>Feature sequence1 785 429 gene locus_tag LOCUS_00010 785 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 940 785 gene locus_tag LOCUS_00020 940 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1860 937 gene locus_tag LOCUS_00030 1860 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2113 1883 gene locus_tag LOCUS_00040 2113 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2355 2113 gene locus_tag LOCUS_00050 2355 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 2616 3092 gene locus_tag LOCUS_00060 2616 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 3234 3100 gene locus_tag LOCUS_00070 3234 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 3385 3768 gene locus_tag LOCUS_00080 3385 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 4357 4656 gene locus_tag LOCUS_00090 4357 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 4653 5669 gene locus_tag LOCUS_00100 4653 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 6582 6094 gene locus_tag LOCUS_00110 6582 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 6967 7482 gene locus_tag LOCUS_00120 6967 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 7560 7703 gene locus_tag LOCUS_00130 7560 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 7693 8106 gene locus_tag LOCUS_00140 7693 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 8221 8994 gene locus_tag LOCUS_00150 gene yfaU 8221 8994 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992954.1 protein_id gnl|my_center|LOCUS_00150 9393 9052 gene locus_tag LOCUS_00160 9393 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 9641 9462 gene locus_tag LOCUS_00170 9641 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 9766 10002 gene locus_tag LOCUS_00180 9766 10002 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_00180 10016 11902 gene locus_tag LOCUS_00190 10016 11902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 11964 12155 gene locus_tag LOCUS_00200 11964 12155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 12499 13638 gene locus_tag LOCUS_00210 12499 13638 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072763.1 protein_id gnl|my_center|LOCUS_00210 13635 16007 gene locus_tag LOCUS_00220 13635 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 17070 16060 gene locus_tag LOCUS_00230 17070 16060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 17199 17918 gene locus_tag LOCUS_00240 17199 17918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 18000 18188 gene locus_tag LOCUS_00250 18000 18188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 18941 18225 gene locus_tag LOCUS_00260 18941 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 19551 18976 gene locus_tag LOCUS_00270 19551 18976 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966864.1 protein_id gnl|my_center|LOCUS_00270 20959 19751 gene locus_tag LOCUS_00280 20959 19751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 21100 22227 gene locus_tag LOCUS_00290 21100 22227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 22220 23185 gene locus_tag LOCUS_00300 22220 23185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 24249 23431 gene locus_tag LOCUS_00310 24249 23431 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_00310 25174 24242 gene locus_tag LOCUS_00320 25174 24242 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_00320 26246 25203 gene locus_tag LOCUS_00330 26246 25203 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_00330 28353 26836 gene locus_tag LOCUS_00340 28353 26836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 30433 28490 gene locus_tag LOCUS_00350 gene metG 30433 28490 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_00350 32269 30452 gene locus_tag LOCUS_00360 32269 30452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 33552 32266 gene locus_tag LOCUS_00370 gene hemW 33552 32266 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_00370 35534 33618 gene locus_tag LOCUS_00380 gene htpG 35534 33618 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_00380 35738 36547 gene locus_tag LOCUS_00390 35738 36547 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_00390 37725 36892 gene locus_tag LOCUS_00400 37725 36892 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338572.1 protein_id gnl|my_center|LOCUS_00400 37875 39431 gene locus_tag LOCUS_00410 37875 39431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 39463 39984 gene locus_tag LOCUS_00420 39463 39984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 40028 40540 gene locus_tag LOCUS_00430 40028 40540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 40635 40946 gene locus_tag LOCUS_00440 40635 40946 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837349.1 protein_id gnl|my_center|LOCUS_00440 41590 41216 gene locus_tag LOCUS_00450 gene rplL 41590 41216 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_00450 42175 41630 gene locus_tag LOCUS_00460 gene rplJ 42175 41630 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_00460 43201 42545 gene locus_tag LOCUS_00470 43201 42545 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356716.1 protein_id gnl|my_center|LOCUS_00470 43984 43208 gene locus_tag LOCUS_00480 gene murI 43984 43208 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475984.1 protein_id gnl|my_center|LOCUS_00480 44267 44022 gene locus_tag LOCUS_00490 44267 44022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 46227 44317 gene locus_tag LOCUS_00500 46227 44317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 46839 46399 gene locus_tag LOCUS_00510 46839 46399 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707865.1 protein_id gnl|my_center|LOCUS_00510 47420 46836 gene locus_tag LOCUS_00520 47420 46836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 48304 47417 gene locus_tag LOCUS_00530 48304 47417 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814617.1 protein_id gnl|my_center|LOCUS_00530 48813 48292 gene locus_tag LOCUS_00540 48813 48292 CDS product RNase III inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645538.1 protein_id gnl|my_center|LOCUS_00540 51194 48810 gene locus_tag LOCUS_00550 51194 48810 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_00550 51947 51234 gene locus_tag LOCUS_00560 51947 51234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 53082 51985 gene locus_tag LOCUS_00570 53082 51985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 53889 53119 gene locus_tag LOCUS_00580 gene truA 53889 53119 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_00580 54689 53886 gene locus_tag LOCUS_00590 54689 53886 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_00590 55549 54683 gene locus_tag LOCUS_00600 55549 54683 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_00600 56423 55587 gene locus_tag LOCUS_00610 56423 55587 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_00610 57299 56439 gene locus_tag LOCUS_00620 57299 56439 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_00620 57569 58009 gene locus_tag LOCUS_00630 57569 58009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 58485 58090 gene locus_tag LOCUS_00640 58485 58090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 58819 58505 gene locus_tag LOCUS_00650 58819 58505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 60660 59086 gene locus_tag LOCUS_00660 60660 59086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 60816 61508 gene locus_tag LOCUS_00670 gene yycF 60816 61508 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_00670 61512 62984 gene locus_tag LOCUS_00680 61512 62984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 62981 63448 gene locus_tag LOCUS_00690 62981 63448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 63482 64555 gene locus_tag LOCUS_00700 63482 64555 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 protein_id gnl|my_center|LOCUS_00700 64637 65200 gene locus_tag LOCUS_00710 gene efp 64637 65200 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_00710 66765 65545 gene locus_tag LOCUS_00720 66765 65545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_00720 67065 66940 gene locus_tag LOCUS_00730 67065 66940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 67355 68296 gene locus_tag LOCUS_00740 67355 68296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 68466 70547 gene locus_tag LOCUS_00750 68466 70547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 71181 70606 gene locus_tag LOCUS_00760 71181 70606 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_00760 72690 71338 gene locus_tag LOCUS_00770 72690 71338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 73235 73624 gene locus_tag LOCUS_00780 73235 73624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 73621 73857 gene locus_tag LOCUS_00790 73621 73857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 73854 74063 gene locus_tag LOCUS_00800 73854 74063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 74076 75473 gene locus_tag LOCUS_00810 74076 75473 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_00810 75575 77365 gene locus_tag LOCUS_00820 75575 77365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 77387 77917 gene locus_tag LOCUS_00830 77387 77917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 77914 78312 gene locus_tag LOCUS_00840 77914 78312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 78315 79529 gene locus_tag LOCUS_00850 78315 79529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 79595 79873 gene locus_tag LOCUS_00860 79595 79873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 79876 80559 gene locus_tag LOCUS_00870 79876 80559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 80561 82546 gene locus_tag LOCUS_00880 80561 82546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 82632 83324 gene locus_tag LOCUS_00890 82632 83324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 83325 83795 gene locus_tag LOCUS_00900 83325 83795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 83792 84004 gene locus_tag LOCUS_00910 83792 84004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 84016 85317 gene locus_tag LOCUS_00920 84016 85317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 85332 86225 gene locus_tag LOCUS_00930 85332 86225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 89694 86368 gene locus_tag LOCUS_00940 89694 86368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 89954 92488 gene locus_tag LOCUS_00950 89954 92488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 93110 93232 gene locus_tag LOCUS_00960 93110 93232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 94653 93727 gene locus_tag LOCUS_00970 94653 93727 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081620.1 protein_id gnl|my_center|LOCUS_00970 95218 94721 gene locus_tag LOCUS_00980 95218 94721 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021451.1 protein_id gnl|my_center|LOCUS_00980 95516 95238 gene locus_tag LOCUS_00990 95516 95238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 95875 96033 gene locus_tag LOCUS_01000 95875 96033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 96269 95976 gene locus_tag LOCUS_01010 96269 95976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 97486 96614 gene locus_tag LOCUS_01020 gene rsmA 97486 96614 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294004.1 protein_id gnl|my_center|LOCUS_01020 98783 97497 gene locus_tag LOCUS_01030 98783 97497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 99273 98788 gene locus_tag LOCUS_01040 gene rimM 99273 98788 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640383.1 protein_id gnl|my_center|LOCUS_01040 99573 99343 gene locus_tag LOCUS_01050 99573 99343 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_01050 99831 99589 gene locus_tag LOCUS_01060 gene rpsP 99831 99589 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392482.1 protein_id gnl|my_center|LOCUS_01060 101279 99894 gene locus_tag LOCUS_01070 gene ffh 101279 99894 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_01070 101635 101285 gene locus_tag LOCUS_01080 101635 101285 CDS product YlxM family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392480.1 protein_id gnl|my_center|LOCUS_01080 101794 108924 gene locus_tag LOCUS_01090 101794 108924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 108987 110276 gene locus_tag LOCUS_01100 108987 110276 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772433.1 protein_id gnl|my_center|LOCUS_01100 110266 111555 gene locus_tag LOCUS_01110 110266 111555 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411976.1 protein_id gnl|my_center|LOCUS_01110 111545 112402 gene locus_tag LOCUS_01120 gene lgt 111545 112402 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 protein_id gnl|my_center|LOCUS_01120 112441 112917 gene locus_tag LOCUS_01130 112441 112917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 114846 113038 gene locus_tag LOCUS_01140 114846 113038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 115721 114858 gene locus_tag LOCUS_01150 115721 114858 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776998.1 protein_id gnl|my_center|LOCUS_01150 116009 115800 gene locus_tag LOCUS_01160 116009 115800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 116096 116171 gene locus_tag LOCUS_t00010 116096 116171 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 116193 116277 gene locus_tag LOCUS_t00020 116193 116277 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 116723 116556 gene locus_tag LOCUS_01170 116723 116556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 117056 118405 gene locus_tag LOCUS_01180 gene gdhA 117056 118405 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815054.1 protein_id gnl|my_center|LOCUS_01180 120081 118753 gene locus_tag LOCUS_01190 120081 118753 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458888.1 protein_id gnl|my_center|LOCUS_01190 120775 120074 gene locus_tag LOCUS_01200 120775 120074 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815058.1 protein_id gnl|my_center|LOCUS_01200 122602 120923 gene locus_tag LOCUS_01210 122602 120923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 125508 122743 gene locus_tag LOCUS_01220 125508 122743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 127372 125801 gene locus_tag LOCUS_01230 127372 125801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 128922 127546 gene locus_tag LOCUS_01240 gene argH 128922 127546 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_01240 130285 129065 gene locus_tag LOCUS_01250 130285 129065 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_01250 132247 130505 gene locus_tag LOCUS_01260 132247 130505 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_01260 132407 133042 gene locus_tag LOCUS_01270 132407 133042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 133046 133882 gene locus_tag LOCUS_01280 133046 133882 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259122.1 protein_id gnl|my_center|LOCUS_01280 133972 136419 gene locus_tag LOCUS_01290 133972 136419 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476221.1 protein_id gnl|my_center|LOCUS_01290 136433 137104 gene locus_tag LOCUS_01300 136433 137104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 138433 137543 gene locus_tag LOCUS_01310 138433 137543 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_01310 139227 138601 gene locus_tag LOCUS_01320 139227 138601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 139448 142141 gene locus_tag LOCUS_01330 139448 142141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 143283 142498 gene locus_tag LOCUS_01340 gene spo0A 143283 142498 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_01340 146245 143714 gene locus_tag LOCUS_01350 146245 143714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 146634 146281 gene locus_tag LOCUS_01360 146634 146281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 147948 146935 gene locus_tag LOCUS_01370 147948 146935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 148111 149391 gene locus_tag LOCUS_01380 148111 149391 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948973.1 protein_id gnl|my_center|LOCUS_01380 149536 150060 gene locus_tag LOCUS_01390 149536 150060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 151730 150033 gene locus_tag LOCUS_01400 151730 150033 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_01400 153617 151734 gene locus_tag LOCUS_01410 gene nuoF 153617 151734 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_01410 154096 153617 gene locus_tag LOCUS_01420 gene nuoE 154096 153617 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_01420 154525 155523 gene locus_tag LOCUS_01430 154525 155523 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_01430 155520 156266 gene locus_tag LOCUS_01440 155520 156266 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_01440 156263 156859 gene locus_tag LOCUS_01450 156263 156859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810701.1 protein_id gnl|my_center|LOCUS_01450 158755 156995 gene locus_tag LOCUS_01460 gene tndX 158755 156995 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_01460 159168 158752 gene locus_tag LOCUS_01470 159168 158752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 159423 159238 gene locus_tag LOCUS_01480 159423 159238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 160068 159829 gene locus_tag LOCUS_01490 160068 159829 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009009556.1 protein_id gnl|my_center|LOCUS_01490 160487 160065 gene locus_tag LOCUS_01500 160487 160065 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804885.1 protein_id gnl|my_center|LOCUS_01500 160398 160775 gene locus_tag LOCUS_01510 160398 160775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 160897 161490 gene locus_tag LOCUS_01520 160897 161490 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_01520 161487 162332 gene locus_tag LOCUS_01530 161487 162332 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287519.1 protein_id gnl|my_center|LOCUS_01530 162351 162743 gene locus_tag LOCUS_01540 162351 162743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 162895 164742 gene locus_tag LOCUS_01550 162895 164742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 165017 164799 gene locus_tag LOCUS_01560 165017 164799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 165970 165020 gene locus_tag LOCUS_01570 165970 165020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 166711 165974 gene locus_tag LOCUS_01580 166711 165974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01580 167782 166757 gene locus_tag LOCUS_01590 167782 166757 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_01590 168018 167803 gene locus_tag LOCUS_01600 168018 167803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 168826 168269 gene locus_tag LOCUS_01610 168826 168269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 171020 168975 gene locus_tag LOCUS_01620 171020 168975 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_01620 172134 171124 gene locus_tag LOCUS_01630 172134 171124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 173689 172409 gene locus_tag LOCUS_01640 173689 172409 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_01640 175017 173686 gene locus_tag LOCUS_01650 175017 173686 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_01650 178631 175113 gene locus_tag LOCUS_01660 178631 175113 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_01660 179543 178644 gene locus_tag LOCUS_01670 gene whiA 179543 178644 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_01670 180419 179556 gene locus_tag LOCUS_01680 gene rapZ 180419 179556 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_01680 181341 180424 gene locus_tag LOCUS_01690 gene murB 181341 180424 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_01690 180671 180748 gene locus_tag LOCUS_t00030 180671 180748 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 182307 181363 gene locus_tag LOCUS_01700 gene hprK 182307 181363 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_01700 182568 182756 gene locus_tag LOCUS_01710 gene rpmB 182568 182756 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_01710 184468 183077 gene locus_tag LOCUS_01720 184468 183077 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_01720 184594 184670 gene locus_tag LOCUS_t00040 184594 184670 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 185904 184909 gene locus_tag LOCUS_01730 185904 184909 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437556.1 protein_id gnl|my_center|LOCUS_01730 186712 185918 gene locus_tag LOCUS_01740 186712 185918 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391606.1 protein_id gnl|my_center|LOCUS_01740 188149 186716 gene locus_tag LOCUS_01750 188149 186716 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903800.1 protein_id gnl|my_center|LOCUS_01750 188584 188171 gene locus_tag LOCUS_01760 188584 188171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 191749 188711 gene locus_tag LOCUS_01770 191749 188711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 192680 192279 gene locus_tag LOCUS_01780 192680 192279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 192855 193781 gene locus_tag LOCUS_01790 192855 193781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 193898 194254 gene locus_tag LOCUS_01800 193898 194254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 194467 194333 gene locus_tag LOCUS_01810 194467 194333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 194550 194867 gene locus_tag LOCUS_01820 194550 194867 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_01820 194893 197415 gene locus_tag LOCUS_01830 194893 197415 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_01830 197748 199067 gene locus_tag LOCUS_01840 197748 199067 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_01840 199098 200255 gene locus_tag LOCUS_01850 199098 200255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 200269 201105 gene locus_tag LOCUS_01860 200269 201105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 202837 201491 gene locus_tag LOCUS_01870 202837 201491 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_01870 203440 202949 gene locus_tag LOCUS_01880 203440 202949 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 protein_id gnl|my_center|LOCUS_01880 204108 203443 gene locus_tag LOCUS_01890 204108 203443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 205001 204240 gene locus_tag LOCUS_01900 205001 204240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 205841 205026 gene locus_tag LOCUS_01910 205841 205026 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358274.1 protein_id gnl|my_center|LOCUS_01910 206660 206235 gene locus_tag LOCUS_01920 206660 206235 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_01920 206884 207096 gene locus_tag LOCUS_01930 206884 207096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 207110 207334 gene locus_tag LOCUS_01940 207110 207334 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_01940 207411 209894 gene locus_tag LOCUS_01950 207411 209894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 209934 210113 gene locus_tag LOCUS_01960 209934 210113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 210307 211188 gene locus_tag LOCUS_01970 210307 211188 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967658.1 protein_id gnl|my_center|LOCUS_01970 212649 211255 gene locus_tag LOCUS_01980 212649 211255 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_01980 214229 212877 gene locus_tag LOCUS_01990 214229 212877 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957028.1 protein_id gnl|my_center|LOCUS_01990 215581 214787 gene locus_tag LOCUS_02000 215581 214787 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_02000 216146 215670 gene locus_tag LOCUS_02010 216146 215670 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258478.1 protein_id gnl|my_center|LOCUS_02010 216293 217195 gene locus_tag LOCUS_02020 216293 217195 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 protein_id gnl|my_center|LOCUS_02020 217676 217263 gene locus_tag LOCUS_02030 217676 217263 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_02030 218486 217941 gene locus_tag LOCUS_02040 218486 217941 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223119.1 protein_id gnl|my_center|LOCUS_02040 218774 218553 gene locus_tag LOCUS_02050 218774 218553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 218989 220524 gene locus_tag LOCUS_02060 218989 220524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 222570 220960 gene locus_tag LOCUS_02070 222570 220960 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_02070 222870 222682 gene locus_tag LOCUS_02080 222870 222682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 223721 222867 gene locus_tag LOCUS_02090 223721 222867 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099498.1 protein_id gnl|my_center|LOCUS_02090 224467 223718 gene locus_tag LOCUS_02100 224467 223718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 226477 224855 gene locus_tag LOCUS_02110 226477 224855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 226847 226449 gene locus_tag LOCUS_02120 226847 226449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 227675 227472 gene locus_tag LOCUS_02130 227675 227472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 228111 227665 gene locus_tag LOCUS_02140 228111 227665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 229083 228316 gene locus_tag LOCUS_02150 229083 228316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 230918 229134 gene locus_tag LOCUS_02160 gene tet(M) 230918 229134 CDS product tetracycline resistance ribosomal protection protein Tet(M) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371500.1 protein_id gnl|my_center|LOCUS_02160 231959 231438 gene locus_tag LOCUS_02170 231959 231438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 232252 232485 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gatgcaagccgcacaggctacgctgaggcaaag 233292 232606 gene locus_tag LOCUS_02180 gene rplA 233292 232606 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_02180 233791 233366 gene locus_tag LOCUS_02190 gene rplK 233791 233366 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_02190 234343 233819 gene locus_tag LOCUS_02200 gene nusG 234343 233819 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_02200 234611 234345 gene locus_tag LOCUS_02210 234611 234345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 234801 234637 gene locus_tag LOCUS_02220 gene rpmG 234801 234637 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_02220 236771 235032 gene locus_tag LOCUS_02230 236771 235032 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_02230 238351 237320 gene locus_tag LOCUS_02240 238351 237320 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_02240 239652 238348 gene locus_tag LOCUS_02250 239652 238348 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_02250 241196 239649 gene locus_tag LOCUS_02260 241196 239649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_02260 242742 241597 gene locus_tag LOCUS_02270 242742 241597 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_02270 243648 242923 gene locus_tag LOCUS_02280 gene deoD 243648 242923 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_02280 243800 244414 gene locus_tag LOCUS_02290 gene udk 243800 244414 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575382.1 protein_id gnl|my_center|LOCUS_02290 244415 245005 gene locus_tag LOCUS_02300 244415 245005 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880948.1 protein_id gnl|my_center|LOCUS_02300 245002 245424 gene locus_tag LOCUS_02310 245002 245424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 246190 245489 gene locus_tag LOCUS_02320 246190 245489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 246430 246191 gene locus_tag LOCUS_02330 246430 246191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 247529 246792 gene locus_tag LOCUS_02340 gene erm(B) 247529 246792 CDS product 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321849.1 protein_id gnl|my_center|LOCUS_02340 249764 248145 gene locus_tag LOCUS_02350 249764 248145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 252590 249996 gene locus_tag LOCUS_02360 gene clpB 252590 249996 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_02360 253292 252651 gene locus_tag LOCUS_02370 253292 252651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 254753 253452 gene locus_tag LOCUS_02380 254753 253452 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205413.1 protein_id gnl|my_center|LOCUS_02380 255267 255355 gene locus_tag LOCUS_t00050 255267 255355 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 256723 255485 gene locus_tag LOCUS_02390 256723 255485 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_02390 257062 256832 gene locus_tag LOCUS_02400 257062 256832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 257280 257053 gene locus_tag LOCUS_02410 257280 257053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 257831 257346 gene locus_tag LOCUS_02420 257831 257346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 258618 258376 gene locus_tag LOCUS_02430 258618 258376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 258832 258620 gene locus_tag LOCUS_02440 258832 258620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 259043 258846 gene locus_tag LOCUS_02450 259043 258846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 259692 259078 gene locus_tag LOCUS_02460 gene lexA 259692 259078 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986377.1 protein_id gnl|my_center|LOCUS_02460 260912 259932 gene locus_tag LOCUS_02470 260912 259932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 261488 260973 gene locus_tag LOCUS_02480 261488 260973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 263356 261611 gene locus_tag LOCUS_02490 263356 261611 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 protein_id gnl|my_center|LOCUS_02490 266704 263363 gene locus_tag LOCUS_02500 gene drmA 266704 263363 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 protein_id gnl|my_center|LOCUS_02500 269335 266717 gene locus_tag LOCUS_02510 269335 266717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 270614 269313 gene locus_tag LOCUS_02520 270614 269313 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876134.1 protein_id gnl|my_center|LOCUS_02520 273577 270641 gene locus_tag LOCUS_02530 273577 270641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 275682 273580 gene locus_tag LOCUS_02540 275682 273580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 275938 275732 gene locus_tag LOCUS_02550 275938 275732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 278013 276202 gene locus_tag LOCUS_02560 278013 276202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 278828 278043 gene locus_tag LOCUS_02570 278828 278043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 281201 278862 gene locus_tag LOCUS_02580 281201 278862 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861114.1 protein_id gnl|my_center|LOCUS_02580 281559 281194 gene locus_tag LOCUS_02590 281559 281194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 283038 281743 gene locus_tag LOCUS_02600 283038 281743 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068364.1 protein_id gnl|my_center|LOCUS_02600 283975 283139 gene locus_tag LOCUS_02610 283975 283139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 284382 284032 gene locus_tag LOCUS_02620 284382 284032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 286195 284369 gene locus_tag LOCUS_02630 286195 284369 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_02630 286373 286182 gene locus_tag LOCUS_02640 286373 286182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 287288 286389 gene locus_tag LOCUS_02650 287288 286389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 288073 287291 gene locus_tag LOCUS_02660 288073 287291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 289397 288012 gene locus_tag LOCUS_02670 289397 288012 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_02670 289702 289433 gene locus_tag LOCUS_02680 289702 289433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 290168 289863 gene locus_tag LOCUS_02690 290168 289863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 290531 290253 gene locus_tag LOCUS_02700 290531 290253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 291451 290528 gene locus_tag LOCUS_02710 291451 290528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 292187 291465 gene locus_tag LOCUS_02720 292187 291465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 293128 292184 gene locus_tag LOCUS_02730 293128 292184 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368706.1 protein_id gnl|my_center|LOCUS_02730 293473 293135 gene locus_tag LOCUS_02740 293473 293135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 294807 293584 gene locus_tag LOCUS_02750 294807 293584 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_02750 295172 295011 gene locus_tag LOCUS_02760 295172 295011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 295916 295314 gene locus_tag LOCUS_02770 295916 295314 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723214.1 protein_id gnl|my_center|LOCUS_02770 297322 296024 gene locus_tag LOCUS_02780 297322 296024 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_02780 298558 297650 gene locus_tag LOCUS_02790 298558 297650 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_02790 299235 298546 gene locus_tag LOCUS_02800 299235 298546 CDS product radical SAM mobile pair protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679436.1 protein_id gnl|my_center|LOCUS_02800 299669 299232 gene locus_tag LOCUS_02810 299669 299232 CDS product radical SAM mobile pair system MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679434.1 protein_id gnl|my_center|LOCUS_02810 300001 301194 gene locus_tag LOCUS_02820 300001 301194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 307860 301405 gene locus_tag LOCUS_02830 307860 301405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 308132 307788 gene locus_tag LOCUS_02840 308132 307788 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_02840 309310 308981 gene locus_tag LOCUS_02850 309310 308981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 310219 309320 gene locus_tag LOCUS_02860 310219 309320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 310791 310246 gene locus_tag LOCUS_02870 310791 310246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323448.1 protein_id gnl|my_center|LOCUS_02870 311726 310788 gene locus_tag LOCUS_02880 311726 310788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 312343 311723 gene locus_tag LOCUS_02890 312343 311723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 316697 312477 gene locus_tag LOCUS_02900 316697 312477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 317436 316777 gene locus_tag LOCUS_02910 317436 316777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 318573 317620 gene locus_tag LOCUS_02920 318573 317620 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_02920 319351 318527 gene locus_tag LOCUS_02930 319351 318527 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_02930 320495 320082 gene locus_tag LOCUS_02940 320495 320082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 321080 321168 gene locus_tag LOCUS_t00060 321080 321168 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 322453 321260 gene locus_tag LOCUS_02950 322453 321260 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_02950 322795 322565 gene locus_tag LOCUS_02960 322795 322565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 323102 322764 gene locus_tag LOCUS_02970 323102 322764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 324055 323117 gene locus_tag LOCUS_02980 324055 323117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 325511 324069 gene locus_tag LOCUS_02990 325511 324069 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_02990 325800 325480 gene locus_tag LOCUS_03000 325800 325480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 327070 325943 gene locus_tag LOCUS_03010 327070 325943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 328076 327798 gene locus_tag LOCUS_03020 328076 327798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 328411 328614 gene locus_tag LOCUS_03030 328411 328614 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_03030 328820 329050 gene locus_tag LOCUS_03040 328820 329050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 329037 329456 gene locus_tag LOCUS_03050 329037 329456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 329771 330220 gene locus_tag LOCUS_03060 329771 330220 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861879.1 protein_id gnl|my_center|LOCUS_03060 330213 331574 gene locus_tag LOCUS_03070 330213 331574 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_03070 331720 332091 gene locus_tag LOCUS_03080 331720 332091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 332842 332171 gene locus_tag LOCUS_03090 gene hypB 332842 332171 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_03090 333242 332901 gene locus_tag LOCUS_03100 333242 332901 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359645.1 protein_id gnl|my_center|LOCUS_03100 334558 333245 gene locus_tag LOCUS_03110 334558 333245 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890744.1 protein_id gnl|my_center|LOCUS_03110 336654 334576 gene locus_tag LOCUS_03120 336654 334576 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964362.1 protein_id gnl|my_center|LOCUS_03120 337608 336658 gene locus_tag LOCUS_03130 337608 336658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 337821 338405 gene locus_tag LOCUS_03140 337821 338405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 340450 338510 gene locus_tag LOCUS_03150 340450 338510 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964362.1 protein_id gnl|my_center|LOCUS_03150 341293 340463 gene locus_tag LOCUS_03160 341293 340463 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931125.1 protein_id gnl|my_center|LOCUS_03160 342163 341309 gene locus_tag LOCUS_03170 342163 341309 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_03170 342447 342974 gene locus_tag LOCUS_03180 342447 342974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 344524 343499 gene locus_tag LOCUS_03190 344524 343499 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_03190 345250 344672 gene locus_tag LOCUS_03200 345250 344672 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027096094.1 protein_id gnl|my_center|LOCUS_03200 345960 346346 gene locus_tag LOCUS_03210 345960 346346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 346831 346412 gene locus_tag LOCUS_03220 346831 346412 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_03220 347762 346848 gene locus_tag LOCUS_03230 gene pyrB 347762 346848 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_03230 348414 347764 gene locus_tag LOCUS_03240 gene pyrE 348414 347764 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232105.1 protein_id gnl|my_center|LOCUS_03240 349151 348453 gene locus_tag LOCUS_03250 gene pyrF 349151 348453 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_03250 350061 349144 gene locus_tag LOCUS_03260 350061 349144 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_03260 350783 350043 gene locus_tag LOCUS_03270 350783 350043 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_03270 353969 350787 gene locus_tag LOCUS_03280 gene carB 353969 350787 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232113.1 protein_id gnl|my_center|LOCUS_03280 355265 354036 gene locus_tag LOCUS_03290 gene pyrC 355265 354036 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108367.1 protein_id gnl|my_center|LOCUS_03290 354097 354192 gene locus_tag LOCUS_t00070 354097 354192 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 356589 355477 gene locus_tag LOCUS_03300 356589 355477 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_03300 358517 356586 gene locus_tag LOCUS_03310 358517 356586 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_03310 359163 358510 gene locus_tag LOCUS_03320 359163 358510 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_03320 360553 359177 gene locus_tag LOCUS_03330 360553 359177 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_03330 360719 361165 gene locus_tag LOCUS_03340 360719 361165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 361166 362533 gene locus_tag LOCUS_03350 361166 362533 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_03350 362796 362617 gene locus_tag LOCUS_03360 362796 362617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 363010 364494 gene locus_tag LOCUS_03370 363010 364494 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_03370 364659 365321 gene locus_tag LOCUS_03380 364659 365321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 365352 367892 gene locus_tag LOCUS_03390 365352 367892 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680008.1 protein_id gnl|my_center|LOCUS_03390 367903 368274 gene locus_tag LOCUS_03400 367903 368274 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359645.1 protein_id gnl|my_center|LOCUS_03400 368296 370374 gene locus_tag LOCUS_03410 368296 370374 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_03410 371263 370526 gene locus_tag LOCUS_03420 371263 370526 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 protein_id gnl|my_center|LOCUS_03420 372572 371277 gene locus_tag LOCUS_03430 372572 371277 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902212.1 protein_id gnl|my_center|LOCUS_03430 373051 372569 gene locus_tag LOCUS_03440 373051 372569 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896258.1 protein_id gnl|my_center|LOCUS_03440 374217 373174 gene locus_tag LOCUS_03450 374217 373174 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491570.1 protein_id gnl|my_center|LOCUS_03450 374472 375530 gene locus_tag LOCUS_03460 374472 375530 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_03460 375555 376280 gene locus_tag LOCUS_03470 375555 376280 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895688.1 protein_id gnl|my_center|LOCUS_03470 376297 377001 gene locus_tag LOCUS_03480 376297 377001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 377466 377056 gene locus_tag LOCUS_03490 377466 377056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 377893 377483 gene locus_tag LOCUS_03500 gene ruvX 377893 377483 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221192.1 protein_id gnl|my_center|LOCUS_03500 379160 377874 gene locus_tag LOCUS_03510 379160 377874 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_03510 379302 380240 gene locus_tag LOCUS_03520 379302 380240 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_03520 380320 381759 gene locus_tag LOCUS_03530 380320 381759 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_03530 383531 382296 gene locus_tag LOCUS_03540 383531 382296 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454238.1 protein_id gnl|my_center|LOCUS_03540 384055 384909 gene locus_tag LOCUS_03550 384055 384909 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860969.1 protein_id gnl|my_center|LOCUS_03550 384981 385991 gene locus_tag LOCUS_03560 384981 385991 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684060.1 protein_id gnl|my_center|LOCUS_03560 386061 387011 gene locus_tag LOCUS_03570 386061 387011 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_03570 388467 387160 gene locus_tag LOCUS_03580 388467 387160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 389035 388481 gene locus_tag LOCUS_03590 389035 388481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 391367 389052 gene locus_tag LOCUS_03600 391367 389052 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068724.1 protein_id gnl|my_center|LOCUS_03600 392008 391385 gene locus_tag LOCUS_03610 392008 391385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 392982 392221 gene locus_tag LOCUS_03620 392982 392221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 393706 393056 gene locus_tag LOCUS_03630 393706 393056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 394413 393826 gene locus_tag LOCUS_03640 394413 393826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 394904 396430 gene locus_tag LOCUS_03650 394904 396430 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_03650 396468 396701 gene locus_tag LOCUS_03660 396468 396701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 396701 397885 gene locus_tag LOCUS_03670 396701 397885 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_03670 397882 399486 gene locus_tag LOCUS_03680 397882 399486 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_03680 399590 400699 gene locus_tag LOCUS_03690 399590 400699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 401261 400821 gene locus_tag LOCUS_03700 gene dut 401261 400821 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_03700 401791 401252 gene locus_tag LOCUS_03710 gene nrdG 401791 401252 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_03710 404031 401857 gene locus_tag LOCUS_03720 gene nrdD 404031 401857 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_03720 405286 404267 gene locus_tag LOCUS_03730 gene galE 405286 404267 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_03730 406327 405791 gene locus_tag LOCUS_03740 gene spoVT 406327 405791 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359411.1 protein_id gnl|my_center|LOCUS_03740 407948 406518 gene locus_tag LOCUS_03750 407948 406518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 408146 407952 gene locus_tag LOCUS_03760 408146 407952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 409933 408143 gene locus_tag LOCUS_03770 409933 408143 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102374990.1 protein_id gnl|my_center|LOCUS_03770 410110 410790 gene locus_tag LOCUS_03780 410110 410790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 410774 412018 gene locus_tag LOCUS_03790 410774 412018 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_03790 412015 414786 gene locus_tag LOCUS_03800 412015 414786 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679058.1 protein_id gnl|my_center|LOCUS_03800 415762 415193 gene locus_tag LOCUS_03810 415762 415193 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008946902.1 protein_id gnl|my_center|LOCUS_03810 417178 415889 gene locus_tag LOCUS_03820 417178 415889 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528423.1 protein_id gnl|my_center|LOCUS_03820 418636 417242 gene locus_tag LOCUS_03830 418636 417242 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939914.1 protein_id gnl|my_center|LOCUS_03830 418841 419695 gene locus_tag LOCUS_03840 418841 419695 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114712.1 protein_id gnl|my_center|LOCUS_03840 419772 420533 gene locus_tag LOCUS_03850 419772 420533 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694770.1 protein_id gnl|my_center|LOCUS_03850 420844 420581 gene locus_tag LOCUS_03860 420844 420581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 421246 420962 gene locus_tag LOCUS_03870 421246 420962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 423576 421228 gene locus_tag LOCUS_03880 gene copA 423576 421228 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_03880 424159 423635 gene locus_tag LOCUS_03890 424159 423635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 424747 424346 gene locus_tag LOCUS_03900 424747 424346 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966444.1 protein_id gnl|my_center|LOCUS_03900 425295 424900 gene locus_tag LOCUS_03910 425295 424900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 425491 426210 gene locus_tag LOCUS_03920 425491 426210 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921957.1 protein_id gnl|my_center|LOCUS_03920 426578 426847 gene locus_tag LOCUS_03930 426578 426847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 427230 427532 gene locus_tag LOCUS_03940 427230 427532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 427727 427888 gene locus_tag LOCUS_03950 427727 427888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 428196 429773 gene locus_tag LOCUS_03960 428196 429773 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063660.1 protein_id gnl|my_center|LOCUS_03960 430925 429822 gene locus_tag LOCUS_03970 430925 429822 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_03970 432230 431241 gene locus_tag LOCUS_03980 432230 431241 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254294.1 protein_id gnl|my_center|LOCUS_03980 433482 432256 gene locus_tag LOCUS_03990 433482 432256 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860960.1 protein_id gnl|my_center|LOCUS_03990 434964 433522 gene locus_tag LOCUS_04000 434964 433522 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_04000 435591 435061 gene locus_tag LOCUS_04010 435591 435061 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430880.1 protein_id gnl|my_center|LOCUS_04010 436325 435588 gene locus_tag LOCUS_04020 436325 435588 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454726.1 protein_id gnl|my_center|LOCUS_04020 437378 436326 gene locus_tag LOCUS_04030 gene vorB 437378 436326 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890635.1 protein_id gnl|my_center|LOCUS_04030 437590 437390 gene locus_tag LOCUS_04040 437590 437390 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423406.1 protein_id gnl|my_center|LOCUS_04040 438920 437622 gene locus_tag LOCUS_04050 438920 437622 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434922.1 protein_id gnl|my_center|LOCUS_04050 439304 440044 gene locus_tag LOCUS_04060 439304 440044 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965838.1 protein_id gnl|my_center|LOCUS_04060 440041 441291 gene locus_tag LOCUS_04070 440041 441291 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877563.1 protein_id gnl|my_center|LOCUS_04070 441383 441646 gene locus_tag LOCUS_04080 441383 441646 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_04080 441671 442300 gene locus_tag LOCUS_04090 441671 442300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 442772 442395 gene locus_tag LOCUS_04100 442772 442395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 443556 442855 gene locus_tag LOCUS_04110 443556 442855 CDS product DUF5714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673563.1 protein_id gnl|my_center|LOCUS_04110 444329 443553 gene locus_tag LOCUS_04120 gene truA 444329 443553 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_04120 445153 444410 gene locus_tag LOCUS_04130 445153 444410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 445939 445166 gene locus_tag LOCUS_04140 445939 445166 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_04140 446259 447797 gene locus_tag LOCUS_04150 446259 447797 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_04150 447990 449492 gene locus_tag LOCUS_04160 447990 449492 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_04160 449643 450185 gene locus_tag LOCUS_04170 449643 450185 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 protein_id gnl|my_center|LOCUS_04170 450178 451713 gene locus_tag LOCUS_04180 450178 451713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 452470 451769 gene locus_tag LOCUS_04190 452470 451769 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_04190 453621 452452 gene locus_tag LOCUS_04200 453621 452452 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891676.1 protein_id gnl|my_center|LOCUS_04200 453840 454649 gene locus_tag LOCUS_04210 453840 454649 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_04210 456026 455520 gene locus_tag LOCUS_04220 456026 455520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 456732 456040 gene locus_tag LOCUS_04230 456732 456040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 457163 456729 gene locus_tag LOCUS_04240 gene rnhA 457163 456729 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_04240 459664 457160 gene locus_tag LOCUS_04250 gene gyrA 459664 457160 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_04250 461610 459679 gene locus_tag LOCUS_04260 gene gyrB 461610 459679 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_04260 461909 461640 gene locus_tag LOCUS_04270 461909 461640 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359336.1 protein_id gnl|my_center|LOCUS_04270 463009 461909 gene locus_tag LOCUS_04280 gene recF 463009 461909 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723768.1 protein_id gnl|my_center|LOCUS_04280 463221 463006 gene locus_tag LOCUS_04290 463221 463006 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941132.1 protein_id gnl|my_center|LOCUS_04290 464351 463245 gene locus_tag LOCUS_04300 gene dnaN 464351 463245 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420481.1 protein_id gnl|my_center|LOCUS_04300 465918 464596 gene locus_tag LOCUS_04310 gene dnaA 465918 464596 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_04310 466127 469645 gene locus_tag LOCUS_04320 gene mfd 466127 469645 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_04320 469683 470867 gene locus_tag LOCUS_04330 469683 470867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 471391 470927 gene locus_tag LOCUS_04340 471391 470927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 471544 472806 gene locus_tag LOCUS_04350 471544 472806 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_04350 473503 472919 gene locus_tag LOCUS_04360 473503 472919 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181746.1 protein_id gnl|my_center|LOCUS_04360 473776 474081 gene locus_tag LOCUS_04370 473776 474081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 474078 475382 gene locus_tag LOCUS_04380 474078 475382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 475811 475557 gene locus_tag LOCUS_04390 475811 475557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 476408 476037 gene locus_tag LOCUS_04400 476408 476037 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 protein_id gnl|my_center|LOCUS_04400 477632 476424 gene locus_tag LOCUS_04410 gene ilvA 477632 476424 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_04410 477931 478644 gene locus_tag LOCUS_04420 477931 478644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131171868.1 protein_id gnl|my_center|LOCUS_04420 478638 480236 gene locus_tag LOCUS_04430 478638 480236 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_04430 480809 480300 gene locus_tag LOCUS_04440 480809 480300 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_04440 480969 481991 gene locus_tag LOCUS_04450 480969 481991 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438242.1 protein_id gnl|my_center|LOCUS_04450 482213 482049 gene locus_tag LOCUS_04460 482213 482049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 483807 482230 gene locus_tag LOCUS_04470 483807 482230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 485003 483807 gene locus_tag LOCUS_04480 485003 483807 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986695.1 protein_id gnl|my_center|LOCUS_04480 486646 485318 gene locus_tag LOCUS_04490 486646 485318 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015963.1 protein_id gnl|my_center|LOCUS_04490 488133 486904 gene locus_tag LOCUS_04500 gene sstT 488133 486904 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_04500 488497 488342 gene locus_tag LOCUS_04510 488497 488342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 490078 488510 gene locus_tag LOCUS_04520 490078 488510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 491285 490080 gene locus_tag LOCUS_04530 491285 490080 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545072.1 protein_id gnl|my_center|LOCUS_04530 492029 491397 gene locus_tag LOCUS_04540 492029 491397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 492331 492510 gene locus_tag LOCUS_04550 492331 492510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 492526 492894 gene locus_tag LOCUS_04560 492526 492894 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_04560 496246 493133 gene locus_tag LOCUS_04570 496246 493133 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870273.1 protein_id gnl|my_center|LOCUS_04570 497034 496243 gene locus_tag LOCUS_04580 497034 496243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 498358 497051 gene locus_tag LOCUS_04590 498358 497051 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548846.1 protein_id gnl|my_center|LOCUS_04590 499035 498355 gene locus_tag LOCUS_04600 499035 498355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 500606 499032 gene locus_tag LOCUS_04610 500606 499032 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870275.1 protein_id gnl|my_center|LOCUS_04610 500836 500612 gene locus_tag LOCUS_04620 500836 500612 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994645.1 protein_id gnl|my_center|LOCUS_04620 501522 501887 gene locus_tag LOCUS_04630 501522 501887 CDS product cysteine-rich VLP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861105.1 protein_id gnl|my_center|LOCUS_04630 502013 502402 gene locus_tag LOCUS_04640 502013 502402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 502452 503306 gene locus_tag LOCUS_04650 502452 503306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 503320 503589 gene locus_tag LOCUS_04660 503320 503589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 503553 505253 gene locus_tag LOCUS_04670 gene tndX 503553 505253 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_04670 505419 505343 gene locus_tag LOCUS_t00080 505419 505343 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 505935 505486 gene locus_tag LOCUS_04680 gene mscL 505935 505486 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242893.1 protein_id gnl|my_center|LOCUS_04680 507270 505966 gene locus_tag LOCUS_04690 gene serS 507270 505966 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_04690 508184 507300 gene locus_tag LOCUS_04700 508184 507300 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_04700 508992 508177 gene locus_tag LOCUS_04710 gene soj 508992 508177 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_04710 509996 509139 gene locus_tag LOCUS_04720 gene gpr 509996 509139 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_04720 510184 510447 gene locus_tag LOCUS_04730 gene rpsT 510184 510447 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774009.1 protein_id gnl|my_center|LOCUS_04730 510514 511401 gene locus_tag LOCUS_04740 510514 511401 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_04740 511541 512935 gene locus_tag LOCUS_04750 gene asnS 511541 512935 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948326.1 protein_id gnl|my_center|LOCUS_04750 513382 513041 gene locus_tag LOCUS_04760 gene hypA 513382 513041 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388923.1 protein_id gnl|my_center|LOCUS_04760 516066 513382 gene locus_tag LOCUS_04770 516066 513382 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_04770 516510 516244 gene locus_tag LOCUS_04780 516510 516244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 516701 516528 gene locus_tag LOCUS_04790 516701 516528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 518327 516717 gene locus_tag LOCUS_04800 518327 516717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 519542 518343 gene locus_tag LOCUS_04810 519542 518343 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454390.1 protein_id gnl|my_center|LOCUS_04810 519997 521013 gene locus_tag LOCUS_04820 gene ptcA 519997 521013 CDS product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355587.1 protein_id gnl|my_center|LOCUS_04820 521038 522417 gene locus_tag LOCUS_04830 521038 522417 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262732.1 protein_id gnl|my_center|LOCUS_04830 522430 523536 gene locus_tag LOCUS_04840 gene aguA 522430 523536 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262731.1 protein_id gnl|my_center|LOCUS_04840 523541 524479 gene locus_tag LOCUS_04850 gene arcC 523541 524479 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363186.1 protein_id gnl|my_center|LOCUS_04850 525086 524529 gene locus_tag LOCUS_04860 525086 524529 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964041.1 protein_id gnl|my_center|LOCUS_04860 525182 525964 gene locus_tag LOCUS_04870 525182 525964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 526558 526037 gene locus_tag LOCUS_04880 526558 526037 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_04880 526685 529939 gene locus_tag LOCUS_04890 526685 529939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 530694 530110 gene locus_tag LOCUS_04900 530694 530110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 530878 534012 gene locus_tag LOCUS_04910 530878 534012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 534125 534589 gene locus_tag LOCUS_04920 534125 534589 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_04920 535391 534627 gene locus_tag LOCUS_04930 535391 534627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 537063 535483 gene locus_tag LOCUS_04940 537063 535483 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051558.1 protein_id gnl|my_center|LOCUS_04940 537344 537063 gene locus_tag LOCUS_04950 537344 537063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 538649 537411 gene locus_tag LOCUS_04960 gene estA 538649 537411 CDS product esterase EstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948553.1 protein_id gnl|my_center|LOCUS_04960 539059 540021 gene locus_tag LOCUS_04970 539059 540021 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_04970 540093 541034 gene locus_tag LOCUS_04980 540093 541034 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563799.1 protein_id gnl|my_center|LOCUS_04980 541036 541830 gene locus_tag LOCUS_04990 541036 541830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_04990 542098 543516 gene locus_tag LOCUS_05000 542098 543516 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_05000 543530 544300 gene locus_tag LOCUS_05010 543530 544300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 544713 545786 gene locus_tag LOCUS_05020 544713 545786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 545783 546487 gene locus_tag LOCUS_05030 545783 546487 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722035.1 protein_id gnl|my_center|LOCUS_05030 547481 546681 gene locus_tag LOCUS_05040 547481 546681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 547645 548310 gene locus_tag LOCUS_05050 547645 548310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 548487 549227 gene locus_tag LOCUS_05060 548487 549227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 549363 550994 gene locus_tag LOCUS_05070 549363 550994 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_05070 552164 551055 gene locus_tag LOCUS_05080 552164 551055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 553327 552161 gene locus_tag LOCUS_05090 553327 552161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 554880 553360 gene locus_tag LOCUS_05100 554880 553360 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_05100 555310 556838 gene locus_tag LOCUS_r00010 555310 556838 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 557149 559982 gene locus_tag LOCUS_r00020 557149 559982 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 560060 560135 gene locus_tag LOCUS_t00090 560060 560135 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 560167 560276 gene locus_tag LOCUS_r00030 560167 560276 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 560462 560947 gene locus_tag LOCUS_05110 560462 560947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 560944 561627 gene locus_tag LOCUS_05120 560944 561627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 561994 561716 gene locus_tag LOCUS_05130 561994 561716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 563075 562296 gene locus_tag LOCUS_05140 563075 562296 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974212.1 protein_id gnl|my_center|LOCUS_05140 563584 564228 gene locus_tag LOCUS_05150 gene deoC 563584 564228 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_05150 564249 565745 gene locus_tag LOCUS_05160 gene rbsA 564249 565745 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217684.1 protein_id gnl|my_center|LOCUS_05160 565763 566728 gene locus_tag LOCUS_05170 565763 566728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 566782 567981 gene locus_tag LOCUS_05180 566782 567981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 568181 569140 gene locus_tag LOCUS_05190 568181 569140 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241393.1 protein_id gnl|my_center|LOCUS_05190 569307 571409 gene locus_tag LOCUS_05200 569307 571409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 571449 572372 gene locus_tag LOCUS_05210 gene rbsK 571449 572372 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391595.1 protein_id gnl|my_center|LOCUS_05210 572715 572524 gene locus_tag LOCUS_05220 572715 572524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 573913 573023 gene locus_tag LOCUS_05230 573913 573023 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563824.1 protein_id gnl|my_center|LOCUS_05230 575272 573959 gene locus_tag LOCUS_05240 575272 573959 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424336.1 protein_id gnl|my_center|LOCUS_05240 576556 575297 gene locus_tag LOCUS_05250 576556 575297 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 protein_id gnl|my_center|LOCUS_05250 578412 576871 gene locus_tag LOCUS_05260 578412 576871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 578781 580727 gene locus_tag LOCUS_05270 578781 580727 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964362.1 protein_id gnl|my_center|LOCUS_05270 580764 581540 gene locus_tag LOCUS_05280 580764 581540 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_05280 581815 582432 gene locus_tag LOCUS_05290 581815 582432 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_05290 582985 582509 gene locus_tag LOCUS_05300 582985 582509 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896783.1 protein_id gnl|my_center|LOCUS_05300 583921 583004 gene locus_tag LOCUS_05310 583921 583004 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_05310 584847 583921 gene locus_tag LOCUS_05320 584847 583921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 587697 584890 gene locus_tag LOCUS_05330 gene ileS 587697 584890 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_05330 588480 587794 gene locus_tag LOCUS_05340 588480 587794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 589121 588552 gene locus_tag LOCUS_05350 589121 588552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 589900 589196 gene locus_tag LOCUS_05360 589900 589196 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_05360 591116 589917 gene locus_tag LOCUS_05370 591116 589917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 591380 591153 gene locus_tag LOCUS_05380 gene hfq 591380 591153 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392630.1 protein_id gnl|my_center|LOCUS_05380 592452 591508 gene locus_tag LOCUS_05390 gene miaA 592452 591508 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_05390 592561 593403 gene locus_tag LOCUS_05400 592561 593403 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811761.1 protein_id gnl|my_center|LOCUS_05400 595379 593457 gene locus_tag LOCUS_05410 595379 593457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 595532 596944 gene locus_tag LOCUS_05420 gene miaB 595532 596944 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_05420 596948 599554 gene locus_tag LOCUS_05430 gene mutS 596948 599554 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541545.1 protein_id gnl|my_center|LOCUS_05430 599556 600260 gene locus_tag LOCUS_05440 599556 600260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 600981 600496 gene locus_tag LOCUS_05450 600981 600496 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084430.1 protein_id gnl|my_center|LOCUS_05450 601828 600995 gene locus_tag LOCUS_05460 601828 600995 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_05460 602080 604536 gene locus_tag LOCUS_05470 602080 604536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 604691 605608 gene locus_tag LOCUS_05480 604691 605608 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_05480 605626 605784 gene locus_tag LOCUS_05490 605626 605784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 606757 605855 gene locus_tag LOCUS_05500 606757 605855 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_05500 607277 607071 gene locus_tag LOCUS_05510 607277 607071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 608651 607293 gene locus_tag LOCUS_05520 608651 607293 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963801.1 protein_id gnl|my_center|LOCUS_05520 608933 608664 gene locus_tag LOCUS_05530 608933 608664 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392891.1 protein_id gnl|my_center|LOCUS_05530 609536 608946 gene locus_tag LOCUS_05540 gene yfbR 609536 608946 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813851.1 protein_id gnl|my_center|LOCUS_05540 609707 611533 gene locus_tag LOCUS_05550 gene typA 609707 611533 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393394.1 protein_id gnl|my_center|LOCUS_05550 611747 612013 gene locus_tag LOCUS_05560 gene rpsO 611747 612013 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_05560 612218 614341 gene locus_tag LOCUS_05570 gene pnp 612218 614341 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_05570 614411 615658 gene locus_tag LOCUS_05580 614411 615658 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 protein_id gnl|my_center|LOCUS_05580 616855 615848 gene locus_tag LOCUS_05590 616855 615848 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_05590 618184 616874 gene locus_tag LOCUS_05600 618184 616874 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986280.1 protein_id gnl|my_center|LOCUS_05600 619334 618195 gene locus_tag LOCUS_05610 619334 618195 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_05610 620133 619510 gene locus_tag LOCUS_05620 620133 619510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 620866 620249 gene locus_tag LOCUS_05630 620866 620249 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_05630 621323 620880 gene locus_tag LOCUS_05640 gene dtd 621323 620880 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_05640 623638 621320 gene locus_tag LOCUS_05650 623638 621320 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_05650 625701 623686 gene locus_tag LOCUS_05660 gene recJ 625701 623686 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_05660 625913 625999 gene locus_tag LOCUS_t00100 625913 625999 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 626254 627378 gene locus_tag LOCUS_05670 626254 627378 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817429.1 protein_id gnl|my_center|LOCUS_05670 628472 627435 gene locus_tag LOCUS_05680 628472 627435 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704264.1 protein_id gnl|my_center|LOCUS_05680 628913 628584 gene locus_tag LOCUS_05690 gene azlD 628913 628584 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_05690 629614 628910 gene locus_tag LOCUS_05700 629614 628910 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410658.1 protein_id gnl|my_center|LOCUS_05700 631224 629755 gene locus_tag LOCUS_05710 631224 629755 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_05710 632346 631423 gene locus_tag LOCUS_05720 632346 631423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 633648 632350 gene locus_tag LOCUS_05730 633648 632350 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_05730 633906 633673 gene locus_tag LOCUS_05740 633906 633673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 634112 634684 gene locus_tag LOCUS_05750 634112 634684 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_05750 635040 636251 gene locus_tag LOCUS_05760 635040 636251 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_05760 636365 637897 gene locus_tag LOCUS_05770 636365 637897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381361.1 protein_id gnl|my_center|LOCUS_05770 637890 639002 gene locus_tag LOCUS_05780 637890 639002 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_05780 638995 639990 gene locus_tag LOCUS_05790 638995 639990 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_05790 640344 640111 gene locus_tag LOCUS_05800 640344 640111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 640607 641752 gene locus_tag LOCUS_05810 640607 641752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 643160 641832 gene locus_tag LOCUS_05820 gene brnQ 643160 641832 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902388.1 protein_id gnl|my_center|LOCUS_05820 643363 644223 gene locus_tag LOCUS_05830 643363 644223 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088772.1 protein_id gnl|my_center|LOCUS_05830 646277 644337 gene locus_tag LOCUS_05840 646277 644337 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_05840 647060 646299 gene locus_tag LOCUS_05850 647060 646299 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 protein_id gnl|my_center|LOCUS_05850 647563 647060 gene locus_tag LOCUS_05860 647563 647060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 647917 649332 gene locus_tag LOCUS_05870 647917 649332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 649367 649837 gene locus_tag LOCUS_05880 649367 649837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 649868 650260 gene locus_tag LOCUS_05890 649868 650260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 652070 650844 gene locus_tag LOCUS_05900 652070 650844 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901956.1 protein_id gnl|my_center|LOCUS_05900 653396 652107 gene locus_tag LOCUS_05910 653396 652107 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528423.1 protein_id gnl|my_center|LOCUS_05910 654496 653540 gene locus_tag LOCUS_05920 654496 653540 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016517.1 protein_id gnl|my_center|LOCUS_05920 654910 654834 gene locus_tag LOCUS_t00110 654910 654834 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 657060 655495 gene locus_tag LOCUS_05930 657060 655495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 657309 659246 gene locus_tag LOCUS_05940 657309 659246 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964362.1 protein_id gnl|my_center|LOCUS_05940 659271 660110 gene locus_tag LOCUS_05950 659271 660110 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641673.1 protein_id gnl|my_center|LOCUS_05950 660192 661052 gene locus_tag LOCUS_05960 660192 661052 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563824.1 protein_id gnl|my_center|LOCUS_05960 661082 661615 gene locus_tag LOCUS_05970 661082 661615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 663782 662067 gene locus_tag LOCUS_05980 663782 662067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 664719 663943 gene locus_tag LOCUS_05990 664719 663943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 664830 665048 gene locus_tag LOCUS_06000 664830 665048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 665084 665725 gene locus_tag LOCUS_06010 665084 665725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 667021 665807 gene locus_tag LOCUS_06020 667021 665807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 667255 667179 gene locus_tag LOCUS_t00120 667255 667179 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 667525 667346 gene locus_tag LOCUS_06030 667525 667346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 667716 668489 gene locus_tag LOCUS_06040 667716 668489 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_06040 668486 669589 gene locus_tag LOCUS_06050 668486 669589 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942069.1 protein_id gnl|my_center|LOCUS_06050 669586 671505 gene locus_tag LOCUS_06060 669586 671505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 671638 673065 gene locus_tag LOCUS_06070 671638 673065 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456001.1 protein_id gnl|my_center|LOCUS_06070 673249 673896 gene locus_tag LOCUS_06080 673249 673896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 674211 673987 gene locus_tag LOCUS_06090 674211 673987 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_06090 674536 675390 gene locus_tag LOCUS_06100 gene noc 674536 675390 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_06100 675488 675973 gene locus_tag LOCUS_06110 675488 675973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 680067 676039 gene locus_tag LOCUS_06120 gene carB 680067 676039 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_06120 681124 680057 gene locus_tag LOCUS_06130 681124 680057 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828679.1 protein_id gnl|my_center|LOCUS_06130 682119 681121 gene locus_tag LOCUS_06140 gene argF 682119 681121 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_06140 683300 682134 gene locus_tag LOCUS_06150 683300 682134 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_06150 684171 683281 gene locus_tag LOCUS_06160 gene argB 684171 683281 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_06160 685404 684190 gene locus_tag LOCUS_06170 gene argJ 685404 684190 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_06170 686359 685415 gene locus_tag LOCUS_06180 gene argC 686359 685415 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_06180 688365 686614 gene locus_tag LOCUS_06190 688365 686614 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_06190 688628 689311 gene locus_tag LOCUS_06200 688628 689311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 689563 690099 gene locus_tag LOCUS_06210 689563 690099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 692311 690542 gene locus_tag LOCUS_06220 692311 690542 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_06220 693864 692308 gene locus_tag LOCUS_06230 693864 692308 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_06230 694275 693910 gene locus_tag LOCUS_06240 694275 693910 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964634.1 protein_id gnl|my_center|LOCUS_06240 695525 694272 gene locus_tag LOCUS_06250 695525 694272 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680998.1 protein_id gnl|my_center|LOCUS_06250 697246 695522 gene locus_tag LOCUS_06260 697246 695522 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971525.1 protein_id gnl|my_center|LOCUS_06260 697444 698019 gene locus_tag LOCUS_06270 697444 698019 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814293.1 protein_id gnl|my_center|LOCUS_06270 698280 699461 gene locus_tag LOCUS_06280 698280 699461 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454390.1 protein_id gnl|my_center|LOCUS_06280 699483 701081 gene locus_tag LOCUS_06290 699483 701081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 701100 701279 gene locus_tag LOCUS_06300 701100 701279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 701898 701698 gene locus_tag LOCUS_06310 gene rpmE 701898 701698 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_06310 705568 702011 gene locus_tag LOCUS_06320 gene addA 705568 702011 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965560.1 protein_id gnl|my_center|LOCUS_06320 708884 705561 gene locus_tag LOCUS_06330 gene addB 708884 705561 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816091.1 protein_id gnl|my_center|LOCUS_06330 710673 709327 gene locus_tag LOCUS_06340 710673 709327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 711412 710972 gene locus_tag LOCUS_06350 711412 710972 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680049.1 protein_id gnl|my_center|LOCUS_06350 712688 711414 gene locus_tag LOCUS_06360 712688 711414 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680050.1 protein_id gnl|my_center|LOCUS_06360 713747 712827 gene locus_tag LOCUS_06370 713747 712827 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_06370 714278 713895 gene locus_tag LOCUS_06380 714278 713895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 714558 714280 gene locus_tag LOCUS_06390 714558 714280 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_06390 716591 714555 gene locus_tag LOCUS_06400 716591 714555 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_06400 717741 716578 gene locus_tag LOCUS_06410 717741 716578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 717889 720114 gene locus_tag LOCUS_06420 717889 720114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 720124 720744 gene locus_tag LOCUS_06430 gene purN 720124 720744 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436064.1 protein_id gnl|my_center|LOCUS_06430 721432 720986 gene locus_tag LOCUS_06440 721432 720986 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_06440 721543 721971 gene locus_tag LOCUS_06450 721543 721971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 722224 722021 gene locus_tag LOCUS_06460 722224 722021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 723198 722221 gene locus_tag LOCUS_06470 723198 722221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 723413 723844 gene locus_tag LOCUS_06480 723413 723844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 723944 725380 gene locus_tag LOCUS_06490 gene proS 723944 725380 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_06490 727138 725438 gene locus_tag LOCUS_06500 727138 725438 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_06500 727483 728799 gene locus_tag LOCUS_06510 gene rsxC 727483 728799 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480691.1 protein_id gnl|my_center|LOCUS_06510 728796 729854 gene locus_tag LOCUS_06520 728796 729854 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_06520 729847 730419 gene locus_tag LOCUS_06530 729847 730419 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_06530 730433 731122 gene locus_tag LOCUS_06540 730433 731122 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_06540 731124 731711 gene locus_tag LOCUS_06550 gene rsxA 731124 731711 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_06550 731725 732537 gene locus_tag LOCUS_06560 731725 732537 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_06560 732679 733716 gene locus_tag LOCUS_06570 732679 733716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 733703 734116 gene locus_tag LOCUS_06580 733703 734116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 734248 734832 gene locus_tag LOCUS_06590 734248 734832 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990735.1 protein_id gnl|my_center|LOCUS_06590 734875 735078 gene locus_tag LOCUS_06600 734875 735078 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_06600 736277 735195 gene locus_tag LOCUS_06610 736277 735195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 736746 736306 gene locus_tag LOCUS_06620 gene rpiB 736746 736306 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_06620 738559 736781 gene locus_tag LOCUS_06630 738559 736781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 738830 740371 gene locus_tag LOCUS_06640 gene rny 738830 740371 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_06640 741267 741443 gene locus_tag LOCUS_06650 741267 741443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 743188 741560 gene locus_tag LOCUS_06660 gene groL 743188 741560 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_06660 743505 743221 gene locus_tag LOCUS_06670 743505 743221 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420907.1 protein_id gnl|my_center|LOCUS_06670 744591 743659 gene locus_tag LOCUS_06680 744591 743659 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429006.1 protein_id gnl|my_center|LOCUS_06680 745855 744734 gene locus_tag LOCUS_06690 745855 744734 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949044.1 protein_id gnl|my_center|LOCUS_06690 746867 745848 gene locus_tag LOCUS_06700 746867 745848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 747889 746882 gene locus_tag LOCUS_06710 gene aroC 747889 746882 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_06710 748105 748794 gene locus_tag LOCUS_06720 748105 748794 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_06720 748795 750282 gene locus_tag LOCUS_06730 748795 750282 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_06730 750378 751667 gene locus_tag LOCUS_06740 750378 751667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 752921 751995 gene locus_tag LOCUS_06750 gene prmA 752921 751995 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_06750 753590 753045 gene locus_tag LOCUS_06760 gene raiA 753590 753045 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_06760 754127 753738 gene locus_tag LOCUS_06770 754127 753738 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_06770 754400 755800 gene locus_tag LOCUS_06780 754400 755800 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_06780 755804 756190 gene locus_tag LOCUS_06790 755804 756190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 756209 758107 gene locus_tag LOCUS_06800 756209 758107 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_06800 758245 758841 gene locus_tag LOCUS_06810 758245 758841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 758843 759616 gene locus_tag LOCUS_06820 758843 759616 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_06820 759777 761369 gene locus_tag LOCUS_06830 gene cls 759777 761369 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_06830 761401 761952 gene locus_tag LOCUS_06840 761401 761952 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_06840 762017 762604 gene locus_tag LOCUS_06850 762017 762604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 762804 763691 gene locus_tag LOCUS_06860 762804 763691 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_06860 765250 763799 gene locus_tag LOCUS_06870 765250 763799 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296829.1 protein_id gnl|my_center|LOCUS_06870 765697 765386 gene locus_tag LOCUS_06880 765697 765386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 765869 766780 gene locus_tag LOCUS_06890 765869 766780 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_06890 767017 767799 gene locus_tag LOCUS_06900 767017 767799 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901989.1 protein_id gnl|my_center|LOCUS_06900 768891 767854 gene locus_tag LOCUS_06910 gene mutY 768891 767854 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486227.1 protein_id gnl|my_center|LOCUS_06910 770192 769038 gene locus_tag LOCUS_06920 gene dnaJ 770192 769038 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357822.1 protein_id gnl|my_center|LOCUS_06920 772172 770307 gene locus_tag LOCUS_06930 gene dnaK 772172 770307 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_06930 772842 772225 gene locus_tag LOCUS_06940 772842 772225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 773920 772784 gene locus_tag LOCUS_06950 gene hrcA 773920 772784 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964592.1 protein_id gnl|my_center|LOCUS_06950 775519 774251 gene locus_tag LOCUS_06960 gene rpoD 775519 774251 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_06960 777269 775500 gene locus_tag LOCUS_06970 gene dnaG 777269 775500 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357766.1 protein_id gnl|my_center|LOCUS_06970 778319 777312 gene locus_tag LOCUS_06980 778319 777312 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_06980 779508 778870 gene locus_tag LOCUS_06990 779508 778870 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027706.1 protein_id gnl|my_center|LOCUS_06990 780790 779510 gene locus_tag LOCUS_07000 gene hflX 780790 779510 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_07000 782097 781153 gene locus_tag LOCUS_07010 782097 781153 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964846.1 protein_id gnl|my_center|LOCUS_07010 783035 782103 gene locus_tag LOCUS_07020 783035 782103 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_07020 783181 782987 gene locus_tag LOCUS_07030 783181 782987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 783782 783366 gene locus_tag LOCUS_07040 783782 783366 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_07040 785179 783791 gene locus_tag LOCUS_07050 gene atpD 785179 783791 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_07050 786092 785220 gene locus_tag LOCUS_07060 gene atpG 786092 785220 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_07060 788379 786133 gene locus_tag LOCUS_07070 788379 786133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 788897 788418 gene locus_tag LOCUS_07080 788897 788418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 789156 788926 gene locus_tag LOCUS_07090 gene atpE 789156 788926 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142903.1 protein_id gnl|my_center|LOCUS_07090 789889 789227 gene locus_tag LOCUS_07100 gene atpB 789889 789227 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582552.1 protein_id gnl|my_center|LOCUS_07100 790304 789882 gene locus_tag LOCUS_07110 790304 789882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 790606 791844 gene locus_tag LOCUS_07120 790606 791844 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_07120 791841 792713 gene locus_tag LOCUS_07130 gene ispE 791841 792713 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_07130 792806 793435 gene locus_tag LOCUS_07140 gene spoIIR 792806 793435 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966181.1 protein_id gnl|my_center|LOCUS_07140 794449 793511 gene locus_tag LOCUS_07150 794449 793511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 795909 794446 gene locus_tag LOCUS_07160 795909 794446 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924633.1 protein_id gnl|my_center|LOCUS_07160 796877 795942 gene locus_tag LOCUS_07170 796877 795942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 800580 797149 gene locus_tag LOCUS_07180 800580 797149 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965948.1 protein_id gnl|my_center|LOCUS_07180 800812 801474 gene locus_tag LOCUS_07190 800812 801474 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_07190 801461 802318 gene locus_tag LOCUS_07200 801461 802318 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_07200 802369 803964 gene locus_tag LOCUS_07210 802369 803964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 804531 805403 gene locus_tag LOCUS_07220 804531 805403 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_07220 805551 806273 gene locus_tag LOCUS_07230 805551 806273 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_07230 806460 806335 gene locus_tag LOCUS_07240 806460 806335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 806549 807064 gene locus_tag LOCUS_07250 806549 807064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 808707 807133 gene locus_tag LOCUS_07260 808707 807133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 809906 808710 gene locus_tag LOCUS_07270 809906 808710 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545072.1 protein_id gnl|my_center|LOCUS_07270 810083 810322 gene locus_tag LOCUS_07280 810083 810322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 810319 810543 gene locus_tag LOCUS_07290 810319 810543 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_07290 810681 811412 gene locus_tag LOCUS_07300 810681 811412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 811800 812162 gene locus_tag LOCUS_07310 811800 812162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 812212 812526 gene locus_tag LOCUS_07320 812212 812526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 813925 812513 gene locus_tag LOCUS_07330 gene gltA 813925 812513 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_07330 814821 813928 gene locus_tag LOCUS_07340 814821 813928 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_07340 817577 815184 gene locus_tag LOCUS_07350 817577 815184 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_07350 819216 817624 gene locus_tag LOCUS_07360 819216 817624 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_07360 820421 819213 gene locus_tag LOCUS_07370 820421 819213 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_07370 821134 820688 gene locus_tag LOCUS_07380 821134 820688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 821915 821262 gene locus_tag LOCUS_07390 821915 821262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 822523 821927 gene locus_tag LOCUS_07400 822523 821927 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814942.1 protein_id gnl|my_center|LOCUS_07400 822662 823603 gene locus_tag LOCUS_07410 822662 823603 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_07410 823685 825388 gene locus_tag LOCUS_07420 823685 825388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 825762 825445 gene locus_tag LOCUS_07430 825762 825445 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282554.1 protein_id gnl|my_center|LOCUS_07430 826700 825969 gene locus_tag LOCUS_07440 826700 825969 CDS product NgoBV family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217109.1 protein_id gnl|my_center|LOCUS_07440 827986 826697 gene locus_tag LOCUS_07450 827986 826697 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223735.1 protein_id gnl|my_center|LOCUS_07450 828770 828201 gene locus_tag LOCUS_07460 828770 828201 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_07460 829227 828814 gene locus_tag LOCUS_07470 829227 828814 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_07470 830094 829666 gene locus_tag LOCUS_07480 830094 829666 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963997.1 protein_id gnl|my_center|LOCUS_07480 831244 830195 gene locus_tag LOCUS_07490 831244 830195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 831355 831597 gene locus_tag LOCUS_07500 831355 831597 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_07500 831947 832996 gene locus_tag LOCUS_07510 831947 832996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 833263 833961 gene locus_tag LOCUS_07520 gene rsmG 833263 833961 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_07520 835070 834024 gene locus_tag LOCUS_07530 835070 834024 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_07530 835801 835499 gene locus_tag LOCUS_07540 835801 835499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 836196 835873 gene locus_tag LOCUS_07550 836196 835873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 836388 838442 gene locus_tag LOCUS_07560 836388 838442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 838567 838857 gene locus_tag LOCUS_07570 838567 838857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 838873 840372 gene locus_tag LOCUS_07580 838873 840372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 840491 841297 gene locus_tag LOCUS_07590 840491 841297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 842586 841393 gene locus_tag LOCUS_07600 gene metK 842586 841393 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_07600 845043 842833 gene locus_tag LOCUS_07610 gene ppk1 845043 842833 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479817.1 protein_id gnl|my_center|LOCUS_07610 845195 845863 gene locus_tag LOCUS_07620 gene hypB 845195 845863 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_07620 846812 845937 gene locus_tag LOCUS_07630 846812 845937 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_07630 847048 848535 gene locus_tag LOCUS_07640 gene putP 847048 848535 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_07640 848724 849182 gene locus_tag LOCUS_07650 848724 849182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 849170 851293 gene locus_tag LOCUS_07660 849170 851293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_07660 851296 853110 gene locus_tag LOCUS_07670 851296 853110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_07670 855067 853655 gene locus_tag LOCUS_07680 gene pyk 855067 853655 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680502.1 protein_id gnl|my_center|LOCUS_07680 856154 855096 gene locus_tag LOCUS_07690 856154 855096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 856418 857380 gene locus_tag LOCUS_07700 856418 857380 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_07700 857380 857967 gene locus_tag LOCUS_07710 gene pth 857380 857967 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_07710 858110 859309 gene locus_tag LOCUS_07720 858110 859309 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418638.1 protein_id gnl|my_center|LOCUS_07720 859306 860409 gene locus_tag LOCUS_07730 gene glgD 859306 860409 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_07730 860444 862855 gene locus_tag LOCUS_07740 860444 862855 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798121.1 protein_id gnl|my_center|LOCUS_07740 862852 863736 gene locus_tag LOCUS_07750 862852 863736 CDS product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208146.1 protein_id gnl|my_center|LOCUS_07750 865755 863794 gene locus_tag LOCUS_07760 gene feoB 865755 863794 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_07760 866363 866049 gene locus_tag LOCUS_07770 866363 866049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 866489 867664 gene locus_tag LOCUS_07780 866489 867664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 868877 867756 gene locus_tag LOCUS_07790 gene prfB 868877 867756 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018379.1 protein_id gnl|my_center|LOCUS_07790 869449 868955 gene locus_tag LOCUS_07800 869449 868955 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_07800 869572 870198 gene locus_tag LOCUS_07810 869572 870198 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_07810 870287 870826 gene locus_tag LOCUS_07820 870287 870826 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_07820 870833 872305 gene locus_tag LOCUS_07830 gene malQ 870833 872305 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143306.1 protein_id gnl|my_center|LOCUS_07830 873045 872359 gene locus_tag LOCUS_07840 873045 872359 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_07840 874080 873169 gene locus_tag LOCUS_07850 874080 873169 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_07850 874290 875672 gene locus_tag LOCUS_07860 874290 875672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 875735 876580 gene locus_tag LOCUS_07870 875735 876580 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_07870 877908 876865 gene locus_tag LOCUS_07880 877908 876865 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_07880 878885 877905 gene locus_tag LOCUS_07890 878885 877905 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_07890 879896 878898 gene locus_tag LOCUS_07900 879896 878898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 880022 882115 gene locus_tag LOCUS_07910 880022 882115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 882136 882708 gene locus_tag LOCUS_07920 882136 882708 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_07920 882705 883553 gene locus_tag LOCUS_07930 gene mreC 882705 883553 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_07930 883555 884070 gene locus_tag LOCUS_07940 883555 884070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 884109 886175 gene locus_tag LOCUS_07950 884109 886175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 886209 886610 gene locus_tag LOCUS_07960 gene mgsA 886209 886610 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_07960 886634 887992 gene locus_tag LOCUS_07970 gene hisS 886634 887992 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_07970 888060 889853 gene locus_tag LOCUS_07980 gene aspS 888060 889853 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_07980 889919 891442 gene locus_tag LOCUS_07990 889919 891442 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_07990 891471 891809 gene locus_tag LOCUS_08000 891471 891809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 891839 893011 gene locus_tag LOCUS_08010 gene thiI 891839 893011 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_08010 893008 894267 gene locus_tag LOCUS_08020 893008 894267 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_08020 894355 895542 gene locus_tag LOCUS_08030 894355 895542 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684076.1 protein_id gnl|my_center|LOCUS_08030 895560 896462 gene locus_tag LOCUS_08040 gene rfbA 895560 896462 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_08040 896455 897483 gene locus_tag LOCUS_08050 gene rfbB 896455 897483 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_08050 898114 897557 gene locus_tag LOCUS_08060 898114 897557 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814119.1 protein_id gnl|my_center|LOCUS_08060 899334 898111 gene locus_tag LOCUS_08070 899334 898111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 899400 899687 gene locus_tag LOCUS_08080 899400 899687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 899794 900039 gene locus_tag LOCUS_08090 899794 900039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 900107 900871 gene locus_tag LOCUS_08100 900107 900871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 901184 900933 gene locus_tag LOCUS_08110 901184 900933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_08110 903001 901199 gene locus_tag LOCUS_08120 gene lepA 903001 901199 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_08120 903309 902998 gene locus_tag LOCUS_08130 903309 902998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 903497 904498 gene locus_tag LOCUS_08140 gene pta 903497 904498 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067221.1 protein_id gnl|my_center|LOCUS_08140 904575 905024 gene locus_tag LOCUS_08150 gene tadA 904575 905024 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_08150 905865 905062 gene locus_tag LOCUS_08160 905865 905062 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769562.1 protein_id gnl|my_center|LOCUS_08160 906490 905936 gene locus_tag LOCUS_08170 906490 905936 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_08170 906934 908385 gene locus_tag LOCUS_08180 906934 908385 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462328.1 protein_id gnl|my_center|LOCUS_08180 910185 908707 gene locus_tag LOCUS_08190 910185 908707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 912254 910383 gene locus_tag LOCUS_08200 912254 910383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 913122 912229 gene locus_tag LOCUS_08210 913122 912229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_08210 913438 913115 gene locus_tag LOCUS_08220 913438 913115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 915512 913635 gene locus_tag LOCUS_08230 gene mnmG 915512 913635 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_08230 914013 913918 gene locus_tag LOCUS_t00130 914013 913918 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 915739 916560 gene locus_tag LOCUS_08240 915739 916560 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_08240 916639 917286 gene locus_tag LOCUS_08250 916639 917286 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430270.1 protein_id gnl|my_center|LOCUS_08250 917299 918072 gene locus_tag LOCUS_08260 917299 918072 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_08260 918192 919016 gene locus_tag LOCUS_08270 918192 919016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 919199 920611 gene locus_tag LOCUS_08280 919199 920611 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_08280 920637 921113 gene locus_tag LOCUS_08290 920637 921113 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_08290 922978 921209 gene locus_tag LOCUS_08300 922978 921209 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_08300 923174 923635 gene locus_tag LOCUS_08310 923174 923635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 924623 926194 gene locus_tag LOCUS_08320 924623 926194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 926298 926459 gene locus_tag LOCUS_08330 926298 926459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 926456 927181 gene locus_tag LOCUS_08340 926456 927181 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393177.1 protein_id gnl|my_center|LOCUS_08340 927178 928221 gene locus_tag LOCUS_08350 927178 928221 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357629.1 protein_id gnl|my_center|LOCUS_08350 929790 928375 gene locus_tag LOCUS_08360 929790 928375 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_08360 930764 929865 gene locus_tag LOCUS_08370 930764 929865 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_08370 931250 930777 gene locus_tag LOCUS_08380 931250 930777 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_08380 931465 931782 gene locus_tag LOCUS_08390 931465 931782 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393534.1 protein_id gnl|my_center|LOCUS_08390 931779 932528 gene locus_tag LOCUS_08400 931779 932528 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259482.1 protein_id gnl|my_center|LOCUS_08400 932599 933492 gene locus_tag LOCUS_08410 gene hslO 932599 933492 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 protein_id gnl|my_center|LOCUS_08410 933603 933678 gene locus_tag LOCUS_t00140 933603 933678 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 933696 933771 gene locus_tag LOCUS_t00150 933696 933771 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 933776 933851 gene locus_tag LOCUS_t00160 933776 933851 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 933859 933932 gene locus_tag LOCUS_t00170 933859 933932 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 934186 934662 gene locus_tag LOCUS_08420 934186 934662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 934703 934927 gene locus_tag LOCUS_08430 934703 934927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 935005 935877 gene locus_tag LOCUS_08440 935005 935877 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_08440 936314 938797 gene locus_tag LOCUS_08450 936314 938797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 938784 942389 gene locus_tag LOCUS_08460 938784 942389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 943935 942526 gene locus_tag LOCUS_08470 gene cysS 943935 942526 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_08470 944299 944826 gene locus_tag LOCUS_08480 944299 944826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 945597 945073 gene locus_tag LOCUS_08490 gene pgsA 945597 945073 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365382.1 protein_id gnl|my_center|LOCUS_08490 946929 945607 gene locus_tag LOCUS_08500 gene rimO 946929 945607 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_08500 947550 946933 gene locus_tag LOCUS_08510 947550 946933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 948656 947550 gene locus_tag LOCUS_08520 gene recA 948656 947550 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_08520 949530 948676 gene locus_tag LOCUS_08530 gene prmC 949530 948676 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_08530 950538 949561 gene locus_tag LOCUS_08540 950538 949561 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_08540 951638 950571 gene locus_tag LOCUS_08550 951638 950571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 952326 951643 gene locus_tag LOCUS_08560 952326 951643 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356531.1 protein_id gnl|my_center|LOCUS_08560 952508 953062 gene locus_tag LOCUS_08570 952508 953062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 953292 953379 gene locus_tag LOCUS_t00180 953292 953379 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 954719 953526 gene locus_tag LOCUS_08580 954719 953526 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_08580 955037 954819 gene locus_tag LOCUS_08590 955037 954819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 955572 955000 gene locus_tag LOCUS_08600 955572 955000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 955815 956024 gene locus_tag LOCUS_08610 955815 956024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 956624 956142 gene locus_tag LOCUS_08620 956624 956142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 957004 957315 gene locus_tag LOCUS_08630 957004 957315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 957322 964005 gene locus_tag LOCUS_08640 957322 964005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 964021 964698 gene locus_tag LOCUS_08650 964021 964698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 964779 967007 gene locus_tag LOCUS_08660 964779 967007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 967022 967576 gene locus_tag LOCUS_08670 967022 967576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 967656 968447 gene locus_tag LOCUS_08680 967656 968447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 970621 969134 gene locus_tag LOCUS_08690 970621 969134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 971375 970614 gene locus_tag LOCUS_08700 gene srtB 971375 970614 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989918.1 protein_id gnl|my_center|LOCUS_08700 973733 971388 gene locus_tag LOCUS_08710 973733 971388 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_08710 974074 973730 gene locus_tag LOCUS_08720 974074 973730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 974923 974087 gene locus_tag LOCUS_08730 974923 974087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 975479 974913 gene locus_tag LOCUS_08740 975479 974913 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103677717.1 protein_id gnl|my_center|LOCUS_08740 975757 975542 gene locus_tag LOCUS_08750 975757 975542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 976115 975771 gene locus_tag LOCUS_08760 976115 975771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 977920 976139 gene locus_tag LOCUS_08770 977920 976139 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010247013.1 protein_id gnl|my_center|LOCUS_08770 978098 977904 gene locus_tag LOCUS_08780 978098 977904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 978988 978101 gene locus_tag LOCUS_08790 978988 978101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 979795 978992 gene locus_tag LOCUS_08800 979795 978992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 981200 979779 gene locus_tag LOCUS_08810 981200 979779 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_08810 981535 981206 gene locus_tag LOCUS_08820 981535 981206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 981843 981532 gene locus_tag LOCUS_08830 981843 981532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 981980 982402 gene locus_tag LOCUS_08840 981980 982402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 982565 983146 gene locus_tag LOCUS_08850 982565 983146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 983669 984637 gene locus_tag LOCUS_08860 gene bsh 983669 984637 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723950.1 protein_id gnl|my_center|LOCUS_08860 984761 985216 gene locus_tag LOCUS_08870 984761 985216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 987278 985272 gene locus_tag LOCUS_08880 987278 985272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 987569 988120 gene locus_tag LOCUS_08890 987569 988120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 988464 988222 gene locus_tag LOCUS_08900 988464 988222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 990649 988502 gene locus_tag LOCUS_08910 990649 988502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 991806 990727 gene locus_tag LOCUS_08920 991806 990727 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886647.1 protein_id gnl|my_center|LOCUS_08920 991956 992861 gene locus_tag LOCUS_08930 991956 992861 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_08930 992979 995543 gene locus_tag LOCUS_08940 992979 995543 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_08940 995549 996289 gene locus_tag LOCUS_08950 995549 996289 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_08950 997897 996398 gene locus_tag LOCUS_08960 997897 996398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 998767 998204 gene locus_tag LOCUS_08970 998767 998204 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_08970 999089 998901 gene locus_tag LOCUS_08980 999089 998901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 999394 999113 gene locus_tag LOCUS_08990 999394 999113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 999760 1000965 gene locus_tag LOCUS_09000 999760 1000965 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986695.1 protein_id gnl|my_center|LOCUS_09000 1000966 1002714 gene locus_tag LOCUS_09010 1000966 1002714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1002779 1003573 gene locus_tag LOCUS_09020 1002779 1003573 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_09020 1003586 1003741 gene locus_tag LOCUS_09030 1003586 1003741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1004215 1004048 gene locus_tag LOCUS_09040 1004215 1004048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1004672 1004229 gene locus_tag LOCUS_09050 gene spoVAC 1004672 1004229 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_09050 1004611 1004862 gene locus_tag LOCUS_09060 1004611 1004862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1005404 1004949 gene locus_tag LOCUS_09070 1005404 1004949 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548951.1 protein_id gnl|my_center|LOCUS_09070 1005808 1005401 gene locus_tag LOCUS_09080 1005808 1005401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1006000 1006422 gene locus_tag LOCUS_09090 1006000 1006422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1006449 1008146 gene locus_tag LOCUS_09100 gene argS 1006449 1008146 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_09100 1008970 1008455 gene locus_tag LOCUS_09110 1008970 1008455 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 protein_id gnl|my_center|LOCUS_09110 1009554 1008976 gene locus_tag LOCUS_09120 1009554 1008976 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963791.1 protein_id gnl|my_center|LOCUS_09120 1009900 1010145 gene locus_tag LOCUS_09130 1009900 1010145 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966909.1 protein_id gnl|my_center|LOCUS_09130 1011038 1010208 gene locus_tag LOCUS_09140 gene rsmI 1011038 1010208 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530019.1 protein_id gnl|my_center|LOCUS_09140 1011772 1011041 gene locus_tag LOCUS_09150 1011772 1011041 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_09150 1012037 1011867 gene locus_tag LOCUS_09160 1012037 1011867 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_09160 1012267 1014744 gene locus_tag LOCUS_09170 1012267 1014744 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391709.1 protein_id gnl|my_center|LOCUS_09170 1014787 1015239 gene locus_tag LOCUS_09180 1014787 1015239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1016282 1015293 gene locus_tag LOCUS_09190 gene spoIID 1016282 1015293 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_09190 1016390 1017196 gene locus_tag LOCUS_09200 1016390 1017196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1017275 1018027 gene locus_tag LOCUS_09210 1017275 1018027 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680854.1 protein_id gnl|my_center|LOCUS_09210 1018040 1018735 gene locus_tag LOCUS_09220 1018040 1018735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_09220 1018732 1020165 gene locus_tag LOCUS_09230 1018732 1020165 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_09230 1021944 1020280 gene locus_tag LOCUS_09240 1021944 1020280 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965042.1 protein_id gnl|my_center|LOCUS_09240 1022379 1022026 gene locus_tag LOCUS_09250 1022379 1022026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1022665 1026201 gene locus_tag LOCUS_09260 gene nifJ 1022665 1026201 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_09260 1026377 1027255 gene locus_tag LOCUS_09270 1026377 1027255 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_09270 1027362 1027658 gene locus_tag LOCUS_09280 gene rpsF 1027362 1027658 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_09280 1027671 1028141 gene locus_tag LOCUS_09290 gene ssb 1027671 1028141 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934759.1 protein_id gnl|my_center|LOCUS_09290 1028166 1028405 gene locus_tag LOCUS_09300 gene rpsR 1028166 1028405 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420527.1 protein_id gnl|my_center|LOCUS_09300 1029383 1028478 gene locus_tag LOCUS_09310 1029383 1028478 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948703.1 protein_id gnl|my_center|LOCUS_09310 1029687 1029875 gene locus_tag LOCUS_09320 1029687 1029875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1030324 1034883 gene locus_tag LOCUS_09330 1030324 1034883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1035691 1035104 gene locus_tag LOCUS_09340 1035691 1035104 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 protein_id gnl|my_center|LOCUS_09340 1036244 1035684 gene locus_tag LOCUS_09350 1036244 1035684 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_09350 1037062 1036274 gene locus_tag LOCUS_09360 1037062 1036274 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_09360 1037916 1037059 gene locus_tag LOCUS_09370 1037916 1037059 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_09370 1038725 1037901 gene locus_tag LOCUS_09380 1038725 1037901 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_09380 1038911 1039615 gene locus_tag LOCUS_09390 1038911 1039615 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965031.1 protein_id gnl|my_center|LOCUS_09390 1039698 1040369 gene locus_tag LOCUS_09400 1039698 1040369 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_09400 1040381 1041364 gene locus_tag LOCUS_09410 1040381 1041364 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_09410 1041472 1042239 gene locus_tag LOCUS_09420 1041472 1042239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_09420 1042232 1044253 gene locus_tag LOCUS_09430 1042232 1044253 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_09430 1045922 1044309 gene locus_tag LOCUS_09440 1045922 1044309 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_09440 1046214 1047410 gene locus_tag LOCUS_09450 1046214 1047410 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879449.1 protein_id gnl|my_center|LOCUS_09450 1047410 1048948 gene locus_tag LOCUS_09460 1047410 1048948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1048965 1049126 gene locus_tag LOCUS_09470 1048965 1049126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1049126 1049833 gene locus_tag LOCUS_09480 1049126 1049833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1050491 1049910 gene locus_tag LOCUS_09490 1050491 1049910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1050650 1052191 gene locus_tag LOCUS_09500 1050650 1052191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1052188 1053168 gene locus_tag LOCUS_09510 1052188 1053168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1054340 1053222 gene locus_tag LOCUS_09520 1054340 1053222 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_09520 1054956 1054444 gene locus_tag LOCUS_09530 1054956 1054444 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356248.1 protein_id gnl|my_center|LOCUS_09530 1056420 1054960 gene locus_tag LOCUS_09540 1056420 1054960 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949007.1 protein_id gnl|my_center|LOCUS_09540 1056618 1057448 gene locus_tag LOCUS_09550 1056618 1057448 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_09550 1057448 1058386 gene locus_tag LOCUS_09560 1057448 1058386 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_09560 1058444 1059520 gene locus_tag LOCUS_09570 1058444 1059520 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906249.1 protein_id gnl|my_center|LOCUS_09570 1060626 1059565 gene locus_tag LOCUS_09580 1060626 1059565 CDS product endonuclease subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387048.1 protein_id gnl|my_center|LOCUS_09580 1061186 1060710 gene locus_tag LOCUS_09590 1061186 1060710 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890655.1 protein_id gnl|my_center|LOCUS_09590 1061305 1062552 gene locus_tag LOCUS_09600 1061305 1062552 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_09600 1063132 1062602 gene locus_tag LOCUS_09610 1063132 1062602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1063373 1063900 gene locus_tag LOCUS_09620 1063373 1063900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1064039 1064452 gene locus_tag LOCUS_09630 gene fur 1064039 1064452 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131709.1 protein_id gnl|my_center|LOCUS_09630 1064445 1065395 gene locus_tag LOCUS_09640 1064445 1065395 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_09640 1065398 1066105 gene locus_tag LOCUS_09650 1065398 1066105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943614.1 protein_id gnl|my_center|LOCUS_09650 1066102 1066926 gene locus_tag LOCUS_09660 1066102 1066926 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_09660 1067698 1066973 gene locus_tag LOCUS_09670 gene sigE 1067698 1066973 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399432.1 protein_id gnl|my_center|LOCUS_09670 1068548 1067712 gene locus_tag LOCUS_09680 1068548 1067712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1068753 1070228 gene locus_tag LOCUS_09690 1068753 1070228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1070225 1070782 gene locus_tag LOCUS_09700 1070225 1070782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1070775 1071275 gene locus_tag LOCUS_09710 1070775 1071275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1071272 1072162 gene locus_tag LOCUS_09720 1071272 1072162 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_09720 1072135 1073745 gene locus_tag LOCUS_09730 1072135 1073745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1073730 1074431 gene locus_tag LOCUS_09740 1073730 1074431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1075355 1074477 gene locus_tag LOCUS_09750 1075355 1074477 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941867.1 protein_id gnl|my_center|LOCUS_09750 1077064 1075373 gene locus_tag LOCUS_09760 1077064 1075373 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 protein_id gnl|my_center|LOCUS_09760 1077966 1077061 gene locus_tag LOCUS_09770 1077966 1077061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1078183 1078953 gene locus_tag LOCUS_09780 1078183 1078953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1079589 1079002 gene locus_tag LOCUS_09790 1079589 1079002 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_09790 1080982 1079618 gene locus_tag LOCUS_09800 1080982 1079618 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_09800 1082016 1081168 gene locus_tag LOCUS_09810 1082016 1081168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1082912 1082127 gene locus_tag LOCUS_09820 1082912 1082127 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_09820 1084717 1083044 gene locus_tag LOCUS_09830 1084717 1083044 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_09830 1084833 1085789 gene locus_tag LOCUS_09840 1084833 1085789 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_09840 1086582 1085839 gene locus_tag LOCUS_09850 1086582 1085839 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622462.1 protein_id gnl|my_center|LOCUS_09850 1087163 1086603 gene locus_tag LOCUS_09860 1087163 1086603 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390032.1 protein_id gnl|my_center|LOCUS_09860 1087905 1087174 gene locus_tag LOCUS_09870 1087905 1087174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1089773 1087902 gene locus_tag LOCUS_09880 gene abc-f 1089773 1087902 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195117.1 protein_id gnl|my_center|LOCUS_09880 1091092 1089788 gene locus_tag LOCUS_09890 1091092 1089788 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392428.1 protein_id gnl|my_center|LOCUS_09890 1092783 1091089 gene locus_tag LOCUS_09900 1092783 1091089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1092917 1093267 gene locus_tag LOCUS_09910 1092917 1093267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1093264 1093776 gene locus_tag LOCUS_09920 1093264 1093776 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_09920 1094108 1095613 gene locus_tag LOCUS_09930 1094108 1095613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1095613 1096173 gene locus_tag LOCUS_09940 1095613 1096173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1096310 1097101 gene locus_tag LOCUS_09950 1096310 1097101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1097419 1098804 gene locus_tag LOCUS_09960 gene fumC 1097419 1098804 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 protein_id gnl|my_center|LOCUS_09960 1098807 1099982 gene locus_tag LOCUS_09970 1098807 1099982 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_09970 1100016 1102394 gene locus_tag LOCUS_09980 1100016 1102394 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_09980 1102516 1102779 gene locus_tag LOCUS_09990 1102516 1102779 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_09990 1102872 1104704 gene locus_tag LOCUS_10000 gene uvrC 1102872 1104704 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_10000 1104695 1105237 gene locus_tag LOCUS_10010 gene rsmD 1104695 1105237 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_10010 1105234 1105725 gene locus_tag LOCUS_10020 gene coaD 1105234 1105725 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_10020 1105786 1106331 gene locus_tag LOCUS_10030 1105786 1106331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1106701 1107117 gene locus_tag LOCUS_10040 gene mraZ 1106701 1107117 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_10040 1107117 1108049 gene locus_tag LOCUS_10050 gene rsmH 1107117 1108049 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_10050 1108064 1108606 gene locus_tag LOCUS_10060 1108064 1108606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1108654 1111008 gene locus_tag LOCUS_10070 1108654 1111008 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_10070 1111029 1112486 gene locus_tag LOCUS_10080 1111029 1112486 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_10080 1112483 1113499 gene locus_tag LOCUS_10090 gene mraY 1112483 1113499 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965426.1 protein_id gnl|my_center|LOCUS_10090 1113531 1114691 gene locus_tag LOCUS_10100 gene spoVE 1113531 1114691 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_10100 1114782 1115918 gene locus_tag LOCUS_10110 gene murG 1114782 1115918 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_10110 1115975 1117234 gene locus_tag LOCUS_10120 gene murA 1115975 1117234 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_10120 1117251 1118030 gene locus_tag LOCUS_10130 1117251 1118030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1118075 1119358 gene locus_tag LOCUS_10140 1118075 1119358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1119434 1120258 gene locus_tag LOCUS_10150 1119434 1120258 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_10150 1120442 1121023 gene locus_tag LOCUS_10160 1120442 1121023 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532679.1 protein_id gnl|my_center|LOCUS_10160 1121013 1122386 gene locus_tag LOCUS_10170 1121013 1122386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1122851 1122483 gene locus_tag LOCUS_10180 1122851 1122483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1123610 1122918 gene locus_tag LOCUS_10190 gene sigK 1123610 1122918 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_10190 1123863 1124072 gene locus_tag LOCUS_10200 1123863 1124072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1124245 1124538 gene locus_tag LOCUS_10210 1124245 1124538 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986587.1 protein_id gnl|my_center|LOCUS_10210 1124535 1125284 gene locus_tag LOCUS_10220 1124535 1125284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263300.1 protein_id gnl|my_center|LOCUS_10220 1125262 1125912 gene locus_tag LOCUS_10230 1125262 1125912 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890774.1 protein_id gnl|my_center|LOCUS_10230 1126003 1126764 gene locus_tag LOCUS_10240 1126003 1126764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1126914 1127369 gene locus_tag LOCUS_10250 gene rimP 1126914 1127369 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_10250 1127387 1128439 gene locus_tag LOCUS_10260 gene nusA 1127387 1128439 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_10260 1128461 1128733 gene locus_tag LOCUS_10270 1128461 1128733 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392562.1 protein_id gnl|my_center|LOCUS_10270 1128690 1129142 gene locus_tag LOCUS_10280 1128690 1129142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1129139 1131478 gene locus_tag LOCUS_10290 1129139 1131478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1131491 1131853 gene locus_tag LOCUS_10300 gene rbfA 1131491 1131853 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965109.1 protein_id gnl|my_center|LOCUS_10300 1131857 1132795 gene locus_tag LOCUS_10310 1131857 1132795 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_10310 1132792 1133661 gene locus_tag LOCUS_10320 gene truB 1132792 1133661 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089690.1 protein_id gnl|my_center|LOCUS_10320 1133665 1134576 gene locus_tag LOCUS_10330 gene ribF 1133665 1134576 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073366.1 protein_id gnl|my_center|LOCUS_10330 1135629 1134637 gene locus_tag LOCUS_10340 1135629 1134637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1135796 1136836 gene locus_tag LOCUS_10350 1135796 1136836 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_10350 1136841 1138199 gene locus_tag LOCUS_10360 1136841 1138199 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_10360 1138637 1138834 gene locus_tag LOCUS_10370 1138637 1138834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1139031 1139549 gene locus_tag LOCUS_10380 1139031 1139549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1139860 1139594 gene locus_tag LOCUS_10390 1139860 1139594 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391580.1 protein_id gnl|my_center|LOCUS_10390 1140087 1139872 gene locus_tag LOCUS_10400 1140087 1139872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1140549 1142534 gene locus_tag LOCUS_10410 gene gyrB 1140549 1142534 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_10410 1142565 1144799 gene locus_tag LOCUS_10420 gene gyrA 1142565 1144799 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_10420 1144812 1145675 gene locus_tag LOCUS_10430 1144812 1145675 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_10430 1145688 1146797 gene locus_tag LOCUS_10440 1145688 1146797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1146877 1146952 gene locus_tag LOCUS_t00190 1146877 1146952 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1147079 1148476 gene locus_tag LOCUS_10450 1147079 1148476 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_10450 1148597 1149832 gene locus_tag LOCUS_10460 1148597 1149832 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890744.1 protein_id gnl|my_center|LOCUS_10460 1150553 1149891 gene locus_tag LOCUS_10470 1150553 1149891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1150856 1152097 gene locus_tag LOCUS_10480 1150856 1152097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1152213 1154174 gene locus_tag LOCUS_10490 gene uvrB 1152213 1154174 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_10490 1154195 1156756 gene locus_tag LOCUS_10500 gene polA 1154195 1156756 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459637.1 protein_id gnl|my_center|LOCUS_10500 1156756 1157214 gene locus_tag LOCUS_10510 gene rimI 1156756 1157214 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_10510 1157211 1158239 gene locus_tag LOCUS_10520 gene tsaD 1157211 1158239 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_10520 1158226 1158897 gene locus_tag LOCUS_10530 gene radC 1158226 1158897 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016743.1 protein_id gnl|my_center|LOCUS_10530 1159394 1159469 gene locus_tag LOCUS_t00200 1159394 1159469 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1159633 1160619 gene locus_tag LOCUS_10540 1159633 1160619 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_10540 1160825 1161418 gene locus_tag LOCUS_10550 1160825 1161418 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_10550 1161415 1161840 gene locus_tag LOCUS_10560 1161415 1161840 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_10560 1162107 1162874 gene locus_tag LOCUS_10570 1162107 1162874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1164033 1162930 gene locus_tag LOCUS_10580 1164033 1162930 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870487.1 protein_id gnl|my_center|LOCUS_10580 1164589 1164071 gene locus_tag LOCUS_10590 1164589 1164071 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_10590 1166666 1164609 gene locus_tag LOCUS_10600 gene recG 1166666 1164609 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_10600 1167199 1166663 gene locus_tag LOCUS_10610 1167199 1166663 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657895.1 protein_id gnl|my_center|LOCUS_10610 1168245 1167199 gene locus_tag LOCUS_10620 1168245 1167199 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_10620 1167492 1167586 gene locus_tag LOCUS_t00210 1167492 1167586 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1168370 1168446 gene locus_tag LOCUS_t00220 1168370 1168446 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1170372 1168558 gene locus_tag LOCUS_10630 1170372 1168558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1171773 1170421 gene locus_tag LOCUS_10640 gene caiB 1171773 1170421 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345588.1 protein_id gnl|my_center|LOCUS_10640 1172622 1171807 gene locus_tag LOCUS_10650 1172622 1171807 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459737.1 protein_id gnl|my_center|LOCUS_10650 1172830 1173714 gene locus_tag LOCUS_10660 1172830 1173714 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808876.1 protein_id gnl|my_center|LOCUS_10660 1174663 1173767 gene locus_tag LOCUS_10670 gene rfbD 1174663 1173767 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664667.1 protein_id gnl|my_center|LOCUS_10670 1175242 1174691 gene locus_tag LOCUS_10680 gene rfbC 1175242 1174691 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_10680 1176315 1175239 gene locus_tag LOCUS_10690 1176315 1175239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1177297 1176296 gene locus_tag LOCUS_10700 1177297 1176296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1178379 1177276 gene locus_tag LOCUS_10710 1178379 1177276 CDS product NAD/NADP octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974667.1 protein_id gnl|my_center|LOCUS_10710 1179263 1178376 gene locus_tag LOCUS_10720 1179263 1178376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1180209 1179289 gene locus_tag LOCUS_10730 1180209 1179289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1181075 1180206 gene locus_tag LOCUS_10740 1181075 1180206 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_10740 1181920 1181072 gene locus_tag LOCUS_10750 1181920 1181072 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776623.1 protein_id gnl|my_center|LOCUS_10750 1183531 1181942 gene locus_tag LOCUS_10760 gene putP 1183531 1181942 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211164.1 protein_id gnl|my_center|LOCUS_10760 1184708 1183653 gene locus_tag LOCUS_10770 1184708 1183653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1185383 1184829 gene locus_tag LOCUS_10780 1185383 1184829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1185885 1185391 gene locus_tag LOCUS_10790 1185885 1185391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1187014 1185947 gene locus_tag LOCUS_10800 1187014 1185947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1187642 1187109 gene locus_tag LOCUS_10810 1187642 1187109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1189611 1187686 gene locus_tag LOCUS_10820 1189611 1187686 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_10820 1190225 1192216 gene locus_tag LOCUS_10830 1190225 1192216 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004800524.1 protein_id gnl|my_center|LOCUS_10830 1192476 1193720 gene locus_tag LOCUS_10840 1192476 1193720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1193713 1194300 gene locus_tag LOCUS_10850 1193713 1194300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1194578 1195345 gene locus_tag LOCUS_10860 gene fabG 1194578 1195345 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_10860 1195429 1196949 gene locus_tag LOCUS_10870 1195429 1196949 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079233.1 protein_id gnl|my_center|LOCUS_10870 1197015 1198436 gene locus_tag LOCUS_10880 1197015 1198436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1198498 1199856 gene locus_tag LOCUS_10890 gene caiB 1198498 1199856 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345588.1 protein_id gnl|my_center|LOCUS_10890 1199972 1201339 gene locus_tag LOCUS_10900 gene caiB 1199972 1201339 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345588.1 protein_id gnl|my_center|LOCUS_10900 1201412 1202197 gene locus_tag LOCUS_10910 1201412 1202197 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084940.1 protein_id gnl|my_center|LOCUS_10910 1202273 1203031 gene locus_tag LOCUS_10920 1202273 1203031 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860631.1 protein_id gnl|my_center|LOCUS_10920 1204394 1203204 gene locus_tag LOCUS_10930 1204394 1203204 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543120.1 protein_id gnl|my_center|LOCUS_10930 1205932 1204391 gene locus_tag LOCUS_10940 1205932 1204391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1206079 1206792 gene locus_tag LOCUS_10950 1206079 1206792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1206899 1207618 gene locus_tag LOCUS_10960 gene pyrH 1206899 1207618 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042663.1 protein_id gnl|my_center|LOCUS_10960 1207654 1208208 gene locus_tag LOCUS_10970 gene frr 1207654 1208208 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293875.1 protein_id gnl|my_center|LOCUS_10970 1208308 1209042 gene locus_tag LOCUS_10980 1208308 1209042 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081614.1 protein_id gnl|my_center|LOCUS_10980 1209083 1209913 gene locus_tag LOCUS_10990 1209083 1209913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1209926 1211074 gene locus_tag LOCUS_11000 1209926 1211074 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460412.1 protein_id gnl|my_center|LOCUS_11000 1211087 1212133 gene locus_tag LOCUS_11010 gene rseP 1211087 1212133 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_11010 1212196 1213254 gene locus_tag LOCUS_11020 gene ispG 1212196 1213254 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_11020 1213262 1217227 gene locus_tag LOCUS_11030 1213262 1217227 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_11030 1217333 1220218 gene locus_tag LOCUS_11040 1217333 1220218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1220238 1220849 gene locus_tag LOCUS_11050 1220238 1220849 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_11050 1221254 1220889 gene locus_tag LOCUS_11060 1221254 1220889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1221537 1222325 gene locus_tag LOCUS_11070 1221537 1222325 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071302.1 protein_id gnl|my_center|LOCUS_11070 1222401 1223177 gene locus_tag LOCUS_11080 1222401 1223177 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_11080 1223164 1223886 gene locus_tag LOCUS_11090 1223164 1223886 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101161.1 protein_id gnl|my_center|LOCUS_11090 1223946 1224767 gene locus_tag LOCUS_11100 gene rlmA 1223946 1224767 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072721.1 protein_id gnl|my_center|LOCUS_11100 1224938 1225372 gene locus_tag LOCUS_11110 1224938 1225372 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245055.1 protein_id gnl|my_center|LOCUS_11110 1225540 1226418 gene locus_tag LOCUS_11120 1225540 1226418 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861195.1 protein_id gnl|my_center|LOCUS_11120 1226589 1227668 gene locus_tag LOCUS_11130 1226589 1227668 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_11130 1227772 1228572 gene locus_tag LOCUS_11140 gene cbiQ 1227772 1228572 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_11140 1228585 1229325 gene locus_tag LOCUS_11150 1228585 1229325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_11150 1229394 1230317 gene locus_tag LOCUS_11160 1229394 1230317 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016040.1 protein_id gnl|my_center|LOCUS_11160 1231865 1230648 gene locus_tag LOCUS_11170 1231865 1230648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1233389 1231887 gene locus_tag LOCUS_11180 1233389 1231887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1233462 1233998 gene locus_tag LOCUS_11190 1233462 1233998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1234004 1235725 gene locus_tag LOCUS_11200 1234004 1235725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1236156 1237937 gene locus_tag LOCUS_11210 1236156 1237937 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384371.1 protein_id gnl|my_center|LOCUS_11210 1237974 1239287 gene locus_tag LOCUS_11220 1237974 1239287 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966105.1 protein_id gnl|my_center|LOCUS_11220 1239489 1239401 gene locus_tag LOCUS_t00230 1239489 1239401 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1240788 1239559 gene locus_tag LOCUS_11230 1240788 1239559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1241042 1244782 gene locus_tag LOCUS_11240 gene rpoB 1241042 1244782 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_11240 1244786 1248508 gene locus_tag LOCUS_11250 gene rpoC 1244786 1248508 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788197.1 protein_id gnl|my_center|LOCUS_11250 1248780 1249202 gene locus_tag LOCUS_11260 gene rpsL 1248780 1249202 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142340.1 protein_id gnl|my_center|LOCUS_11260 1249332 1249802 gene locus_tag LOCUS_11270 gene rpsG 1249332 1249802 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_11270 1249827 1251899 gene locus_tag LOCUS_11280 gene fusA 1249827 1251899 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_11280 1251974 1253212 gene locus_tag LOCUS_11290 gene tuf 1251974 1253212 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_11290 1253466 1254860 gene locus_tag LOCUS_11300 1253466 1254860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1255382 1254936 gene locus_tag LOCUS_11310 1255382 1254936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1255465 1256178 gene locus_tag LOCUS_11320 1255465 1256178 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546764.1 protein_id gnl|my_center|LOCUS_11320 1256351 1257445 gene locus_tag LOCUS_11330 1256351 1257445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1257491 1258183 gene locus_tag LOCUS_11340 gene ftsE 1257491 1258183 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_11340 1258143 1259054 gene locus_tag LOCUS_11350 gene ftsX 1258143 1259054 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963820.1 protein_id gnl|my_center|LOCUS_11350 1259067 1260290 gene locus_tag LOCUS_11360 1259067 1260290 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_11360 1260404 1261609 gene locus_tag LOCUS_11370 1260404 1261609 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_11370 1261656 1262141 gene locus_tag LOCUS_11380 gene greA 1261656 1262141 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_11380 1262152 1264107 gene locus_tag LOCUS_11390 gene lysS 1262152 1264107 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_11390 1265187 1264183 gene locus_tag LOCUS_11400 gene plcA 1265187 1264183 CDS product phosphatidylinositol diacylglycerol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095605.1 protein_id gnl|my_center|LOCUS_11400 1265574 1266920 gene locus_tag LOCUS_11410 1265574 1266920 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490912.1 protein_id gnl|my_center|LOCUS_11410 1268260 1266986 gene locus_tag LOCUS_11420 1268260 1266986 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262728.1 protein_id gnl|my_center|LOCUS_11420 1269717 1268284 gene locus_tag LOCUS_11430 gene purB 1269717 1268284 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_11430 1271327 1269720 gene locus_tag LOCUS_11440 1271327 1269720 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723607.1 protein_id gnl|my_center|LOCUS_11440 1271927 1271340 gene locus_tag LOCUS_11450 1271927 1271340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1272347 1274440 gene locus_tag LOCUS_11460 1272347 1274440 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_11460 1274768 1276348 gene locus_tag LOCUS_11470 gene asnB 1274768 1276348 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_11470 1276356 1276964 gene locus_tag LOCUS_11480 1276356 1276964 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_11480 1277918 1277007 gene locus_tag LOCUS_11490 1277918 1277007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1280933 1277991 gene locus_tag LOCUS_11500 1280933 1277991 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054447.1 protein_id gnl|my_center|LOCUS_11500 1281197 1282552 gene locus_tag LOCUS_11510 gene trkA 1281197 1282552 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_11510 1283262 1282612 gene locus_tag LOCUS_11520 1283262 1282612 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_11520 1283379 1285805 gene locus_tag LOCUS_11530 gene pcrA 1283379 1285805 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_11530 1285811 1286704 gene locus_tag LOCUS_11540 1285811 1286704 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920615.1 protein_id gnl|my_center|LOCUS_11540 1287383 1286736 gene locus_tag LOCUS_11550 1287383 1286736 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_11550 1287528 1287619 gene locus_tag LOCUS_t00240 1287528 1287619 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1288794 1287754 gene locus_tag LOCUS_11560 1288794 1287754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1289419 1288982 gene locus_tag LOCUS_11570 1289419 1288982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1289785 1289429 gene locus_tag LOCUS_11580 1289785 1289429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1289984 1290175 gene locus_tag LOCUS_11590 1289984 1290175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1290700 1290320 gene locus_tag LOCUS_11600 1290700 1290320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1290850 1290990 gene locus_tag LOCUS_11610 1290850 1290990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1291046 1291192 gene locus_tag LOCUS_11620 1291046 1291192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1291192 1291545 gene locus_tag LOCUS_11630 1291192 1291545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1291699 1291917 gene locus_tag LOCUS_11640 1291699 1291917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1291934 1292191 gene locus_tag LOCUS_11650 1291934 1292191 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963633.1 protein_id gnl|my_center|LOCUS_11650 1292191 1292346 gene locus_tag LOCUS_11660 1292191 1292346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1292346 1292624 gene locus_tag LOCUS_11670 1292346 1292624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1292639 1292812 gene locus_tag LOCUS_11680 1292639 1292812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1292833 1293252 gene locus_tag LOCUS_11690 1292833 1293252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1293283 1293633 gene locus_tag LOCUS_11700 1293283 1293633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1293637 1295259 gene locus_tag LOCUS_11710 1293637 1295259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1295256 1296263 gene locus_tag LOCUS_11720 1295256 1296263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1296256 1296549 gene locus_tag LOCUS_11730 1296256 1296549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1296689 1296817 gene locus_tag LOCUS_11740 1296689 1296817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1297004 1297219 gene locus_tag LOCUS_11750 1297004 1297219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1297216 1297368 gene locus_tag LOCUS_11760 1297216 1297368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1297696 1298244 gene locus_tag LOCUS_11770 1297696 1298244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1298196 1298537 gene locus_tag LOCUS_11780 1298196 1298537 CDS product DUF4406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047617.1 protein_id gnl|my_center|LOCUS_11780 1298534 1299088 gene locus_tag LOCUS_11790 1298534 1299088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1299069 1299254 gene locus_tag LOCUS_11800 1299069 1299254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1300320 1299310 gene locus_tag LOCUS_11810 1300320 1299310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1300975 1300334 gene locus_tag LOCUS_11820 1300975 1300334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1301697 1300972 gene locus_tag LOCUS_11830 1301697 1300972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1302029 1301754 gene locus_tag LOCUS_11840 1302029 1301754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1302410 1303168 gene locus_tag LOCUS_11850 1302410 1303168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1303165 1303434 gene locus_tag LOCUS_11860 1303165 1303434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1303424 1303930 gene locus_tag LOCUS_11870 1303424 1303930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1303931 1305574 gene locus_tag LOCUS_11880 1303931 1305574 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143988.1 protein_id gnl|my_center|LOCUS_11880 1305571 1305771 gene locus_tag LOCUS_11890 1305571 1305771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1305746 1306561 gene locus_tag LOCUS_11900 1305746 1306561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1306576 1307226 gene locus_tag LOCUS_11910 1306576 1307226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1307239 1308180 gene locus_tag LOCUS_11920 1307239 1308180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1308333 1308899 gene locus_tag LOCUS_11930 1308333 1308899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1308903 1310774 gene locus_tag LOCUS_11940 1308903 1310774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1310784 1312616 gene locus_tag LOCUS_11950 1310784 1312616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1312737 1313756 gene locus_tag LOCUS_11960 1312737 1313756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1313771 1314100 gene locus_tag LOCUS_11970 1313771 1314100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1314097 1315266 gene locus_tag LOCUS_11980 1314097 1315266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1315268 1317253 gene locus_tag LOCUS_11990 1315268 1317253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1317339 1318187 gene locus_tag LOCUS_12000 1317339 1318187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1318201 1318659 gene locus_tag LOCUS_12010 1318201 1318659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1318709 1320112 gene locus_tag LOCUS_12020 1318709 1320112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1320124 1326486 gene locus_tag LOCUS_12030 1320124 1326486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1326699 1326787 gene locus_tag LOCUS_t00250 1326699 1326787 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1327058 1326867 gene locus_tag LOCUS_12040 1327058 1326867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1327332 1328537 gene locus_tag LOCUS_12050 1327332 1328537 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939637.1 protein_id gnl|my_center|LOCUS_12050 1329250 1328591 gene locus_tag LOCUS_12060 1329250 1328591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1329935 1329273 gene locus_tag LOCUS_12070 1329935 1329273 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_12070 1330057 1330770 gene locus_tag LOCUS_12080 1330057 1330770 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_12080 1330896 1330969 gene locus_tag LOCUS_t00260 1330896 1330969 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1331518 1331276 gene locus_tag LOCUS_12090 1331518 1331276 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385813.1 protein_id gnl|my_center|LOCUS_12090 1334031 1331650 gene locus_tag LOCUS_12100 gene pheT 1334031 1331650 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_12100 1335073 1334048 gene locus_tag LOCUS_12110 gene pheS 1335073 1334048 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_12110 1335499 1336347 gene locus_tag LOCUS_12120 1335499 1336347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1336356 1336958 gene locus_tag LOCUS_12130 1336356 1336958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1336915 1338030 gene locus_tag LOCUS_12140 gene alr 1336915 1338030 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_12140 1338113 1338463 gene locus_tag LOCUS_12150 1338113 1338463 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_12150 1338494 1338976 gene locus_tag LOCUS_12160 1338494 1338976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1339032 1339526 gene locus_tag LOCUS_12170 1339032 1339526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1339592 1340896 gene locus_tag LOCUS_12180 1339592 1340896 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243952.1 protein_id gnl|my_center|LOCUS_12180 1341765 1340947 gene locus_tag LOCUS_12190 1341765 1340947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1343874 1341829 gene locus_tag LOCUS_12200 gene fusA 1343874 1341829 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_12200 1346437 1344002 gene locus_tag LOCUS_12210 1346437 1344002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1347241 1346477 gene locus_tag LOCUS_12220 gene rlmB 1347241 1346477 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_12220 1347398 1348246 gene locus_tag LOCUS_12230 1347398 1348246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1348252 1349067 gene locus_tag LOCUS_12240 1348252 1349067 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015798.1 protein_id gnl|my_center|LOCUS_12240 1349183 1349422 gene locus_tag LOCUS_12250 1349183 1349422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1349762 1352815 gene locus_tag LOCUS_12260 1349762 1352815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1352922 1360229 gene locus_tag LOCUS_12270 1352922 1360229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1360733 1361974 gene locus_tag LOCUS_12280 1360733 1361974 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454238.1 protein_id gnl|my_center|LOCUS_12280 1362165 1362593 gene locus_tag LOCUS_12290 1362165 1362593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1363238 1362729 gene locus_tag LOCUS_12300 1363238 1362729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1363276 1364085 gene locus_tag LOCUS_12310 1363276 1364085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1364184 1364101 gene locus_tag LOCUS_t00270 1364184 1364101 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1364434 1365324 gene locus_tag LOCUS_12320 1364434 1365324 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_12320 1366564 1365374 gene locus_tag LOCUS_12330 1366564 1365374 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358889.1 protein_id gnl|my_center|LOCUS_12330 1368135 1366774 gene locus_tag LOCUS_12340 1368135 1366774 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_12340 1368716 1368171 gene locus_tag LOCUS_12350 gene pyrR 1368716 1368171 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460661.1 protein_id gnl|my_center|LOCUS_12350 1370625 1368964 gene locus_tag LOCUS_12360 gene glnS 1370625 1368964 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287115.1 protein_id gnl|my_center|LOCUS_12360 1370765 1371571 gene locus_tag LOCUS_12370 1370765 1371571 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816742.1 protein_id gnl|my_center|LOCUS_12370 1371868 1374492 gene locus_tag LOCUS_12380 1371868 1374492 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_12380 1374598 1374933 gene locus_tag LOCUS_12390 gene spoIIAA 1374598 1374933 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059133.1 protein_id gnl|my_center|LOCUS_12390 1374927 1375361 gene locus_tag LOCUS_12400 gene spoIIAB 1374927 1375361 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_12400 1375358 1376071 gene locus_tag LOCUS_12410 gene sigF 1375358 1376071 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_12410 1376188 1376991 gene locus_tag LOCUS_12420 1376188 1376991 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388064.1 protein_id gnl|my_center|LOCUS_12420 1377205 1377933 gene locus_tag LOCUS_12430 1377205 1377933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_12430 1377994 1378203 gene locus_tag LOCUS_12440 1377994 1378203 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_12440 1378219 1379298 gene locus_tag LOCUS_12450 1378219 1379298 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869339.1 protein_id gnl|my_center|LOCUS_12450 1379299 1380045 gene locus_tag LOCUS_12460 1379299 1380045 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_12460 1380047 1380586 gene locus_tag LOCUS_12470 1380047 1380586 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_12470 1381032 1380670 gene locus_tag LOCUS_12480 gene spoVAE 1381032 1380670 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_12480 1382021 1381029 gene locus_tag LOCUS_12490 gene spoVAD 1382021 1381029 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_12490 1382383 1382135 gene locus_tag LOCUS_12500 gene spoIIID 1382383 1382135 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_12500 1382536 1382739 gene locus_tag LOCUS_12510 1382536 1382739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1382960 1383265 gene locus_tag LOCUS_12520 1382960 1383265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1383292 1383798 gene locus_tag LOCUS_12530 1383292 1383798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1384263 1385303 gene locus_tag LOCUS_12540 1384263 1385303 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905271.1 protein_id gnl|my_center|LOCUS_12540 1385308 1386066 gene locus_tag LOCUS_12550 gene phnC 1385308 1386066 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258841.1 protein_id gnl|my_center|LOCUS_12550 1386063 1387619 gene locus_tag LOCUS_12560 1386063 1387619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1387909 1388910 gene locus_tag LOCUS_12570 1387909 1388910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1389123 1389707 gene locus_tag LOCUS_12580 gene thiT 1389123 1389707 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869028.1 protein_id gnl|my_center|LOCUS_12580 1389835 1389969 gene locus_tag LOCUS_12590 gene rpmH 1389835 1389969 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966999.1 protein_id gnl|my_center|LOCUS_12590 1390082 1390435 gene locus_tag LOCUS_12600 gene rnpA 1390082 1390435 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893914.1 protein_id gnl|my_center|LOCUS_12600 1390432 1390650 gene locus_tag LOCUS_12610 gene yidD 1390432 1390650 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809334.1 protein_id gnl|my_center|LOCUS_12610 1390689 1391948 gene locus_tag LOCUS_12620 1390689 1391948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1391945 1392721 gene locus_tag LOCUS_12630 1391945 1392721 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393997.1 protein_id gnl|my_center|LOCUS_12630 1392748 1392972 gene locus_tag LOCUS_12640 gene acpP 1392748 1392972 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583309.1 protein_id gnl|my_center|LOCUS_12640 1393100 1393891 gene locus_tag LOCUS_12650 1393100 1393891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1393920 1395227 gene locus_tag LOCUS_12660 1393920 1395227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1395991 1395284 gene locus_tag LOCUS_12670 1395991 1395284 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_12670 1396100 1396912 gene locus_tag LOCUS_12680 1396100 1396912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1397396 1396965 gene locus_tag LOCUS_12690 1397396 1396965 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941889.1 protein_id gnl|my_center|LOCUS_12690 1397567 1397809 gene locus_tag LOCUS_12700 1397567 1397809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1397802 1398146 gene locus_tag LOCUS_12710 1397802 1398146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1398139 1398414 gene locus_tag LOCUS_12720 1398139 1398414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1399559 1398411 gene locus_tag LOCUS_12730 gene wecB 1399559 1398411 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140128.1 protein_id gnl|my_center|LOCUS_12730 1400739 1399543 gene locus_tag LOCUS_12740 1400739 1399543 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_12740 1401780 1400767 gene locus_tag LOCUS_12750 gene trpS 1401780 1400767 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369391.1 protein_id gnl|my_center|LOCUS_12750 1401942 1403432 gene locus_tag LOCUS_12760 gene gltX 1401942 1403432 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_12760 1403438 1404112 gene locus_tag LOCUS_12770 1403438 1404112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1404174 1405532 gene locus_tag LOCUS_12780 1404174 1405532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1405646 1406281 gene locus_tag LOCUS_12790 1405646 1406281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1406379 1406455 gene locus_tag LOCUS_t00280 1406379 1406455 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1407736 1406555 gene locus_tag LOCUS_12800 1407736 1406555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1408419 1407889 gene locus_tag LOCUS_12810 1408419 1407889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1409378 1408419 gene locus_tag LOCUS_12820 1409378 1408419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1410011 1409409 gene locus_tag LOCUS_12830 1410011 1409409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1410162 1410353 gene locus_tag LOCUS_12840 1410162 1410353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1410394 1410864 gene locus_tag LOCUS_12850 1410394 1410864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1410845 1411132 gene locus_tag LOCUS_12860 1410845 1411132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1411262 1412029 gene locus_tag LOCUS_12870 1411262 1412029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1412020 1413327 gene locus_tag LOCUS_12880 gene dnaB 1412020 1413327 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027355.1 protein_id gnl|my_center|LOCUS_12880 1413288 1413596 gene locus_tag LOCUS_12890 1413288 1413596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1413593 1414363 gene locus_tag LOCUS_12900 1413593 1414363 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369746.1 protein_id gnl|my_center|LOCUS_12900 1414356 1415615 gene locus_tag LOCUS_12910 1414356 1415615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1415612 1416157 gene locus_tag LOCUS_12920 1415612 1416157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1416147 1416506 gene locus_tag LOCUS_12930 1416147 1416506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1416499 1416789 gene locus_tag LOCUS_12940 1416499 1416789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1416782 1417030 gene locus_tag LOCUS_12950 1416782 1417030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1417084 1417842 gene locus_tag LOCUS_12960 1417084 1417842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1418192 1418488 gene locus_tag LOCUS_12970 1418192 1418488 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023349146.1 protein_id gnl|my_center|LOCUS_12970 1418713 1419084 gene locus_tag LOCUS_12980 1418713 1419084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1419081 1420856 gene locus_tag LOCUS_12990 1419081 1420856 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031366181.1 protein_id gnl|my_center|LOCUS_12990 1420871 1422064 gene locus_tag LOCUS_13000 1420871 1422064 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905712.1 protein_id gnl|my_center|LOCUS_13000 1422057 1422659 gene locus_tag LOCUS_13010 1422057 1422659 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905713.1 protein_id gnl|my_center|LOCUS_13010 1422649 1424061 gene locus_tag LOCUS_13020 1422649 1424061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1424061 1424345 gene locus_tag LOCUS_13030 1424061 1424345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1424400 1424666 gene locus_tag LOCUS_13040 1424400 1424666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1424671 1425060 gene locus_tag LOCUS_13050 1424671 1425060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1425053 1425373 gene locus_tag LOCUS_13060 1425053 1425373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1425376 1425942 gene locus_tag LOCUS_13070 1425376 1425942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1425939 1426238 gene locus_tag LOCUS_13080 1425939 1426238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1426313 1426528 gene locus_tag LOCUS_13090 1426313 1426528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1426525 1428648 gene locus_tag LOCUS_13100 1426525 1428648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1428648 1429649 gene locus_tag LOCUS_13110 1428648 1429649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1429649 1431106 gene locus_tag LOCUS_13120 1429649 1431106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1431118 1431996 gene locus_tag LOCUS_13130 1431118 1431996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1431998 1434034 gene locus_tag LOCUS_13140 1431998 1434034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1434039 1434881 gene locus_tag LOCUS_13150 1434039 1434881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1434871 1435203 gene locus_tag LOCUS_13160 1434871 1435203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1435217 1435480 gene locus_tag LOCUS_13170 1435217 1435480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1435677 1435952 gene locus_tag LOCUS_13180 1435677 1435952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1435999 1436706 gene locus_tag LOCUS_13190 1435999 1436706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1436721 1437362 gene locus_tag LOCUS_13200 1436721 1437362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1437376 1438398 gene locus_tag LOCUS_13210 1437376 1438398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1438826 1438901 gene locus_tag LOCUS_t00290 1438826 1438901 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1439127 1439354 gene locus_tag LOCUS_13220 1439127 1439354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1439622 1441307 gene locus_tag LOCUS_13230 1439622 1441307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1441304 1442554 gene locus_tag LOCUS_13240 1441304 1442554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1442551 1443180 gene locus_tag LOCUS_13250 1442551 1443180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1443362 1443745 gene locus_tag LOCUS_13260 1443362 1443745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1443808 1448781 gene locus_tag LOCUS_13270 1443808 1448781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1448965 1449336 gene locus_tag LOCUS_13280 1448965 1449336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1449382 1449861 gene locus_tag LOCUS_13290 1449382 1449861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1450171 1450932 gene locus_tag LOCUS_13300 1450171 1450932 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_13300 1451084 1451242 gene locus_tag LOCUS_13310 1451084 1451242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1451288 1452115 gene locus_tag LOCUS_13320 1451288 1452115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1452112 1452720 gene locus_tag LOCUS_13330 1452112 1452720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1452730 1454568 gene locus_tag LOCUS_13340 1452730 1454568 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_13340 1454561 1455223 gene locus_tag LOCUS_13350 1454561 1455223 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048024.1 protein_id gnl|my_center|LOCUS_13350 1455362 1455703 gene locus_tag LOCUS_13360 gene rplS 1455362 1455703 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_13360 1455860 1456408 gene locus_tag LOCUS_13370 gene lepB 1455860 1456408 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_13370 1456410 1457288 gene locus_tag LOCUS_13380 gene ylqF 1456410 1457288 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_13380 1457285 1457890 gene locus_tag LOCUS_13390 gene rnhB 1457285 1457890 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191384.1 protein_id gnl|my_center|LOCUS_13390 1457892 1458263 gene locus_tag LOCUS_13400 1457892 1458263 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223856.1 protein_id gnl|my_center|LOCUS_13400 1458277 1459758 gene locus_tag LOCUS_13410 gene thrC 1458277 1459758 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_13410 1459979 1459791 gene locus_tag LOCUS_13420 1459979 1459791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1460065 1460754 gene locus_tag LOCUS_13430 1460065 1460754 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_13430 1460869 1462197 gene locus_tag LOCUS_13440 gene tig 1460869 1462197 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_13440 1462275 1462856 gene locus_tag LOCUS_13450 gene clpP 1462275 1462856 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_13450 1462919 1464169 gene locus_tag LOCUS_13460 gene clpX 1462919 1464169 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_13460 1464217 1466637 gene locus_tag LOCUS_13470 gene lon 1464217 1466637 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_13470 1466648 1467241 gene locus_tag LOCUS_13480 gene yihA 1466648 1467241 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816879.1 protein_id gnl|my_center|LOCUS_13480 1467490 1468164 gene locus_tag LOCUS_13490 1467490 1468164 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_13490 1468139 1468948 gene locus_tag LOCUS_13500 1468139 1468948 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_13500 1468958 1469575 gene locus_tag LOCUS_13510 gene scpB 1468958 1469575 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460224.1 protein_id gnl|my_center|LOCUS_13510 1469582 1470220 gene locus_tag LOCUS_13520 1469582 1470220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1470213 1470593 gene locus_tag LOCUS_13530 gene ytfJ 1470213 1470593 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965359.1 protein_id gnl|my_center|LOCUS_13530 1470654 1471793 gene locus_tag LOCUS_13540 1470654 1471793 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_13540 1471804 1472505 gene locus_tag LOCUS_13550 1471804 1472505 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_13550 1472636 1473499 gene locus_tag LOCUS_13560 1472636 1473499 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_13560 1473534 1474718 gene locus_tag LOCUS_13570 1473534 1474718 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_13570 1474741 1475433 gene locus_tag LOCUS_13580 gene cmk 1474741 1475433 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_13580 1475430 1477493 gene locus_tag LOCUS_13590 1475430 1477493 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_13590 1477635 1478360 gene locus_tag LOCUS_13600 gene ispD 1477635 1478360 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_13600 1478357 1478836 gene locus_tag LOCUS_13610 gene ispF 1478357 1478836 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_13610 1478893 1479150 gene locus_tag LOCUS_13620 1478893 1479150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1479147 1480268 gene locus_tag LOCUS_13630 1479147 1480268 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_13630 1480376 1481290 gene locus_tag LOCUS_13640 gene cdaA 1480376 1481290 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_13640 1481250 1482500 gene locus_tag LOCUS_13650 1481250 1482500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1482505 1482915 gene locus_tag LOCUS_13660 1482505 1482915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1482934 1483812 gene locus_tag LOCUS_13670 1482934 1483812 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_13670 1483825 1484088 gene locus_tag LOCUS_13680 1483825 1484088 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_13680 1484085 1484696 gene locus_tag LOCUS_13690 gene gmk 1484085 1484696 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_13690 1484693 1484890 gene locus_tag LOCUS_13700 1484693 1484890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1484946 1487399 gene locus_tag LOCUS_13710 gene priA 1484946 1487399 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674553.1 protein_id gnl|my_center|LOCUS_13710 1487414 1487914 gene locus_tag LOCUS_13720 gene def 1487414 1487914 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_13720 1487920 1488843 gene locus_tag LOCUS_13730 gene fmt 1487920 1488843 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_13730 1488846 1490174 gene locus_tag LOCUS_13740 gene rsmB 1488846 1490174 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_13740 1490171 1491202 gene locus_tag LOCUS_13750 gene rlmN 1490171 1491202 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626897.1 protein_id gnl|my_center|LOCUS_13750 1491216 1491941 gene locus_tag LOCUS_13760 1491216 1491941 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_13760 1491962 1493650 gene locus_tag LOCUS_13770 gene pknB 1491962 1493650 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_13770 1493678 1494562 gene locus_tag LOCUS_13780 gene rsgA 1493678 1494562 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460520.1 protein_id gnl|my_center|LOCUS_13780 1494627 1494782 gene locus_tag LOCUS_13790 1494627 1494782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1494846 1496345 gene locus_tag LOCUS_13800 1494846 1496345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1496434 1497165 gene locus_tag LOCUS_13810 1496434 1497165 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_13810 1497328 1497627 gene locus_tag LOCUS_13820 1497328 1497627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1497747 1498007 gene locus_tag LOCUS_13830 1497747 1498007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1498065 1498889 gene locus_tag LOCUS_13840 1498065 1498889 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_13840 1499569 1498892 gene locus_tag LOCUS_13850 gene tsaA 1499569 1498892 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_13850 1500234 1499566 gene locus_tag LOCUS_13860 gene nth 1500234 1499566 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_13860 1500319 1501581 gene locus_tag LOCUS_13870 1500319 1501581 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_13870 1501585 1501770 gene locus_tag LOCUS_13880 1501585 1501770 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_13880 1502664 1501804 gene locus_tag LOCUS_13890 1502664 1501804 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359214.1 protein_id gnl|my_center|LOCUS_13890 1503854 1502943 gene locus_tag LOCUS_13900 gene tsf 1503854 1502943 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_13900 1504654 1503920 gene locus_tag LOCUS_13910 gene rpsB 1504654 1503920 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_13910 1505112 1504831 gene locus_tag LOCUS_13920 1505112 1504831 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_13920 1505946 1505164 gene locus_tag LOCUS_13930 gene sigG 1505946 1505164 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_13930 1507287 1506013 gene locus_tag LOCUS_13940 1507287 1506013 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047697.1 protein_id gnl|my_center|LOCUS_13940 1507420 1508274 gene locus_tag LOCUS_13950 1507420 1508274 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_13950 1508278 1509288 gene locus_tag LOCUS_13960 1508278 1509288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1509439 1510701 gene locus_tag LOCUS_13970 1509439 1510701 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837362.1 protein_id gnl|my_center|LOCUS_13970 1511780 1510761 gene locus_tag LOCUS_13980 1511780 1510761 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_13980 1512710 1511826 gene locus_tag LOCUS_13990 1512710 1511826 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_13990 1512934 1513410 gene locus_tag LOCUS_14000 1512934 1513410 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_14000 1513459 1514652 gene locus_tag LOCUS_14010 1513459 1514652 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_14010 1514676 1515458 gene locus_tag LOCUS_14020 gene tpiA 1514676 1515458 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231038.1 protein_id gnl|my_center|LOCUS_14020 1515455 1516978 gene locus_tag LOCUS_14030 gene gpmI 1515455 1516978 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_14030 1516991 1518283 gene locus_tag LOCUS_14040 gene eno 1516991 1518283 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_14040 1518363 1519070 gene locus_tag LOCUS_14050 1518363 1519070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1519158 1519234 gene locus_tag LOCUS_t00300 1519158 1519234 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1519267 1519341 gene locus_tag LOCUS_t00310 1519267 1519341 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1519345 1519421 gene locus_tag LOCUS_t00320 1519345 1519421 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1519474 1520301 gene locus_tag LOCUS_14060 1519474 1520301 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766372.1 protein_id gnl|my_center|LOCUS_14060 1521539 1520352 gene locus_tag LOCUS_14070 1521539 1520352 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_14070 1521734 1522477 gene locus_tag LOCUS_14080 1521734 1522477 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090697.1 protein_id gnl|my_center|LOCUS_14080 1523639 1522533 gene locus_tag LOCUS_14090 1523639 1522533 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_14090 1523775 1524998 gene locus_tag LOCUS_14100 1523775 1524998 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_14100 1527379 1525247 gene locus_tag LOCUS_14110 1527379 1525247 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_14110 1528413 1527619 gene locus_tag LOCUS_14120 1528413 1527619 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_14120 1528669 1528463 gene locus_tag LOCUS_14130 1528669 1528463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1530289 1528688 gene locus_tag LOCUS_14140 1530289 1528688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1531476 1530289 gene locus_tag LOCUS_14150 1531476 1530289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1532773 1531955 gene locus_tag LOCUS_14160 1532773 1531955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1533344 1532766 gene locus_tag LOCUS_14170 1533344 1532766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1533548 1534933 gene locus_tag LOCUS_14180 gene murC 1533548 1534933 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_14180 1535115 1537460 gene locus_tag LOCUS_14190 gene spoIIE 1535115 1537460 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966481.1 protein_id gnl|my_center|LOCUS_14190 1537460 1537816 gene locus_tag LOCUS_14200 1537460 1537816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1537951 1539186 gene locus_tag LOCUS_14210 1537951 1539186 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_14210 1539222 1540625 gene locus_tag LOCUS_14220 gene mgtE 1539222 1540625 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_14220 1540760 1542343 gene locus_tag LOCUS_14230 1540760 1542343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1542340 1543389 gene locus_tag LOCUS_14240 gene queA 1542340 1543389 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_14240 1543591 1544724 gene locus_tag LOCUS_14250 1543591 1544724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1544916 1545365 gene locus_tag LOCUS_14260 1544916 1545365 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_14260 1546156 1545581 gene locus_tag LOCUS_14270 1546156 1545581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14270 1546785 1547423 gene locus_tag LOCUS_14280 1546785 1547423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1547561 1548691 gene locus_tag LOCUS_14290 gene tgt 1547561 1548691 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_14290 1548752 1549132 gene locus_tag LOCUS_14300 1548752 1549132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1549204 1549632 gene locus_tag LOCUS_14310 1549204 1549632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1549920 1550525 gene locus_tag LOCUS_14320 1549920 1550525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1550573 1551463 gene locus_tag LOCUS_14330 gene xerD 1550573 1551463 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_14330 1551571 1552086 gene locus_tag LOCUS_14340 gene ruvC 1551571 1552086 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_14340 1552071 1552682 gene locus_tag LOCUS_14350 gene ruvA 1552071 1552682 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309787.1 protein_id gnl|my_center|LOCUS_14350 1552701 1553741 gene locus_tag LOCUS_14360 gene ruvB 1552701 1553741 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_14360 1553849 1554469 gene locus_tag LOCUS_14370 1553849 1554469 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_14370 1554516 1554794 gene locus_tag LOCUS_14380 1554516 1554794 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_14380 1554882 1555085 gene locus_tag LOCUS_14390 1554882 1555085 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_14390 1555148 1555837 gene locus_tag LOCUS_14400 1555148 1555837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1555831 1556631 gene locus_tag LOCUS_14410 1555831 1556631 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_14410 1556719 1558197 gene locus_tag LOCUS_14420 gene spoIVA 1556719 1558197 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_14420 1558719 1559111 gene locus_tag LOCUS_14430 1558719 1559111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1559343 1560539 gene locus_tag LOCUS_14440 1559343 1560539 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_14440 1560683 1561417 gene locus_tag LOCUS_14450 gene cwlD 1560683 1561417 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966373.1 protein_id gnl|my_center|LOCUS_14450 1561483 1562781 gene locus_tag LOCUS_14460 gene radA 1561483 1562781 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_14460 1562993 1564015 gene locus_tag LOCUS_14470 1562993 1564015 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_14470 1565712 1564042 gene locus_tag LOCUS_14480 1565712 1564042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1566691 1565756 gene locus_tag LOCUS_14490 gene fba 1566691 1565756 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_14490 1566852 1568093 gene locus_tag LOCUS_14500 1566852 1568093 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_14500 1568205 1569803 gene locus_tag LOCUS_14510 1568205 1569803 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_14510 1569807 1571480 gene locus_tag LOCUS_14520 gene rlmD 1569807 1571480 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914581.1 protein_id gnl|my_center|LOCUS_14520 1571600 1572421 gene locus_tag LOCUS_14530 1571600 1572421 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_14530 1572378 1573304 gene locus_tag LOCUS_14540 1572378 1573304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1573317 1573592 gene locus_tag LOCUS_14550 1573317 1573592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1573622 1573807 gene locus_tag LOCUS_14560 1573622 1573807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1573874 1574743 gene locus_tag LOCUS_14570 1573874 1574743 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_14570 1574778 1575524 gene locus_tag LOCUS_14580 1574778 1575524 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922216.1 protein_id gnl|my_center|LOCUS_14580 1575547 1575858 gene locus_tag LOCUS_14590 1575547 1575858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1575871 1576290 gene locus_tag LOCUS_14600 1575871 1576290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1576375 1576875 gene locus_tag LOCUS_14610 1576375 1576875 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_14610 1576872 1578701 gene locus_tag LOCUS_14620 1576872 1578701 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_14620 1578921 1579139 gene locus_tag LOCUS_14630 1578921 1579139 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_14630 1579209 1580078 gene locus_tag LOCUS_14640 1579209 1580078 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_14640 1580099 1580551 gene locus_tag LOCUS_14650 1580099 1580551 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_14650 1580451 1582913 gene locus_tag LOCUS_14660 1580451 1582913 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_14660 1582913 1583293 gene locus_tag LOCUS_14670 1582913 1583293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1583286 1585022 gene locus_tag LOCUS_14680 1583286 1585022 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861112.1 protein_id gnl|my_center|LOCUS_14680 1585051 1585308 gene locus_tag LOCUS_14690 1585051 1585308 CDS product DUF4315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861111.1 protein_id gnl|my_center|LOCUS_14690 1585298 1586062 gene locus_tag LOCUS_14700 1585298 1586062 CDS product DUF4366 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035394374.1 protein_id gnl|my_center|LOCUS_14700 1586250 1586933 gene locus_tag LOCUS_14710 1586250 1586933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1586920 1589028 gene locus_tag LOCUS_14720 1586920 1589028 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368714.1 protein_id gnl|my_center|LOCUS_14720 1589025 1589303 gene locus_tag LOCUS_14730 1589025 1589303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1589310 1592678 gene locus_tag LOCUS_14740 1589310 1592678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1592680 1592895 gene locus_tag LOCUS_14750 1592680 1592895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1593438 1592992 gene locus_tag LOCUS_14760 1593438 1592992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1593746 1594102 gene locus_tag LOCUS_14770 1593746 1594102 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_14770 1594377 1594105 gene locus_tag LOCUS_14780 1594377 1594105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1594462 1601757 gene locus_tag LOCUS_14790 1594462 1601757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1601759 1602577 gene locus_tag LOCUS_14800 1601759 1602577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1602580 1602918 gene locus_tag LOCUS_14810 gene mobC 1602580 1602918 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_14810 1603070 1603372 gene locus_tag LOCUS_14820 1603070 1603372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1603369 1603668 gene locus_tag LOCUS_14830 1603369 1603668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1605155 1603743 gene locus_tag LOCUS_14840 1605155 1603743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1605271 1606683 gene locus_tag LOCUS_14850 1605271 1606683 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_14850 1607262 1606906 gene locus_tag LOCUS_14860 1607262 1606906 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368681.1 protein_id gnl|my_center|LOCUS_14860 1607434 1607637 gene locus_tag LOCUS_14870 1607434 1607637 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905249.1 protein_id gnl|my_center|LOCUS_14870 1607615 1608298 gene locus_tag LOCUS_14880 1607615 1608298 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 protein_id gnl|my_center|LOCUS_14880 1608308 1609543 gene locus_tag LOCUS_14890 1608308 1609543 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963773.1 protein_id gnl|my_center|LOCUS_14890 1609606 1610289 gene locus_tag LOCUS_14900 1609606 1610289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_14900 1610286 1612625 gene locus_tag LOCUS_14910 1610286 1612625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948492.1 protein_id gnl|my_center|LOCUS_14910 1613228 1613641 gene locus_tag LOCUS_14920 1613228 1613641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1613765 1613941 gene locus_tag LOCUS_14930 1613765 1613941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1614003 1614686 gene locus_tag LOCUS_14940 1614003 1614686 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861401.1 protein_id gnl|my_center|LOCUS_14940 1614683 1615714 gene locus_tag LOCUS_14950 1614683 1615714 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861402.1 protein_id gnl|my_center|LOCUS_14950 1615858 1616523 gene locus_tag LOCUS_14960 1615858 1616523 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_14960 1616539 1619172 gene locus_tag LOCUS_14970 1616539 1619172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_14970 1619810 1620223 gene locus_tag LOCUS_14980 1619810 1620223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1620722 1621072 gene locus_tag LOCUS_14990 1620722 1621072 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989608.1 protein_id gnl|my_center|LOCUS_14990 1621152 1621313 gene locus_tag LOCUS_15000 1621152 1621313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1621369 1623045 gene locus_tag LOCUS_15010 1621369 1623045 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_15010 1623058 1623957 gene locus_tag LOCUS_15020 1623058 1623957 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 protein_id gnl|my_center|LOCUS_15020 1624072 1624323 gene locus_tag LOCUS_15030 1624072 1624323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1624948 1624406 gene locus_tag LOCUS_15040 1624948 1624406 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136366.1 protein_id gnl|my_center|LOCUS_15040 1625081 1626127 gene locus_tag LOCUS_15050 1625081 1626127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1626283 1627503 gene locus_tag LOCUS_15060 1626283 1627503 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_15060 1627890 1627558 gene locus_tag LOCUS_15070 1627890 1627558 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_15070 1629564 1627906 gene locus_tag LOCUS_15080 1629564 1627906 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_15080 1630302 1629703 gene locus_tag LOCUS_15090 gene recR 1630302 1629703 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_15090 1630973 1630320 gene locus_tag LOCUS_15100 gene rpe 1630973 1630320 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_15100 1631157 1631639 gene locus_tag LOCUS_15110 1631157 1631639 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_15110 1633775 1631706 gene locus_tag LOCUS_15120 1633775 1631706 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_15120 1634041 1633778 gene locus_tag LOCUS_15130 1634041 1633778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1635459 1634254 gene locus_tag LOCUS_15140 gene tyrS 1635459 1634254 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_15140 1635862 1635479 gene locus_tag LOCUS_15150 1635862 1635479 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941063.1 protein_id gnl|my_center|LOCUS_15150 1637559 1635859 gene locus_tag LOCUS_15160 gene recN 1637559 1635859 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_15160 1638033 1637584 gene locus_tag LOCUS_15170 1638033 1637584 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_15170 1638902 1638045 gene locus_tag LOCUS_15180 1638902 1638045 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_15180 1639717 1638899 gene locus_tag LOCUS_15190 1639717 1638899 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965376.1 protein_id gnl|my_center|LOCUS_15190 1641573 1639714 gene locus_tag LOCUS_15200 gene dxs 1641573 1639714 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_15200 1642568 1641690 gene locus_tag LOCUS_15210 1642568 1641690 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_15210 1642805 1642572 gene locus_tag LOCUS_15220 1642805 1642572 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383143.1 protein_id gnl|my_center|LOCUS_15220 1644009 1642780 gene locus_tag LOCUS_15230 gene xseA 1644009 1642780 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_15230 1644538 1644011 gene locus_tag LOCUS_15240 gene nusB 1644538 1644011 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_15240 1644922 1644560 gene locus_tag LOCUS_15250 1644922 1644560 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810919.1 protein_id gnl|my_center|LOCUS_15250 1645273 1645055 gene locus_tag LOCUS_15260 1645273 1645055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1645272 1645910 gene locus_tag LOCUS_15270 1645272 1645910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1645888 1646589 gene locus_tag LOCUS_15280 gene rgbR 1645888 1646589 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_15280 1646841 1647056 gene locus_tag LOCUS_15290 1646841 1647056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1647713 1647150 gene locus_tag LOCUS_15300 1647713 1647150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1648221 1647727 gene locus_tag LOCUS_15310 1648221 1647727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1648706 1648218 gene locus_tag LOCUS_15320 1648706 1648218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1649812 1648703 gene locus_tag LOCUS_15330 1649812 1648703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1650195 1649809 gene locus_tag LOCUS_15340 1650195 1649809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1650389 1650195 gene locus_tag LOCUS_15350 1650389 1650195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1650919 1650407 gene locus_tag LOCUS_15360 1650919 1650407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1651797 1650916 gene locus_tag LOCUS_15370 gene spoIIIAA 1651797 1650916 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358945.1 protein_id gnl|my_center|LOCUS_15370 1653134 1651905 gene locus_tag LOCUS_15380 1653134 1651905 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_15380 1654636 1653131 gene locus_tag LOCUS_15390 gene glpK 1654636 1653131 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_15390 1654933 1654757 gene locus_tag LOCUS_15400 1654933 1654757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1654877 1655659 gene locus_tag LOCUS_15410 1654877 1655659 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_15410 1657454 1656552 gene locus_tag LOCUS_15420 1657454 1656552 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_15420 1658521 1657490 gene locus_tag LOCUS_15430 1658521 1657490 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_15430 1659242 1658589 gene locus_tag LOCUS_15440 1659242 1658589 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_15440 1661461 1659239 gene locus_tag LOCUS_15450 1661461 1659239 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_15450 1661784 1661437 gene locus_tag LOCUS_15460 1661784 1661437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1664655 1661827 gene locus_tag LOCUS_15470 gene uvrA 1664655 1661827 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963825.1 protein_id gnl|my_center|LOCUS_15470 1665165 1664674 gene locus_tag LOCUS_15480 gene ybaK 1665165 1664674 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_15480 1665302 1666243 gene locus_tag LOCUS_15490 gene gluQRS 1665302 1666243 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_15490 1667039 1666296 gene locus_tag LOCUS_15500 1667039 1666296 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_15500 1668406 1667036 gene locus_tag LOCUS_15510 1668406 1667036 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964280.1 protein_id gnl|my_center|LOCUS_15510 1669625 1668441 gene locus_tag LOCUS_15520 1669625 1668441 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_15520 1671306 1669615 gene locus_tag LOCUS_15530 1671306 1669615 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_15530 1671978 1671409 gene locus_tag LOCUS_15540 1671978 1671409 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_15540 1672543 1672109 gene locus_tag LOCUS_15550 1672543 1672109 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_15550 1673747 1672533 gene locus_tag LOCUS_15560 1673747 1672533 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_15560 1674678 1673737 gene locus_tag LOCUS_15570 1674678 1673737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1676111 1674705 gene locus_tag LOCUS_15580 gene sufB 1676111 1674705 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_15580 1676874 1676128 gene locus_tag LOCUS_15590 gene sufC 1676874 1676128 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_15590 1677512 1677093 gene locus_tag LOCUS_15600 1677512 1677093 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_15600 1679473 1677584 gene locus_tag LOCUS_15610 1679473 1677584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681347.1 protein_id gnl|my_center|LOCUS_15610 1681217 1679466 gene locus_tag LOCUS_15620 1681217 1679466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681349.1 protein_id gnl|my_center|LOCUS_15620 1681667 1681248 gene locus_tag LOCUS_15630 1681667 1681248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1681976 1681797 gene locus_tag LOCUS_15640 1681976 1681797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1683560 1681995 gene locus_tag LOCUS_15650 1683560 1681995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1684756 1683560 gene locus_tag LOCUS_15660 gene fldC 1684756 1683560 CDS product phenyllactyl-CoA dehydratase subunit FldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048236.1 protein_id gnl|my_center|LOCUS_15660 1685195 1684851 gene locus_tag LOCUS_15670 1685195 1684851 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675609.1 protein_id gnl|my_center|LOCUS_15670 1688034 1685260 gene locus_tag LOCUS_15680 1688034 1685260 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_15680 1688283 1688888 gene locus_tag LOCUS_15690 1688283 1688888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1689007 1689222 gene locus_tag LOCUS_15700 1689007 1689222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1689226 1689360 gene locus_tag LOCUS_15710 1689226 1689360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1691043 1689502 gene locus_tag LOCUS_15720 gene guaA 1691043 1689502 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 protein_id gnl|my_center|LOCUS_15720 1692890 1691058 gene locus_tag LOCUS_15730 gene glmS 1692890 1691058 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_15730 1693270 1693470 gene locus_tag LOCUS_15740 1693270 1693470 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_15740 1694697 1693537 gene locus_tag LOCUS_15750 1694697 1693537 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_15750 1694813 1695346 gene locus_tag LOCUS_15760 1694813 1695346 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_15760 1696567 1695404 gene locus_tag LOCUS_15770 1696567 1695404 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 protein_id gnl|my_center|LOCUS_15770 1697651 1696560 gene locus_tag LOCUS_15780 gene serC 1697651 1696560 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766746.1 protein_id gnl|my_center|LOCUS_15780 1699024 1697738 gene locus_tag LOCUS_15790 gene mtaB 1699024 1697738 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_15790 1699055 1700188 gene locus_tag LOCUS_15800 1699055 1700188 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_15800 1701472 1700177 gene locus_tag LOCUS_15810 1701472 1700177 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_15810 1701731 1702861 gene locus_tag LOCUS_15820 gene dacF 1701731 1702861 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_15820 1702936 1704216 gene locus_tag LOCUS_15830 1702936 1704216 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243401.1 protein_id gnl|my_center|LOCUS_15830 1704304 1704723 gene locus_tag LOCUS_15840 1704304 1704723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_15840 1705022 1704777 gene locus_tag LOCUS_15850 1705022 1704777 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_15850 1705351 1705076 gene locus_tag LOCUS_15860 1705351 1705076 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_15860 1706237 1705419 gene locus_tag LOCUS_15870 1706237 1705419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1707912 1706305 gene locus_tag LOCUS_15880 1707912 1706305 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964334.1 protein_id gnl|my_center|LOCUS_15880 1709044 1708025 gene locus_tag LOCUS_15890 gene gap 1709044 1708025 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_15890 1709267 1710334 gene locus_tag LOCUS_15900 1709267 1710334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1711208 1710390 gene locus_tag LOCUS_15910 gene lipA 1711208 1710390 CDS product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 protein_id gnl|my_center|LOCUS_15910 1711947 1711183 gene locus_tag LOCUS_15920 1711947 1711183 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_15920 1712675 1711944 gene locus_tag LOCUS_15930 gene nadE 1712675 1711944 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808614.1 protein_id gnl|my_center|LOCUS_15930 1714677 1712698 gene locus_tag LOCUS_15940 gene ligA 1714677 1712698 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_15940 1715327 1714683 gene locus_tag LOCUS_15950 1715327 1714683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1716758 1715376 gene locus_tag LOCUS_15960 gene murD 1716758 1715376 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_15960 1717542 1717467 gene locus_tag LOCUS_t00330 1717542 1717467 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1717651 1717575 gene locus_tag LOCUS_t00340 1717651 1717575 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1720117 1717811 gene locus_tag LOCUS_15970 1720117 1717811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1720398 1720473 gene locus_tag LOCUS_t00350 1720398 1720473 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1720928 1721074 gene locus_tag LOCUS_15980 1720928 1721074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1721939 1721139 gene locus_tag LOCUS_15990 gene proC 1721939 1721139 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689692.1 protein_id gnl|my_center|LOCUS_15990 1723208 1721952 gene locus_tag LOCUS_16000 1723208 1721952 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255283.1 protein_id gnl|my_center|LOCUS_16000 1724003 1723221 gene locus_tag LOCUS_16010 gene proB 1724003 1723221 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_16010 1724075 1724437 gene locus_tag LOCUS_16020 1724075 1724437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1725503 1724571 gene locus_tag LOCUS_16030 gene cysK 1725503 1724571 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_16030 1725970 1725650 gene locus_tag LOCUS_16040 1725970 1725650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1726016 1727200 gene locus_tag LOCUS_16050 1726016 1727200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1727914 1727315 gene locus_tag LOCUS_16060 1727914 1727315 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392905.1 protein_id gnl|my_center|LOCUS_16060 1728349 1727918 gene locus_tag LOCUS_16070 1728349 1727918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1729844 1728474 gene locus_tag LOCUS_16080 1729844 1728474 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_16080 1729983 1730056 gene locus_tag LOCUS_t00360 1729983 1730056 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1730689 1730294 gene locus_tag LOCUS_16090 1730689 1730294 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_16090 1731470 1731087 gene locus_tag LOCUS_16100 1731470 1731087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1732044 1731448 gene locus_tag LOCUS_16110 1732044 1731448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1732336 1732019 gene locus_tag LOCUS_16120 1732336 1732019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1732883 1732620 gene locus_tag LOCUS_16130 1732883 1732620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1733171 1732899 gene locus_tag LOCUS_16140 1733171 1732899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1734045 1733179 gene locus_tag LOCUS_16150 1734045 1733179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1736116 1734131 gene locus_tag LOCUS_16160 1736116 1734131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1737512 1736118 gene locus_tag LOCUS_16170 1737512 1736118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1739061 1737526 gene locus_tag LOCUS_16180 1739061 1737526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1739479 1739078 gene locus_tag LOCUS_16190 1739479 1739078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1741228 1739483 gene locus_tag LOCUS_16200 1741228 1739483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1741787 1741221 gene locus_tag LOCUS_16210 1741787 1741221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1742230 1741784 gene locus_tag LOCUS_16220 1742230 1741784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1742767 1742243 gene locus_tag LOCUS_16230 1742767 1742243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1743244 1742774 gene locus_tag LOCUS_16240 1743244 1742774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1743668 1743237 gene locus_tag LOCUS_16250 1743668 1743237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1744063 1743665 gene locus_tag LOCUS_16260 1744063 1743665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1744515 1744057 gene locus_tag LOCUS_16270 1744515 1744057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1745417 1744533 gene locus_tag LOCUS_16280 1745417 1744533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1746032 1745442 gene locus_tag LOCUS_16290 1746032 1745442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1746439 1746254 gene locus_tag LOCUS_16300 1746439 1746254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1748247 1746436 gene locus_tag LOCUS_16310 1748247 1746436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1749596 1748244 gene locus_tag LOCUS_16320 1749596 1748244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1749922 1749593 gene locus_tag LOCUS_16330 1749922 1749593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1751511 1749919 gene locus_tag LOCUS_16340 1751511 1749919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1751749 1751516 gene locus_tag LOCUS_16350 1751749 1751516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1752408 1751971 gene locus_tag LOCUS_16360 1752408 1751971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1752965 1752438 gene locus_tag LOCUS_16370 1752965 1752438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1753734 1753021 gene locus_tag LOCUS_16380 1753734 1753021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922062.1 protein_id gnl|my_center|LOCUS_16380 1754138 1753752 gene locus_tag LOCUS_16390 1754138 1753752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1755876 1754158 gene locus_tag LOCUS_16400 1755876 1754158 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072910.1 protein_id gnl|my_center|LOCUS_16400 1756298 1755876 gene locus_tag LOCUS_16410 1756298 1755876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1756943 1756308 gene locus_tag LOCUS_16420 1756943 1756308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1757717 1756959 gene locus_tag LOCUS_16430 1757717 1756959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1758122 1757913 gene locus_tag LOCUS_16440 1758122 1757913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1758298 1758143 gene locus_tag LOCUS_16450 1758298 1758143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 1758567 1758295 gene locus_tag LOCUS_16460 1758567 1758295 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_16460 1758815 1758585 gene locus_tag LOCUS_16470 1758815 1758585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1758886 1759335 gene locus_tag LOCUS_16480 1758886 1759335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1759500 1759297 gene locus_tag LOCUS_16490 1759500 1759297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1759749 1759555 gene locus_tag LOCUS_16500 1759749 1759555 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703553.1 protein_id gnl|my_center|LOCUS_16500 1759894 1760283 gene locus_tag LOCUS_16510 1759894 1760283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1760824 1760249 gene locus_tag LOCUS_16520 1760824 1760249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1760979 1761782 gene locus_tag LOCUS_16530 1760979 1761782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1761796 1761957 gene locus_tag LOCUS_16540 1761796 1761957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1762152 1762967 gene locus_tag LOCUS_16550 1762152 1762967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1763029 1764078 gene locus_tag LOCUS_16560 1763029 1764078 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947770.1 protein_id gnl|my_center|LOCUS_16560 1764988 1764221 gene locus_tag LOCUS_16570 1764988 1764221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1765613 1764969 gene locus_tag LOCUS_16580 1765613 1764969 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271956.1 protein_id gnl|my_center|LOCUS_16580 1766781 1765768 gene locus_tag LOCUS_16590 gene asnA 1766781 1765768 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_16590 1767314 1766778 gene locus_tag LOCUS_16600 1767314 1766778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1767459 1768250 gene locus_tag LOCUS_16610 1767459 1768250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1768960 1768304 gene locus_tag LOCUS_16620 1768960 1768304 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_16620 1770314 1768965 gene locus_tag LOCUS_16630 gene glmM 1770314 1768965 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_16630 1771062 1770367 gene locus_tag LOCUS_16640 gene nagB 1771062 1770367 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728169.1 protein_id gnl|my_center|LOCUS_16640 1771917 1771099 gene locus_tag LOCUS_16650 gene dapF 1771917 1771099 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_16650 1772008 1772685 gene locus_tag LOCUS_16660 1772008 1772685 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_16660 1772682 1773059 gene locus_tag LOCUS_16670 1772682 1773059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1773514 1773056 gene locus_tag LOCUS_16680 gene nrdR 1773514 1773056 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_16680 1774231 1773650 gene locus_tag LOCUS_16690 gene rnmV 1774231 1773650 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305490.1 protein_id gnl|my_center|LOCUS_16690 1775283 1774228 gene locus_tag LOCUS_16700 1775283 1774228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1777572 1775293 gene locus_tag LOCUS_16710 1777572 1775293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1777996 1777655 gene locus_tag LOCUS_16720 1777996 1777655 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_16720 1780651 1778009 gene locus_tag LOCUS_16730 gene alaS 1780651 1778009 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_16730 1780891 1780685 gene locus_tag LOCUS_16740 1780891 1780685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1782340 1781147 gene locus_tag LOCUS_16750 1782340 1781147 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_16750 1783426 1782404 gene locus_tag LOCUS_16760 gene mltG 1783426 1782404 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_16760 1783631 1784134 gene locus_tag LOCUS_16770 1783631 1784134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1784248 1784382 gene locus_tag LOCUS_16780 1784248 1784382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1784987 1784379 gene locus_tag LOCUS_16790 1784987 1784379 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_16790 1785652 1784984 gene locus_tag LOCUS_16800 1785652 1784984 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_16800 1786379 1785639 gene locus_tag LOCUS_16810 1786379 1785639 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290748.1 protein_id gnl|my_center|LOCUS_16810 1787111 1786398 gene locus_tag LOCUS_16820 1787111 1786398 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_16820 1788007 1787183 gene locus_tag LOCUS_16830 gene yidA 1788007 1787183 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048269.1 protein_id gnl|my_center|LOCUS_16830 1788147 1788710 gene locus_tag LOCUS_16840 1788147 1788710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1788947 1788762 gene locus_tag LOCUS_16850 gene rpsU 1788947 1788762 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_16850 1791478 1789052 gene locus_tag LOCUS_16860 gene leuS 1791478 1789052 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_16860 1791924 1791568 gene locus_tag LOCUS_16870 gene rsfS 1791924 1791568 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 protein_id gnl|my_center|LOCUS_16870 1793143 1791947 gene locus_tag LOCUS_16880 1793143 1791947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1794311 1793124 gene locus_tag LOCUS_16890 1794311 1793124 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_16890 1794613 1794308 gene locus_tag LOCUS_16900 gene yhbY 1794613 1794308 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460893.1 protein_id gnl|my_center|LOCUS_16900 1795190 1794600 gene locus_tag LOCUS_16910 1795190 1794600 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641531.1 protein_id gnl|my_center|LOCUS_16910 1796095 1795187 gene locus_tag LOCUS_16920 gene ftsY 1796095 1795187 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_16920 1799672 1796112 gene locus_tag LOCUS_16930 gene smc 1799672 1796112 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361019.1 protein_id gnl|my_center|LOCUS_16930 1800524 1799847 gene locus_tag LOCUS_16940 gene rnc 1800524 1799847 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_16940 1801549 1800524 gene locus_tag LOCUS_16950 gene plsX 1801549 1800524 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_16950 1802859 1801546 gene locus_tag LOCUS_16960 gene trmFO 1802859 1801546 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813284.1 protein_id gnl|my_center|LOCUS_16960 1805244 1802905 gene locus_tag LOCUS_16970 gene topA 1805244 1802905 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813282.1 protein_id gnl|my_center|LOCUS_16970 1806494 1805250 gene locus_tag LOCUS_16980 gene dprA 1806494 1805250 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_16980 1807262 1806507 gene locus_tag LOCUS_16990 1807262 1806507 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246182.1 protein_id gnl|my_center|LOCUS_16990 1808692 1807352 gene locus_tag LOCUS_17000 1808692 1807352 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_17000 1809657 1808704 gene locus_tag LOCUS_17010 1809657 1808704 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_17010 1810676 1809798 gene locus_tag LOCUS_17020 gene sdaAA 1810676 1809798 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_17020 1811341 1810673 gene locus_tag LOCUS_17030 gene sdaAB 1811341 1810673 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460514.1 protein_id gnl|my_center|LOCUS_17030 1812770 1811496 gene locus_tag LOCUS_17040 1812770 1811496 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_17040 1813428 1812904 gene locus_tag LOCUS_17050 1813428 1812904 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989773.1 protein_id gnl|my_center|LOCUS_17050 1813973 1813467 gene locus_tag LOCUS_17060 1813973 1813467 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_17060 1814464 1814015 gene locus_tag LOCUS_17070 1814464 1814015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1816446 1814686 gene locus_tag LOCUS_17080 1816446 1814686 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_17080 1816915 1816448 gene locus_tag LOCUS_17090 1816915 1816448 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_17090 1819499 1816905 gene locus_tag LOCUS_17100 1819499 1816905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1820352 1819516 gene locus_tag LOCUS_17110 1820352 1819516 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546705.1 protein_id gnl|my_center|LOCUS_17110 1821867 1820458 gene locus_tag LOCUS_17120 1821867 1820458 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_17120 1823066 1821864 gene locus_tag LOCUS_17130 1823066 1821864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1824130 1823063 gene locus_tag LOCUS_17140 gene prfA 1824130 1823063 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947982.1 protein_id gnl|my_center|LOCUS_17140 1826126 1824246 gene locus_tag LOCUS_17150 1826126 1824246 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_17150 1826964 1826254 gene locus_tag LOCUS_17160 1826964 1826254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_17160 1827868 1826957 gene locus_tag LOCUS_17170 1827868 1826957 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096031.1 protein_id gnl|my_center|LOCUS_17170 1829063 1827861 gene locus_tag LOCUS_17180 1829063 1827861 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_17180 1829955 1829080 gene locus_tag LOCUS_17190 1829955 1829080 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_17190 1831283 1830102 gene locus_tag LOCUS_17200 1831283 1830102 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_17200 1832647 1831448 gene locus_tag LOCUS_17210 1832647 1831448 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_17210 1832774 1833973 gene locus_tag LOCUS_17220 1832774 1833973 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_17220 1834551 1834006 gene locus_tag LOCUS_17230 1834551 1834006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1834757 1835071 gene locus_tag LOCUS_17240 gene rplU 1834757 1835071 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048023.1 protein_id gnl|my_center|LOCUS_17240 1835112 1835375 gene locus_tag LOCUS_17250 gene rpmA 1835112 1835375 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964571.1 protein_id gnl|my_center|LOCUS_17250 1835451 1836740 gene locus_tag LOCUS_17260 gene obgE 1835451 1836740 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_17260 1837635 1836793 gene locus_tag LOCUS_17270 1837635 1836793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389995.1 protein_id gnl|my_center|LOCUS_17270 1838336 1837683 gene locus_tag LOCUS_17280 1838336 1837683 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271956.1 protein_id gnl|my_center|LOCUS_17280 1838807 1838385 gene locus_tag LOCUS_17290 1838807 1838385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1839188 1840111 gene locus_tag LOCUS_17300 1839188 1840111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1840182 1840907 gene locus_tag LOCUS_17310 1840182 1840907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1841320 1840964 gene locus_tag LOCUS_17320 gene rplT 1841320 1840964 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 protein_id gnl|my_center|LOCUS_17320 1841548 1841351 gene locus_tag LOCUS_17330 gene rpmI 1841548 1841351 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232040.1 protein_id gnl|my_center|LOCUS_17330 1842164 1841574 gene locus_tag LOCUS_17340 gene infC 1842164 1841574 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830789.1 protein_id gnl|my_center|LOCUS_17340 1842407 1842799 gene locus_tag LOCUS_17350 1842407 1842799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1843533 1842793 gene locus_tag LOCUS_17360 gene deoC 1843533 1842793 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_17360 1843667 1844290 gene locus_tag LOCUS_17370 1843667 1844290 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_17370 1844799 1844434 gene locus_tag LOCUS_17380 1844799 1844434 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 protein_id gnl|my_center|LOCUS_17380 1844944 1846839 gene locus_tag LOCUS_17390 gene glgB 1844944 1846839 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_17390 1846853 1850344 gene locus_tag LOCUS_17400 1846853 1850344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1850322 1851641 gene locus_tag LOCUS_17410 1850322 1851641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1851834 1852610 gene locus_tag LOCUS_17420 1851834 1852610 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_17420 1853391 1852675 gene locus_tag LOCUS_17430 1853391 1852675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1854438 1853461 gene locus_tag LOCUS_17440 1854438 1853461 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_17440 1855151 1854501 gene locus_tag LOCUS_17450 1855151 1854501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1855701 1855291 gene locus_tag LOCUS_17460 gene rpsI 1855701 1855291 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814701.1 protein_id gnl|my_center|LOCUS_17460 1856147 1855719 gene locus_tag LOCUS_17470 gene rplM 1856147 1855719 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_17470 1856365 1857090 gene locus_tag LOCUS_17480 1856365 1857090 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_17480 1859137 1857164 gene locus_tag LOCUS_17490 1859137 1857164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1860686 1859379 gene locus_tag LOCUS_17500 1860686 1859379 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199804.1 protein_id gnl|my_center|LOCUS_17500 1861003 1862145 gene locus_tag LOCUS_17510 1861003 1862145 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237280.1 protein_id gnl|my_center|LOCUS_17510 1862142 1862945 gene locus_tag LOCUS_17520 1862142 1862945 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674361.1 protein_id gnl|my_center|LOCUS_17520 1862979 1863545 gene locus_tag LOCUS_17530 1862979 1863545 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_17530 1863609 1865048 gene locus_tag LOCUS_17540 1863609 1865048 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_17540 1866499 1865108 gene locus_tag LOCUS_17550 1866499 1865108 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956936.1 protein_id gnl|my_center|LOCUS_17550 1867539 1866808 gene locus_tag LOCUS_17560 1867539 1866808 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_17560 1867635 1868123 gene locus_tag LOCUS_17570 1867635 1868123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1868238 1868330 gene locus_tag LOCUS_t00370 1868238 1868330 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1870108 1868639 gene locus_tag LOCUS_17580 1870108 1868639 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17580 1870433 1870098 gene locus_tag LOCUS_17590 1870433 1870098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17590 1870715 1870437 gene locus_tag LOCUS_17600 1870715 1870437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1871439 1870738 gene locus_tag LOCUS_17610 1871439 1870738 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_17610 1873414 1871432 gene locus_tag LOCUS_17620 1873414 1871432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1873735 1873466 gene locus_tag LOCUS_17630 1873735 1873466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1874415 1873768 gene locus_tag LOCUS_17640 1874415 1873768 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_17640 1875769 1874429 gene locus_tag LOCUS_17650 1875769 1874429 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_17650 1876355 1877035 gene locus_tag LOCUS_17660 1876355 1877035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1877291 1877986 gene locus_tag LOCUS_17670 1877291 1877986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1877983 1878666 gene locus_tag LOCUS_17680 gene tenA 1877983 1878666 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198338.1 protein_id gnl|my_center|LOCUS_17680 1878709 1879635 gene locus_tag LOCUS_17690 1878709 1879635 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188032.1 protein_id gnl|my_center|LOCUS_17690 1879777 1880760 gene locus_tag LOCUS_17700 1879777 1880760 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964363.1 protein_id gnl|my_center|LOCUS_17700 1880902 1881279 gene locus_tag LOCUS_17710 1880902 1881279 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_17710 1881281 1881976 gene locus_tag LOCUS_17720 1881281 1881976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_17720 1881970 1882776 gene locus_tag LOCUS_17730 1881970 1882776 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436375.1 protein_id gnl|my_center|LOCUS_17730 1883476 1882847 gene locus_tag LOCUS_17740 gene upp 1883476 1882847 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_17740 1884216 1883506 gene locus_tag LOCUS_17750 gene tsaB 1884216 1883506 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_17750 1884641 1884210 gene locus_tag LOCUS_17760 1884641 1884210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1884761 1885903 gene locus_tag LOCUS_17770 gene rodA 1884761 1885903 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_17770 1886470 1886039 gene locus_tag LOCUS_17780 gene nifU 1886470 1886039 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_17780 1887690 1886500 gene locus_tag LOCUS_17790 gene nifS 1887690 1886500 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_17790 1888232 1887822 gene locus_tag LOCUS_17800 gene iscR 1888232 1887822 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_17800 1888950 1888360 gene locus_tag LOCUS_17810 1888950 1888360 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_17810 1889383 1891446 gene locus_tag LOCUS_17820 1889383 1891446 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_17820 1892260 1891577 gene locus_tag LOCUS_17830 1892260 1891577 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244307.1 protein_id gnl|my_center|LOCUS_17830 1893517 1892276 gene locus_tag LOCUS_17840 1893517 1892276 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178657.1 protein_id gnl|my_center|LOCUS_17840 1894873 1894103 gene locus_tag LOCUS_17850 1894873 1894103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1895186 1894941 gene locus_tag LOCUS_17860 1895186 1894941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1896345 1895293 gene locus_tag LOCUS_17870 1896345 1895293 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674735.1 protein_id gnl|my_center|LOCUS_17870 1897744 1896599 gene locus_tag LOCUS_17880 1897744 1896599 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107233.1 protein_id gnl|my_center|LOCUS_17880 1898913 1897747 gene locus_tag LOCUS_17890 1898913 1897747 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107232.1 protein_id gnl|my_center|LOCUS_17890 1899941 1898913 gene locus_tag LOCUS_17900 1899941 1898913 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 protein_id gnl|my_center|LOCUS_17900 1902497 1901178 gene locus_tag LOCUS_17910 1902497 1901178 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_17910 1902996 1902472 gene locus_tag LOCUS_17920 gene lacA 1902996 1902472 CDS product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301800.1 protein_id gnl|my_center|LOCUS_17920 1903757 1902993 gene locus_tag LOCUS_17930 1903757 1902993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1905357 1904149 gene locus_tag LOCUS_17940 1905357 1904149 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_17940 1909582 1905434 gene locus_tag LOCUS_17950 1909582 1905434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1909818 1909579 gene locus_tag LOCUS_17960 1909818 1909579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1915838 1910337 gene locus_tag LOCUS_17970 1915838 1910337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1916388 1915867 gene locus_tag LOCUS_17980 1916388 1915867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1917044 1916370 gene locus_tag LOCUS_17990 1917044 1916370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1918095 1917730 gene locus_tag LOCUS_18000 1918095 1917730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1919446 1918613 gene locus_tag LOCUS_18010 1919446 1918613 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107914.1 protein_id gnl|my_center|LOCUS_18010 1920104 1919469 gene locus_tag LOCUS_18020 1920104 1919469 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_18020 1920870 1920106 gene locus_tag LOCUS_18030 gene ptkA 1920870 1920106 CDS product tyrosine-protein kinase PtkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244182.1 protein_id gnl|my_center|LOCUS_18030 1921636 1920833 gene locus_tag LOCUS_18040 1921636 1920833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1922082 1921669 gene locus_tag LOCUS_18050 1922082 1921669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1923767 1922652 gene locus_tag LOCUS_18060 1923767 1922652 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_18060 1925970 1924540 gene locus_tag LOCUS_18070 1925970 1924540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1927768 1926185 gene locus_tag LOCUS_18080 1927768 1926185 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_18080 1929048 1927765 gene locus_tag LOCUS_18090 1929048 1927765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1929267 1929109 gene locus_tag LOCUS_18100 1929267 1929109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1929886 1930053 gene locus_tag LOCUS_18110 1929886 1930053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1930144 1931433 gene locus_tag LOCUS_18120 1930144 1931433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1932531 1931584 gene locus_tag LOCUS_18130 1932531 1931584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1932946 1932533 gene locus_tag LOCUS_18140 1932946 1932533 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439566.1 protein_id gnl|my_center|LOCUS_18140 1935167 1933005 gene locus_tag LOCUS_18150 1935167 1933005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1937550 1935181 gene locus_tag LOCUS_18160 1937550 1935181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1938278 1937547 gene locus_tag LOCUS_18170 1938278 1937547 CDS product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963390.1 protein_id gnl|my_center|LOCUS_18170 1940770 1938275 gene locus_tag LOCUS_18180 1940770 1938275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224695.1 protein_id gnl|my_center|LOCUS_18180 1942200 1940926 gene locus_tag LOCUS_18190 1942200 1940926 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008363502.1 protein_id gnl|my_center|LOCUS_18190 1942928 1942545 gene locus_tag LOCUS_18200 1942928 1942545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1943540 1942944 gene locus_tag LOCUS_18210 1943540 1942944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1943885 1943544 gene locus_tag LOCUS_18220 1943885 1943544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1944313 1943882 gene locus_tag LOCUS_18230 1944313 1943882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1944641 1944300 gene locus_tag LOCUS_18240 1944641 1944300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1944949 1944638 gene locus_tag LOCUS_18250 1944949 1944638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1946170 1944968 gene locus_tag LOCUS_18260 1946170 1944968 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383948.1 protein_id gnl|my_center|LOCUS_18260 1946896 1946177 gene locus_tag LOCUS_18270 1946896 1946177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1947866 1946805 gene locus_tag LOCUS_18280 1947866 1946805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 1948278 1949204 gene locus_tag LOCUS_18290 1948278 1949204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1950955 1949390 gene locus_tag LOCUS_18300 1950955 1949390 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_18300 1951319 1951092 gene locus_tag LOCUS_18310 1951319 1951092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 1951614 1951435 gene locus_tag LOCUS_18320 1951614 1951435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1951834 1951607 gene locus_tag LOCUS_18330 1951834 1951607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 1952495 1951818 gene locus_tag LOCUS_18340 1952495 1951818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1953864 1952626 gene locus_tag LOCUS_18350 1953864 1952626 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_18350 1954646 1953864 gene locus_tag LOCUS_18360 1954646 1953864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1955199 1954651 gene locus_tag LOCUS_18370 1955199 1954651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1955986 1955639 gene locus_tag LOCUS_18380 1955986 1955639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1956551 1956126 gene locus_tag LOCUS_18390 1956551 1956126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1956772 1956548 gene locus_tag LOCUS_18400 1956772 1956548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1958141 1956777 gene locus_tag LOCUS_18410 1958141 1956777 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_18410 1958403 1958122 gene locus_tag LOCUS_18420 1958403 1958122 CDS product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714182.1 protein_id gnl|my_center|LOCUS_18420 1961004 1958656 gene locus_tag LOCUS_18430 1961004 1958656 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 protein_id gnl|my_center|LOCUS_18430 1961426 1961046 gene locus_tag LOCUS_18440 1961426 1961046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1963377 1961437 gene locus_tag LOCUS_18450 1963377 1961437 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_18450 1963627 1963445 gene locus_tag LOCUS_18460 1963627 1963445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1964193 1963645 gene locus_tag LOCUS_18470 1964193 1963645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1965341 1964196 gene locus_tag LOCUS_18480 1965341 1964196 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_18480 1965648 1965331 gene locus_tag LOCUS_18490 1965648 1965331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1965841 1965641 gene locus_tag LOCUS_18500 1965841 1965641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 1966313 1965915 gene locus_tag LOCUS_18510 1966313 1965915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1966743 1966549 gene locus_tag LOCUS_18520 1966743 1966549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1967128 1967925 gene locus_tag LOCUS_18530 1967128 1967925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1967943 1968158 gene locus_tag LOCUS_18540 1967943 1968158 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_18540 1968231 1970237 gene locus_tag LOCUS_18550 1968231 1970237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1970234 1971595 gene locus_tag LOCUS_18560 1970234 1971595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 1971598 1972770 gene locus_tag LOCUS_18570 1971598 1972770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 1972794 1975775 gene locus_tag LOCUS_18580 1972794 1975775 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_18580 1975806 1976744 gene locus_tag LOCUS_18590 1975806 1976744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1976741 1979413 gene locus_tag LOCUS_18600 1976741 1979413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1979897 1979822 gene locus_tag LOCUS_t00380 1979897 1979822 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1980041 1980730 gene locus_tag LOCUS_18610 gene trmB 1980041 1980730 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939002.1 protein_id gnl|my_center|LOCUS_18610 1980685 1981440 gene locus_tag LOCUS_18620 1980685 1981440 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_18620 1981434 1982408 gene locus_tag LOCUS_18630 gene dusB 1981434 1982408 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_18630 1982430 1983005 gene locus_tag LOCUS_18640 1982430 1983005 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_18640 1983002 1983886 gene locus_tag LOCUS_18650 1983002 1983886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1984163 1984834 gene locus_tag LOCUS_18660 1984163 1984834 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_18660 1984859 1985914 gene locus_tag LOCUS_18670 1984859 1985914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1985971 1987338 gene locus_tag LOCUS_18680 gene mnmE 1985971 1987338 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_18680 1988704 1987394 gene locus_tag LOCUS_18690 1988704 1987394 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454045.1 protein_id gnl|my_center|LOCUS_18690 1988921 1989358 gene locus_tag LOCUS_18700 1988921 1989358 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943207.1 protein_id gnl|my_center|LOCUS_18700 1990484 1989753 gene locus_tag LOCUS_18710 1990484 1989753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1990705 1991901 gene locus_tag LOCUS_18720 1990705 1991901 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681414.1 protein_id gnl|my_center|LOCUS_18720 1991901 1993685 gene locus_tag LOCUS_18730 1991901 1993685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1993720 1994514 gene locus_tag LOCUS_18740 1993720 1994514 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_18740 1994542 1994712 gene locus_tag LOCUS_18750 1994542 1994712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1997248 1994771 gene locus_tag LOCUS_18760 1997248 1994771 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_18760 1997428 1997353 gene locus_tag LOCUS_t00390 1997428 1997353 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1997910 1999916 gene locus_tag LOCUS_18770 1997910 1999916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1999950 2000288 gene locus_tag LOCUS_18780 1999950 2000288 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_18780 2001559 2000333 gene locus_tag LOCUS_18790 gene dinB 2001559 2000333 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392743.1 protein_id gnl|my_center|LOCUS_18790 2001696 2002391 gene locus_tag LOCUS_18800 2001696 2002391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2003101 2002445 gene locus_tag LOCUS_18810 2003101 2002445 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_18810 2003212 2004288 gene locus_tag LOCUS_18820 2003212 2004288 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393267.1 protein_id gnl|my_center|LOCUS_18820 2004974 2004348 gene locus_tag LOCUS_18830 2004974 2004348 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_18830 2005795 2004971 gene locus_tag LOCUS_18840 2005795 2004971 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_18840 2006169 2005807 gene locus_tag LOCUS_18850 2006169 2005807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2006373 2007020 gene locus_tag LOCUS_18860 2006373 2007020 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398264.1 protein_id gnl|my_center|LOCUS_18860 2007347 2007030 gene locus_tag LOCUS_18870 gene sugE 2007347 2007030 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156471.1 protein_id gnl|my_center|LOCUS_18870 2007610 2008140 gene locus_tag LOCUS_18880 2007610 2008140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2008421 2008346 gene locus_tag LOCUS_t00400 2008421 2008346 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2008518 2008442 gene locus_tag LOCUS_t00410 2008518 2008442 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2008634 2008560 gene locus_tag LOCUS_t00420 2008634 2008560 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2008781 2008672 gene locus_tag LOCUS_r00040 2008781 2008672 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2008953 2008878 gene locus_tag LOCUS_t00430 2008953 2008878 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2009037 2008963 gene locus_tag LOCUS_t00440 2009037 2008963 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2011951 2009118 gene locus_tag LOCUS_r00050 2011951 2009118 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2012265 2012190 gene locus_tag LOCUS_t00450 2012265 2012190 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2012352 2012276 gene locus_tag LOCUS_t00460 2012352 2012276 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2013983 2012455 gene locus_tag LOCUS_r00060 2013983 2012455 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2015117 2014425 gene locus_tag LOCUS_18890 gene sleB 2015117 2014425 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964005.1 protein_id gnl|my_center|LOCUS_18890 2016939 2015194 gene locus_tag LOCUS_18900 gene thrS 2016939 2015194 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965659.1 protein_id gnl|my_center|LOCUS_18900 2017365 2017655 gene locus_tag LOCUS_18910 2017365 2017655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2018807 2017710 gene locus_tag LOCUS_18920 gene ychF 2018807 2017710 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_18920 2019426 2018896 gene locus_tag LOCUS_18930 2019426 2018896 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_18930 2021541 2019541 gene locus_tag LOCUS_18940 2021541 2019541 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_18940 2022878 2021538 gene locus_tag LOCUS_18950 2022878 2021538 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459193.1 protein_id gnl|my_center|LOCUS_18950 2023426 2022884 gene locus_tag LOCUS_18960 2023426 2022884 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_18960 2024492 2023524 gene locus_tag LOCUS_18970 2024492 2023524 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206433.1 protein_id gnl|my_center|LOCUS_18970 2026212 2024653 gene locus_tag LOCUS_18980 2026212 2024653 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_18980 2026674 2027858 gene locus_tag LOCUS_18990 2026674 2027858 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860960.1 protein_id gnl|my_center|LOCUS_18990 2027972 2029588 gene locus_tag LOCUS_19000 2027972 2029588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2029782 2030930 gene locus_tag LOCUS_19010 2029782 2030930 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903799.1 protein_id gnl|my_center|LOCUS_19010 2030943 2031755 gene locus_tag LOCUS_19020 2030943 2031755 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391606.1 protein_id gnl|my_center|LOCUS_19020 2031748 2032758 gene locus_tag LOCUS_19030 2031748 2032758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2032783 2033574 gene locus_tag LOCUS_19040 2032783 2033574 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183923.1 protein_id gnl|my_center|LOCUS_19040 2033592 2034350 gene locus_tag LOCUS_19050 2033592 2034350 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065257.1 protein_id gnl|my_center|LOCUS_19050 2036048 2034423 gene locus_tag LOCUS_19060 2036048 2034423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2036527 2038068 gene locus_tag LOCUS_19070 2036527 2038068 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_19070 2039390 2038203 gene locus_tag LOCUS_19080 2039390 2038203 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860960.1 protein_id gnl|my_center|LOCUS_19080 2040115 2039654 gene locus_tag LOCUS_19090 2040115 2039654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2041258 2040143 gene locus_tag LOCUS_19100 2041258 2040143 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931899.1 protein_id gnl|my_center|LOCUS_19100 2042890 2041493 gene locus_tag LOCUS_19110 2042890 2041493 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876425.1 protein_id gnl|my_center|LOCUS_19110 2043336 2044328 gene locus_tag LOCUS_19120 2043336 2044328 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085392.1 protein_id gnl|my_center|LOCUS_19120 2046606 2044597 gene locus_tag LOCUS_19130 gene ftsH 2046606 2044597 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_19130 2047192 2046644 gene locus_tag LOCUS_19140 gene hpt 2047192 2046644 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_19140 2048504 2047173 gene locus_tag LOCUS_19150 gene tilS 2048504 2047173 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_19150 2049843 2048494 gene locus_tag LOCUS_19160 gene dnaB 2049843 2048494 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_19160 2050322 2049873 gene locus_tag LOCUS_19170 gene rplI 2050322 2049873 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048442.1 protein_id gnl|my_center|LOCUS_19170 2052368 2050341 gene locus_tag LOCUS_19180 2052368 2050341 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_19180 2052494 2053501 gene locus_tag LOCUS_19190 2052494 2053501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2054399 2053746 gene locus_tag LOCUS_19200 2054399 2053746 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_19200 2055812 2054439 gene locus_tag LOCUS_19210 2055812 2054439 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_19210 2057587 2055809 gene locus_tag LOCUS_19220 2057587 2055809 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_19220 2057913 2057599 gene locus_tag LOCUS_19230 2057913 2057599 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_19230 2058907 2057906 gene locus_tag LOCUS_19240 2058907 2057906 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986935.1 protein_id gnl|my_center|LOCUS_19240 2059589 2058987 gene locus_tag LOCUS_19250 2059589 2058987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2060108 2059626 gene locus_tag LOCUS_19260 2060108 2059626 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_19260 2062130 2060148 gene locus_tag LOCUS_19270 2062130 2060148 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_19270 2062444 2062130 gene locus_tag LOCUS_19280 2062444 2062130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2062846 2063721 gene locus_tag LOCUS_19290 2062846 2063721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2065693 2064089 gene locus_tag LOCUS_19300 2065693 2064089 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_19300 2067010 2065778 gene locus_tag LOCUS_19310 2067010 2065778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2067629 2067117 gene locus_tag LOCUS_19320 2067629 2067117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2068241 2067681 gene locus_tag LOCUS_19330 2068241 2067681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2068465 2068229 gene locus_tag LOCUS_19340 2068465 2068229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2068368 2069198 gene locus_tag LOCUS_19350 2068368 2069198 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_19350 2069304 2069609 gene locus_tag LOCUS_19360 2069304 2069609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2070031 2069702 gene locus_tag LOCUS_19370 2070031 2069702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2070010 2070423 gene locus_tag LOCUS_19380 2070010 2070423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2070571 2071899 gene locus_tag LOCUS_19390 2070571 2071899 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641680.1 protein_id gnl|my_center|LOCUS_19390 2074057 2072189 gene locus_tag LOCUS_19400 2074057 2072189 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19400 2074281 2074063 gene locus_tag LOCUS_19410 2074281 2074063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2074710 2074339 gene locus_tag LOCUS_19420 2074710 2074339 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_19420 2075277 2074849 gene locus_tag LOCUS_19430 2075277 2074849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2076236 2075274 gene locus_tag LOCUS_19440 2076236 2075274 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_19440 2077354 2076266 gene locus_tag LOCUS_19450 gene mnmA 2077354 2076266 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_19450 2078229 2077471 gene locus_tag LOCUS_19460 2078229 2077471 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579984.1 protein_id gnl|my_center|LOCUS_19460 2078437 2078524 gene locus_tag LOCUS_t00470 2078437 2078524 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2080282 2078573 gene locus_tag LOCUS_19470 gene tndX 2080282 2078573 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_19470 2080566 2080381 gene locus_tag LOCUS_19480 2080566 2080381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2081183 2080941 gene locus_tag LOCUS_19490 2081183 2080941 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905237.1 protein_id gnl|my_center|LOCUS_19490 2081601 2081176 gene locus_tag LOCUS_19500 2081601 2081176 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905239.1 protein_id gnl|my_center|LOCUS_19500 2083217 2082141 gene locus_tag LOCUS_19510 2083217 2082141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2084089 2083214 gene locus_tag LOCUS_19520 2084089 2083214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_19520 2085156 2084176 gene locus_tag LOCUS_19530 2085156 2084176 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_19530 2086016 2085342 gene locus_tag LOCUS_19540 2086016 2085342 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_19540 2086245 2086060 gene locus_tag LOCUS_19550 2086245 2086060 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434206.1 protein_id gnl|my_center|LOCUS_19550 2086414 2086803 gene locus_tag LOCUS_19560 2086414 2086803 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861099.1 protein_id gnl|my_center|LOCUS_19560 2087057 2087386 gene locus_tag LOCUS_19570 gene mobC 2087057 2087386 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_19570 2087347 2088693 gene locus_tag LOCUS_19580 2087347 2088693 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_19580 2088777 2089109 gene locus_tag LOCUS_19590 2088777 2089109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2089571 2089158 gene locus_tag LOCUS_19600 2089571 2089158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2092429 2090579 gene locus_tag LOCUS_19610 2092429 2090579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2092921 2092442 gene locus_tag LOCUS_19620 2092921 2092442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2095004 2092908 gene locus_tag LOCUS_19630 2095004 2092908 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861108.1 protein_id gnl|my_center|LOCUS_19630 2095092 2095964 gene locus_tag LOCUS_19640 2095092 2095964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2097048 2096008 gene locus_tag LOCUS_19650 2097048 2096008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2097313 2097038 gene locus_tag LOCUS_19660 2097313 2097038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2098062 2097316 gene locus_tag LOCUS_19670 2098062 2097316 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004056545.1 protein_id gnl|my_center|LOCUS_19670 2099965 2098055 gene locus_tag LOCUS_19680 2099965 2098055 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861112.1 protein_id gnl|my_center|LOCUS_19680 2100192 2099962 gene locus_tag LOCUS_19690 2100192 2099962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2100488 2100084 gene locus_tag LOCUS_19700 2100488 2100084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2100478 2100762 gene locus_tag LOCUS_19710 2100478 2100762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2101815 2101051 gene locus_tag LOCUS_19720 2101815 2101051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 2102595 2101975 gene locus_tag LOCUS_19730 2102595 2101975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2105032 2102615 gene locus_tag LOCUS_19740 2105032 2102615 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861114.1 protein_id gnl|my_center|LOCUS_19740 2105384 2104980 gene locus_tag LOCUS_19750 2105384 2104980 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_19750 2106262 2105399 gene locus_tag LOCUS_19760 2106262 2105399 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_19760 2108126 2106519 gene locus_tag LOCUS_19770 2108126 2106519 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_19770 2108452 2108261 gene locus_tag LOCUS_19780 2108452 2108261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2109304 2108465 gene locus_tag LOCUS_19790 2109304 2108465 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_19790 2110041 2109301 gene locus_tag LOCUS_19800 2110041 2109301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2110225 2110031 gene locus_tag LOCUS_19810 2110225 2110031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2112019 2110400 gene locus_tag LOCUS_19820 2112019 2110400 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_19820 2112389 2111991 gene locus_tag LOCUS_19830 2112389 2111991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2113240 2112830 gene locus_tag LOCUS_19840 2113240 2112830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2113495 2113298 gene locus_tag LOCUS_19850 2113495 2113298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2113931 2113473 gene locus_tag LOCUS_19860 2113931 2113473 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989664.1 protein_id gnl|my_center|LOCUS_19860 2114794 2114090 gene locus_tag LOCUS_19870 2114794 2114090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2115272 2114787 gene locus_tag LOCUS_19880 2115272 2114787 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_19880 2115685 2115545 gene locus_tag LOCUS_19890 2115685 2115545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2116465 2115689 gene locus_tag LOCUS_19900 2116465 2115689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2116746 2116588 gene locus_tag LOCUS_19910 2116746 2116588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2118760 2116889 gene locus_tag LOCUS_19920 2118760 2116889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2120253 2118757 gene locus_tag LOCUS_19930 2120253 2118757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2120578 2120219 gene locus_tag LOCUS_19940 2120578 2120219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2121230 2120706 gene locus_tag LOCUS_19950 2121230 2120706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943137.1 protein_id gnl|my_center|LOCUS_19950 2122841 2122497 gene locus_tag LOCUS_19960 2122841 2122497 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_19960 2125828 2122838 gene locus_tag LOCUS_19970 2125828 2122838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2126316 2125825 gene locus_tag LOCUS_19980 2126316 2125825 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_19980 2127200 2126322 gene locus_tag LOCUS_19990 2127200 2126322 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_19990 2128592 2127603 gene locus_tag LOCUS_20000 2128592 2127603 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_20000 2130910 2128811 gene locus_tag LOCUS_20010 2130910 2128811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2132222 2130897 gene locus_tag LOCUS_20020 2132222 2130897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2133115 2132240 gene locus_tag LOCUS_20030 2133115 2132240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2133354 2135168 gene locus_tag LOCUS_20040 gene ftsH 2133354 2135168 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_20040 2135234 2136754 gene locus_tag LOCUS_20050 2135234 2136754 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_20050 2136751 2137479 gene locus_tag LOCUS_20060 2136751 2137479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2137630 2138403 gene locus_tag LOCUS_20070 2137630 2138403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_20070 2138393 2140447 gene locus_tag LOCUS_20080 2138393 2140447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2140472 2141149 gene locus_tag LOCUS_20090 2140472 2141149 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_20090 2141139 2142152 gene locus_tag LOCUS_20100 2141139 2142152 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594860.1 protein_id gnl|my_center|LOCUS_20100 2144073 2142298 gene locus_tag LOCUS_20110 2144073 2142298 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_20110 2145169 2144438 gene locus_tag LOCUS_20120 2145169 2144438 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_20120 2145912 2145244 gene locus_tag LOCUS_20130 2145912 2145244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2148532 2146802 gene locus_tag LOCUS_20140 2148532 2146802 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_20140 2149055 2148537 gene locus_tag LOCUS_20150 2149055 2148537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2149894 2151012 gene locus_tag LOCUS_20160 2149894 2151012 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_20160 2151009 2151902 gene locus_tag LOCUS_20170 2151009 2151902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_20170 2151904 2153877 gene locus_tag LOCUS_20180 2151904 2153877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2154087 2154800 gene locus_tag LOCUS_20190 2154087 2154800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461283.1 protein_id gnl|my_center|LOCUS_20190 2154814 2157513 gene locus_tag LOCUS_20200 2154814 2157513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2157719 2159107 gene locus_tag LOCUS_20210 2157719 2159107 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_20210 2159266 2159526 gene locus_tag LOCUS_20220 2159266 2159526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2159643 2159882 gene locus_tag LOCUS_20230 2159643 2159882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2162874 2160211 gene locus_tag LOCUS_20240 gene ppdK 2162874 2160211 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_20240 2163371 2165230 gene locus_tag LOCUS_20250 2163371 2165230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2165466 2167346 gene locus_tag LOCUS_20260 2165466 2167346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 2167816 2168454 gene locus_tag LOCUS_20270 2167816 2168454 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_20270 2168614 2170500 gene locus_tag LOCUS_20280 2168614 2170500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2171443 2170610 gene locus_tag LOCUS_20290 2171443 2170610 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_20290 2171663 2172124 gene locus_tag LOCUS_20300 2171663 2172124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 2172288 2173721 gene locus_tag LOCUS_20310 2172288 2173721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2173723 2175195 gene locus_tag LOCUS_20320 2173723 2175195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2175192 2176175 gene locus_tag LOCUS_20330 2175192 2176175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2176197 2177168 gene locus_tag LOCUS_20340 2176197 2177168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2177173 2178705 gene locus_tag LOCUS_20350 2177173 2178705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2178702 2179850 gene locus_tag LOCUS_20360 2178702 2179850 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060798.1 protein_id gnl|my_center|LOCUS_20360 2179847 2180236 gene locus_tag LOCUS_20370 gene tagD 2179847 2180236 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 protein_id gnl|my_center|LOCUS_20370 2180463 2181803 gene locus_tag LOCUS_20380 gene spoVB 2180463 2181803 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964335.1 protein_id gnl|my_center|LOCUS_20380 2182588 2181833 gene locus_tag LOCUS_20390 2182588 2181833 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_20390 2182911 2183435 gene locus_tag LOCUS_20400 2182911 2183435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2183830 2183486 gene locus_tag LOCUS_20410 2183830 2183486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2186577 2183851 gene locus_tag LOCUS_20420 2186577 2183851 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_20420 2186821 2187663 gene locus_tag LOCUS_20430 2186821 2187663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2188028 2189032 gene locus_tag LOCUS_20440 2188028 2189032 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_20440 2189025 2189702 gene locus_tag LOCUS_20450 2189025 2189702 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817223.1 protein_id gnl|my_center|LOCUS_20450 2189845 2190696 gene locus_tag LOCUS_20460 2189845 2190696 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_20460 2191783 2190800 gene locus_tag LOCUS_20470 2191783 2190800 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_20470 2192595 2191780 gene locus_tag LOCUS_20480 2192595 2191780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_20480 2193346 2192588 gene locus_tag LOCUS_20490 2193346 2192588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_20490 2194341 2193478 gene locus_tag LOCUS_20500 2194341 2193478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2197039 2194397 gene locus_tag LOCUS_20510 2197039 2194397 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909521.1 protein_id gnl|my_center|LOCUS_20510 2198608 2197274 gene locus_tag LOCUS_20520 2198608 2197274 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090934236.1 protein_id gnl|my_center|LOCUS_20520 2199613 2198621 gene locus_tag LOCUS_20530 gene ansA 2199613 2198621 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_20530 2200361 2199615 gene locus_tag LOCUS_20540 2200361 2199615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2200515 2200375 gene locus_tag LOCUS_20550 2200515 2200375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2201471 2200581 gene locus_tag LOCUS_20560 gene era 2201471 2200581 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_20560 2201970 2201482 gene locus_tag LOCUS_20570 gene ybeY 2201970 2201482 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_20570 2202959 2201967 gene locus_tag LOCUS_20580 2202959 2201967 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_20580 2204163 2202982 gene locus_tag LOCUS_20590 2204163 2202982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2204500 2204228 gene locus_tag LOCUS_20600 2204500 2204228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2204603 2205571 gene locus_tag LOCUS_20610 2204603 2205571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460508.1 protein_id gnl|my_center|LOCUS_20610 2206158 2205574 gene locus_tag LOCUS_20620 2206158 2205574 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_20620 2206709 2206155 gene locus_tag LOCUS_20630 2206709 2206155 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_20630 2208506 2206776 gene locus_tag LOCUS_20640 2208506 2206776 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_20640 2208834 2208499 gene locus_tag LOCUS_20650 2208834 2208499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2209332 2208850 gene locus_tag LOCUS_20660 gene rlmH 2209332 2208850 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_20660 2210123 2209320 gene locus_tag LOCUS_20670 2210123 2209320 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_20670 2211415 2210120 gene locus_tag LOCUS_20680 2211415 2210120 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_20680 2212120 2211554 gene locus_tag LOCUS_20690 2212120 2211554 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_20690 2212268 2212735 gene locus_tag LOCUS_20700 2212268 2212735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2212807 2213274 gene locus_tag LOCUS_20710 gene smpB 2212807 2213274 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_20710 2213274 2213795 gene locus_tag LOCUS_20720 2213274 2213795 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_20720 2214795 2216429 gene locus_tag LOCUS_20730 2214795 2216429 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_20730 2216439 2217407 gene locus_tag LOCUS_20740 2216439 2217407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2218068 2217904 gene locus_tag LOCUS_20750 2218068 2217904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 2220056 2218068 gene locus_tag LOCUS_20760 gene feoB 2220056 2218068 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_20760 2220283 2220053 gene locus_tag LOCUS_20770 2220283 2220053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2223960 2220463 gene locus_tag LOCUS_20780 2223960 2220463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2224308 2224961 gene locus_tag LOCUS_20790 2224308 2224961 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_20790 2224966 2226345 gene locus_tag LOCUS_20800 2224966 2226345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2226342 2227166 gene locus_tag LOCUS_20810 2226342 2227166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2227268 2227960 gene locus_tag LOCUS_20820 2227268 2227960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2228594 2228010 gene locus_tag LOCUS_20830 2228594 2228010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2228888 2229535 gene locus_tag LOCUS_20840 2228888 2229535 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254956.1 protein_id gnl|my_center|LOCUS_20840 2229582 2230736 gene locus_tag LOCUS_20850 gene rlmD 2229582 2230736 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_20850 2231710 2230808 gene locus_tag LOCUS_20860 2231710 2230808 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_20860 2231857 2232885 gene locus_tag LOCUS_20870 2231857 2232885 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922574.1 protein_id gnl|my_center|LOCUS_20870 2234288 2233146 gene locus_tag LOCUS_20880 2234288 2233146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2234959 2234285 gene locus_tag LOCUS_20890 2234959 2234285 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_20890 2235104 2235250 gene locus_tag LOCUS_20900 2235104 2235250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2235243 2236166 gene locus_tag LOCUS_20910 2235243 2236166 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_20910 2236166 2237122 gene locus_tag LOCUS_20920 2236166 2237122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2238154 2237195 gene locus_tag LOCUS_20930 2238154 2237195 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192803849.1 protein_id gnl|my_center|LOCUS_20930 2238309 2238725 gene locus_tag LOCUS_20940 2238309 2238725 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968595.1 protein_id gnl|my_center|LOCUS_20940 2238737 2239291 gene locus_tag LOCUS_20950 2238737 2239291 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185716.1 protein_id gnl|my_center|LOCUS_20950 2239604 2239353 gene locus_tag LOCUS_20960 2239604 2239353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2241406 2239751 gene locus_tag LOCUS_20970 2241406 2239751 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_20970 2242077 2241403 gene locus_tag LOCUS_20980 2242077 2241403 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_20980 2242725 2242081 gene locus_tag LOCUS_20990 gene phoU 2242725 2242081 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_20990 2243480 2242725 gene locus_tag LOCUS_21000 gene pstB 2243480 2242725 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_21000 2244340 2243477 gene locus_tag LOCUS_21010 gene pstA 2244340 2243477 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_21010 2245212 2244337 gene locus_tag LOCUS_21020 gene pstC 2245212 2244337 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_21020 2246107 2245277 gene locus_tag LOCUS_21030 2246107 2245277 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_21030 2246438 2247529 gene locus_tag LOCUS_21040 2246438 2247529 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810346.1 protein_id gnl|my_center|LOCUS_21040 2247498 2248553 gene locus_tag LOCUS_21050 2247498 2248553 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459052.1 protein_id gnl|my_center|LOCUS_21050 2248550 2249326 gene locus_tag LOCUS_21060 2248550 2249326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810342.1 protein_id gnl|my_center|LOCUS_21060 2249323 2249844 gene locus_tag LOCUS_21070 2249323 2249844 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860658.1 protein_id gnl|my_center|LOCUS_21070 2250902 2250081 gene locus_tag LOCUS_21080 2250902 2250081 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_21080 2251031 2251483 gene locus_tag LOCUS_21090 2251031 2251483 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048323.1 protein_id gnl|my_center|LOCUS_21090 2252738 2251545 gene locus_tag LOCUS_21100 2252738 2251545 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948693.1 protein_id gnl|my_center|LOCUS_21100 2253178 2252735 gene locus_tag LOCUS_21110 gene aroQ 2253178 2252735 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_21110 2254392 2253175 gene locus_tag LOCUS_21120 2254392 2253175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2255537 2254395 gene locus_tag LOCUS_21130 gene pheA 2255537 2254395 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130282.1 protein_id gnl|my_center|LOCUS_21130 2256829 2255549 gene locus_tag LOCUS_21140 gene aroA 2256829 2255549 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_21140 2257887 2256826 gene locus_tag LOCUS_21150 gene aroB 2257887 2256826 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382321.1 protein_id gnl|my_center|LOCUS_21150 2258717 2257884 gene locus_tag LOCUS_21160 2258717 2257884 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_21160 2259718 2258714 gene locus_tag LOCUS_21170 gene aroF 2259718 2258714 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_21170 2262886 2260121 gene locus_tag LOCUS_21180 2262886 2260121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2263455 2264285 gene locus_tag LOCUS_21190 gene thiM 2263455 2264285 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_21190 2264272 2264913 gene locus_tag LOCUS_21200 gene thiE 2264272 2264913 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_21200 2265013 2265816 gene locus_tag LOCUS_21210 gene thiD 2265013 2265816 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_21210 2265819 2266991 gene locus_tag LOCUS_21220 gene cytX 2265819 2266991 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705129.1 protein_id gnl|my_center|LOCUS_21220 2267390 2268313 gene locus_tag LOCUS_21230 2267390 2268313 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_21230 2268327 2269121 gene locus_tag LOCUS_21240 2268327 2269121 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_21240 2269918 2269166 gene locus_tag LOCUS_21250 2269918 2269166 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_21250 2270050 2270967 gene locus_tag LOCUS_21260 2270050 2270967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2271410 2271006 gene locus_tag LOCUS_21270 2271410 2271006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2272237 2271695 gene locus_tag LOCUS_21280 2272237 2271695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2273115 2272234 gene locus_tag LOCUS_21290 2273115 2272234 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_21290 2273265 2273837 gene locus_tag LOCUS_21300 2273265 2273837 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937344.1 protein_id gnl|my_center|LOCUS_21300 2274451 2273897 gene locus_tag LOCUS_21310 2274451 2273897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2274926 2274486 gene locus_tag LOCUS_21320 2274926 2274486 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_21320 2274987 2275256 gene locus_tag LOCUS_21330 2274987 2275256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2275281 2276255 gene locus_tag LOCUS_21340 2275281 2276255 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_21340 2276268 2277026 gene locus_tag LOCUS_21350 2276268 2277026 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_21350 2277308 2279221 gene locus_tag LOCUS_21360 2277308 2279221 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_21360 2279378 2279854 gene locus_tag LOCUS_21370 2279378 2279854 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459155.1 protein_id gnl|my_center|LOCUS_21370 2279867 2280460 gene locus_tag LOCUS_21380 2279867 2280460 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_21380 2280695 2280868 gene locus_tag LOCUS_21390 2280695 2280868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2281268 2280921 gene locus_tag LOCUS_21400 2281268 2280921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2281722 2281647 gene locus_tag LOCUS_t00480 2281722 2281647 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2282478 2281855 gene locus_tag LOCUS_21410 2282478 2281855 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_21410 2283406 2282489 gene locus_tag LOCUS_21420 2283406 2282489 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_21420 2284152 2283421 gene locus_tag LOCUS_21430 2284152 2283421 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_21430 2284811 2284170 gene locus_tag LOCUS_21440 gene plsY 2284811 2284170 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_21440 2286133 2284808 gene locus_tag LOCUS_21450 gene der 2286133 2284808 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_21450 2287521 2286136 gene locus_tag LOCUS_21460 2287521 2286136 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_21460 2287803 2287621 gene locus_tag LOCUS_21470 gene rpmF 2287803 2287621 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_21470 2288349 2287819 gene locus_tag LOCUS_21480 2288349 2287819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2288471 2289442 gene locus_tag LOCUS_21490 2288471 2289442 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_21490 2290783 2289494 gene locus_tag LOCUS_21500 2290783 2289494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2291507 2290767 gene locus_tag LOCUS_21510 2291507 2290767 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_21510 2292647 2291535 gene locus_tag LOCUS_21520 2292647 2291535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2293209 2292790 gene locus_tag LOCUS_21530 2293209 2292790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 2293953 2293276 gene locus_tag LOCUS_21540 2293953 2293276 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391764.1 protein_id gnl|my_center|LOCUS_21540 2294173 2294694 gene locus_tag LOCUS_21550 2294173 2294694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 2294713 2295216 gene locus_tag LOCUS_21560 gene greA 2294713 2295216 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182999.1 protein_id gnl|my_center|LOCUS_21560 2296813 2295203 gene locus_tag LOCUS_21570 2296813 2295203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2297943 2296957 gene locus_tag LOCUS_21580 2297943 2296957 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_21580 2298102 2298635 gene locus_tag LOCUS_21590 2298102 2298635 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966725.1 protein_id gnl|my_center|LOCUS_21590 2300122 2298710 gene locus_tag LOCUS_21600 2300122 2298710 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346373.1 protein_id gnl|my_center|LOCUS_21600 2300341 2301009 gene locus_tag LOCUS_21610 2300341 2301009 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036734.1 protein_id gnl|my_center|LOCUS_21610 2301009 2301926 gene locus_tag LOCUS_21620 2301009 2301926 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_21620 2303968 2301989 gene locus_tag LOCUS_21630 2303968 2301989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2304308 2304006 gene locus_tag LOCUS_21640 2304308 2304006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2305089 2304391 gene locus_tag LOCUS_21650 2305089 2304391 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_21650 2305260 2306444 gene locus_tag LOCUS_21660 2305260 2306444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2306521 2306778 gene locus_tag LOCUS_21670 2306521 2306778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 2308599 2306848 gene locus_tag LOCUS_21680 2308599 2306848 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_21680 2310008 2308785 gene locus_tag LOCUS_21690 2310008 2308785 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_21690 2311383 2310010 gene locus_tag LOCUS_21700 2311383 2310010 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_21700 2312054 2311380 gene locus_tag LOCUS_21710 2312054 2311380 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_21710 2312564 2312223 gene locus_tag LOCUS_21720 gene rplQ 2312564 2312223 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_21720 2313549 2312599 gene locus_tag LOCUS_21730 2313549 2312599 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_21730 2314256 2313630 gene locus_tag LOCUS_21740 gene rpsD 2314256 2313630 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_21740 2314678 2314277 gene locus_tag LOCUS_21750 gene rpsK 2314678 2314277 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_21750 2315061 2314693 gene locus_tag LOCUS_21760 gene rpsM 2315061 2314693 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_21760 2315523 2315305 gene locus_tag LOCUS_21770 gene infA 2315523 2315305 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_21770 2316317 2315562 gene locus_tag LOCUS_21780 gene map 2316317 2315562 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_21780 2316949 2316314 gene locus_tag LOCUS_21790 2316949 2316314 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393916.1 protein_id gnl|my_center|LOCUS_21790 2318264 2316966 gene locus_tag LOCUS_21800 gene secY 2318264 2316966 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427725.1 protein_id gnl|my_center|LOCUS_21800 2318706 2318266 gene locus_tag LOCUS_21810 gene rplO 2318706 2318266 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393918.1 protein_id gnl|my_center|LOCUS_21810 2318903 2318721 gene locus_tag LOCUS_21820 2318903 2318721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 2319448 2318918 gene locus_tag LOCUS_21830 gene rpsE 2319448 2318918 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_21830 2319825 2319466 gene locus_tag LOCUS_21840 gene rplR 2319825 2319466 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001865622.1 protein_id gnl|my_center|LOCUS_21840 2320381 2319842 gene locus_tag LOCUS_21850 gene rplF 2320381 2319842 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_21850 2320795 2320397 gene locus_tag LOCUS_21860 gene rpsH 2320795 2320397 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_21860 2321501 2321316 gene locus_tag LOCUS_21870 2321501 2321316 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_21870 2322071 2321517 gene locus_tag LOCUS_21880 gene rplE 2322071 2321517 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_21880 2322395 2322090 gene locus_tag LOCUS_21890 gene rplX 2322395 2322090 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_21890 2322781 2322410 gene locus_tag LOCUS_21900 gene rplN 2322781 2322410 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_21900 2323057 2322794 gene locus_tag LOCUS_21910 gene rpsQ 2323057 2322794 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_21910 2323266 2323072 gene locus_tag LOCUS_21920 gene rpmC 2323266 2323072 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495193.1 protein_id gnl|my_center|LOCUS_21920 2323696 2323268 gene locus_tag LOCUS_21930 gene rplP 2323696 2323268 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_21930 2324574 2323696 gene locus_tag LOCUS_21940 2324574 2323696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2324939 2324592 gene locus_tag LOCUS_21950 gene rplV 2324939 2324592 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567555.1 protein_id gnl|my_center|LOCUS_21950 2325227 2324952 gene locus_tag LOCUS_21960 gene rpsS 2325227 2324952 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_21960 2326078 2325242 gene locus_tag LOCUS_21970 gene rplB 2326078 2325242 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_21970 2326390 2326094 gene locus_tag LOCUS_21980 gene rplW 2326390 2326094 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567562.1 protein_id gnl|my_center|LOCUS_21980 2327013 2326390 gene locus_tag LOCUS_21990 gene rplD 2327013 2326390 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_21990 2327751 2327032 gene locus_tag LOCUS_22000 gene rplC 2327751 2327032 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_22000 2328209 2327889 gene locus_tag LOCUS_22010 gene rpsJ 2328209 2327889 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 protein_id gnl|my_center|LOCUS_22010 2328885 2328589 gene locus_tag LOCUS_22020 2328885 2328589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 2329276 2328896 gene locus_tag LOCUS_22030 2329276 2328896 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_22030 2329694 2329254 gene locus_tag LOCUS_22040 2329694 2329254 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062081852.1 protein_id gnl|my_center|LOCUS_22040 2331265 2329691 gene locus_tag LOCUS_22050 2331265 2329691 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 protein_id gnl|my_center|LOCUS_22050 2332085 2331282 gene locus_tag LOCUS_22060 gene pgeF 2332085 2331282 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839662.1 protein_id gnl|my_center|LOCUS_22060 2334846 2332078 gene locus_tag LOCUS_22070 gene secA 2334846 2332078 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_22070 2335028 2336512 gene locus_tag LOCUS_22080 2335028 2336512 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_22080 2336638 2336711 gene locus_tag LOCUS_t00490 2336638 2336711 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2336745 2336821 gene locus_tag LOCUS_t00500 2336745 2336821 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2336835 2336910 gene locus_tag LOCUS_t00510 2336835 2336910 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2336963 2337036 gene locus_tag LOCUS_t00520 2336963 2337036 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2337100 2337175 gene locus_tag LOCUS_t00530 2337100 2337175 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2337692 2337369 gene locus_tag LOCUS_22090 2337692 2337369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2338432 2337689 gene locus_tag LOCUS_22100 2338432 2337689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2338680 2338495 gene locus_tag LOCUS_22110 2338680 2338495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2339281 2338841 gene locus_tag LOCUS_22120 2339281 2338841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 2339544 2339302 gene locus_tag LOCUS_22130 2339544 2339302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2340119 2339619 gene locus_tag LOCUS_22140 2340119 2339619 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360775.1 protein_id gnl|my_center|LOCUS_22140 2340427 2340179 gene locus_tag LOCUS_22150 2340427 2340179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 2341383 2341772 gene locus_tag LOCUS_22160 2341383 2341772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 2342287 2343069 gene locus_tag LOCUS_22170 2342287 2343069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2343079 2343222 gene locus_tag LOCUS_22180 2343079 2343222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2343313 2344722 gene locus_tag LOCUS_22190 2343313 2344722 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_22190 2344732 2345076 gene locus_tag LOCUS_22200 2344732 2345076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2345069 2346778 gene locus_tag LOCUS_22210 2345069 2346778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2346890 2347789 gene locus_tag LOCUS_22220 2346890 2347789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2347853 2348905 gene locus_tag LOCUS_22230 2347853 2348905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2348965 2349393 gene locus_tag LOCUS_22240 2348965 2349393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2349399 2351171 gene locus_tag LOCUS_22250 2349399 2351171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2351183 2352247 gene locus_tag LOCUS_22260 2351183 2352247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2352279 2352608 gene locus_tag LOCUS_22270 2352279 2352608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2352605 2353426 gene locus_tag LOCUS_22280 2352605 2353426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2353428 2355347 gene locus_tag LOCUS_22290 2353428 2355347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2355360 2356208 gene locus_tag LOCUS_22300 2355360 2356208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2356225 2356488 gene locus_tag LOCUS_22310 2356225 2356488 CDS product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384371.1 protein_id gnl|my_center|LOCUS_22310 2356491 2356736 gene locus_tag LOCUS_22320 2356491 2356736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2356807 2357967 gene locus_tag LOCUS_22330 2356807 2357967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 2357964 2363027 gene locus_tag LOCUS_22340 2357964 2363027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2363609 2363091 gene locus_tag LOCUS_22350 2363609 2363091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2363851 2363606 gene locus_tag LOCUS_22360 2363851 2363606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2364450 2363854 gene locus_tag LOCUS_22370 2364450 2363854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2364682 2364455 gene locus_tag LOCUS_22380 2364682 2364455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2365025 2364696 gene locus_tag LOCUS_22390 2365025 2364696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2365309 2365028 gene locus_tag LOCUS_22400 2365309 2365028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2365793 2365296 gene locus_tag LOCUS_22410 2365793 2365296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2366511 2365780 gene locus_tag LOCUS_22420 2366511 2365780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2366991 2366524 gene locus_tag LOCUS_22430 2366991 2366524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2367527 2366994 gene locus_tag LOCUS_22440 2367527 2366994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2367733 2367524 gene locus_tag LOCUS_22450 2367733 2367524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2368023 2367730 gene locus_tag LOCUS_22460 2368023 2367730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 2369576 2368011 gene locus_tag LOCUS_22470 2369576 2368011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2369932 2369576 gene locus_tag LOCUS_22480 2369932 2369576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2370087 2369932 gene locus_tag LOCUS_22490 2370087 2369932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 2371007 2370084 gene locus_tag LOCUS_22500 2371007 2370084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2371260 2371030 gene locus_tag LOCUS_22510 2371260 2371030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 2371502 2371260 gene locus_tag LOCUS_22520 2371502 2371260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2371763 2372239 gene locus_tag LOCUS_22530 2371763 2372239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2372381 2372247 gene locus_tag LOCUS_22540 2372381 2372247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2372532 2372915 gene locus_tag LOCUS_22550 2372532 2372915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2373504 2373803 gene locus_tag LOCUS_22560 2373504 2373803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2373800 2374816 gene locus_tag LOCUS_22570 2373800 2374816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2375730 2375242 gene locus_tag LOCUS_22580 2375730 2375242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2376115 2376630 gene locus_tag LOCUS_22590 2376115 2376630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2376708 2376851 gene locus_tag LOCUS_22600 2376708 2376851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2376841 2377254 gene locus_tag LOCUS_22610 2376841 2377254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2377369 2378142 gene locus_tag LOCUS_22620 gene yfaU 2377369 2378142 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992954.1 protein_id gnl|my_center|LOCUS_22620 2378541 2378200 gene locus_tag LOCUS_22630 2378541 2378200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2378789 2378610 gene locus_tag LOCUS_22640 2378789 2378610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640