_18940 61348 60230 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529437.1 protein_id gnl|my_center|LOCUS_18940 61519 62715 gene locus_tag LOCUS_18950 61519 62715 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088155.1 protein_id gnl|my_center|LOCUS_18950 63145 62891 gene locus_tag LOCUS_18960 63145 62891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 67675 63476 gene locus_tag LOCUS_18970 gene rpoC 67675 63476 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088158.1 protein_id gnl|my_center|LOCUS_18970 71977 67835 gene locus_tag LOCUS_18980 gene rpoB 71977 67835 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088159.1 protein_id gnl|my_center|LOCUS_18980 73028 72648 gene locus_tag LOCUS_18990 gene rplL 73028 72648 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088160.1 protein_id gnl|my_center|LOCUS_18990 73601 73083 gene locus_tag LOCUS_19000 gene rplJ 73601 73083 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_249163115.1 protein_id gnl|my_center|LOCUS_19000 75067 74375 gene locus_tag LOCUS_19010 gene rplA 75067 74375 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088163.1 protein_id gnl|my_center|LOCUS_19010 75502 75074 gene locus_tag LOCUS_19020 gene rplK 75502 75074 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088164.1 protein_id gnl|my_center|LOCUS_19020 76209 75679 gene locus_tag LOCUS_19030 gene nusG 76209 75679 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088165.1 protein_id gnl|my_center|LOCUS_19030 76431 76240 gene locus_tag LOCUS_19040 gene secE 76431 76240 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007611620.1 protein_id gnl|my_center|LOCUS_19040 76766 76691 gene locus_tag LOCUS_t00220 76766 76691 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 77096 77626 gene locus_tag LOCUS_19050 77096 77626 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973257.1 protein_id gnl|my_center|LOCUS_19050 77688 78650 gene locus_tag LOCUS_19060 77688 78650 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973258.1 protein_id gnl|my_center|LOCUS_19060 78910 81276 gene locus_tag LOCUS_19070 78910 81276 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966299.1 protein_id gnl|my_center|LOCUS_19070 81569 81754 gene locus_tag LOCUS_19080 81569 81754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence19 2904 235 gene locus_tag LOCUS_19090 2904 235 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087385.1 protein_id gnl|my_center|LOCUS_19090 3653 3090 gene locus_tag LOCUS_19100 3653 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 3902 5596 gene locus_tag LOCUS_19110 3902 5596 CDS product beta-1,6-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087383.1 protein_id gnl|my_center|LOCUS_19110 5936 5556 gene locus_tag LOCUS_19120 5936 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087382.1 protein_id gnl|my_center|LOCUS_19120 7304 6000 gene locus_tag LOCUS_19130 7304 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087380.1 protein_id gnl|my_center|LOCUS_19130 8113 7667 gene locus_tag LOCUS_19140 8113 7667 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085072.1 protein_id gnl|my_center|LOCUS_19140 9142 8417 gene locus_tag LOCUS_19150 9142 8417 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215732092.1 protein_id gnl|my_center|LOCUS_19150 10677 12035 gene locus_tag LOCUS_19160 gene glmU 10677 12035 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087379.1 protein_id gnl|my_center|LOCUS_19160 12309 12079 gene locus_tag LOCUS_19170 12309 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 12624 12803 gene locus_tag LOCUS_19180 12624 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 13090 12878 gene locus_tag LOCUS_19190 13090 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 13354 13184 gene locus_tag LOCUS_19200 13354 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 13803 13561 gene locus_tag LOCUS_19210 13803 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 14109 14705 gene locus_tag LOCUS_19220 14109 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921482.1 protein_id gnl|my_center|LOCUS_19220 16148 14994 gene locus_tag LOCUS_19230 16148 14994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 17284 17631 gene locus_tag LOCUS_19240 17284 17631 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123225.1 protein_id gnl|my_center|LOCUS_19240 17685 18458 gene locus_tag LOCUS_19250 17685 18458 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922416.1 protein_id gnl|my_center|LOCUS_19250 18483 18752 gene locus_tag LOCUS_19260 18483 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 18745 18966 gene locus_tag LOCUS_19270 18745 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 19113 19355 gene locus_tag LOCUS_19280 19113 19355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 19345 20241 gene locus_tag LOCUS_19290 19345 20241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 20238 22193 gene locus_tag LOCUS_19300 20238 22193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 22190 22696 gene locus_tag LOCUS_19310 22190 22696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 22693 23379 gene locus_tag LOCUS_19320 22693 23379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087777.1 protein_id gnl|my_center|LOCUS_19320 23721 25292 gene locus_tag LOCUS_19330 23721 25292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 25301 27952 gene locus_tag LOCUS_19340 25301 27952 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964263.1 protein_id gnl|my_center|LOCUS_19340 28038 29342 gene locus_tag LOCUS_19350 28038 29342 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018208816.1 protein_id gnl|my_center|LOCUS_19350 29339 29791 gene locus_tag LOCUS_19360 29339 29791 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085262.1 protein_id gnl|my_center|LOCUS_19360 29885 31486 gene locus_tag LOCUS_19370 29885 31486 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256199.1 protein_id gnl|my_center|LOCUS_19370 31519 31445 gene locus_tag LOCUS_t00230 31519 31445 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 31784 32449 gene locus_tag LOCUS_19380 31784 32449 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967576.1 protein_id gnl|my_center|LOCUS_19380 32605 32841 gene locus_tag LOCUS_19390 32605 32841 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087519.1 protein_id gnl|my_center|LOCUS_19390 33011 33526 gene locus_tag LOCUS_19400 gene tatB 33011 33526 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087518.1 protein_id gnl|my_center|LOCUS_19400 33523 34332 gene locus_tag LOCUS_19410 gene tatC 33523 34332 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087517.1 protein_id gnl|my_center|LOCUS_19410 34497 35936 gene locus_tag LOCUS_19420 gene serS 34497 35936 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087516.1 protein_id gnl|my_center|LOCUS_19420 35936 37261 gene locus_tag LOCUS_19430 35936 37261 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992237.1 protein_id gnl|my_center|LOCUS_19430 37476 38243 gene locus_tag LOCUS_19440 gene surE 37476 38243 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171844.1 protein_id gnl|my_center|LOCUS_19440 38805 38425 gene locus_tag LOCUS_19450 38805 38425 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087513.1 protein_id gnl|my_center|LOCUS_19450 39087 39740 gene locus_tag LOCUS_19460 39087 39740 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087512.1 protein_id gnl|my_center|LOCUS_19460 40006 41346 gene locus_tag LOCUS_19470 40006 41346 CDS product LysM peptidoglycan-binding domain-containing M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087511.1 protein_id gnl|my_center|LOCUS_19470 42445 41471 gene locus_tag LOCUS_19480 42445 41471 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087505.1 protein_id gnl|my_center|LOCUS_19480 42633 43019 gene locus_tag LOCUS_19490 gene yajC 42633 43019 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087504.1 protein_id gnl|my_center|LOCUS_19490 43063 44664 gene locus_tag LOCUS_19500 gene secD 43063 44664 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087503.1 protein_id gnl|my_center|LOCUS_19500 44681 45721 gene locus_tag LOCUS_19510 gene secF 44681 45721 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087502.1 protein_id gnl|my_center|LOCUS_19510 45718 46104 gene locus_tag LOCUS_19520 45718 46104 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087501.1 protein_id gnl|my_center|LOCUS_19520 46219 47106 gene locus_tag LOCUS_19530 46219 47106 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087500.1 protein_id gnl|my_center|LOCUS_19530 48155 47112 gene locus_tag LOCUS_19540 48155 47112 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921622.1 protein_id gnl|my_center|LOCUS_19540 49674 48241 gene locus_tag LOCUS_19550 gene trmFO 49674 48241 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087495.1 protein_id gnl|my_center|LOCUS_19550 49673 49888 gene locus_tag LOCUS_19560 49673 49888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 50879 49950 gene locus_tag LOCUS_19570 50879 49950 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170858.1 protein_id gnl|my_center|LOCUS_19570 51295 51669 gene locus_tag LOCUS_19580 51295 51669 CDS product DUF3597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171860.1 protein_id gnl|my_center|LOCUS_19580 52275 51994 gene locus_tag LOCUS_19590 52275 51994 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087485.1 protein_id gnl|my_center|LOCUS_19590 52542 52952 gene locus_tag LOCUS_19600 52542 52952 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087052.1 protein_id gnl|my_center|LOCUS_19600 54758 53007 gene locus_tag LOCUS_19610 54758 53007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 55240 55986 gene locus_tag LOCUS_19620 55240 55986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 56701 56024 gene locus_tag LOCUS_19630 gene aat 56701 56024 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087059.1 protein_id gnl|my_center|LOCUS_19630 57957 56869 gene locus_tag LOCUS_19640 57957 56869 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087060.1 protein_id gnl|my_center|LOCUS_19640 58394 57954 gene locus_tag LOCUS_19650 58394 57954 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087061.1 protein_id gnl|my_center|LOCUS_19650 59923 58391 gene locus_tag LOCUS_19660 59923 58391 CDS product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087062.1 protein_id gnl|my_center|LOCUS_19660 61405 60050 gene locus_tag LOCUS_19670 gene accC 61405 60050 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087063.1 protein_id gnl|my_center|LOCUS_19670 61913 61431 gene locus_tag LOCUS_19680 gene accB 61913 61431 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087064.1 protein_id gnl|my_center|LOCUS_19680 62446 61955 gene locus_tag LOCUS_19690 gene aroQ 62446 61955 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087065.1 protein_id gnl|my_center|LOCUS_19690 63569 62802 gene locus_tag LOCUS_19700 63569 62802 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087067.1 protein_id gnl|my_center|LOCUS_19700 64894 63608 gene locus_tag LOCUS_19710 64894 63608 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087068.1 protein_id gnl|my_center|LOCUS_19710 65272 66459 gene locus_tag LOCUS_19720 65272 66459 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087069.1 protein_id gnl|my_center|LOCUS_19720 66707 68827 gene locus_tag LOCUS_19730 66707 68827 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087787.1 protein_id gnl|my_center|LOCUS_19730 69889 73383 gene locus_tag LOCUS_19740 69889 73383 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088094.1 protein_id gnl|my_center|LOCUS_19740 73518 76199 gene locus_tag LOCUS_19750 73518 76199 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088084.1 protein_id gnl|my_center|LOCUS_19750 76814 76464 gene locus_tag LOCUS_19760 76814 76464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088083.1 protein_id gnl|my_center|LOCUS_19760 77852 77202 gene locus_tag LOCUS_19770 77852 77202 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083331.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence20 983 123 gene locus_tag LOCUS_19780 gene tesB 983 123 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174978.1 protein_id gnl|my_center|LOCUS_19780 1142 2362 gene locus_tag LOCUS_19790 1142 2362 CDS product ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083432.1 protein_id gnl|my_center|LOCUS_19790 2675 3925 gene locus_tag LOCUS_19800 2675 3925 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921599.1 protein_id gnl|my_center|LOCUS_19800 4039 6525 gene locus_tag LOCUS_19810 4039 6525 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083444.1 protein_id gnl|my_center|LOCUS_19810 6945 7778 gene locus_tag LOCUS_19820 6945 7778 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083445.1 protein_id gnl|my_center|LOCUS_19820 7872 8687 gene locus_tag LOCUS_19830 gene xth 7872 8687 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083446.1 protein_id gnl|my_center|LOCUS_19830 9243 8794 gene locus_tag LOCUS_19840 9243 8794 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083447.1 protein_id gnl|my_center|LOCUS_19840 10147 9461 gene locus_tag LOCUS_19850 10147 9461 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008142830.1 protein_id gnl|my_center|LOCUS_19850 10375 10923 gene locus_tag LOCUS_19860 10375 10923 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171578751.1 protein_id gnl|my_center|LOCUS_19860 11623 10991 gene locus_tag LOCUS_19870 11623 10991 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083450.1 protein_id gnl|my_center|LOCUS_19870 12366 11662 gene locus_tag LOCUS_19880 12366 11662 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967553.1 protein_id gnl|my_center|LOCUS_19880 13622 16255 gene locus_tag LOCUS_19890 gene leuS 13622 16255 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083454.1 protein_id gnl|my_center|LOCUS_19890 16242 16826 gene locus_tag LOCUS_19900 gene lptE 16242 16826 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083455.1 protein_id gnl|my_center|LOCUS_19900 16837 17865 gene locus_tag LOCUS_19910 gene holA 16837 17865 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083456.1 protein_id gnl|my_center|LOCUS_19910 18789 17905 gene locus_tag LOCUS_19920 18789 17905 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965125.1 protein_id gnl|my_center|LOCUS_19920 19887 19030 gene locus_tag LOCUS_19930 19887 19030 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083458.1 protein_id gnl|my_center|LOCUS_19930 20597 19884 gene locus_tag LOCUS_19940 gene rsmG 20597 19884 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178639.1 protein_id gnl|my_center|LOCUS_19940 22591 20720 gene locus_tag LOCUS_19950 gene mnmG 22591 20720 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083460.1 protein_id gnl|my_center|LOCUS_19950 24128 22758 gene locus_tag LOCUS_19960 gene mnmE 24128 22758 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083461.1 protein_id gnl|my_center|LOCUS_19960 24232 26271 gene locus_tag LOCUS_19970 24232 26271 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_19970 26440 26282 gene locus_tag LOCUS_19980 26440 26282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 27841 26576 gene locus_tag LOCUS_19990 gene rho 27841 26576 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083462.1 protein_id gnl|my_center|LOCUS_19990 28546 28124 gene locus_tag LOCUS_20000 gene hemJ 28546 28124 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_20000 28989 29819 gene locus_tag LOCUS_20010 28989 29819 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083464.1 protein_id gnl|my_center|LOCUS_20010 29827 30435 gene locus_tag LOCUS_20020 29827 30435 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083465.1 protein_id gnl|my_center|LOCUS_20020 30452 31051 gene locus_tag LOCUS_20030 gene coaE 30452 31051 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083466.1 protein_id gnl|my_center|LOCUS_20030 31141 31833 gene locus_tag LOCUS_20040 gene dnaQ 31141 31833 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083467.1 protein_id gnl|my_center|LOCUS_20040 32493 32014 gene locus_tag LOCUS_20050 gene secB 32493 32014 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083468.1 protein_id gnl|my_center|LOCUS_20050 32911 33615 gene locus_tag LOCUS_20060 32911 33615 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_20060 33881 35101 gene locus_tag LOCUS_20070 33881 35101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 35365 35679 gene locus_tag LOCUS_20080 35365 35679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 37067 35766 gene locus_tag LOCUS_20090 gene hslU 37067 35766 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083473.1 protein_id gnl|my_center|LOCUS_20090 37786 37232 gene locus_tag LOCUS_20100 gene hslV 37786 37232 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083476.1 protein_id gnl|my_center|LOCUS_20100 38158 38751 gene locus_tag LOCUS_20110 gene hisB 38158 38751 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083477.1 protein_id gnl|my_center|LOCUS_20110 38778 39302 gene locus_tag LOCUS_20120 38778 39302 CDS product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083478.1 protein_id gnl|my_center|LOCUS_20120 39299 39949 gene locus_tag LOCUS_20130 gene hisH 39299 39949 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083479.1 protein_id gnl|my_center|LOCUS_20130 39937 40686 gene locus_tag LOCUS_20140 gene hisA 39937 40686 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965127.1 protein_id gnl|my_center|LOCUS_20140 40705 41481 gene locus_tag LOCUS_20150 gene hisF 40705 41481 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083481.1 protein_id gnl|my_center|LOCUS_20150 41560 41883 gene locus_tag LOCUS_20160 41560 41883 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083482.1 protein_id gnl|my_center|LOCUS_20160 42021 42977 gene locus_tag LOCUS_20170 gene coaA 42021 42977 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027543772.1 protein_id gnl|my_center|LOCUS_20170 45344 43086 gene locus_tag LOCUS_20180 45344 43086 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965129.1 protein_id gnl|my_center|LOCUS_20180 47139 45583 gene locus_tag LOCUS_20190 47139 45583 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083488.1 protein_id gnl|my_center|LOCUS_20190 48161 47220 gene locus_tag LOCUS_20200 gene gshB 48161 47220 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083495.1 protein_id gnl|my_center|LOCUS_20200 48617 48210 gene locus_tag LOCUS_20210 48617 48210 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083496.1 protein_id gnl|my_center|LOCUS_20210 49557 48604 gene locus_tag LOCUS_20220 gene rsmI 49557 48604 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083497.1 protein_id gnl|my_center|LOCUS_20220 49823 51037 gene locus_tag LOCUS_20230 49823 51037 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000235.1 protein_id gnl|my_center|LOCUS_20230 51231 51305 gene locus_tag LOCUS_t00240 51231 51305 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 51614 51357 gene locus_tag LOCUS_20240 51614 51357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 52366 51692 gene locus_tag LOCUS_20250 52366 51692 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398389.1 protein_id gnl|my_center|LOCUS_20250 53990 52446 gene locus_tag LOCUS_20260 53990 52446 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172956.1 protein_id gnl|my_center|LOCUS_20260 54218 54781 gene locus_tag LOCUS_20270 54218 54781 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172955.1 protein_id gnl|my_center|LOCUS_20270 56171 54996 gene locus_tag LOCUS_20280 56171 54996 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_20280 57767 56286 gene locus_tag LOCUS_20290 57767 56286 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 protein_id gnl|my_center|LOCUS_20290 58325 59794 gene locus_tag LOCUS_20300 58325 59794 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089988.1 protein_id gnl|my_center|LOCUS_20300 59791 60837 gene locus_tag LOCUS_20310 59791 60837 CDS product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089989.1 protein_id gnl|my_center|LOCUS_20310 62482 60839 gene locus_tag LOCUS_20320 62482 60839 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083514069.1 protein_id gnl|my_center|LOCUS_20320 62775 63980 gene locus_tag LOCUS_20330 62775 63980 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_20330 63990 64322 gene locus_tag LOCUS_20340 63990 64322 CDS product sulfite:cytochrome C oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172935.1 protein_id gnl|my_center|LOCUS_20340 64580 64780 gene locus_tag LOCUS_20350 64580 64780 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008563500.1 protein_id gnl|my_center|LOCUS_20350 65553 64960 gene locus_tag LOCUS_20360 65553 64960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 65906 68914 gene locus_tag LOCUS_20370 gene putA 65906 68914 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089996.1 protein_id gnl|my_center|LOCUS_20370 69786 69175 gene locus_tag LOCUS_20380 69786 69175 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083848.1 protein_id gnl|my_center|LOCUS_20380 70433 70651 gene locus_tag LOCUS_20390 70433 70651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20390 70603 70827 gene locus_tag LOCUS_20400 70603 70827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 70909 71166 gene locus_tag LOCUS_20410 70909 71166 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535711.1 protein_id gnl|my_center|LOCUS_20410 71163 71618 gene locus_tag LOCUS_20420 71163 71618 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970313.1 protein_id gnl|my_center|LOCUS_20420 71956 72141 gene locus_tag LOCUS_20430 71956 72141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 73281 72544 gene locus_tag LOCUS_20440 73281 72544 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083849.1 protein_id gnl|my_center|LOCUS_20440 75025 73283 gene locus_tag LOCUS_20450 75025 73283 CDS product DUF3369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083850.1 protein_id gnl|my_center|LOCUS_20450 77502 75517 gene locus_tag LOCUS_20460 77502 75517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence21 332 2479 gene locus_tag LOCUS_20470 332 2479 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268707.1 protein_id gnl|my_center|LOCUS_20470 2719 3333 gene locus_tag LOCUS_20480 2719 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 4348 3842 gene locus_tag LOCUS_20490 4348 3842 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242238.1 protein_id gnl|my_center|LOCUS_20490 4934 4446 gene locus_tag LOCUS_20500 4934 4446 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192281448.1 protein_id gnl|my_center|LOCUS_20500 5155 5385 gene locus_tag LOCUS_20510 5155 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969104.1 protein_id gnl|my_center|LOCUS_20510 5620 6072 gene locus_tag LOCUS_20520 5620 6072 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089311.1 protein_id gnl|my_center|LOCUS_20520 6163 6729 gene locus_tag LOCUS_20530 6163 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 8610 7486 gene locus_tag LOCUS_20540 8610 7486 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087991.1 protein_id gnl|my_center|LOCUS_20540 9554 9000 gene locus_tag LOCUS_20550 9554 9000 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_20550 10104 9958 gene locus_tag LOCUS_20560 10104 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 10919 10485 gene locus_tag LOCUS_20570 10919 10485 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061352.1 protein_id gnl|my_center|LOCUS_20570 11165 11557 gene locus_tag LOCUS_20580 11165 11557 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021993.1 protein_id gnl|my_center|LOCUS_20580 12158 13294 gene locus_tag LOCUS_20590 12158 13294 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036647.1 protein_id gnl|my_center|LOCUS_20590 13388 14104 gene locus_tag LOCUS_20600 13388 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 14201 14434 gene locus_tag LOCUS_20610 14201 14434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 14732 15031 gene locus_tag LOCUS_20620 14732 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 15028 17214 gene locus_tag LOCUS_20630 15028 17214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 17211 17576 gene locus_tag LOCUS_20640 17211 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 17939 18169 gene locus_tag LOCUS_20650 17939 18169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 18246 18470 gene locus_tag LOCUS_20660 18246 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 18539 19429 gene locus_tag LOCUS_20670 18539 19429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 19404 19685 gene locus_tag LOCUS_20680 19404 19685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 22200 19690 gene locus_tag LOCUS_20690 22200 19690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 22375 22175 gene locus_tag LOCUS_20700 22375 22175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 24797 22527 gene locus_tag LOCUS_20710 24797 22527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 26511 25960 gene locus_tag LOCUS_20720 26511 25960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 27809 26814 gene locus_tag LOCUS_20730 27809 26814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 28957 31362 gene locus_tag LOCUS_20740 28957 31362 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 protein_id gnl|my_center|LOCUS_20740 31356 32498 gene locus_tag LOCUS_20750 31356 32498 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476039.1 protein_id gnl|my_center|LOCUS_20750 32495 34447 gene locus_tag LOCUS_20760 32495 34447 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051765.1 protein_id gnl|my_center|LOCUS_20760 34444 37494 gene locus_tag LOCUS_20770 34444 37494 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_20770 37497 38198 gene locus_tag LOCUS_20780 37497 38198 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_20780 38594 38518 gene locus_tag LOCUS_t00250 38594 38518 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39814 38723 gene locus_tag LOCUS_20790 39814 38723 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083664.1 protein_id gnl|my_center|LOCUS_20790 40241 40600 gene locus_tag LOCUS_20800 40241 40600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083660.1 protein_id gnl|my_center|LOCUS_20800 41010 40696 gene locus_tag LOCUS_20810 41010 40696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083655.1 protein_id gnl|my_center|LOCUS_20810 41372 41154 gene locus_tag LOCUS_20820 41372 41154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 41478 41744 gene locus_tag LOCUS_20830 gene rpsT 41478 41744 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083654.1 protein_id gnl|my_center|LOCUS_20830 43172 44506 gene locus_tag LOCUS_20840 gene dnaA 43172 44506 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083652.1 protein_id gnl|my_center|LOCUS_20840 44711 45829 gene locus_tag LOCUS_20850 gene dnaN 44711 45829 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083651.1 protein_id gnl|my_center|LOCUS_20850 46097 47254 gene locus_tag LOCUS_20860 gene recF 46097 47254 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083649.1 protein_id gnl|my_center|LOCUS_20860 47544 49985 gene locus_tag LOCUS_20870 gene gyrB 47544 49985 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083645.1 protein_id gnl|my_center|LOCUS_20870 50658 50092 gene locus_tag LOCUS_20880 50658 50092 CDS product PAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083984.1 protein_id gnl|my_center|LOCUS_20880 50702 50914 gene locus_tag LOCUS_20890 50702 50914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 52341 50971 gene locus_tag LOCUS_20900 52341 50971 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083983.1 protein_id gnl|my_center|LOCUS_20900 53008 56175 gene locus_tag LOCUS_20910 53008 56175 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921381.1 protein_id gnl|my_center|LOCUS_20910 56463 57389 gene locus_tag LOCUS_20920 56463 57389 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172821.1 protein_id gnl|my_center|LOCUS_20920 57392 58174 gene locus_tag LOCUS_20930 57392 58174 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083972.1 protein_id gnl|my_center|LOCUS_20930 58910 58239 gene locus_tag LOCUS_20940 gene pdeM 58910 58239 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000237.1 protein_id gnl|my_center|LOCUS_20940 61470 58978 gene locus_tag LOCUS_20950 61470 58978 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083967.1 protein_id gnl|my_center|LOCUS_20950 61789 63150 gene locus_tag LOCUS_20960 61789 63150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 63474 64397 gene locus_tag LOCUS_20970 gene htpX 63474 64397 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085237.1 protein_id gnl|my_center|LOCUS_20970 64975 67647 gene locus_tag LOCUS_20980 64975 67647 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088025.1 protein_id gnl|my_center|LOCUS_20980 68449 67781 gene locus_tag LOCUS_20990 68449 67781 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083722.1 protein_id gnl|my_center|LOCUS_20990 68732 68508 gene locus_tag LOCUS_21000 68732 68508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 68692 69222 gene locus_tag LOCUS_21010 68692 69222 CDS product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083725.1 protein_id gnl|my_center|LOCUS_21010 69927 69373 gene locus_tag LOCUS_21020 69927 69373 CDS product ActR/PrrA/RegA family redox response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463732.1 protein_id gnl|my_center|LOCUS_21020 71359 70019 gene locus_tag LOCUS_21030 71359 70019 CDS product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083727.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence22 765 2603 gene locus_tag LOCUS_21040 765 2603 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530880.1 protein_id gnl|my_center|LOCUS_21040 2603 7069 gene locus_tag LOCUS_21050 2603 7069 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972439.1 protein_id gnl|my_center|LOCUS_21050 8424 7210 gene locus_tag LOCUS_21060 8424 7210 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086242.1 protein_id gnl|my_center|LOCUS_21060 11473 9071 gene locus_tag LOCUS_21070 11473 9071 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180938212.1 protein_id gnl|my_center|LOCUS_21070 12676 12521 gene locus_tag LOCUS_21080 12676 12521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 14187 13048 gene locus_tag LOCUS_21090 14187 13048 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810851.1 protein_id gnl|my_center|LOCUS_21090 17093 14778 gene locus_tag LOCUS_21100 gene metE 17093 14778 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216166.1 protein_id gnl|my_center|LOCUS_21100 18038 17472 gene locus_tag LOCUS_21110 18038 17472 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703367.1 protein_id gnl|my_center|LOCUS_21110 18735 21575 gene locus_tag LOCUS_21120 18735 21575 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224745.1 protein_id gnl|my_center|LOCUS_21120 21639 22808 gene locus_tag LOCUS_21130 21639 22808 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224744.1 protein_id gnl|my_center|LOCUS_21130 23423 22977 gene locus_tag LOCUS_21140 23423 22977 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970165.1 protein_id gnl|my_center|LOCUS_21140 23707 24177 gene locus_tag LOCUS_21150 23707 24177 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971197.1 protein_id gnl|my_center|LOCUS_21150 24320 24844 gene locus_tag LOCUS_21160 24320 24844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 26413 25373 gene locus_tag LOCUS_21170 26413 25373 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_21170 27009 26557 gene locus_tag LOCUS_21180 27009 26557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 27459 28139 gene locus_tag LOCUS_21190 27459 28139 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965227.1 protein_id gnl|my_center|LOCUS_21190 29207 28170 gene locus_tag LOCUS_21200 29207 28170 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083843.1 protein_id gnl|my_center|LOCUS_21200 29852 29262 gene locus_tag LOCUS_21210 29852 29262 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083844.1 protein_id gnl|my_center|LOCUS_21210 30255 31757 gene locus_tag LOCUS_21220 gene hisS 30255 31757 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325488.1 protein_id gnl|my_center|LOCUS_21220 32229 32492 gene locus_tag LOCUS_21230 32229 32492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 33114 35144 gene locus_tag LOCUS_21240 33114 35144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 35155 35679 gene locus_tag LOCUS_21250 35155 35679 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_21250 35682 36527 gene locus_tag LOCUS_21260 35682 36527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 36524 37333 gene locus_tag LOCUS_21270 36524 37333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 37343 38659 gene locus_tag LOCUS_21280 37343 38659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 38664 40592 gene locus_tag LOCUS_21290 38664 40592 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_21290 40593 40856 gene locus_tag LOCUS_21300 40593 40856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 40853 43465 gene locus_tag LOCUS_21310 40853 43465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 43684 44337 gene locus_tag LOCUS_21320 43684 44337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_21320 44347 44634 gene locus_tag LOCUS_21330 44347 44634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_21330 44639 45772 gene locus_tag LOCUS_21340 44639 45772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 45783 46496 gene locus_tag LOCUS_21350 45783 46496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 46515 46820 gene locus_tag LOCUS_21360 46515 46820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 46820 47197 gene locus_tag LOCUS_21370 46820 47197 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_21370 47205 49709 gene locus_tag LOCUS_21380 47205 49709 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_21380 49711 53205 gene locus_tag LOCUS_21390 49711 53205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 53207 55450 gene locus_tag LOCUS_21400 53207 55450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258039.1 protein_id gnl|my_center|LOCUS_21400 55490 58756 gene locus_tag LOCUS_21410 55490 58756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 58766 59062 gene locus_tag LOCUS_21420 58766 59062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 60050 59259 gene locus_tag LOCUS_21430 60050 59259 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836201.1 protein_id gnl|my_center|LOCUS_21430 61237 60404 gene locus_tag LOCUS_21440 gene pyrH 61237 60404 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979322.1 protein_id gnl|my_center|LOCUS_21440 62062 61250 gene locus_tag LOCUS_21450 62062 61250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 63030 62563 gene locus_tag LOCUS_21460 63030 62563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 64570 63377 gene locus_tag LOCUS_21470 64570 63377 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651240.1 protein_id gnl|my_center|LOCUS_21470 65185 64775 gene locus_tag LOCUS_21480 65185 64775 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811678.1 protein_id gnl|my_center|LOCUS_21480 65521 65724 gene locus_tag LOCUS_21490 65521 65724 CDS product KGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508120.1 protein_id gnl|my_center|LOCUS_21490 66897 65911 gene locus_tag LOCUS_21500 66897 65911 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_21500 67520 66894 gene locus_tag LOCUS_21510 gene gstA 67520 66894 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 protein_id gnl|my_center|LOCUS_21510 67926 68480 gene locus_tag LOCUS_21520 67926 68480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 69020 68574 gene locus_tag LOCUS_21530 69020 68574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 69357 69034 gene locus_tag LOCUS_21540 69357 69034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence23 694 618 gene locus_tag LOCUS_t00260 694 618 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 912 1211 gene locus_tag LOCUS_21550 912 1211 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087690.1 protein_id gnl|my_center|LOCUS_21550 1348 2589 gene locus_tag LOCUS_21560 gene pepT 1348 2589 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 protein_id gnl|my_center|LOCUS_21560 3352 2621 gene locus_tag LOCUS_21570 3352 2621 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965090.1 protein_id gnl|my_center|LOCUS_21570 3651 3962 gene locus_tag LOCUS_21580 3651 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 4865 4008 gene locus_tag LOCUS_21590 4865 4008 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966304.1 protein_id gnl|my_center|LOCUS_21590 5095 5313 gene locus_tag LOCUS_21600 5095 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 5477 5401 gene locus_tag LOCUS_t00270 5477 5401 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8126 5697 gene locus_tag LOCUS_21610 gene lon 8126 5697 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087707.1 protein_id gnl|my_center|LOCUS_21610 9706 8432 gene locus_tag LOCUS_21620 gene clpX 9706 8432 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008547851.1 protein_id gnl|my_center|LOCUS_21620 10794 10156 gene locus_tag LOCUS_21630 10794 10156 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087708.1 protein_id gnl|my_center|LOCUS_21630 10892 11101 gene locus_tag LOCUS_21640 10892 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 12532 11171 gene locus_tag LOCUS_21650 gene tig 12532 11171 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087709.1 protein_id gnl|my_center|LOCUS_21650 12769 12685 gene locus_tag LOCUS_t00280 12769 12685 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13440 14546 gene locus_tag LOCUS_21660 13440 14546 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087710.1 protein_id gnl|my_center|LOCUS_21660 16063 14564 gene locus_tag LOCUS_21670 16063 14564 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966309.1 protein_id gnl|my_center|LOCUS_21670 16410 16748 gene locus_tag LOCUS_21680 16410 16748 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603495.1 protein_id gnl|my_center|LOCUS_21680 17000 18409 gene locus_tag LOCUS_21690 gene glnA 17000 18409 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087712.1 protein_id gnl|my_center|LOCUS_21690 18572 19705 gene locus_tag LOCUS_21700 18572 19705 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966312.1 protein_id gnl|my_center|LOCUS_21700 20114 19812 gene locus_tag LOCUS_21710 20114 19812 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087723.1 protein_id gnl|my_center|LOCUS_21710 20869 20357 gene locus_tag LOCUS_21720 20869 20357 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087797.1 protein_id gnl|my_center|LOCUS_21720 21634 21299 gene locus_tag LOCUS_21730 21634 21299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 21929 22990 gene locus_tag LOCUS_21740 gene hemB 21929 22990 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 protein_id gnl|my_center|LOCUS_21740 23121 23660 gene locus_tag LOCUS_21750 23121 23660 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171628.1 protein_id gnl|my_center|LOCUS_21750 23742 24521 gene locus_tag LOCUS_21760 23742 24521 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087800.1 protein_id gnl|my_center|LOCUS_21760 26011 24644 gene locus_tag LOCUS_21770 26011 24644 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087805.1 protein_id gnl|my_center|LOCUS_21770 26200 26649 gene locus_tag LOCUS_21780 26200 26649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 26872 26606 gene locus_tag LOCUS_21790 26872 26606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087843.1 protein_id gnl|my_center|LOCUS_21790 27694 27575 gene locus_tag LOCUS_21800 27694 27575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 29797 28313 gene locus_tag LOCUS_21810 gene gatB 29797 28313 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087847.1 protein_id gnl|my_center|LOCUS_21810 31251 29872 gene locus_tag LOCUS_21820 31251 29872 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 protein_id gnl|my_center|LOCUS_21820 31718 31413 gene locus_tag LOCUS_21830 31718 31413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087848.1 protein_id gnl|my_center|LOCUS_21830 33190 31712 gene locus_tag LOCUS_21840 gene gatA 33190 31712 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087849.1 protein_id gnl|my_center|LOCUS_21840 33393 33187 gene locus_tag LOCUS_21850 33393 33187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 33696 33409 gene locus_tag LOCUS_21860 gene gatC 33696 33409 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087850.1 protein_id gnl|my_center|LOCUS_21860 33982 34482 gene locus_tag LOCUS_21870 gene ruvX 33982 34482 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171591.1 protein_id gnl|my_center|LOCUS_21870 35264 34473 gene locus_tag LOCUS_21880 35264 34473 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087856.1 protein_id gnl|my_center|LOCUS_21880 36916 35276 gene locus_tag LOCUS_21890 36916 35276 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087857.1 protein_id gnl|my_center|LOCUS_21890 37088 38041 gene locus_tag LOCUS_21900 37088 38041 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087859.1 protein_id gnl|my_center|LOCUS_21900 38309 39610 gene locus_tag LOCUS_21910 38309 39610 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171586.1 protein_id gnl|my_center|LOCUS_21910 39719 40312 gene locus_tag LOCUS_21920 gene plsY 39719 40312 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087861.1 protein_id gnl|my_center|LOCUS_21920 40489 41619 gene locus_tag LOCUS_21930 gene dprA 40489 41619 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087864.1 protein_id gnl|my_center|LOCUS_21930 42389 41652 gene locus_tag LOCUS_21940 42389 41652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 43026 44276 gene locus_tag LOCUS_21950 43026 44276 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171076.1 protein_id gnl|my_center|LOCUS_21950 44457 45995 gene locus_tag LOCUS_21960 44457 45995 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086847.1 protein_id gnl|my_center|LOCUS_21960 46144 47328 gene locus_tag LOCUS_21970 gene alr 46144 47328 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967543.1 protein_id gnl|my_center|LOCUS_21970 47338 48789 gene locus_tag LOCUS_21980 gene radA 47338 48789 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086838.1 protein_id gnl|my_center|LOCUS_21980 49057 49686 gene locus_tag LOCUS_21990 49057 49686 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086837.1 protein_id gnl|my_center|LOCUS_21990 49745 51259 gene locus_tag LOCUS_22000 gene purF 49745 51259 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086836.1 protein_id gnl|my_center|LOCUS_22000 51513 51289 gene locus_tag LOCUS_22010 51513 51289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 51507 52250 gene locus_tag LOCUS_22020 51507 52250 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086835.1 protein_id gnl|my_center|LOCUS_22020 54002 52626 gene locus_tag LOCUS_22030 gene der 54002 52626 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086828.1 protein_id gnl|my_center|LOCUS_22030 54581 54057 gene locus_tag LOCUS_22040 54581 54057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086827.1 protein_id gnl|my_center|LOCUS_22040 55273 54620 gene locus_tag LOCUS_22050 55273 54620 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086826.1 protein_id gnl|my_center|LOCUS_22050 57189 55381 gene locus_tag LOCUS_22060 57189 55381 CDS product di-heme-cytochrome C peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114647.1 protein_id gnl|my_center|LOCUS_22060 58188 57364 gene locus_tag LOCUS_22070 gene panB 58188 57364 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086824.1 protein_id gnl|my_center|LOCUS_22070 58774 58190 gene locus_tag LOCUS_22080 58774 58190 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086823.1 protein_id gnl|my_center|LOCUS_22080 58960 59256 gene locus_tag LOCUS_22090 58960 59256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 60981 59314 gene locus_tag LOCUS_22100 60981 59314 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086821.1 protein_id gnl|my_center|LOCUS_22100 61119 61433 gene locus_tag LOCUS_22110 gene sugE 61119 61433 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171053.1 protein_id gnl|my_center|LOCUS_22110 62427 61426 gene locus_tag LOCUS_22120 62427 61426 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086819.1 protein_id gnl|my_center|LOCUS_22120 63197 62442 gene locus_tag LOCUS_22130 63197 62442 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086818.1 protein_id gnl|my_center|LOCUS_22130 63732 63370 gene locus_tag LOCUS_22140 63732 63370 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967551.1 protein_id gnl|my_center|LOCUS_22140 64078 66117 gene locus_tag LOCUS_22150 gene thrS 64078 66117 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832605.1 protein_id gnl|my_center|LOCUS_22150 66264 66827 gene locus_tag LOCUS_22160 66264 66827 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157335780.1 protein_id gnl|my_center|LOCUS_22160 67507 67010 gene locus_tag LOCUS_22170 67507 67010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 68173 67616 gene locus_tag LOCUS_22180 68173 67616 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529619.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence24 1227 904 gene locus_tag LOCUS_22190 1227 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 3373 1883 gene locus_tag LOCUS_22200 3373 1883 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085036.1 protein_id gnl|my_center|LOCUS_22200 3839 3630 gene locus_tag LOCUS_22210 3839 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 4003 4860 gene locus_tag LOCUS_22220 4003 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 5464 4994 gene locus_tag LOCUS_22230 5464 4994 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084076.1 protein_id gnl|my_center|LOCUS_22230 6053 5559 gene locus_tag LOCUS_22240 6053 5559 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084075.1 protein_id gnl|my_center|LOCUS_22240 7345 6050 gene locus_tag LOCUS_22250 gene hisD 7345 6050 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084074.1 protein_id gnl|my_center|LOCUS_22250 8772 7480 gene locus_tag LOCUS_22260 gene murA 8772 7480 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530201.1 protein_id gnl|my_center|LOCUS_22260 9374 9448 gene locus_tag LOCUS_t00290 9374 9448 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9791 10462 gene locus_tag LOCUS_22270 9791 10462 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084022.1 protein_id gnl|my_center|LOCUS_22270 10743 11768 gene locus_tag LOCUS_22280 gene bioB 10743 11768 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084890.1 protein_id gnl|my_center|LOCUS_22280 12079 13308 gene locus_tag LOCUS_22290 gene hemA 12079 13308 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084018.1 protein_id gnl|my_center|LOCUS_22290 14076 13426 gene locus_tag LOCUS_22300 14076 13426 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083218.1 protein_id gnl|my_center|LOCUS_22300 14897 14364 gene locus_tag LOCUS_22310 14897 14364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173697.1 protein_id gnl|my_center|LOCUS_22310 15418 15819 gene locus_tag LOCUS_22320 15418 15819 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109866586.1 protein_id gnl|my_center|LOCUS_22320 15888 16631 gene locus_tag LOCUS_22330 15888 16631 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084006.1 protein_id gnl|my_center|LOCUS_22330 16689 16916 gene locus_tag LOCUS_22340 16689 16916 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007599451.1 protein_id gnl|my_center|LOCUS_22340 16978 17535 gene locus_tag LOCUS_22350 16978 17535 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084005.1 protein_id gnl|my_center|LOCUS_22350 17543 18028 gene locus_tag LOCUS_22360 17543 18028 CDS product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084004.1 protein_id gnl|my_center|LOCUS_22360 18372 18635 gene locus_tag LOCUS_22370 18372 18635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22370 18651 18854 gene locus_tag LOCUS_22380 18651 18854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22380 18993 18805 gene locus_tag LOCUS_22390 18993 18805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 19022 21097 gene locus_tag LOCUS_22400 19022 21097 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090149.1 protein_id gnl|my_center|LOCUS_22400 21801 21376 gene locus_tag LOCUS_22410 21801 21376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 22241 22053 gene locus_tag LOCUS_22420 22241 22053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 24479 23319 gene locus_tag LOCUS_22430 gene hemW 24479 23319 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172453.1 protein_id gnl|my_center|LOCUS_22430 25101 24466 gene locus_tag LOCUS_22440 gene rdgB 25101 24466 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083500.1 protein_id gnl|my_center|LOCUS_22440 25861 25148 gene locus_tag LOCUS_22450 gene rph 25861 25148 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083501.1 protein_id gnl|my_center|LOCUS_22450 26038 27126 gene locus_tag LOCUS_22460 gene hrcA 26038 27126 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083502.1 protein_id gnl|my_center|LOCUS_22460 27215 27808 gene locus_tag LOCUS_22470 gene grpE 27215 27808 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083503.1 protein_id gnl|my_center|LOCUS_22470 29046 28108 gene locus_tag LOCUS_22480 29046 28108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965133.1 protein_id gnl|my_center|LOCUS_22480 29468 31366 gene locus_tag LOCUS_22490 gene dnaK 29468 31366 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083506.1 protein_id gnl|my_center|LOCUS_22490 31524 32660 gene locus_tag LOCUS_22500 gene dnaJ 31524 32660 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083507.1 protein_id gnl|my_center|LOCUS_22500 32850 33356 gene locus_tag LOCUS_22510 32850 33356 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598495.1 protein_id gnl|my_center|LOCUS_22510 33572 34165 gene locus_tag LOCUS_22520 33572 34165 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083508.1 protein_id gnl|my_center|LOCUS_22520 34310 35080 gene locus_tag LOCUS_22530 gene dapB 34310 35080 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965144.1 protein_id gnl|my_center|LOCUS_22530 35104 35727 gene locus_tag LOCUS_22540 35104 35727 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083512.1 protein_id gnl|my_center|LOCUS_22540 36768 35863 gene locus_tag LOCUS_22550 36768 35863 CDS product bifunctional helix-turn-helix domain-containing protein/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083513.1 protein_id gnl|my_center|LOCUS_22550 37348 36824 gene locus_tag LOCUS_22560 37348 36824 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_22560 37366 38274 gene locus_tag LOCUS_22570 37366 38274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 40135 38432 gene locus_tag LOCUS_22580 gene rpsA 40135 38432 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027546860.1 protein_id gnl|my_center|LOCUS_22580 41277 40570 gene locus_tag LOCUS_22590 41277 40570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 41943 41305 gene locus_tag LOCUS_22600 gene cmk 41943 41305 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083564.1 protein_id gnl|my_center|LOCUS_22600 43289 41940 gene locus_tag LOCUS_22610 gene aroA 43289 41940 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965151.1 protein_id gnl|my_center|LOCUS_22610 43436 43849 gene locus_tag LOCUS_22620 43436 43849 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083562.1 protein_id gnl|my_center|LOCUS_22620 44030 44105 gene locus_tag LOCUS_t00300 44030 44105 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 44350 44874 gene locus_tag LOCUS_22630 44350 44874 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083554.1 protein_id gnl|my_center|LOCUS_22630 44973 45239 gene locus_tag LOCUS_22640 44973 45239 CDS product DUF1150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083553.1 protein_id gnl|my_center|LOCUS_22640 45373 47217 gene locus_tag LOCUS_22650 gene ilvD 45373 47217 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087307.1 protein_id gnl|my_center|LOCUS_22650 48019 47558 gene locus_tag LOCUS_22660 gene ptsN 48019 47558 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083550.1 protein_id gnl|my_center|LOCUS_22660 48863 48267 gene locus_tag LOCUS_22670 gene raiA 48863 48267 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083549.1 protein_id gnl|my_center|LOCUS_22670 50548 48920 gene locus_tag LOCUS_22680 gene rpoN 50548 48920 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083548.1 protein_id gnl|my_center|LOCUS_22680 51137 50742 gene locus_tag LOCUS_22690 51137 50742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 51305 51607 gene locus_tag LOCUS_22700 51305 51607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 52663 51662 gene locus_tag LOCUS_22710 gene lptB 52663 51662 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083547.1 protein_id gnl|my_center|LOCUS_22710 53756 53079 gene locus_tag LOCUS_22720 53756 53079 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965157.1 protein_id gnl|my_center|LOCUS_22720 54409 53753 gene locus_tag LOCUS_22730 gene lptC 54409 53753 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083545.1 protein_id gnl|my_center|LOCUS_22730 55245 54625 gene locus_tag LOCUS_22740 55245 54625 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_22740 55582 55944 gene locus_tag LOCUS_22750 55582 55944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 56740 56147 gene locus_tag LOCUS_22760 56740 56147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 57142 59166 gene locus_tag LOCUS_22770 57142 59166 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556205.1 protein_id gnl|my_center|LOCUS_22770 59163 59843 gene locus_tag LOCUS_22780 59163 59843 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387954.1 protein_id gnl|my_center|LOCUS_22780 60798 59959 gene locus_tag LOCUS_22790 60798 59959 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965652.1 protein_id gnl|my_center|LOCUS_22790 62459 62377 gene locus_tag LOCUS_t00310 62459 62377 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 62641 63672 gene locus_tag LOCUS_22800 62641 63672 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_22800 63880 64551 gene locus_tag LOCUS_22810 63880 64551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 65240 64596 gene locus_tag LOCUS_22820 65240 64596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 66132 65212 gene locus_tag LOCUS_22830 66132 65212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence25 316 89 gene locus_tag LOCUS_22840 316 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 212 1750 gene locus_tag LOCUS_22850 212 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2308 1766 gene locus_tag LOCUS_22860 2308 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2712 2939 gene locus_tag LOCUS_22870 2712 2939 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384747.1 protein_id gnl|my_center|LOCUS_22870 4987 3704 gene locus_tag LOCUS_22880 4987 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 5753 5109 gene locus_tag LOCUS_22890 5753 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 6411 5857 gene locus_tag LOCUS_22900 6411 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 7283 7447 gene locus_tag LOCUS_22910 7283 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 8183 10246 gene locus_tag LOCUS_22920 8183 10246 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250346.1 protein_id gnl|my_center|LOCUS_22920 10304 10525 gene locus_tag LOCUS_22930 10304 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 11802 10624 gene locus_tag LOCUS_22940 11802 10624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 12623 11799 gene locus_tag LOCUS_22950 12623 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 13011 13238 gene locus_tag LOCUS_22960 13011 13238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 13557 13255 gene locus_tag LOCUS_22970 13557 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 14600 15544 gene locus_tag LOCUS_22980 14600 15544 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965435.1 protein_id gnl|my_center|LOCUS_22980 16463 15645 gene locus_tag LOCUS_22990 16463 15645 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090079.1 protein_id gnl|my_center|LOCUS_22990 17002 17211 gene locus_tag LOCUS_23000 17002 17211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 19554 17404 gene locus_tag LOCUS_23010 gene rpoD 19554 17404 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090084.1 protein_id gnl|my_center|LOCUS_23010 22161 20257 gene locus_tag LOCUS_23020 22161 20257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 22390 22938 gene locus_tag LOCUS_23030 22390 22938 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090086.1 protein_id gnl|my_center|LOCUS_23030 23581 23417 gene locus_tag LOCUS_23040 23581 23417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 24383 23931 gene locus_tag LOCUS_23050 24383 23931 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090104.1 protein_id gnl|my_center|LOCUS_23050 24482 25696 gene locus_tag LOCUS_23060 gene carA 24482 25696 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090106.1 protein_id gnl|my_center|LOCUS_23060 26250 25756 gene locus_tag LOCUS_23070 26250 25756 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547661.1 protein_id gnl|my_center|LOCUS_23070 27122 27049 gene locus_tag LOCUS_t00320 27122 27049 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27522 30992 gene locus_tag LOCUS_23080 gene carB 27522 30992 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090112.1 protein_id gnl|my_center|LOCUS_23080 31316 31792 gene locus_tag LOCUS_23090 gene greA 31316 31792 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090113.1 protein_id gnl|my_center|LOCUS_23090 32065 32463 gene locus_tag LOCUS_23100 32065 32463 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 protein_id gnl|my_center|LOCUS_23100 32984 32505 gene locus_tag LOCUS_23110 32984 32505 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157328319.1 protein_id gnl|my_center|LOCUS_23110 33244 34209 gene locus_tag LOCUS_23120 gene trxB 33244 34209 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090115.1 protein_id gnl|my_center|LOCUS_23120 34215 35108 gene locus_tag LOCUS_23130 34215 35108 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172837.1 protein_id gnl|my_center|LOCUS_23130 36042 35362 gene locus_tag LOCUS_23140 36042 35362 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547672.1 protein_id gnl|my_center|LOCUS_23140 36466 36236 gene locus_tag LOCUS_23150 36466 36236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 36813 36661 gene locus_tag LOCUS_23160 36813 36661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 38801 37593 gene locus_tag LOCUS_23170 38801 37593 CDS product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089365.1 protein_id gnl|my_center|LOCUS_23170 39093 40649 gene locus_tag LOCUS_23180 39093 40649 CDS product DUF4403 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089383.1 protein_id gnl|my_center|LOCUS_23180 41383 40865 gene locus_tag LOCUS_23190 41383 40865 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089389.1 protein_id gnl|my_center|LOCUS_23190 41828 41628 gene locus_tag LOCUS_23200 41828 41628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 42149 42580 gene locus_tag LOCUS_23210 42149 42580 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966407.1 protein_id gnl|my_center|LOCUS_23210 44079 42598 gene locus_tag LOCUS_23220 44079 42598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965503.1 protein_id gnl|my_center|LOCUS_23220 44351 45367 gene locus_tag LOCUS_23230 44351 45367 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089395.1 protein_id gnl|my_center|LOCUS_23230 45358 45555 gene locus_tag LOCUS_23240 gene thiS 45358 45555 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089396.1 protein_id gnl|my_center|LOCUS_23240 45621 46403 gene locus_tag LOCUS_23250 45621 46403 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089397.1 protein_id gnl|my_center|LOCUS_23250 46390 46998 gene locus_tag LOCUS_23260 46390 46998 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089398.1 protein_id gnl|my_center|LOCUS_23260 47008 47394 gene locus_tag LOCUS_23270 47008 47394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 47429 49369 gene locus_tag LOCUS_23280 gene thiC 47429 49369 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089399.1 protein_id gnl|my_center|LOCUS_23280 49478 50104 gene locus_tag LOCUS_23290 49478 50104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 50237 51184 gene locus_tag LOCUS_23300 50237 51184 CDS product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295677.1 protein_id gnl|my_center|LOCUS_23300 51873 51439 gene locus_tag LOCUS_23310 51873 51439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966402.1 protein_id gnl|my_center|LOCUS_23310 51770 52036 gene locus_tag LOCUS_23320 51770 52036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 52300 52554 gene locus_tag LOCUS_23330 52300 52554 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089412.1 protein_id gnl|my_center|LOCUS_23330 52717 54810 gene locus_tag LOCUS_23340 52717 54810 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083208.1 protein_id gnl|my_center|LOCUS_23340 55739 55257 gene locus_tag LOCUS_23350 gene bfr 55739 55257 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089420.1 protein_id gnl|my_center|LOCUS_23350 56464 56766 gene locus_tag LOCUS_23360 56464 56766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 56968 57270 gene locus_tag LOCUS_23370 56968 57270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089423.1 protein_id gnl|my_center|LOCUS_23370 58603 57341 gene locus_tag LOCUS_23380 58603 57341 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089424.1 protein_id gnl|my_center|LOCUS_23380 59192 58605 gene locus_tag LOCUS_23390 59192 58605 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086552.1 protein_id gnl|my_center|LOCUS_23390 60084 59314 gene locus_tag LOCUS_23400 gene tam 60084 59314 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530924.1 protein_id gnl|my_center|LOCUS_23400 62177 60126 gene locus_tag LOCUS_23410 62177 60126 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106714628.1 protein_id gnl|my_center|LOCUS_23410 62247 62447 gene locus_tag LOCUS_23420 62247 62447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence26 522 842 gene locus_tag LOCUS_23430 522 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 847 2442 gene locus_tag LOCUS_23440 847 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 2439 3185 gene locus_tag LOCUS_23450 2439 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 3275 4099 gene locus_tag LOCUS_23460 3275 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 4883 4653 gene locus_tag LOCUS_23470 4883 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 5381 4977 gene locus_tag LOCUS_23480 5381 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 6485 6898 gene locus_tag LOCUS_23490 6485 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 6895 7323 gene locus_tag LOCUS_23500 6895 7323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 7501 7425 gene locus_tag LOCUS_t00330 7501 7425 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8194 7781 gene locus_tag LOCUS_23510 8194 7781 CDS product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090130.1 protein_id gnl|my_center|LOCUS_23510 8774 8394 gene locus_tag LOCUS_23520 8774 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 9037 12003 gene locus_tag LOCUS_23530 9037 12003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 12715 12065 gene locus_tag LOCUS_23540 12715 12065 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089829.1 protein_id gnl|my_center|LOCUS_23540 13482 12772 gene locus_tag LOCUS_23550 13482 12772 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089830.1 protein_id gnl|my_center|LOCUS_23550 13793 15724 gene locus_tag LOCUS_23560 13793 15724 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921541.1 protein_id gnl|my_center|LOCUS_23560 16577 15759 gene locus_tag LOCUS_23570 16577 15759 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089840.1 protein_id gnl|my_center|LOCUS_23570 17491 16577 gene locus_tag LOCUS_23580 17491 16577 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089841.1 protein_id gnl|my_center|LOCUS_23580 18636 17488 gene locus_tag LOCUS_23590 18636 17488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089842.1 protein_id gnl|my_center|LOCUS_23590 18790 19893 gene locus_tag LOCUS_23600 18790 19893 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089845.1 protein_id gnl|my_center|LOCUS_23600 20225 20040 gene locus_tag LOCUS_23610 20225 20040 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008131172.1 protein_id gnl|my_center|LOCUS_23610 20509 22389 gene locus_tag LOCUS_23620 20509 22389 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089779.1 protein_id gnl|my_center|LOCUS_23620 22628 22834 gene locus_tag LOCUS_23630 22628 22834 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089847.1 protein_id gnl|my_center|LOCUS_23630 23045 23533 gene locus_tag LOCUS_23640 gene purE 23045 23533 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089851.1 protein_id gnl|my_center|LOCUS_23640 23530 24642 gene locus_tag LOCUS_23650 23530 24642 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089852.1 protein_id gnl|my_center|LOCUS_23650 27359 24885 gene locus_tag LOCUS_23660 27359 24885 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114936.1 protein_id gnl|my_center|LOCUS_23660 28480 27500 gene locus_tag LOCUS_23670 28480 27500 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836262.1 protein_id gnl|my_center|LOCUS_23670 29076 28576 gene locus_tag LOCUS_23680 29076 28576 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836263.1 protein_id gnl|my_center|LOCUS_23680 30069 29353 gene locus_tag LOCUS_23690 gene aqpZ 30069 29353 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089853.1 protein_id gnl|my_center|LOCUS_23690 30334 30621 gene locus_tag LOCUS_23700 gene rpsU 30334 30621 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089854.1 protein_id gnl|my_center|LOCUS_23700 31534 31058 gene locus_tag LOCUS_23710 31534 31058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 32948 31551 gene locus_tag LOCUS_23720 32948 31551 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089861.1 protein_id gnl|my_center|LOCUS_23720 33424 33107 gene locus_tag LOCUS_23730 33424 33107 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089862.1 protein_id gnl|my_center|LOCUS_23730 34672 33542 gene locus_tag LOCUS_23740 34672 33542 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965507.1 protein_id gnl|my_center|LOCUS_23740 34950 34768 gene locus_tag LOCUS_23750 34950 34768 CDS product aa3-type cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136857.1 protein_id gnl|my_center|LOCUS_23750 37039 35252 gene locus_tag LOCUS_23760 37039 35252 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089865.1 protein_id gnl|my_center|LOCUS_23760 37277 38773 gene locus_tag LOCUS_23770 37277 38773 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089866.1 protein_id gnl|my_center|LOCUS_23770 39108 41507 gene locus_tag LOCUS_23780 39108 41507 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089867.1 protein_id gnl|my_center|LOCUS_23780 41881 43362 gene locus_tag LOCUS_23790 41881 43362 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089868.1 protein_id gnl|my_center|LOCUS_23790 44993 43557 gene locus_tag LOCUS_23800 gene pyk 44993 43557 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089873.1 protein_id gnl|my_center|LOCUS_23800 45517 44990 gene locus_tag LOCUS_23810 45517 44990 CDS product DUF1036 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089872.1 protein_id gnl|my_center|LOCUS_23810 45751 46053 gene locus_tag LOCUS_23820 45751 46053 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173016.1 protein_id gnl|my_center|LOCUS_23820 46243 46512 gene locus_tag LOCUS_23830 46243 46512 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136868.1 protein_id gnl|my_center|LOCUS_23830 46748 46909 gene locus_tag LOCUS_23840 46748 46909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 47751 47080 gene locus_tag LOCUS_23850 47751 47080 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967322.1 protein_id gnl|my_center|LOCUS_23850 48480 48779 gene locus_tag LOCUS_23860 48480 48779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 49035 50249 gene locus_tag LOCUS_23870 49035 50249 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083234.1 protein_id gnl|my_center|LOCUS_23870 50577 50278 gene locus_tag LOCUS_23880 50577 50278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 50798 51004 gene locus_tag LOCUS_23890 50798 51004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 51080 51679 gene locus_tag LOCUS_23900 gene wrbA 51080 51679 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090297.1 protein_id gnl|my_center|LOCUS_23900 51922 52896 gene locus_tag LOCUS_23910 gene hemE 51922 52896 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085186.1 protein_id gnl|my_center|LOCUS_23910 53204 52911 gene locus_tag LOCUS_23920 53204 52911 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174267.1 protein_id gnl|my_center|LOCUS_23920 53325 54017 gene locus_tag LOCUS_23930 gene mobA 53325 54017 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921607.1 protein_id gnl|my_center|LOCUS_23930 54640 54098 gene locus_tag LOCUS_23940 gene msrA 54640 54098 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530793.1 protein_id gnl|my_center|LOCUS_23940 55095 55325 gene locus_tag LOCUS_23950 55095 55325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 56179 55910 gene locus_tag LOCUS_23960 56179 55910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 56234 56743 gene locus_tag LOCUS_23970 56234 56743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence27 415 230 gene locus_tag LOCUS_23980 415 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 666 857 gene locus_tag LOCUS_23990 666 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 976 1356 gene locus_tag LOCUS_24000 976 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 1406 1672 gene locus_tag LOCUS_24010 1406 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 1669 3324 gene locus_tag LOCUS_24020 1669 3324 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_24020 3371 3295 gene locus_tag LOCUS_t00340 3371 3295 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5090 3612 gene locus_tag LOCUS_24030 5090 3612 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175987.1 protein_id gnl|my_center|LOCUS_24030 5873 5394 gene locus_tag LOCUS_24040 5873 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 5972 7816 gene locus_tag LOCUS_24050 gene yidC 5972 7816 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966085.1 protein_id gnl|my_center|LOCUS_24050 7966 8619 gene locus_tag LOCUS_24060 gene yihA 7966 8619 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090821.1 protein_id gnl|my_center|LOCUS_24060 8616 9017 gene locus_tag LOCUS_24070 8616 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 9181 10077 gene locus_tag LOCUS_24080 gene argB 9181 10077 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090823.1 protein_id gnl|my_center|LOCUS_24080 10074 10790 gene locus_tag LOCUS_24090 10074 10790 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090825.1 protein_id gnl|my_center|LOCUS_24090 10865 11710 gene locus_tag LOCUS_24100 gene dapD 10865 11710 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090826.1 protein_id gnl|my_center|LOCUS_24100 11719 12888 gene locus_tag LOCUS_24110 gene dapE 11719 12888 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090828.1 protein_id gnl|my_center|LOCUS_24110 12885 13445 gene locus_tag LOCUS_24120 12885 13445 CDS product 5'-nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208025.1 protein_id gnl|my_center|LOCUS_24120 14177 13572 gene locus_tag LOCUS_24130 gene recR 14177 13572 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090836.1 protein_id gnl|my_center|LOCUS_24130 14639 14319 gene locus_tag LOCUS_24140 14639 14319 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090837.1 protein_id gnl|my_center|LOCUS_24140 16517 14697 gene locus_tag LOCUS_24150 16517 14697 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090838.1 protein_id gnl|my_center|LOCUS_24150 17299 18234 gene locus_tag LOCUS_24160 17299 18234 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966070.1 protein_id gnl|my_center|LOCUS_24160 18307 18816 gene locus_tag LOCUS_24170 18307 18816 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090847.1 protein_id gnl|my_center|LOCUS_24170 20394 18895 gene locus_tag LOCUS_24180 20394 18895 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090848.1 protein_id gnl|my_center|LOCUS_24180 21095 20568 gene locus_tag LOCUS_24190 21095 20568 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494178.1 protein_id gnl|my_center|LOCUS_24190 22186 21443 gene locus_tag LOCUS_24200 22186 21443 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337653.1 protein_id gnl|my_center|LOCUS_24200 24775 22235 gene locus_tag LOCUS_24210 gene hrpB 24775 22235 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968081.1 protein_id gnl|my_center|LOCUS_24210 25033 26082 gene locus_tag LOCUS_24220 25033 26082 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967713.1 protein_id gnl|my_center|LOCUS_24220 26194 29256 gene locus_tag LOCUS_24230 gene polA 26194 29256 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090853.1 protein_id gnl|my_center|LOCUS_24230 29494 30465 gene locus_tag LOCUS_24240 29494 30465 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085904.1 protein_id gnl|my_center|LOCUS_24240 30478 30666 gene locus_tag LOCUS_24250 30478 30666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 30802 33540 gene locus_tag LOCUS_24260 gene ligD 30802 33540 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089512.1 protein_id gnl|my_center|LOCUS_24260 33546 34508 gene locus_tag LOCUS_24270 gene rocF 33546 34508 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088863.1 protein_id gnl|my_center|LOCUS_24270 36248 34611 gene locus_tag LOCUS_24280 36248 34611 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090863.1 protein_id gnl|my_center|LOCUS_24280 37080 36343 gene locus_tag LOCUS_24290 37080 36343 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090865.1 protein_id gnl|my_center|LOCUS_24290 37294 37995 gene locus_tag LOCUS_24300 37294 37995 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008542552.1 protein_id gnl|my_center|LOCUS_24300 38172 39989 gene locus_tag LOCUS_24310 38172 39989 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175918.1 protein_id gnl|my_center|LOCUS_24310 39986 40483 gene locus_tag LOCUS_24320 39986 40483 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090867.1 protein_id gnl|my_center|LOCUS_24320 40637 41038 gene locus_tag LOCUS_24330 40637 41038 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090868.1 protein_id gnl|my_center|LOCUS_24330 41035 41364 gene locus_tag LOCUS_24340 41035 41364 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090869.1 protein_id gnl|my_center|LOCUS_24340 41464 43275 gene locus_tag LOCUS_24350 gene lepA 41464 43275 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175920.1 protein_id gnl|my_center|LOCUS_24350 43389 43748 gene locus_tag LOCUS_24360 43389 43748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 43958 44926 gene locus_tag LOCUS_24370 gene mepA 43958 44926 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967706.1 protein_id gnl|my_center|LOCUS_24370 45248 46072 gene locus_tag LOCUS_24380 gene modA 45248 46072 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090881.1 protein_id gnl|my_center|LOCUS_24380 46540 47235 gene locus_tag LOCUS_24390 gene modB 46540 47235 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090882.1 protein_id gnl|my_center|LOCUS_24390 47238 47903 gene locus_tag LOCUS_24400 gene modC 47238 47903 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090883.1 protein_id gnl|my_center|LOCUS_24400 49700 47904 gene locus_tag LOCUS_24410 49700 47904 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090889.1 protein_id gnl|my_center|LOCUS_24410 50021 50845 gene locus_tag LOCUS_24420 gene map 50021 50845 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090891.1 protein_id gnl|my_center|LOCUS_24420 51230 51940 gene locus_tag LOCUS_24430 gene radC 51230 51940 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133415038.1 protein_id gnl|my_center|LOCUS_24430 53118 52465 gene locus_tag LOCUS_24440 53118 52465 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388104.1 protein_id gnl|my_center|LOCUS_24440 54118 53036 gene locus_tag LOCUS_24450 54118 53036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 54425 54105 gene locus_tag LOCUS_24460 54425 54105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 54826 54422 gene locus_tag LOCUS_24470 54826 54422 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082866.1 protein_id gnl|my_center|LOCUS_24470 54988 55251 gene locus_tag LOCUS_24480 54988 55251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence28 1597 899 gene locus_tag LOCUS_24490 1597 899 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175884.1 protein_id gnl|my_center|LOCUS_24490 2305 1865 gene locus_tag LOCUS_24500 2305 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 2678 2472 gene locus_tag LOCUS_24510 2678 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 2979 3758 gene locus_tag LOCUS_24520 2979 3758 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967522.1 protein_id gnl|my_center|LOCUS_24520 3954 4499 gene locus_tag LOCUS_24530 3954 4499 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_24530 4511 5089 gene locus_tag LOCUS_24540 4511 5089 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088266.1 protein_id gnl|my_center|LOCUS_24540 6960 5296 gene locus_tag LOCUS_24550 6960 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 8164 7232 gene locus_tag LOCUS_24560 8164 7232 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967526.1 protein_id gnl|my_center|LOCUS_24560 8713 8318 gene locus_tag LOCUS_24570 gene hisI 8713 8318 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_24570 9492 8794 gene locus_tag LOCUS_24580 gene folE 9492 8794 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088270.1 protein_id gnl|my_center|LOCUS_24580 9740 10195 gene locus_tag LOCUS_24590 9740 10195 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088271.1 protein_id gnl|my_center|LOCUS_24590 11176 10259 gene locus_tag LOCUS_24600 11176 10259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175874.1 protein_id gnl|my_center|LOCUS_24600 12807 11842 gene locus_tag LOCUS_24610 12807 11842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088297.1 protein_id gnl|my_center|LOCUS_24610 13112 14164 gene locus_tag LOCUS_24620 13112 14164 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175852.1 protein_id gnl|my_center|LOCUS_24620 14605 14177 gene locus_tag LOCUS_24630 14605 14177 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_24630 15536 14742 gene locus_tag LOCUS_24640 15536 14742 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921493.1 protein_id gnl|my_center|LOCUS_24640 15956 15756 gene locus_tag LOCUS_24650 15956 15756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 16767 17561 gene locus_tag LOCUS_24660 16767 17561 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532435.1 protein_id gnl|my_center|LOCUS_24660 17851 17522 gene locus_tag LOCUS_24670 17851 17522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 17953 18510 gene locus_tag LOCUS_24680 17953 18510 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175850.1 protein_id gnl|my_center|LOCUS_24680 18766 19554 gene locus_tag LOCUS_24690 gene murI 18766 19554 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088448.1 protein_id gnl|my_center|LOCUS_24690 19908 20525 gene locus_tag LOCUS_24700 gene rpsD 19908 20525 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088452.1 protein_id gnl|my_center|LOCUS_24700 20859 20596 gene locus_tag LOCUS_24710 20859 20596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 21495 21157 gene locus_tag LOCUS_24720 gene grxD 21495 21157 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548651.1 protein_id gnl|my_center|LOCUS_24720 21736 22983 gene locus_tag LOCUS_24730 gene egtB 21736 22983 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967201.1 protein_id gnl|my_center|LOCUS_24730 23027 23992 gene locus_tag LOCUS_24740 gene egtD 23027 23992 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967207.1 protein_id gnl|my_center|LOCUS_24740 24232 23999 gene locus_tag LOCUS_24750 24232 23999 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088461.1 protein_id gnl|my_center|LOCUS_24750 26740 24530 gene locus_tag LOCUS_24760 gene purL 26740 24530 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088464.1 protein_id gnl|my_center|LOCUS_24760 27204 26737 gene locus_tag LOCUS_24770 27204 26737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 27902 27201 gene locus_tag LOCUS_24780 gene purQ 27902 27201 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088468.1 protein_id gnl|my_center|LOCUS_24780 28154 27915 gene locus_tag LOCUS_24790 gene purS 28154 27915 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088473.1 protein_id gnl|my_center|LOCUS_24790 28992 28195 gene locus_tag LOCUS_24800 28992 28195 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008974302.1 protein_id gnl|my_center|LOCUS_24800 29296 29619 gene locus_tag LOCUS_24810 29296 29619 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088474.1 protein_id gnl|my_center|LOCUS_24810 30262 29762 gene locus_tag LOCUS_24820 gene cynS 30262 29762 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088475.1 protein_id gnl|my_center|LOCUS_24820 31745 30522 gene locus_tag LOCUS_24830 31745 30522 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088490.1 protein_id gnl|my_center|LOCUS_24830 32050 33267 gene locus_tag LOCUS_24840 32050 33267 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088491.1 protein_id gnl|my_center|LOCUS_24840 35908 33338 gene locus_tag LOCUS_24850 gene alaS 35908 33338 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967195.1 protein_id gnl|my_center|LOCUS_24850 36519 37682 gene locus_tag LOCUS_24860 gene gcvT 36519 37682 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921497.1 protein_id gnl|my_center|LOCUS_24860 37692 38057 gene locus_tag LOCUS_24870 gene gcvH 37692 38057 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088496.1 protein_id gnl|my_center|LOCUS_24870 38130 40994 gene locus_tag LOCUS_24880 gene gcvP 38130 40994 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967189.1 protein_id gnl|my_center|LOCUS_24880 42435 41347 gene locus_tag LOCUS_24890 gene recA 42435 41347 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088499.1 protein_id gnl|my_center|LOCUS_24890 42791 42991 gene locus_tag LOCUS_24900 42791 42991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 43204 43428 gene locus_tag LOCUS_24910 43204 43428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 44300 43851 gene locus_tag LOCUS_24920 44300 43851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 45299 45045 gene locus_tag LOCUS_24930 45299 45045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 46934 45489 gene locus_tag LOCUS_24940 46934 45489 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089294.1 protein_id gnl|my_center|LOCUS_24940 47384 48610 gene locus_tag LOCUS_24950 47384 48610 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088523.1 protein_id gnl|my_center|LOCUS_24950 48607 49548 gene locus_tag LOCUS_24960 48607 49548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 49699 50187 gene locus_tag LOCUS_24970 49699 50187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 50317 51000 gene locus_tag LOCUS_24980 50317 51000 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 protein_id gnl|my_center|LOCUS_24980 51027 51464 gene locus_tag LOCUS_24990 51027 51464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086686.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence29 207 3164 gene locus_tag LOCUS_25000 207 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 3167 4291 gene locus_tag LOCUS_25010 3167 4291 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063891.1 protein_id gnl|my_center|LOCUS_25010 4288 6912 gene locus_tag LOCUS_25020 4288 6912 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931042.1 protein_id gnl|my_center|LOCUS_25020 7108 7656 gene locus_tag LOCUS_25030 7108 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 8003 7752 gene locus_tag LOCUS_25040 8003 7752 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313814.1 protein_id gnl|my_center|LOCUS_25040 10665 8458 gene locus_tag LOCUS_25050 10665 8458 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087967.1 protein_id gnl|my_center|LOCUS_25050 11842 10826 gene locus_tag LOCUS_25060 11842 10826 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087966.1 protein_id gnl|my_center|LOCUS_25060 12345 11839 gene locus_tag LOCUS_25070 12345 11839 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171505.1 protein_id gnl|my_center|LOCUS_25070 12972 12634 gene locus_tag LOCUS_25080 12972 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 14051 16513 gene locus_tag LOCUS_25090 gene nirB 14051 16513 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530460.1 protein_id gnl|my_center|LOCUS_25090 16510 16839 gene locus_tag LOCUS_25100 gene nirD 16510 16839 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 protein_id gnl|my_center|LOCUS_25100 17134 17613 gene locus_tag LOCUS_25110 17134 17613 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165023455.1 protein_id gnl|my_center|LOCUS_25110 18118 17798 gene locus_tag LOCUS_25120 18118 17798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 18654 18421 gene locus_tag LOCUS_25130 18654 18421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 19557 19473 gene locus_tag LOCUS_t00350 19557 19473 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19887 20429 gene locus_tag LOCUS_25140 19887 20429 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084158.1 protein_id gnl|my_center|LOCUS_25140 20776 20630 gene locus_tag LOCUS_25150 20776 20630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 20739 20933 gene locus_tag LOCUS_25160 20739 20933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 21096 21506 gene locus_tag LOCUS_25170 21096 21506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084161.1 protein_id gnl|my_center|LOCUS_25170 21654 22181 gene locus_tag LOCUS_25180 21654 22181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 22720 22307 gene locus_tag LOCUS_25190 22720 22307 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920892.1 protein_id gnl|my_center|LOCUS_25190 22908 22726 gene locus_tag LOCUS_25200 22908 22726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 23012 23464 gene locus_tag LOCUS_25210 23012 23464 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191066.1 protein_id gnl|my_center|LOCUS_25210 24450 23479 gene locus_tag LOCUS_25220 24450 23479 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084169.1 protein_id gnl|my_center|LOCUS_25220 25137 24580 gene locus_tag LOCUS_25230 25137 24580 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173554.1 protein_id gnl|my_center|LOCUS_25230 26956 25442 gene locus_tag LOCUS_25240 26956 25442 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171469.1 protein_id gnl|my_center|LOCUS_25240 27734 27081 gene locus_tag LOCUS_25250 27734 27081 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084189.1 protein_id gnl|my_center|LOCUS_25250 27780 28652 gene locus_tag LOCUS_25260 gene gluQRS 27780 28652 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084190.1 protein_id gnl|my_center|LOCUS_25260 28826 30028 gene locus_tag LOCUS_25270 28826 30028 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084191.1 protein_id gnl|my_center|LOCUS_25270 30815 29955 gene locus_tag LOCUS_25280 30815 29955 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084192.1 protein_id gnl|my_center|LOCUS_25280 30993 31187 gene locus_tag LOCUS_25290 30993 31187 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544319.1 protein_id gnl|my_center|LOCUS_25290 31217 31789 gene locus_tag LOCUS_25300 31217 31789 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_25300 31943 32692 gene locus_tag LOCUS_25310 31943 32692 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084195.1 protein_id gnl|my_center|LOCUS_25310 32692 33636 gene locus_tag LOCUS_25320 32692 33636 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084196.1 protein_id gnl|my_center|LOCUS_25320 33742 34623 gene locus_tag LOCUS_25330 33742 34623 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084197.1 protein_id gnl|my_center|LOCUS_25330 34693 34884 gene locus_tag LOCUS_25340 34693 34884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 35279 34881 gene locus_tag LOCUS_25350 35279 34881 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946356.1 protein_id gnl|my_center|LOCUS_25350 35681 35322 gene locus_tag LOCUS_25360 35681 35322 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387235.1 protein_id gnl|my_center|LOCUS_25360 36455 35784 gene locus_tag LOCUS_25370 36455 35784 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084198.1 protein_id gnl|my_center|LOCUS_25370 36581 37972 gene locus_tag LOCUS_25380 gene argH 36581 37972 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965353.1 protein_id gnl|my_center|LOCUS_25380 38035 38343 gene locus_tag LOCUS_25390 38035 38343 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084200.1 protein_id gnl|my_center|LOCUS_25390 38610 39875 gene locus_tag LOCUS_25400 gene lysA 38610 39875 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084201.1 protein_id gnl|my_center|LOCUS_25400 40216 40755 gene locus_tag LOCUS_25410 40216 40755 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527938.1 protein_id gnl|my_center|LOCUS_25410 41797 41390 gene locus_tag LOCUS_25420 41797 41390 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087115.1 protein_id gnl|my_center|LOCUS_25420 42523 43269 gene locus_tag LOCUS_25430 42523 43269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 43935 44132 gene locus_tag LOCUS_25440 43935 44132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 46060 45017 gene locus_tag LOCUS_25450 46060 45017 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 protein_id gnl|my_center|LOCUS_25450 46564 46292 gene locus_tag LOCUS_25460 46564 46292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 47250 47026 gene locus_tag LOCUS_25470 47250 47026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 47509 48777 gene locus_tag LOCUS_25480 47509 48777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 49287 48847 gene locus_tag LOCUS_25490 gene tsaA 49287 48847 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980532.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence30 398 81 gene locus_tag LOCUS_25500 398 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 691 521 gene locus_tag LOCUS_25510 691 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25510 902 1153 gene locus_tag LOCUS_25520 902 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 1465 1175 gene locus_tag LOCUS_25530 1465 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975461.1 protein_id gnl|my_center|LOCUS_25530 2938 1514 gene locus_tag LOCUS_25540 2938 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 3227 2991 gene locus_tag LOCUS_25550 3227 2991 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107649648.1 protein_id gnl|my_center|LOCUS_25550 3340 3600 gene locus_tag LOCUS_25560 3340 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 4856 3621 gene locus_tag LOCUS_25570 4856 3621 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703417.1 protein_id gnl|my_center|LOCUS_25570 5104 5015 gene locus_tag LOCUS_t00360 5104 5015 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6669 5392 gene locus_tag LOCUS_25580 6669 5392 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175323.1 protein_id gnl|my_center|LOCUS_25580 8841 7048 gene locus_tag LOCUS_25590 8841 7048 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_25590 9632 8838 gene locus_tag LOCUS_25600 gene otsB 9632 8838 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083155.1 protein_id gnl|my_center|LOCUS_25600 11089 9644 gene locus_tag LOCUS_25610 11089 9644 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175325.1 protein_id gnl|my_center|LOCUS_25610 11512 12150 gene locus_tag LOCUS_25620 11512 12150 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175667.1 protein_id gnl|my_center|LOCUS_25620 12335 13870 gene locus_tag LOCUS_25630 12335 13870 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967445.1 protein_id gnl|my_center|LOCUS_25630 14134 14910 gene locus_tag LOCUS_25640 14134 14910 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083187.1 protein_id gnl|my_center|LOCUS_25640 14910 18035 gene locus_tag LOCUS_25650 14910 18035 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083188.1 protein_id gnl|my_center|LOCUS_25650 18991 18185 gene locus_tag LOCUS_25660 18991 18185 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083189.1 protein_id gnl|my_center|LOCUS_25660 19273 21195 gene locus_tag LOCUS_25670 19273 21195 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083190.1 protein_id gnl|my_center|LOCUS_25670 22009 21395 gene locus_tag LOCUS_25680 22009 21395 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084047.1 protein_id gnl|my_center|LOCUS_25680 22533 22261 gene locus_tag LOCUS_25690 22533 22261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 22987 23949 gene locus_tag LOCUS_25700 22987 23949 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090703.1 protein_id gnl|my_center|LOCUS_25700 24357 24124 gene locus_tag LOCUS_25710 24357 24124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 25353 25613 gene locus_tag LOCUS_25720 25353 25613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 26344 28791 gene locus_tag LOCUS_25730 26344 28791 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083191.1 protein_id gnl|my_center|LOCUS_25730 28911 29816 gene locus_tag LOCUS_25740 28911 29816 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175680.1 protein_id gnl|my_center|LOCUS_25740 30774 29899 gene locus_tag LOCUS_25750 30774 29899 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083202.1 protein_id gnl|my_center|LOCUS_25750 31159 32892 gene locus_tag LOCUS_25760 31159 32892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967439.1 protein_id gnl|my_center|LOCUS_25760 32977 34074 gene locus_tag LOCUS_25770 32977 34074 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531646.1 protein_id gnl|my_center|LOCUS_25770 34397 35713 gene locus_tag LOCUS_25780 34397 35713 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957913.1 protein_id gnl|my_center|LOCUS_25780 36607 35708 gene locus_tag LOCUS_25790 gene asd 36607 35708 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089371.1 protein_id gnl|my_center|LOCUS_25790 36648 38312 gene locus_tag LOCUS_25800 36648 38312 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089372.1 protein_id gnl|my_center|LOCUS_25800 38965 38342 gene locus_tag LOCUS_25810 38965 38342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_25810 39782 39093 gene locus_tag LOCUS_25820 39782 39093 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089374.1 protein_id gnl|my_center|LOCUS_25820 40870 39821 gene locus_tag LOCUS_25830 40870 39821 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966415.1 protein_id gnl|my_center|LOCUS_25830 42468 41413 gene locus_tag LOCUS_25840 gene arsB 42468 41413 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164747183.1 protein_id gnl|my_center|LOCUS_25840 42902 42477 gene locus_tag LOCUS_25850 gene arsC 42902 42477 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969944.1 protein_id gnl|my_center|LOCUS_25850 43175 42912 gene locus_tag LOCUS_25860 43175 42912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 43530 43168 gene locus_tag LOCUS_25870 43530 43168 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398909.1 protein_id gnl|my_center|LOCUS_25870 43713 44117 gene locus_tag LOCUS_25880 43713 44117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 44600 45184 gene locus_tag LOCUS_25890 44600 45184 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857526.1 protein_id gnl|my_center|LOCUS_25890 45177 46421 gene locus_tag LOCUS_25900 45177 46421 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857525.1 protein_id gnl|my_center|LOCUS_25900 46518 47405 gene locus_tag LOCUS_25910 46518 47405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence31 309 599 gene locus_tag LOCUS_25920 309 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 673 1746 gene locus_tag LOCUS_25930 673 1746 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337224.1 protein_id gnl|my_center|LOCUS_25930 1764 1690 gene locus_tag LOCUS_t00370 1764 1690 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2019 2267 gene locus_tag LOCUS_25940 2019 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 3090 2641 gene locus_tag LOCUS_25950 3090 2641 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087171.1 protein_id gnl|my_center|LOCUS_25950 3747 3977 gene locus_tag LOCUS_25960 3747 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 4650 5303 gene locus_tag LOCUS_25970 4650 5303 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967130.1 protein_id gnl|my_center|LOCUS_25970 5457 5948 gene locus_tag LOCUS_25980 5457 5948 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087183.1 protein_id gnl|my_center|LOCUS_25980 6028 6104 gene locus_tag LOCUS_t00380 6028 6104 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6325 6675 gene locus_tag LOCUS_25990 6325 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 7805 9616 gene locus_tag LOCUS_26000 7805 9616 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815500.1 protein_id gnl|my_center|LOCUS_26000 9631 9795 gene locus_tag LOCUS_26010 9631 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 9792 10154 gene locus_tag LOCUS_26020 9792 10154 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171332.1 protein_id gnl|my_center|LOCUS_26020 10258 11862 gene locus_tag LOCUS_26030 10258 11862 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087192.1 protein_id gnl|my_center|LOCUS_26030 11865 13865 gene locus_tag LOCUS_26040 11865 13865 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967137.1 protein_id gnl|my_center|LOCUS_26040 14227 13973 gene locus_tag LOCUS_26050 14227 13973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 14490 14912 gene locus_tag LOCUS_26060 gene ndk 14490 14912 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086893.1 protein_id gnl|my_center|LOCUS_26060 14951 15778 gene locus_tag LOCUS_26070 14951 15778 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086894.1 protein_id gnl|my_center|LOCUS_26070 16525 15872 gene locus_tag LOCUS_26080 gene purN 16525 15872 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171111.1 protein_id gnl|my_center|LOCUS_26080 17622 16549 gene locus_tag LOCUS_26090 gene purM 17622 16549 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086899.1 protein_id gnl|my_center|LOCUS_26090 17792 18334 gene locus_tag LOCUS_26100 17792 18334 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086898.1 protein_id gnl|my_center|LOCUS_26100 18368 19048 gene locus_tag LOCUS_26110 18368 19048 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086897.1 protein_id gnl|my_center|LOCUS_26110 19200 21401 gene locus_tag LOCUS_26120 19200 21401 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171108.1 protein_id gnl|my_center|LOCUS_26120 21409 22920 gene locus_tag LOCUS_26130 gene ppx 21409 22920 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086895.1 protein_id gnl|my_center|LOCUS_26130 23145 24455 gene locus_tag LOCUS_26140 23145 24455 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392427.1 protein_id gnl|my_center|LOCUS_26140 25806 24496 gene locus_tag LOCUS_26150 gene rnd 25806 24496 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086908.1 protein_id gnl|my_center|LOCUS_26150 26034 27818 gene locus_tag LOCUS_26160 gene aspS 26034 27818 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086916.1 protein_id gnl|my_center|LOCUS_26160 27998 30304 gene locus_tag LOCUS_26170 27998 30304 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086918.1 protein_id gnl|my_center|LOCUS_26170 31334 30528 gene locus_tag LOCUS_26180 31334 30528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 32074 31505 gene locus_tag LOCUS_26190 32074 31505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 32348 32220 gene locus_tag LOCUS_26200 32348 32220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 32722 33159 gene locus_tag LOCUS_26210 32722 33159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 34313 33366 gene locus_tag LOCUS_26220 34313 33366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 34748 35998 gene locus_tag LOCUS_26230 34748 35998 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265555.1 protein_id gnl|my_center|LOCUS_26230 36094 36786 gene locus_tag LOCUS_26240 36094 36786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 36868 37116 gene locus_tag LOCUS_26250 36868 37116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 37116 37493 gene locus_tag LOCUS_26260 37116 37493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 37490 38353 gene locus_tag LOCUS_26270 37490 38353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 38350 39558 gene locus_tag LOCUS_26280 38350 39558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 39870 40406 gene locus_tag LOCUS_26290 39870 40406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 40856 41182 gene locus_tag LOCUS_26300 40856 41182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 41186 41908 gene locus_tag LOCUS_26310 41186 41908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 41922 42470 gene locus_tag LOCUS_26320 41922 42470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 42482 43003 gene locus_tag LOCUS_26330 42482 43003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 43387 43178 gene locus_tag LOCUS_26340 43387 43178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 46247 46077 gene locus_tag LOCUS_26350 46247 46077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 46854 46627 gene locus_tag LOCUS_26360 46854 46627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence32 530 1795 gene locus_tag LOCUS_26370 gene phaZ 530 1795 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083730.1 protein_id gnl|my_center|LOCUS_26370 2088 2840 gene locus_tag LOCUS_26380 2088 2840 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083731.1 protein_id gnl|my_center|LOCUS_26380 5192 2994 gene locus_tag LOCUS_26390 5192 2994 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 protein_id gnl|my_center|LOCUS_26390 5101 5364 gene locus_tag LOCUS_26400 5101 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 8255 5478 gene locus_tag LOCUS_26410 8255 5478 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965190.1 protein_id gnl|my_center|LOCUS_26410 8538 9542 gene locus_tag LOCUS_26420 8538 9542 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083919.1 protein_id gnl|my_center|LOCUS_26420 10160 9765 gene locus_tag LOCUS_26430 gene apaG 10160 9765 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172741.1 protein_id gnl|my_center|LOCUS_26430 10362 11609 gene locus_tag LOCUS_26440 10362 11609 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083921.1 protein_id gnl|my_center|LOCUS_26440 11606 12370 gene locus_tag LOCUS_26450 11606 12370 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083922.1 protein_id gnl|my_center|LOCUS_26450 13832 12639 gene locus_tag LOCUS_26460 13832 12639 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965254.1 protein_id gnl|my_center|LOCUS_26460 14169 15275 gene locus_tag LOCUS_26470 14169 15275 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172745.1 protein_id gnl|my_center|LOCUS_26470 15592 15777 gene locus_tag LOCUS_26480 15592 15777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 15802 16182 gene locus_tag LOCUS_26490 gene crcB 15802 16182 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975197.1 protein_id gnl|my_center|LOCUS_26490 16288 16361 gene locus_tag LOCUS_t00390 16288 16361 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16786 16415 gene locus_tag LOCUS_26500 16786 16415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 16870 17331 gene locus_tag LOCUS_26510 16870 17331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965271.1 protein_id gnl|my_center|LOCUS_26510 17570 18166 gene locus_tag LOCUS_26520 17570 18166 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083950.1 protein_id gnl|my_center|LOCUS_26520 18987 18172 gene locus_tag LOCUS_26530 18987 18172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26530 19806 20243 gene locus_tag LOCUS_26540 19806 20243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 20305 21204 gene locus_tag LOCUS_26550 20305 21204 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083951.1 protein_id gnl|my_center|LOCUS_26550 21254 22885 gene locus_tag LOCUS_26560 21254 22885 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083952.1 protein_id gnl|my_center|LOCUS_26560 23061 23579 gene locus_tag LOCUS_26570 23061 23579 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083403.1 protein_id gnl|my_center|LOCUS_26570 23779 24390 gene locus_tag LOCUS_26580 gene pyrE 23779 24390 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547500.1 protein_id gnl|my_center|LOCUS_26580 25029 24484 gene locus_tag LOCUS_26590 25029 24484 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083404.1 protein_id gnl|my_center|LOCUS_26590 25614 26978 gene locus_tag LOCUS_26600 25614 26978 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_26600 27106 28860 gene locus_tag LOCUS_26610 27106 28860 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 protein_id gnl|my_center|LOCUS_26610 29052 30644 gene locus_tag LOCUS_26620 gene purH 29052 30644 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083410.1 protein_id gnl|my_center|LOCUS_26620 30917 31426 gene locus_tag LOCUS_26630 30917 31426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26630 32848 31544 gene locus_tag LOCUS_26640 32848 31544 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083411.1 protein_id gnl|my_center|LOCUS_26640 33201 34796 gene locus_tag LOCUS_26650 gene ggt 33201 34796 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083412.1 protein_id gnl|my_center|LOCUS_26650 34965 35885 gene locus_tag LOCUS_26660 gene panE 34965 35885 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083418.1 protein_id gnl|my_center|LOCUS_26660 36605 35913 gene locus_tag LOCUS_26670 36605 35913 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083540.1 protein_id gnl|my_center|LOCUS_26670 36883 37689 gene locus_tag LOCUS_26680 36883 37689 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083541.1 protein_id gnl|my_center|LOCUS_26680 38790 37822 gene locus_tag LOCUS_26690 38790 37822 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083542.1 protein_id gnl|my_center|LOCUS_26690 38943 39029 gene locus_tag LOCUS_t00400 38943 39029 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39171 39467 gene locus_tag LOCUS_26700 39171 39467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence33 1337 69 gene locus_tag LOCUS_26710 1337 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 5659 2036 gene locus_tag LOCUS_26720 5659 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967166.1 protein_id gnl|my_center|LOCUS_26720 6663 5854 gene locus_tag LOCUS_26730 6663 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088566.1 protein_id gnl|my_center|LOCUS_26730 7094 6660 gene locus_tag LOCUS_26740 7094 6660 CDS product DUF6468 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088567.1 protein_id gnl|my_center|LOCUS_26740 8293 7091 gene locus_tag LOCUS_26750 gene fliM 8293 7091 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088568.1 protein_id gnl|my_center|LOCUS_26750 8967 8476 gene locus_tag LOCUS_26760 gene fliL 8967 8476 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088569.1 protein_id gnl|my_center|LOCUS_26760 9488 10255 gene locus_tag LOCUS_26770 gene flgF 9488 10255 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088570.1 protein_id gnl|my_center|LOCUS_26770 10268 11056 gene locus_tag LOCUS_26780 gene flgG 10268 11056 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088571.1 protein_id gnl|my_center|LOCUS_26780 11066 12154 gene locus_tag LOCUS_26790 gene flgA 11066 12154 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967164.1 protein_id gnl|my_center|LOCUS_26790 12160 12918 gene locus_tag LOCUS_26800 gene flgH 12160 12918 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088573.1 protein_id gnl|my_center|LOCUS_26800 13328 13606 gene locus_tag LOCUS_26810 13328 13606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 13835 15709 gene locus_tag LOCUS_26820 13835 15709 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265771.1 protein_id gnl|my_center|LOCUS_26820 16223 15858 gene locus_tag LOCUS_26830 gene dksA 16223 15858 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008554760.1 protein_id gnl|my_center|LOCUS_26830 16902 16570 gene locus_tag LOCUS_26840 16902 16570 CDS product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088579.1 protein_id gnl|my_center|LOCUS_26840 17310 18434 gene locus_tag LOCUS_26850 17310 18434 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173283.1 protein_id gnl|my_center|LOCUS_26850 18434 18823 gene locus_tag LOCUS_26860 18434 18823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 18820 19311 gene locus_tag LOCUS_26870 18820 19311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088582.1 protein_id gnl|my_center|LOCUS_26870 19590 20093 gene locus_tag LOCUS_26880 19590 20093 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 protein_id gnl|my_center|LOCUS_26880 20241 21197 gene locus_tag LOCUS_26890 20241 21197 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974566.1 protein_id gnl|my_center|LOCUS_26890 21404 23812 gene locus_tag LOCUS_26900 21404 23812 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114936.1 protein_id gnl|my_center|LOCUS_26900 24041 24406 gene locus_tag LOCUS_26910 24041 24406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088583.1 protein_id gnl|my_center|LOCUS_26910 24834 24469 gene locus_tag LOCUS_26920 24834 24469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 25229 24864 gene locus_tag LOCUS_26930 gene flaF 25229 24864 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008554779.1 protein_id gnl|my_center|LOCUS_26930 27097 25487 gene locus_tag LOCUS_26940 27097 25487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 29058 27484 gene locus_tag LOCUS_26950 29058 27484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 29389 29820 gene locus_tag LOCUS_26960 gene flbT 29389 29820 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088588.1 protein_id gnl|my_center|LOCUS_26960 31303 29846 gene locus_tag LOCUS_26970 31303 29846 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088589.1 protein_id gnl|my_center|LOCUS_26970 31533 31300 gene locus_tag LOCUS_26980 31533 31300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 33114 31609 gene locus_tag LOCUS_26990 33114 31609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 35004 33142 gene locus_tag LOCUS_27000 gene flgK 35004 33142 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088594.1 protein_id gnl|my_center|LOCUS_27000 36917 35076 gene locus_tag LOCUS_27010 36917 35076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 37659 37147 gene locus_tag LOCUS_27020 gene msrB 37659 37147 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967753.1 protein_id gnl|my_center|LOCUS_27020 39239 37839 gene locus_tag LOCUS_27030 39239 37839 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088597.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence34 278 781 gene locus_tag LOCUS_27040 278 781 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975011.1 protein_id gnl|my_center|LOCUS_27040 1116 1313 gene locus_tag LOCUS_27050 1116 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1423 1599 gene locus_tag LOCUS_27060 1423 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1599 1958 gene locus_tag LOCUS_27070 1599 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 3561 3328 gene locus_tag LOCUS_27080 3561 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 4406 3969 gene locus_tag LOCUS_27090 4406 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 4945 4769 gene locus_tag LOCUS_27100 4945 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 5486 5205 gene locus_tag LOCUS_27110 gene minE 5486 5205 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086986.1 protein_id gnl|my_center|LOCUS_27110 6304 5483 gene locus_tag LOCUS_27120 gene minD 6304 5483 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086985.1 protein_id gnl|my_center|LOCUS_27120 7015 6320 gene locus_tag LOCUS_27130 gene minC 7015 6320 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086984.1 protein_id gnl|my_center|LOCUS_27130 7317 7664 gene locus_tag LOCUS_27140 7317 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 8395 9396 gene locus_tag LOCUS_27150 gene pseB 8395 9396 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_27150 10917 9643 gene locus_tag LOCUS_27160 10917 9643 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088667.1 protein_id gnl|my_center|LOCUS_27160 12226 11426 gene locus_tag LOCUS_27170 12226 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 12352 13125 gene locus_tag LOCUS_27180 12352 13125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 13168 13542 gene locus_tag LOCUS_27190 13168 13542 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640021.1 protein_id gnl|my_center|LOCUS_27190 13539 14519 gene locus_tag LOCUS_27200 13539 14519 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918510.1 protein_id gnl|my_center|LOCUS_27200 15029 14547 gene locus_tag LOCUS_27210 15029 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 16477 15026 gene locus_tag LOCUS_27220 gene ltrA 16477 15026 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967989.1 protein_id gnl|my_center|LOCUS_27220 16668 16474 gene locus_tag LOCUS_27230 16668 16474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27230 17718 17221 gene locus_tag LOCUS_27240 17718 17221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 17960 17721 gene locus_tag LOCUS_27250 17960 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 19168 18374 gene locus_tag LOCUS_27260 19168 18374 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086685.1 protein_id gnl|my_center|LOCUS_27260 19641 19171 gene locus_tag LOCUS_27270 gene exbD 19641 19171 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086684.1 protein_id gnl|my_center|LOCUS_27270 20634 19645 gene locus_tag LOCUS_27280 gene exbB 20634 19645 CDS product tonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086683.1 protein_id gnl|my_center|LOCUS_27280 22269 20863 gene locus_tag LOCUS_27290 22269 20863 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526222.1 protein_id gnl|my_center|LOCUS_27290 22931 22266 gene locus_tag LOCUS_27300 22931 22266 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 protein_id gnl|my_center|LOCUS_27300 23459 25450 gene locus_tag LOCUS_27310 23459 25450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 25805 26386 gene locus_tag LOCUS_27320 25805 26386 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529619.1 protein_id gnl|my_center|LOCUS_27320 26489 26932 gene locus_tag LOCUS_27330 26489 26932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 27349 26981 gene locus_tag LOCUS_27340 27349 26981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 27703 28563 gene locus_tag LOCUS_27350 27703 28563 CDS product sulfurtransferase/chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066514002.1 protein_id gnl|my_center|LOCUS_27350 28560 29951 gene locus_tag LOCUS_27360 gene chrA 28560 29951 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087813.1 protein_id gnl|my_center|LOCUS_27360 30012 30914 gene locus_tag LOCUS_27370 30012 30914 CDS product DUF1259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965726.1 protein_id gnl|my_center|LOCUS_27370 31628 31056 gene locus_tag LOCUS_27380 31628 31056 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904694.1 protein_id gnl|my_center|LOCUS_27380 32768 31632 gene locus_tag LOCUS_27390 32768 31632 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531646.1 protein_id gnl|my_center|LOCUS_27390 34411 33767 gene locus_tag LOCUS_27400 34411 33767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 34604 34996 gene locus_tag LOCUS_27410 34604 34996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27410 34912 35361 gene locus_tag LOCUS_27420 34912 35361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27420 35482 35799 gene locus_tag LOCUS_27430 35482 35799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence35 847 269 gene locus_tag LOCUS_27440 847 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085332.1 protein_id gnl|my_center|LOCUS_27440 2498 1113 gene locus_tag LOCUS_27450 2498 1113 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965917.1 protein_id gnl|my_center|LOCUS_27450 5766 2920 gene locus_tag LOCUS_27460 gene ppdK 5766 2920 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921419.1 protein_id gnl|my_center|LOCUS_27460 7990 6068 gene locus_tag LOCUS_27470 gene ftsH 7990 6068 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089881.1 protein_id gnl|my_center|LOCUS_27470 9340 8327 gene locus_tag LOCUS_27480 gene tilS 9340 8327 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089882.1 protein_id gnl|my_center|LOCUS_27480 9773 9384 gene locus_tag LOCUS_27490 9773 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 10741 9833 gene locus_tag LOCUS_27500 gene ybgF 10741 9833 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173009.1 protein_id gnl|my_center|LOCUS_27500 11706 11212 gene locus_tag LOCUS_27510 gene pal 11706 11212 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089884.1 protein_id gnl|my_center|LOCUS_27510 12706 11963 gene locus_tag LOCUS_27520 12706 11963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089885.1 protein_id gnl|my_center|LOCUS_27520 15225 12904 gene locus_tag LOCUS_27530 15225 12904 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089886.1 protein_id gnl|my_center|LOCUS_27530 16892 15540 gene locus_tag LOCUS_27540 gene tolB 16892 15540 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173006.1 protein_id gnl|my_center|LOCUS_27540 17944 16934 gene locus_tag LOCUS_27550 17944 16934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 18334 17948 gene locus_tag LOCUS_27560 gene tolR 18334 17948 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089889.1 protein_id gnl|my_center|LOCUS_27560 19148 18435 gene locus_tag LOCUS_27570 gene tolQ 19148 18435 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089890.1 protein_id gnl|my_center|LOCUS_27570 20162 19668 gene locus_tag LOCUS_27580 20162 19668 CDS product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173002.1 protein_id gnl|my_center|LOCUS_27580 21146 20433 gene locus_tag LOCUS_27590 21146 20433 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089896.1 protein_id gnl|my_center|LOCUS_27590 21729 21313 gene locus_tag LOCUS_27600 21729 21313 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_27600 23420 22146 gene locus_tag LOCUS_27610 23420 22146 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529830.1 protein_id gnl|my_center|LOCUS_27610 23785 23417 gene locus_tag LOCUS_27620 23785 23417 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089906.1 protein_id gnl|my_center|LOCUS_27620 24449 23976 gene locus_tag LOCUS_27630 24449 23976 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528038.1 protein_id gnl|my_center|LOCUS_27630 25197 24673 gene locus_tag LOCUS_27640 gene ybgC 25197 24673 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089947.1 protein_id gnl|my_center|LOCUS_27640 <26583 25461 gene locus_tag LOCUS_27650 <26583 25461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094976806.1:Holliday junction branch migration DNA helicase RuvB >Feature sequence36 362 96 gene locus_tag LOCUS_27660 362 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008131028.1 protein_id gnl|my_center|LOCUS_27660 684 1181 gene locus_tag LOCUS_27670 gene coaD 684 1181 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087462.1 protein_id gnl|my_center|LOCUS_27670 1214 1774 gene locus_tag LOCUS_27680 1214 1774 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087461.1 protein_id gnl|my_center|LOCUS_27680 1785 2204 gene locus_tag LOCUS_27690 1785 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087460.1 protein_id gnl|my_center|LOCUS_27690 2197 2661 gene locus_tag LOCUS_27700 2197 2661 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 protein_id gnl|my_center|LOCUS_27700 2741 3856 gene locus_tag LOCUS_27710 gene queA 2741 3856 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087458.1 protein_id gnl|my_center|LOCUS_27710 3853 4986 gene locus_tag LOCUS_27720 gene tgt 3853 4986 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967463.1 protein_id gnl|my_center|LOCUS_27720 5443 6420 gene locus_tag LOCUS_27730 gene cysK 5443 6420 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087451.1 protein_id gnl|my_center|LOCUS_27730 6993 6568 gene locus_tag LOCUS_27740 6993 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 7432 7085 gene locus_tag LOCUS_27750 7432 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172475.1 protein_id gnl|my_center|LOCUS_27750 7922 9070 gene locus_tag LOCUS_27760 7922 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 9540 9340 gene locus_tag LOCUS_27770 9540 9340 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544319.1 protein_id gnl|my_center|LOCUS_27770 9878 10147 gene locus_tag LOCUS_27780 9878 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 10404 10571 gene locus_tag LOCUS_27790 10404 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 10631 11071 gene locus_tag LOCUS_27800 10631 11071 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_27800 11441 12718 gene locus_tag LOCUS_27810 11441 12718 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338075.1 protein_id gnl|my_center|LOCUS_27810 12715 13326 gene locus_tag LOCUS_27820 12715 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 13419 13631 gene locus_tag LOCUS_27830 13419 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 13628 13852 gene locus_tag LOCUS_27840 13628 13852 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544396.1 protein_id gnl|my_center|LOCUS_27840 13871 14644 gene locus_tag LOCUS_27850 13871 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 14644 14949 gene locus_tag LOCUS_27860 14644 14949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 15200 17656 gene locus_tag LOCUS_27870 15200 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 18843 19484 gene locus_tag LOCUS_27880 18843 19484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 19478 20230 gene locus_tag LOCUS_27890 19478 20230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 20221 20880 gene locus_tag LOCUS_27900 20221 20880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 21030 21242 gene locus_tag LOCUS_27910 21030 21242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 21211 21678 gene locus_tag LOCUS_27920 21211 21678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 22031 22189 gene locus_tag LOCUS_27930 22031 22189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 22201 22458 gene locus_tag LOCUS_27940 22201 22458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 22624 23307 gene locus_tag LOCUS_27950 22624 23307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 23403 23726 gene locus_tag LOCUS_27960 23403 23726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 23939 23745 gene locus_tag LOCUS_27970 23939 23745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 24960 24085 gene locus_tag LOCUS_27980 24960 24085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 25137 25062 gene locus_tag LOCUS_t00410 25137 25062 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence37 311 102 gene locus_tag LOCUS_27990 311 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 1331 2026 gene locus_tag LOCUS_28000 1331 2026 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965913.1 protein_id gnl|my_center|LOCUS_28000 2121 2642 gene locus_tag LOCUS_28010 2121 2642 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965912.1 protein_id gnl|my_center|LOCUS_28010 2651 3007 gene locus_tag LOCUS_28020 2651 3007 CDS product cupredoxin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085346.1 protein_id gnl|my_center|LOCUS_28020 3965 3510 gene locus_tag LOCUS_28030 3965 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 4556 4107 gene locus_tag LOCUS_28040 4556 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 8195 4950 gene locus_tag LOCUS_28050 8195 4950 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007003880.1 protein_id gnl|my_center|LOCUS_28050 9448 8234 gene locus_tag LOCUS_28060 9448 8234 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269235.1 protein_id gnl|my_center|LOCUS_28060 9923 9573 gene locus_tag LOCUS_28070 9923 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 10561 9950 gene locus_tag LOCUS_28080 10561 9950 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_28080 10697 11104 gene locus_tag LOCUS_28090 10697 11104 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 protein_id gnl|my_center|LOCUS_28090 11279 11542 gene locus_tag LOCUS_28100 11279 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 12197 11517 gene locus_tag LOCUS_28110 12197 11517 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095521776.1 protein_id gnl|my_center|LOCUS_28110 13573 13118 gene locus_tag LOCUS_28120 13573 13118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 14856 13573 gene locus_tag LOCUS_28130 14856 13573 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_28130 15286 14849 gene locus_tag LOCUS_28140 15286 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 15516 15298 gene locus_tag LOCUS_28150 15516 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 17241 15862 gene locus_tag LOCUS_28160 17241 15862 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090968.1 protein_id gnl|my_center|LOCUS_28160 18122 17241 gene locus_tag LOCUS_28170 18122 17241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 18415 18122 gene locus_tag LOCUS_28180 18415 18122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 19418 18513 gene locus_tag LOCUS_28190 19418 18513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 20613 19465 gene locus_tag LOCUS_28200 20613 19465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 21077 21511 gene locus_tag LOCUS_28210 21077 21511 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_28210 21640 22899 gene locus_tag LOCUS_28220 21640 22899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 22902 23309 gene locus_tag LOCUS_28230 22902 23309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 24424 23306 gene locus_tag LOCUS_28240 24424 23306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence38 615 223 gene locus_tag LOCUS_28250 gene arsC 615 223 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085868.1 protein_id gnl|my_center|LOCUS_28250 2957 708 gene locus_tag LOCUS_28260 gene parC 2957 708 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087818.1 protein_id gnl|my_center|LOCUS_28260 3833 3051 gene locus_tag LOCUS_28270 gene recO 3833 3051 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087819.1 protein_id gnl|my_center|LOCUS_28270 4264 3893 gene locus_tag LOCUS_28280 4264 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087820.1 protein_id gnl|my_center|LOCUS_28280 5189 4278 gene locus_tag LOCUS_28290 gene era 5189 4278 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087821.1 protein_id gnl|my_center|LOCUS_28290 5986 5186 gene locus_tag LOCUS_28300 gene rnc 5986 5186 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087822.1 protein_id gnl|my_center|LOCUS_28300 6741 5983 gene locus_tag LOCUS_28310 gene lepB 6741 5983 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087823.1 protein_id gnl|my_center|LOCUS_28310 7431 7012 gene locus_tag LOCUS_28320 gene acpS 7431 7012 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087824.1 protein_id gnl|my_center|LOCUS_28320 8207 7428 gene locus_tag LOCUS_28330 8207 7428 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087825.1 protein_id gnl|my_center|LOCUS_28330 10926 8671 gene locus_tag LOCUS_28340 10926 8671 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087826.1 protein_id gnl|my_center|LOCUS_28340 11341 11637 gene locus_tag LOCUS_28350 11341 11637 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172803.1 protein_id gnl|my_center|LOCUS_28350 11955 11707 gene locus_tag LOCUS_28360 11955 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 12871 12479 gene locus_tag LOCUS_28370 gene rpoZ 12871 12479 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008133017.1 protein_id gnl|my_center|LOCUS_28370 13214 13831 gene locus_tag LOCUS_28380 13214 13831 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087827.1 protein_id gnl|my_center|LOCUS_28380 13938 14510 gene locus_tag LOCUS_28390 13938 14510 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_28390 14507 14746 gene locus_tag LOCUS_28400 14507 14746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 15358 14885 gene locus_tag LOCUS_28410 gene smpB 15358 14885 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087830.1 protein_id gnl|my_center|LOCUS_28410 15842 15423 gene locus_tag LOCUS_28420 gene mscL 15842 15423 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547170.1 protein_id gnl|my_center|LOCUS_28420 16786 15896 gene locus_tag LOCUS_28430 gene dapA 16786 15896 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171604.1 protein_id gnl|my_center|LOCUS_28430 17325 19244 gene locus_tag LOCUS_28440 17325 19244 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966353.1 protein_id gnl|my_center|LOCUS_28440 19819 19496 gene locus_tag LOCUS_28450 19819 19496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 21694 20135 gene locus_tag LOCUS_28460 21694 20135 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089626.1 protein_id gnl|my_center|LOCUS_28460 22373 22466 gene locus_tag LOCUS_t00420 22373 22466 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <24172 22767 gene locus_tag LOCUS_28470 <24172 22767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016374.1:type III restriction-modification system endonuclease >Feature sequence39 323 3 gene locus_tag LOCUS_28480 323 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 497 423 gene locus_tag LOCUS_t00430 497 423 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 883 551 gene locus_tag LOCUS_28490 883 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090070.1 protein_id gnl|my_center|LOCUS_28490 882 1937 gene locus_tag LOCUS_28500 882 1937 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090071.1 protein_id gnl|my_center|LOCUS_28500 2151 3050 gene locus_tag LOCUS_28510 gene rpoH 2151 3050 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090072.1 protein_id gnl|my_center|LOCUS_28510 4369 3149 gene locus_tag LOCUS_28520 4369 3149 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965436.1 protein_id gnl|my_center|LOCUS_28520 5207 4848 gene locus_tag LOCUS_28530 5207 4848 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090378.1 protein_id gnl|my_center|LOCUS_28530 5564 5824 gene locus_tag LOCUS_28540 5564 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 6533 5883 gene locus_tag LOCUS_28550 6533 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 6519 6776 gene locus_tag LOCUS_28560 6519 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 8294 6765 gene locus_tag LOCUS_28570 8294 6765 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533322.1 protein_id gnl|my_center|LOCUS_28570 9271 8291 gene locus_tag LOCUS_28580 gene nadA 9271 8291 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206696170.1 protein_id gnl|my_center|LOCUS_28580 10292 9324 gene locus_tag LOCUS_28590 10292 9324 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533320.1 protein_id gnl|my_center|LOCUS_28590 10555 10848 gene locus_tag LOCUS_28600 10555 10848 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084888.1 protein_id gnl|my_center|LOCUS_28600 10890 12026 gene locus_tag LOCUS_28610 10890 12026 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973492.1 protein_id gnl|my_center|LOCUS_28610 12023 12664 gene locus_tag LOCUS_28620 gene bioD 12023 12664 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533326.1 protein_id gnl|my_center|LOCUS_28620 12661 13920 gene locus_tag LOCUS_28630 12661 13920 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533327.1 protein_id gnl|my_center|LOCUS_28630 14538 14062 gene locus_tag LOCUS_28640 14538 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 15224 14784 gene locus_tag LOCUS_28650 15224 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 15105 15494 gene locus_tag LOCUS_28660 15105 15494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28660 16040 15612 gene locus_tag LOCUS_28670 16040 15612 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087893.1 protein_id gnl|my_center|LOCUS_28670 16443 16252 gene locus_tag LOCUS_28680 16443 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 16751 16485 gene locus_tag LOCUS_28690 16751 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 17058 18257 gene locus_tag LOCUS_28700 17058 18257 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173158.1 protein_id gnl|my_center|LOCUS_28700 18438 18211 gene locus_tag LOCUS_28710 18438 18211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 19623 18997 gene locus_tag LOCUS_28720 19623 18997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 21075 19894 gene locus_tag LOCUS_28730 21075 19894 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085634.1 protein_id gnl|my_center|LOCUS_28730 21828 21553 gene locus_tag LOCUS_28740 21828 21553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 21872 22060 gene locus_tag LOCUS_28750 21872 22060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 22391 22834 gene locus_tag LOCUS_28760 22391 22834 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412347.1 protein_id gnl|my_center|LOCUS_28760 23366 23118 gene locus_tag LOCUS_28770 23366 23118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 23391 23621 gene locus_tag LOCUS_28780 23391 23621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 23817 23665 gene locus_tag LOCUS_28790 23817 23665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence40 1337 117 gene locus_tag LOCUS_28800 1337 117 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_28800 1886 3067 gene locus_tag LOCUS_28810 1886 3067 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_28810 4356 3091 gene locus_tag LOCUS_28820 4356 3091 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966321.1 protein_id gnl|my_center|LOCUS_28820 5922 4390 gene locus_tag LOCUS_28830 5922 4390 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171667.1 protein_id gnl|my_center|LOCUS_28830 7164 6031 gene locus_tag LOCUS_28840 7164 6031 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087736.1 protein_id gnl|my_center|LOCUS_28840 7875 7168 gene locus_tag LOCUS_28850 7875 7168 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172554.1 protein_id gnl|my_center|LOCUS_28850 8122 10275 gene locus_tag LOCUS_28860 8122 10275 CDS product exopolysaccharide transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087735.1 protein_id gnl|my_center|LOCUS_28860 11489 10296 gene locus_tag LOCUS_28870 11489 10296 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966320.1 protein_id gnl|my_center|LOCUS_28870 11889 11683 gene locus_tag LOCUS_28880 11889 11683 CDS product DUF2842 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087732.1 protein_id gnl|my_center|LOCUS_28880 11986 13065 gene locus_tag LOCUS_28890 11986 13065 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087731.1 protein_id gnl|my_center|LOCUS_28890 13143 14390 gene locus_tag LOCUS_28900 13143 14390 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971853.1 protein_id gnl|my_center|LOCUS_28900 15844 14567 gene locus_tag LOCUS_28910 15844 14567 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087730.1 protein_id gnl|my_center|LOCUS_28910 16313 16777 gene locus_tag LOCUS_28920 gene rplM 16313 16777 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087726.1 protein_id gnl|my_center|LOCUS_28920 16780 17256 gene locus_tag LOCUS_28930 gene rpsI 16780 17256 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087725.1 protein_id gnl|my_center|LOCUS_28930 17386 18396 gene locus_tag LOCUS_28940 17386 18396 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235885780.1 protein_id gnl|my_center|LOCUS_28940 18488 18970 gene locus_tag LOCUS_28950 gene tsaA 18488 18970 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087894.1 protein_id gnl|my_center|LOCUS_28950 20021 19050 gene locus_tag LOCUS_28960 20021 19050 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087892.1 protein_id gnl|my_center|LOCUS_28960 21183 20431 gene locus_tag LOCUS_28970 21183 20431 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087891.1 protein_id gnl|my_center|LOCUS_28970 21656 21189 gene locus_tag LOCUS_28980 21656 21189 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_28980 21856 22773 gene locus_tag LOCUS_28990 21856 22773 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171560.1 protein_id gnl|my_center|LOCUS_28990 23331 22864 gene locus_tag LOCUS_29000 23331 22864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 >Feature sequence41 304 110 gene locus_tag LOCUS_29010 304 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 1988 468 gene locus_tag LOCUS_29020 1988 468 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972926.1 protein_id gnl|my_center|LOCUS_29020 3318 2053 gene locus_tag LOCUS_29030 3318 2053 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329916.1 protein_id gnl|my_center|LOCUS_29030 5443 3437 gene locus_tag LOCUS_29040 5443 3437 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844877.1 protein_id gnl|my_center|LOCUS_29040 7399 5486 gene locus_tag LOCUS_29050 7399 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 8451 7534 gene locus_tag LOCUS_29060 8451 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 9300 8731 gene locus_tag LOCUS_29070 9300 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067054.1 protein_id gnl|my_center|LOCUS_29070 9475 10011 gene locus_tag LOCUS_29080 9475 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 10675 11262 gene locus_tag LOCUS_29090 10675 11262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 11729 12208 gene locus_tag LOCUS_29100 11729 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 13718 12414 gene locus_tag LOCUS_29110 gene pvdA 13718 12414 CDS product L-ornithine N(5)-monooxygenase PvdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114509.1 protein_id gnl|my_center|LOCUS_29110 14148 13741 gene locus_tag LOCUS_29120 14148 13741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29120 16686 14986 gene locus_tag LOCUS_29130 gene pvdE 16686 14986 CDS product pyoverdine export ABC transporter PvdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103601.1 protein_id gnl|my_center|LOCUS_29130 16827 17027 gene locus_tag LOCUS_29140 16827 17027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 17938 16937 gene locus_tag LOCUS_29150 17938 16937 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521279.1 protein_id gnl|my_center|LOCUS_29150 <22196 17947 gene locus_tag LOCUS_29160 <22196 17947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_155585792.1:non-ribosomal peptide synthetase >Feature sequence42 112 282 gene locus_tag LOCUS_29170 112 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 357 566 gene locus_tag LOCUS_29180 357 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 496 924 gene locus_tag LOCUS_29190 496 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 924 1271 gene locus_tag LOCUS_29200 924 1271 CDS product head-tail adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975487.1 protein_id gnl|my_center|LOCUS_29200 1324 1611 gene locus_tag LOCUS_29210 1324 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 1779 1991 gene locus_tag LOCUS_29220 1779 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 1979 2428 gene locus_tag LOCUS_29230 1979 2428 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038731.1 protein_id gnl|my_center|LOCUS_29230 2432 2881 gene locus_tag LOCUS_29240 2432 2881 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_29240 2900 3784 gene locus_tag LOCUS_29250 2900 3784 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_29250 3848 5578 gene locus_tag LOCUS_29260 3848 5578 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_29260 6146 5760 gene locus_tag LOCUS_29270 6146 5760 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_29270 6862 6536 gene locus_tag LOCUS_29280 6862 6536 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527402.1 protein_id gnl|my_center|LOCUS_29280 7739 8977 gene locus_tag LOCUS_29290 7739 8977 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 protein_id gnl|my_center|LOCUS_29290 8974 10107 gene locus_tag LOCUS_29300 8974 10107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_29300 10109 10813 gene locus_tag LOCUS_29310 10109 10813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_29310 11185 11661 gene locus_tag LOCUS_29320 11185 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 11714 11926 gene locus_tag LOCUS_29330 11714 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 12142 12549 gene locus_tag LOCUS_29340 12142 12549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328788.1 protein_id gnl|my_center|LOCUS_29340 16231 13043 gene locus_tag LOCUS_29350 16231 13043 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_29350 17427 16312 gene locus_tag LOCUS_29360 17427 16312 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_29360 18782 17427 gene locus_tag LOCUS_29370 18782 17427 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968693.1 protein_id gnl|my_center|LOCUS_29370 20316 18775 gene locus_tag LOCUS_29380 20316 18775 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_29380 20612 20433 gene locus_tag LOCUS_29390 20612 20433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence43 211 2316 gene locus_tag LOCUS_29400 211 2316 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533213.1 protein_id gnl|my_center|LOCUS_29400 4185 2596 gene locus_tag LOCUS_29410 4185 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 5375 5181 gene locus_tag LOCUS_29420 5375 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 5757 5966 gene locus_tag LOCUS_29430 5757 5966 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085938.1 protein_id gnl|my_center|LOCUS_29430 6394 6212 gene locus_tag LOCUS_29440 6394 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 6393 6656 gene locus_tag LOCUS_29450 6393 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 7125 8111 gene locus_tag LOCUS_29460 gene glk 7125 8111 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087427.1 protein_id gnl|my_center|LOCUS_29460 9776 8352 gene locus_tag LOCUS_29470 9776 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 11531 10986 gene locus_tag LOCUS_29480 11531 10986 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423733.1 protein_id gnl|my_center|LOCUS_29480 11767 12270 gene locus_tag LOCUS_29490 gene ectA 11767 12270 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640101.1 protein_id gnl|my_center|LOCUS_29490 12275 13597 gene locus_tag LOCUS_29500 gene ectB 12275 13597 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086037.1 protein_id gnl|my_center|LOCUS_29500 13617 14033 gene locus_tag LOCUS_29510 13617 14033 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003071625.1 protein_id gnl|my_center|LOCUS_29510 14057 14977 gene locus_tag LOCUS_29520 gene thpD 14057 14977 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 protein_id gnl|my_center|LOCUS_29520 14974 15114 gene locus_tag LOCUS_29530 14974 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 15189 15365 gene locus_tag LOCUS_29540 15189 15365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 15362 16678 gene locus_tag LOCUS_29550 15362 16678 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066901444.1 protein_id gnl|my_center|LOCUS_29550 16881 19907 gene locus_tag LOCUS_29560 16881 19907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence44 609 1751 gene locus_tag LOCUS_29570 609 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 2250 2507 gene locus_tag LOCUS_29580 2250 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29580 2927 2712 gene locus_tag LOCUS_29590 2927 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 3983 3426 gene locus_tag LOCUS_29600 3983 3426 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_29600 5032 5262 gene locus_tag LOCUS_29610 5032 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 9006 5833 gene locus_tag LOCUS_29620 9006 5833 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_29620 10424 9003 gene locus_tag LOCUS_29630 10424 9003 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_29630 10898 10506 gene locus_tag LOCUS_29640 10898 10506 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244429.1 protein_id gnl|my_center|LOCUS_29640 11364 10996 gene locus_tag LOCUS_29650 11364 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 11740 11465 gene locus_tag LOCUS_29660 11740 11465 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083527.1 protein_id gnl|my_center|LOCUS_29660 11784 14207 gene locus_tag LOCUS_29670 11784 14207 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_29670 14573 14181 gene locus_tag LOCUS_29680 14573 14181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 14809 14576 gene locus_tag LOCUS_29690 14809 14576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 14702 15148 gene locus_tag LOCUS_29700 14702 15148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 15715 16125 gene locus_tag LOCUS_29710 15715 16125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 16187 16642 gene locus_tag LOCUS_29720 16187 16642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 16639 18297 gene locus_tag LOCUS_29730 16639 18297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 18937 18662 gene locus_tag LOCUS_29740 18937 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence45 126 611 gene locus_tag LOCUS_29750 126 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 1148 2347 gene locus_tag LOCUS_29760 1148 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 2419 2673 gene locus_tag LOCUS_29770 2419 2673 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614401.1 protein_id gnl|my_center|LOCUS_29770 2670 3092 gene locus_tag LOCUS_29780 2670 3092 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_29780 3230 5245 gene locus_tag LOCUS_29790 3230 5245 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368406.1 protein_id gnl|my_center|LOCUS_29790 5249 5704 gene locus_tag LOCUS_29800 5249 5704 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082874.1 protein_id gnl|my_center|LOCUS_29800 6589 5798 gene locus_tag LOCUS_29810 gene molC 6589 5798 CDS product molybdate ABC transporter ATP-binding protein MolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693486.1 protein_id gnl|my_center|LOCUS_29810 7640 6582 gene locus_tag LOCUS_29820 7640 6582 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705138.1 protein_id gnl|my_center|LOCUS_29820 8334 7819 gene locus_tag LOCUS_29830 8334 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 8782 10854 gene locus_tag LOCUS_29840 8782 10854 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268707.1 protein_id gnl|my_center|LOCUS_29840 10863 11972 gene locus_tag LOCUS_29850 10863 11972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 12057 13157 gene locus_tag LOCUS_29860 12057 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 13219 13614 gene locus_tag LOCUS_29870 13219 13614 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531026.1 protein_id gnl|my_center|LOCUS_29870 13695 14132 gene locus_tag LOCUS_29880 13695 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 14181 15080 gene locus_tag LOCUS_29890 14181 15080 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142979.1 protein_id gnl|my_center|LOCUS_29890 15308 16297 gene locus_tag LOCUS_29900 gene trbB 15308 16297 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090996.1 protein_id gnl|my_center|LOCUS_29900 16254 16589 gene locus_tag LOCUS_29910 16254 16589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 16589 16852 gene locus_tag LOCUS_29920 16589 16852 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312513.1 protein_id gnl|my_center|LOCUS_29920 >Feature sequence46 578 381 gene locus_tag LOCUS_29930 578 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 952 752 gene locus_tag LOCUS_29940 952 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 1359 1274 gene locus_tag LOCUS_t00440 1359 1274 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1748 1599 gene locus_tag LOCUS_29950 1748 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2392 3036 gene locus_tag LOCUS_29960 2392 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 3458 3531 gene locus_tag LOCUS_t00450 3458 3531 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3880 4302 gene locus_tag LOCUS_29970 3880 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 5521 5844 gene locus_tag LOCUS_29980 5521 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 5941 6435 gene locus_tag LOCUS_29990 5941 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 6745 7275 gene locus_tag LOCUS_30000 6745 7275 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537953.1 protein_id gnl|my_center|LOCUS_30000 7372 8328 gene locus_tag LOCUS_30010 7372 8328 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537952.1 protein_id gnl|my_center|LOCUS_30010 8474 10972 gene locus_tag LOCUS_30020 gene fpvA 8474 10972 CDS product ferripyoverdine/pyocin S3 receptor FpvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349900.1 protein_id gnl|my_center|LOCUS_30020 11441 12562 gene locus_tag LOCUS_30030 11441 12562 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106912.1 protein_id gnl|my_center|LOCUS_30030 12559 13089 gene locus_tag LOCUS_30040 12559 13089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111932.1 protein_id gnl|my_center|LOCUS_30040 13086 13412 gene locus_tag LOCUS_30050 13086 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089624.1 protein_id gnl|my_center|LOCUS_30050 13426 14652 gene locus_tag LOCUS_30060 gene pvdR 13426 14652 CDS product pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114507.1 protein_id gnl|my_center|LOCUS_30060 14649 16598 gene locus_tag LOCUS_30070 14649 16598 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769685.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence47 347 541 gene locus_tag LOCUS_30080 347 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 1352 915 gene locus_tag LOCUS_30090 1352 915 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_30090 1496 1807 gene locus_tag LOCUS_30100 1496 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1746 1985 gene locus_tag LOCUS_30110 1746 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 1966 2184 gene locus_tag LOCUS_30120 1966 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 2852 2673 gene locus_tag LOCUS_30130 2852 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 3107 2931 gene locus_tag LOCUS_30140 3107 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 3410 7408 gene locus_tag LOCUS_30150 3410 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 9689 9048 gene locus_tag LOCUS_30160 9689 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 10338 10808 gene locus_tag LOCUS_30170 10338 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 11581 12282 gene locus_tag LOCUS_30180 11581 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 12279 13169 gene locus_tag LOCUS_30190 12279 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 14346 14696 gene locus_tag LOCUS_30200 14346 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 15526 14753 gene locus_tag LOCUS_30210 15526 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 15668 15976 gene locus_tag LOCUS_30220 15668 15976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 >Feature sequence48 329 253 gene locus_tag LOCUS_t00460 329 253 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 878 663 gene locus_tag LOCUS_30230 878 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 1510 1947 gene locus_tag LOCUS_30240 1510 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30240 1916 2416 gene locus_tag LOCUS_30250 1916 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30250 3189 2413 gene locus_tag LOCUS_30260 3189 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 4852 3596 gene locus_tag LOCUS_30270 gene narK 4852 3596 CDS product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841855.1 protein_id gnl|my_center|LOCUS_30270 5774 5097 gene locus_tag LOCUS_30280 gene narI 5774 5097 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934155.1 protein_id gnl|my_center|LOCUS_30280 6837 5809 gene locus_tag LOCUS_30290 6837 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 8541 7000 gene locus_tag LOCUS_30300 gene narH 8541 7000 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692685.1 protein_id gnl|my_center|LOCUS_30300 9300 8605 gene locus_tag LOCUS_30310 9300 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 12938 9294 gene locus_tag LOCUS_30320 12938 9294 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 protein_id gnl|my_center|LOCUS_30320 13918 12938 gene locus_tag LOCUS_30330 13918 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 14591 15337 gene locus_tag LOCUS_30340 14591 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence49 1036 824 gene locus_tag LOCUS_30350 1036 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 1639 1881 gene locus_tag LOCUS_30360 1639 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 2090 2452 gene locus_tag LOCUS_30370 2090 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3624 4211 gene locus_tag LOCUS_30380 3624 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 4609 4340 gene locus_tag LOCUS_30390 4609 4340 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_30390 4799 5002 gene locus_tag LOCUS_30400 4799 5002 CDS product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967854.1 protein_id gnl|my_center|LOCUS_30400 5190 4999 gene locus_tag LOCUS_30410 5190 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 5394 5846 gene locus_tag LOCUS_30420 5394 5846 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971129.1 protein_id gnl|my_center|LOCUS_30420 6106 6921 gene locus_tag LOCUS_30430 6106 6921 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267572.1 protein_id gnl|my_center|LOCUS_30430 6939 8771 gene locus_tag LOCUS_30440 6939 8771 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186147.1 protein_id gnl|my_center|LOCUS_30440 8984 9217 gene locus_tag LOCUS_30450 8984 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 9972 10196 gene locus_tag LOCUS_30460 9972 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 10385 10690 gene locus_tag LOCUS_30470 10385 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 11684 11070 gene locus_tag LOCUS_30480 11684 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090060.1 protein_id gnl|my_center|LOCUS_30480 12284 15028 gene locus_tag LOCUS_30490 12284 15028 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253039.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence50 532 293 gene locus_tag LOCUS_30500 532 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967182.1 protein_id gnl|my_center|LOCUS_30500 798 616 gene locus_tag LOCUS_30510 798 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 1067 795 gene locus_tag LOCUS_30520 1067 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1559 1780 gene locus_tag LOCUS_30530 1559 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 1828 2208 gene locus_tag LOCUS_30540 1828 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086641.1 protein_id gnl|my_center|LOCUS_30540 2293 2649 gene locus_tag LOCUS_30550 2293 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 3229 3933 gene locus_tag LOCUS_30560 gene rlmB 3229 3933 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921492.1 protein_id gnl|my_center|LOCUS_30560 4529 3996 gene locus_tag LOCUS_30570 4529 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088248.1 protein_id gnl|my_center|LOCUS_30570 5026 4580 gene locus_tag LOCUS_30580 5026 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088249.1 protein_id gnl|my_center|LOCUS_30580 5434 5508 gene locus_tag LOCUS_t00470 5434 5508 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6006 5767 gene locus_tag LOCUS_30590 6006 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 6269 6099 gene locus_tag LOCUS_30600 6269 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 6768 6553 gene locus_tag LOCUS_30610 6768 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 8935 7145 gene locus_tag LOCUS_30620 8935 7145 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135176564.1 protein_id gnl|my_center|LOCUS_30620 9037 9222 gene locus_tag LOCUS_30630 9037 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 10513 9602 gene locus_tag LOCUS_30640 10513 9602 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089304.1 protein_id gnl|my_center|LOCUS_30640 11756 10683 gene locus_tag LOCUS_30650 11756 10683 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123834.1 protein_id gnl|my_center|LOCUS_30650 12681 12460 gene locus_tag LOCUS_30660 12681 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30660 13201 12746 gene locus_tag LOCUS_30670 13201 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30670 13279 14040 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcggttggcctgcgatttctgaactgctagcgt >Feature sequence51 1889 333 gene locus_tag LOCUS_30680 1889 333 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036716.1 protein_id gnl|my_center|LOCUS_30680 3437 3361 gene locus_tag LOCUS_t00480 3437 3361 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3931 5127 gene locus_tag LOCUS_30690 3931 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390100.1 protein_id gnl|my_center|LOCUS_30690 5495 7756 gene locus_tag LOCUS_30700 5495 7756 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395400.1 protein_id gnl|my_center|LOCUS_30700 8948 7821 gene locus_tag LOCUS_30710 8948 7821 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969205.1 protein_id gnl|my_center|LOCUS_30710 9823 9164 gene locus_tag LOCUS_30720 9823 9164 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_30720 10197 10769 gene locus_tag LOCUS_30730 10197 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036041420.1 protein_id gnl|my_center|LOCUS_30730 11165 13180 gene locus_tag LOCUS_30740 11165 13180 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088023.1 protein_id gnl|my_center|LOCUS_30740 13256 13555 gene locus_tag LOCUS_30750 13256 13555 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088021.1 protein_id gnl|my_center|LOCUS_30750 13810 13995 gene locus_tag LOCUS_30760 13810 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence52 837 1169 gene locus_tag LOCUS_30770 837 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 1160 1528 gene locus_tag LOCUS_30780 1160 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 1525 1929 gene locus_tag LOCUS_30790 1525 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 1975 2667 gene locus_tag LOCUS_30800 1975 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 3306 2689 gene locus_tag LOCUS_30810 3306 2689 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084862.1 protein_id gnl|my_center|LOCUS_30810 3395 3697 gene locus_tag LOCUS_30820 3395 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3705 5927 gene locus_tag LOCUS_30830 3705 5927 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_30830 8281 6287 gene locus_tag LOCUS_30840 8281 6287 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170118038.1 protein_id gnl|my_center|LOCUS_30840 8891 8553 gene locus_tag LOCUS_30850 8891 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30850 9307 8939 gene locus_tag LOCUS_30860 9307 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30860 9669 11438 gene locus_tag LOCUS_30870 9669 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 11567 11950 gene locus_tag LOCUS_30880 11567 11950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30880 12178 12546 gene locus_tag LOCUS_30890 12178 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 13544 12519 gene locus_tag LOCUS_30900 13544 12519 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028351643.1 protein_id gnl|my_center|LOCUS_30900 >Feature sequence53 791 531 gene locus_tag LOCUS_30910 791 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30910 1872 1003 gene locus_tag LOCUS_30920 1872 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 2198 1869 gene locus_tag LOCUS_30930 2198 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 2318 3616 gene locus_tag LOCUS_30940 2318 3616 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_30940 3613 4329 gene locus_tag LOCUS_30950 3613 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 4540 5031 gene locus_tag LOCUS_30960 4540 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 5218 5006 gene locus_tag LOCUS_30970 5218 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 6227 5973 gene locus_tag LOCUS_30980 6227 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 6306 6548 gene locus_tag LOCUS_30990 6306 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30990 6802 6590 gene locus_tag LOCUS_31000 6802 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 8235 7804 gene locus_tag LOCUS_31010 8235 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086262.1 protein_id gnl|my_center|LOCUS_31010 8331 8777 gene locus_tag LOCUS_31020 8331 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 8896 10509 gene locus_tag LOCUS_31030 8896 10509 CDS product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965969.1 protein_id gnl|my_center|LOCUS_31030 10506 11447 gene locus_tag LOCUS_31040 10506 11447 CDS product DUF2950 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086271.1 protein_id gnl|my_center|LOCUS_31040 12153 12881 gene locus_tag LOCUS_31050 12153 12881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31050 12959 13315 gene locus_tag LOCUS_31060 12959 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31060 >Feature sequence54 316 3495 gene locus_tag LOCUS_31070 316 3495 CDS product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880525.1 protein_id gnl|my_center|LOCUS_31070 4314 4523 gene locus_tag LOCUS_31080 4314 4523 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031814.1 protein_id gnl|my_center|LOCUS_31080 4523 5065 gene locus_tag LOCUS_31090 4523 5065 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 protein_id gnl|my_center|LOCUS_31090 6169 6354 gene locus_tag LOCUS_31100 6169 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 6308 6724 gene locus_tag LOCUS_31110 6308 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 9822 6721 gene locus_tag LOCUS_31120 9822 6721 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532875.1 protein_id gnl|my_center|LOCUS_31120 10032 11240 gene locus_tag LOCUS_31130 10032 11240 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546440.1 protein_id gnl|my_center|LOCUS_31130 12424 12221 gene locus_tag LOCUS_31140 12424 12221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31140 <13303 12477 gene locus_tag LOCUS_31150 <13303 12477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200941.1:universal stress protein >Feature sequence55 440 54 gene locus_tag LOCUS_31160 440 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1674 898 gene locus_tag LOCUS_31170 1674 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 3151 2693 gene locus_tag LOCUS_31180 3151 2693 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971993.1 protein_id gnl|my_center|LOCUS_31180 3453 3214 gene locus_tag LOCUS_31190 3453 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3620 3886 gene locus_tag LOCUS_31200 3620 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31200 5068 4151 gene locus_tag LOCUS_31210 5068 4151 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921653.1 protein_id gnl|my_center|LOCUS_31210 5042 5254 gene locus_tag LOCUS_31220 5042 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 5662 5886 gene locus_tag LOCUS_31230 5662 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 6397 6741 gene locus_tag LOCUS_31240 6397 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 6951 9581 gene locus_tag LOCUS_31250 6951 9581 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_31250 11271 10588 gene locus_tag LOCUS_31260 11271 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 11751 12905 gene locus_tag LOCUS_31270 11751 12905 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035337.1 protein_id gnl|my_center|LOCUS_31270 >Feature sequence56 134 508 gene locus_tag LOCUS_31280 134 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 790 1191 gene locus_tag LOCUS_31290 790 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 1554 1345 gene locus_tag LOCUS_31300 1554 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 1808 2449 gene locus_tag LOCUS_31310 1808 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 3208 2510 gene locus_tag LOCUS_31320 3208 2510 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140124.1 protein_id gnl|my_center|LOCUS_31320 3957 5390 gene locus_tag LOCUS_31330 3957 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 5458 6303 gene locus_tag LOCUS_31340 5458 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 6450 12425 gene locus_tag LOCUS_31350 6450 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 12700 12482 gene locus_tag LOCUS_31360 12700 12482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence57 596 330 gene locus_tag LOCUS_31370 596 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31370 626 838 gene locus_tag LOCUS_31380 626 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 1368 1021 gene locus_tag LOCUS_31390 1368 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31390 2367 1654 gene locus_tag LOCUS_31400 2367 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 3688 2756 gene locus_tag LOCUS_31410 3688 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 5112 3685 gene locus_tag LOCUS_31420 5112 3685 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086847.1 protein_id gnl|my_center|LOCUS_31420 5142 5327 gene locus_tag LOCUS_31430 5142 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 5530 5363 gene locus_tag LOCUS_31440 5530 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 6935 5760 gene locus_tag LOCUS_31450 6935 5760 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 protein_id gnl|my_center|LOCUS_31450 10960 7595 gene locus_tag LOCUS_31460 10960 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 11683 10979 gene locus_tag LOCUS_31470 11683 10979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 >Feature sequence58 <1 561 gene locus_tag LOCUS_31480 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090918.1:IS21-like element helper ATPase IstB 1089 814 gene locus_tag LOCUS_31490 1089 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 1384 1893 gene locus_tag LOCUS_31500 1384 1893 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_31500 1890 3227 gene locus_tag LOCUS_31510 1890 3227 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_31510 3470 3658 gene locus_tag LOCUS_31520 3470 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 3876 3670 gene locus_tag LOCUS_31530 3876 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 4102 8193 gene locus_tag LOCUS_31540 4102 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 7924 8000 gene locus_tag LOCUS_t00490 7924 8000 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8795 9622 gene locus_tag LOCUS_31550 8795 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 10454 9771 gene locus_tag LOCUS_31560 10454 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 11056 11493 gene locus_tag LOCUS_31570 11056 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence59 80 1171 gene locus_tag LOCUS_31580 80 1171 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188583328.1 protein_id gnl|my_center|LOCUS_31580 1356 1862 gene locus_tag LOCUS_31590 1356 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31590 1771 2109 gene locus_tag LOCUS_31600 1771 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31600 3133 2936 gene locus_tag LOCUS_31610 3133 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 3495 4184 gene locus_tag LOCUS_31620 3495 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 4181 6262 gene locus_tag LOCUS_31630 4181 6262 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136402.1 protein_id gnl|my_center|LOCUS_31630 6246 6461 gene locus_tag LOCUS_31640 6246 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 7917 7459 gene locus_tag LOCUS_31650 7917 7459 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_31650 8224 7925 gene locus_tag LOCUS_31660 8224 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 8666 8322 gene locus_tag LOCUS_31670 8666 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 9672 8659 gene locus_tag LOCUS_31680 9672 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 10005 10859 gene locus_tag LOCUS_31690 10005 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence60 485 805 gene locus_tag LOCUS_31700 485 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 2443 839 gene locus_tag LOCUS_31710 2443 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 2907 2440 gene locus_tag LOCUS_31720 2907 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 3305 2910 gene locus_tag LOCUS_31730 3305 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 3971 4111 gene locus_tag LOCUS_31740 3971 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 4250 4450 gene locus_tag LOCUS_31750 4250 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 4510 4659 gene locus_tag LOCUS_31760 4510 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 4656 4838 gene locus_tag LOCUS_31770 4656 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 5227 5433 gene locus_tag LOCUS_31780 5227 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 5571 5711 gene locus_tag LOCUS_31790 5571 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 6241 6450 gene locus_tag LOCUS_31800 6241 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 6908 6633 gene locus_tag LOCUS_31810 6908 6633 CDS product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083000.1 protein_id gnl|my_center|LOCUS_31810 7276 7001 gene locus_tag LOCUS_31820 7276 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083002.1 protein_id gnl|my_center|LOCUS_31820 8568 8254 gene locus_tag LOCUS_31830 8568 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 10376 10750 gene locus_tag LOCUS_31840 10376 10750 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640021.1 protein_id gnl|my_center|LOCUS_31840 >Feature sequence61 149 451 gene locus_tag LOCUS_31850 149 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 1281 526 gene locus_tag LOCUS_31860 gene fliP 1281 526 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088559.1 protein_id gnl|my_center|LOCUS_31860 2159 1278 gene locus_tag LOCUS_31870 2159 1278 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088558.1 protein_id gnl|my_center|LOCUS_31870 2535 2942 gene locus_tag LOCUS_31880 gene flgB 2535 2942 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088557.1 protein_id gnl|my_center|LOCUS_31880 2973 3398 gene locus_tag LOCUS_31890 gene flgC 2973 3398 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602149.1 protein_id gnl|my_center|LOCUS_31890 3414 3725 gene locus_tag LOCUS_31900 gene fliE 3414 3725 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088556.1 protein_id gnl|my_center|LOCUS_31900 3869 4132 gene locus_tag LOCUS_31910 gene fliQ 3869 4132 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088555.1 protein_id gnl|my_center|LOCUS_31910 4149 4919 gene locus_tag LOCUS_31920 gene fliR 4149 4919 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088554.1 protein_id gnl|my_center|LOCUS_31920 4930 6009 gene locus_tag LOCUS_31930 gene flhB 4930 6009 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 protein_id gnl|my_center|LOCUS_31930 6161 8713 gene locus_tag LOCUS_31940 6161 8713 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088552.1 protein_id gnl|my_center|LOCUS_31940 9715 8750 gene locus_tag LOCUS_31950 9715 8750 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085859.1 protein_id gnl|my_center|LOCUS_31950 >Feature sequence62 359 93 gene locus_tag LOCUS_31960 359 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 1511 363 gene locus_tag LOCUS_31970 1511 363 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090064.1 protein_id gnl|my_center|LOCUS_31970 2042 1704 gene locus_tag LOCUS_31980 2042 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31980 2482 2090 gene locus_tag LOCUS_31990 2482 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31990 3093 2671 gene locus_tag LOCUS_32000 3093 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 3169 3825 gene locus_tag LOCUS_32010 3169 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 4480 4037 gene locus_tag LOCUS_32020 4480 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32020 4889 4524 gene locus_tag LOCUS_32030 4889 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32030 4984 4802 gene locus_tag LOCUS_32040 4984 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32040 5859 4996 gene locus_tag LOCUS_32050 5859 4996 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968971.1 protein_id gnl|my_center|LOCUS_32050 6361 5918 gene locus_tag LOCUS_32060 6361 5918 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089292.1 protein_id gnl|my_center|LOCUS_32060 7018 6386 gene locus_tag LOCUS_32070 7018 6386 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 protein_id gnl|my_center|LOCUS_32070 8045 7134 gene locus_tag LOCUS_32080 8045 7134 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383681.1 protein_id gnl|my_center|LOCUS_32080 >Feature sequence63 1096 266 gene locus_tag LOCUS_32090 1096 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 2245 1244 gene locus_tag LOCUS_32100 2245 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 3653 2229 gene locus_tag LOCUS_32110 3653 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 4471 3650 gene locus_tag LOCUS_32120 4471 3650 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_32120 5268 4468 gene locus_tag LOCUS_32130 5268 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 5379 5936 gene locus_tag LOCUS_32140 5379 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 5933 6880 gene locus_tag LOCUS_32150 5933 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 6850 7293 gene locus_tag LOCUS_32160 6850 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 7290 8471 gene locus_tag LOCUS_32170 7290 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 8446 8967 gene locus_tag LOCUS_32180 8446 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 >Feature sequence64 440 1522 gene locus_tag LOCUS_32190 440 1522 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171974.1 protein_id gnl|my_center|LOCUS_32190 2552 1854 gene locus_tag LOCUS_32200 2552 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 3594 2950 gene locus_tag LOCUS_32210 3594 2950 CDS product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32210 3748 3482 gene locus_tag LOCUS_32220 3748 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32220 4263 5987 gene locus_tag LOCUS_32230 4263 5987 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086257.1 protein_id gnl|my_center|LOCUS_32230 6027 6860 gene locus_tag LOCUS_32240 gene ppk2 6027 6860 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328758.1 protein_id gnl|my_center|LOCUS_32240 7029 7247 gene locus_tag LOCUS_32250 7029 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 7671 7516 gene locus_tag LOCUS_32260 7671 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 7873 7715 gene locus_tag LOCUS_32270 7873 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 8404 7895 gene locus_tag LOCUS_32280 8404 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086265.1 protein_id gnl|my_center|LOCUS_32280 >Feature sequence65 1364 318 gene locus_tag LOCUS_32290 1364 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 2145 1357 gene locus_tag LOCUS_32300 2145 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 2839 2135 gene locus_tag LOCUS_32310 2839 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 4386 2836 gene locus_tag LOCUS_32320 4386 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 4604 4410 gene locus_tag LOCUS_32330 4604 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 4931 4794 gene locus_tag LOCUS_32340 4931 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 8191 5000 gene locus_tag LOCUS_32350 8191 5000 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804239.1 protein_id gnl|my_center|LOCUS_32350 >Feature sequence66 562 140 gene locus_tag LOCUS_32360 562 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 857 1195 gene locus_tag LOCUS_32370 857 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 1469 1654 gene locus_tag LOCUS_32380 1469 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 3873 2575 gene locus_tag LOCUS_32390 3873 2575 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_32390 4759 4911 gene locus_tag LOCUS_32400 4759 4911 CDS product aa3-type cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136857.1 protein_id gnl|my_center|LOCUS_32400 5233 5679 gene locus_tag LOCUS_32410 5233 5679 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725092.1 protein_id gnl|my_center|LOCUS_32410 6198 6638 gene locus_tag LOCUS_32420 6198 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 6679 7929 gene locus_tag LOCUS_32430 6679 7929 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400619.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence67 1351 533 gene locus_tag LOCUS_32440 1351 533 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_32440 2511 2308 gene locus_tag LOCUS_32450 2511 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 3614 2697 gene locus_tag LOCUS_32460 3614 2697 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919312.1 protein_id gnl|my_center|LOCUS_32460 5497 5222 gene locus_tag LOCUS_32470 5497 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 6056 5601 gene locus_tag LOCUS_32480 6056 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 >Feature sequence68 944 471 gene locus_tag LOCUS_32490 gene bamE 944 471 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171637.1 protein_id gnl|my_center|LOCUS_32490 1052 1594 gene locus_tag LOCUS_32500 1052 1594 CDS product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087784.1 protein_id gnl|my_center|LOCUS_32500 1604 2197 gene locus_tag LOCUS_32510 1604 2197 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087783.1 protein_id gnl|my_center|LOCUS_32510 2441 3502 gene locus_tag LOCUS_32520 gene plsX 2441 3502 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087782.1 protein_id gnl|my_center|LOCUS_32520 3499 4476 gene locus_tag LOCUS_32530 3499 4476 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087781.1 protein_id gnl|my_center|LOCUS_32530 4607 4927 gene locus_tag LOCUS_32540 4607 4927 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171641.1 protein_id gnl|my_center|LOCUS_32540 4964 5560 gene locus_tag LOCUS_32550 4964 5560 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087779.1 protein_id gnl|my_center|LOCUS_32550 5642 5719 gene locus_tag LOCUS_t00500 5642 5719 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6050 5814 gene locus_tag LOCUS_32560 6050 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 6410 6676 gene locus_tag LOCUS_32570 6410 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 >Feature sequence69 2060 396 gene locus_tag LOCUS_32580 2060 396 CDS product bifunctional protein tyrosine phosphatase family protein/NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 protein_id gnl|my_center|LOCUS_32580 2990 2103 gene locus_tag LOCUS_32590 2990 2103 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_32590 3404 4039 gene locus_tag LOCUS_32600 3404 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 4036 4440 gene locus_tag LOCUS_32610 4036 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 5076 4555 gene locus_tag LOCUS_32620 5076 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 6460 5060 gene locus_tag LOCUS_32630 6460 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence70 940 659 gene locus_tag LOCUS_32640 940 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 1293 1601 gene locus_tag LOCUS_32650 1293 1601 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810529.1 protein_id gnl|my_center|LOCUS_32650 1681 1845 gene locus_tag LOCUS_32660 1681 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 2257 2484 gene locus_tag LOCUS_32670 2257 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 3180 4505 gene locus_tag LOCUS_32680 3180 4505 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625669.1 protein_id gnl|my_center|LOCUS_32680 5038 5331 gene locus_tag LOCUS_32690 5038 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 >Feature sequence71 2788 428 gene locus_tag LOCUS_32700 2788 428 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531532.1 protein_id gnl|my_center|LOCUS_32700 3106 3429 gene locus_tag LOCUS_32710 3106 3429 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088803.1 protein_id gnl|my_center|LOCUS_32710 3784 3497 gene locus_tag LOCUS_32720 3784 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 4183 3836 gene locus_tag LOCUS_32730 4183 3836 CDS product head-tail adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975487.1 protein_id gnl|my_center|LOCUS_32730 4219 4470 gene locus_tag LOCUS_32740 4219 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 4538 4966 gene locus_tag LOCUS_32750 4538 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 6011 4944 gene locus_tag LOCUS_32760 6011 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence72 163 414 gene locus_tag LOCUS_32770 163 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548121.1 protein_id gnl|my_center|LOCUS_32770 429 662 gene locus_tag LOCUS_32780 429 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 1101 1265 gene locus_tag LOCUS_32790 1101 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 1494 1667 gene locus_tag LOCUS_32800 1494 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 2625 2437 gene locus_tag LOCUS_32810 2625 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 4343 3282 gene locus_tag LOCUS_32820 gene lpxD 4343 3282 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087620.1 protein_id gnl|my_center|LOCUS_32820 4596 4465 gene locus_tag LOCUS_32830 4596 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 5170 5430 gene locus_tag LOCUS_32840 5170 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083002.1 protein_id gnl|my_center|LOCUS_32840 5499 5720 gene locus_tag LOCUS_32850 5499 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence73 264 509 gene locus_tag LOCUS_32860 264 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 726 469 gene locus_tag LOCUS_32870 726 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 1042 734 gene locus_tag LOCUS_32880 1042 734 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188824681.1 protein_id gnl|my_center|LOCUS_32880 1333 1055 gene locus_tag LOCUS_32890 1333 1055 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626377.1 protein_id gnl|my_center|LOCUS_32890 1497 2273 gene locus_tag LOCUS_32900 1497 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 2273 2695 gene locus_tag LOCUS_32910 2273 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 2692 2988 gene locus_tag LOCUS_32920 2692 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 2989 3219 gene locus_tag LOCUS_32930 2989 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 3204 3383 gene locus_tag LOCUS_32940 3204 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 3855 3511 gene locus_tag LOCUS_32950 3855 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 4187 3885 gene locus_tag LOCUS_32960 4187 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 4465 4190 gene locus_tag LOCUS_32970 4465 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 4958 4668 gene locus_tag LOCUS_32980 4958 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 5176 4955 gene locus_tag LOCUS_32990 5176 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 >Feature sequence74 644 853 gene locus_tag LOCUS_33000 644 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 2527 1127 gene locus_tag LOCUS_33010 2527 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528200.1 protein_id gnl|my_center|LOCUS_33010 3351 5138 gene locus_tag LOCUS_33020 3351 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 >Feature sequence75 25 879 gene locus_tag LOCUS_33030 gene coxB 25 879 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083989.1 protein_id gnl|my_center|LOCUS_33030 1107 2612 gene locus_tag LOCUS_33040 gene ctaD 1107 2612 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083990.1 protein_id gnl|my_center|LOCUS_33040 2619 3611 gene locus_tag LOCUS_33050 2619 3611 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083991.1 protein_id gnl|my_center|LOCUS_33050 3627 3797 gene locus_tag LOCUS_33060 3627 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083992.1 protein_id gnl|my_center|LOCUS_33060 3804 4454 gene locus_tag LOCUS_33070 3804 4454 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083993.1 protein_id gnl|my_center|LOCUS_33070 4551 5405 gene locus_tag LOCUS_33080 4551 5405 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence76 218 1690 gene locus_tag LOCUS_33090 218 1690 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107137.1 protein_id gnl|my_center|LOCUS_33090 1735 2073 gene locus_tag LOCUS_33100 1735 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 2084 2776 gene locus_tag LOCUS_33110 2084 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 2790 4361 gene locus_tag LOCUS_33120 2790 4361 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_33120 5332 4688 gene locus_tag LOCUS_33130 5332 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 >Feature sequence77 282 121 gene locus_tag LOCUS_33140 282 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 798 556 gene locus_tag LOCUS_33150 798 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 1253 900 gene locus_tag LOCUS_33160 1253 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 1415 1771 gene locus_tag LOCUS_33170 1415 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 2022 2273 gene locus_tag LOCUS_33180 2022 2273 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626379.1 protein_id gnl|my_center|LOCUS_33180 2273 3580 gene locus_tag LOCUS_33190 2273 3580 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390196.1 protein_id gnl|my_center|LOCUS_33190 >Feature sequence78 744 535 gene locus_tag LOCUS_33200 744 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33200 1050 1271 gene locus_tag LOCUS_33210 1050 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 1380 2729 gene locus_tag LOCUS_33220 1380 2729 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963983.1 protein_id gnl|my_center|LOCUS_33220 2761 5001 gene locus_tag LOCUS_33230 2761 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 >Feature sequence79 3529 566 gene locus_tag LOCUS_33240 3529 566 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_33240 4728 3526 gene locus_tag LOCUS_33250 4728 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 >Feature sequence80 50 442 gene locus_tag LOCUS_33260 50 442 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083995.1 protein_id gnl|my_center|LOCUS_33260 439 1197 gene locus_tag LOCUS_33270 439 1197 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965289.1 protein_id gnl|my_center|LOCUS_33270 1824 1516 gene locus_tag LOCUS_33280 gene cyoD 1824 1516 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409003.1 protein_id gnl|my_center|LOCUS_33280 2499 1882 gene locus_tag LOCUS_33290 2499 1882 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704586.1 protein_id gnl|my_center|LOCUS_33290 4469 2496 gene locus_tag LOCUS_33300 gene cyoB 4469 2496 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163523.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence81 134 334 gene locus_tag LOCUS_33310 134 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 1829 1470 gene locus_tag LOCUS_33320 1829 1470 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085389.1 protein_id gnl|my_center|LOCUS_33320 2155 2436 gene locus_tag LOCUS_33330 2155 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 3366 2644 gene locus_tag LOCUS_33340 3366 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 4234 4461 gene locus_tag LOCUS_33350 4234 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 >Feature sequence82 198 959 gene locus_tag LOCUS_33360 198 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 1328 1537 gene locus_tag LOCUS_33370 1328 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 2748 2951 gene locus_tag LOCUS_33380 2748 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 4259 4104 gene locus_tag LOCUS_33390 4259 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 >Feature sequence83 421 242 gene locus_tag LOCUS_33400 421 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 769 1086 gene locus_tag LOCUS_33410 769 1086 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088371.1 protein_id gnl|my_center|LOCUS_33410 1222 2862 gene locus_tag LOCUS_33420 gene groL 1222 2862 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089717.1 protein_id gnl|my_center|LOCUS_33420 3122 3625 gene locus_tag LOCUS_33430 3122 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33430 >Feature sequence84 1638 283 gene locus_tag LOCUS_33440 1638 283 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_33440 1726 2304 gene locus_tag LOCUS_33450 1726 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 2606 2938 gene locus_tag LOCUS_33460 2606 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 3311 3027 gene locus_tag LOCUS_33470 3311 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 3556 3311 gene locus_tag LOCUS_33480 3556 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 4068 3553 gene locus_tag LOCUS_33490 4068 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 >Feature sequence85 1241 1316 gene locus_tag LOCUS_t00510 1241 1316 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence86 137 598 gene locus_tag LOCUS_33500 137 598 CDS product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090747.1 protein_id gnl|my_center|LOCUS_33500 607 861 gene locus_tag LOCUS_33510 607 861 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090746.1 protein_id gnl|my_center|LOCUS_33510 2167 1301 gene locus_tag LOCUS_33520 2167 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 2439 2164 gene locus_tag LOCUS_33530 2439 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 2610 3533 gene locus_tag LOCUS_33540 2610 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 >Feature sequence87 521 682 gene locus_tag LOCUS_33550 521 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 867 995 gene locus_tag LOCUS_33560 867 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 1232 1717 gene locus_tag LOCUS_33570 1232 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965970.1 protein_id gnl|my_center|LOCUS_33570 1710 2963 gene locus_tag LOCUS_33580 1710 2963 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086267.1 protein_id gnl|my_center|LOCUS_33580 >Feature sequence88 166 1305 gene locus_tag LOCUS_33590 166 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence89 1650 583 gene locus_tag LOCUS_33600 1650 583 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080867124.1 protein_id gnl|my_center|LOCUS_33600 2935 1898 gene locus_tag LOCUS_33610 2935 1898 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223455.1 protein_id gnl|my_center|LOCUS_33610 >Feature sequence90 >Feature sequence91 498 277 gene locus_tag LOCUS_33620 498 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 828 544 gene locus_tag LOCUS_33630 828 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083002.1 protein_id gnl|my_center|LOCUS_33630 709 927 gene locus_tag LOCUS_33640 709 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 1765 2016 gene locus_tag LOCUS_33650 1765 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence92 1162 221 gene locus_tag LOCUS_33660 1162 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 2226 1246 gene locus_tag LOCUS_33670 2226 1246 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918510.1 protein_id gnl|my_center|LOCUS_33670 2609 2223 gene locus_tag LOCUS_33680 2609 2223 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640021.1 protein_id gnl|my_center|LOCUS_33680 >Feature sequence93 714 902 gene locus_tag LOCUS_33690 714 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 1633 1442 gene locus_tag LOCUS_33700 1633 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 1686 2015 gene locus_tag LOCUS_33710 1686 2015 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_33710 2012 2917 gene locus_tag LOCUS_33720 2012 2917 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349104.1 protein_id gnl|my_center|LOCUS_33720 >Feature sequence94 132 494 gene locus_tag LOCUS_33730 132 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 487 927 gene locus_tag LOCUS_33740 487 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 941 1132 gene locus_tag LOCUS_33750 941 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 1129 1362 gene locus_tag LOCUS_33760 1129 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 1938 2111 gene locus_tag LOCUS_33770 1938 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 2351 2154 gene locus_tag LOCUS_33780 2351 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 >Feature sequence95 331 1359 gene locus_tag LOCUS_33790 331 1359 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939034.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence96 294 692 gene locus_tag LOCUS_33800 294 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 871 2061 gene locus_tag LOCUS_33810 871 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 2159 2308 gene locus_tag LOCUS_33820 2159 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33820 >Feature sequence97 553 1935 gene locus_tag LOCUS_33830 553 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230934.1 protein_id gnl|my_center|LOCUS_33830 >Feature sequence98 193 1146 gene locus_tag LOCUS_33840 193 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840