>Feature sequence001 2390 1581 gene locus_tag LOCUS_00010 2390 1581 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_00010 3000 2392 gene locus_tag LOCUS_00020 3000 2392 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_00020 3298 3041 gene locus_tag LOCUS_00030 3298 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4254 3394 gene locus_tag LOCUS_00040 gene atpB 4254 3394 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908157.1 protein_id gnl|my_center|LOCUS_00040 4703 4251 gene locus_tag LOCUS_00050 4703 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4982 4755 gene locus_tag LOCUS_00060 4982 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6387 5257 gene locus_tag LOCUS_00070 6387 5257 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_00070 7093 6398 gene locus_tag LOCUS_00080 7093 6398 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_00080 7946 7098 gene locus_tag LOCUS_00090 gene prmC 7946 7098 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_00090 9019 7943 gene locus_tag LOCUS_00100 gene prfA 9019 7943 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_00100 9362 9120 gene locus_tag LOCUS_00110 gene rpmE 9362 9120 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229538.1 protein_id gnl|my_center|LOCUS_00110 11612 9534 gene locus_tag LOCUS_00120 gene rho 11612 9534 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030205.1 protein_id gnl|my_center|LOCUS_00120 12805 11879 gene locus_tag LOCUS_00130 gene thrB 12805 11879 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_00130 13887 12802 gene locus_tag LOCUS_00140 gene thrC 13887 12802 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_00140 15214 13907 gene locus_tag LOCUS_00150 15214 13907 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_00150 16692 15295 gene locus_tag LOCUS_00160 gene lysA 16692 15295 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775960.1 protein_id gnl|my_center|LOCUS_00160 18373 16694 gene locus_tag LOCUS_00170 gene argS 18373 16694 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 protein_id gnl|my_center|LOCUS_00170 18522 18595 gene locus_tag LOCUS_t00010 18522 18595 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18786 19349 gene locus_tag LOCUS_00180 18786 19349 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_00180 19858 19688 gene locus_tag LOCUS_00190 19858 19688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20328 19855 gene locus_tag LOCUS_00200 20328 19855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20875 20333 gene locus_tag LOCUS_00210 20875 20333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21153 20857 gene locus_tag LOCUS_00220 21153 20857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21465 23789 gene locus_tag LOCUS_00230 21465 23789 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950372.1 protein_id gnl|my_center|LOCUS_00230 24235 26250 gene locus_tag LOCUS_00240 24235 26250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26470 27108 gene locus_tag LOCUS_00250 26470 27108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27105 27485 gene locus_tag LOCUS_00260 27105 27485 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972099.1 protein_id gnl|my_center|LOCUS_00260 27482 27853 gene locus_tag LOCUS_00270 gene crcB 27482 27853 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 protein_id gnl|my_center|LOCUS_00270 28397 27930 gene locus_tag LOCUS_00280 28397 27930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225541.1 protein_id gnl|my_center|LOCUS_00280 29183 28620 gene locus_tag LOCUS_00290 29183 28620 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029611.1 protein_id gnl|my_center|LOCUS_00290 30132 29260 gene locus_tag LOCUS_00300 30132 29260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 30758 30147 gene locus_tag LOCUS_00310 30758 30147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 31137 34928 gene locus_tag LOCUS_00320 31137 34928 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_00320 34942 35121 gene locus_tag LOCUS_00330 34942 35121 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_00330 35392 36147 gene locus_tag LOCUS_00340 35392 36147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36223 37848 gene locus_tag LOCUS_00350 36223 37848 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420837.1 protein_id gnl|my_center|LOCUS_00350 38614 37901 gene locus_tag LOCUS_00360 38614 37901 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533117.1 protein_id gnl|my_center|LOCUS_00360 39713 38622 gene locus_tag LOCUS_00370 39713 38622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 41062 39728 gene locus_tag LOCUS_00380 41062 39728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 42351 41059 gene locus_tag LOCUS_00390 42351 41059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 43331 42348 gene locus_tag LOCUS_00400 43331 42348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 43906 43382 gene locus_tag LOCUS_00410 43906 43382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 45074 43911 gene locus_tag LOCUS_00420 45074 43911 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_00420 46075 45071 gene locus_tag LOCUS_00430 46075 45071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 47364 46072 gene locus_tag LOCUS_00440 47364 46072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 48883 47429 gene locus_tag LOCUS_00450 48883 47429 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405205.1 protein_id gnl|my_center|LOCUS_00450 50419 48896 gene locus_tag LOCUS_00460 50419 48896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 51603 50416 gene locus_tag LOCUS_00470 51603 50416 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_00470 52363 51689 gene locus_tag LOCUS_00480 52363 51689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00480 53062 52448 gene locus_tag LOCUS_00490 53062 52448 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030074.1 protein_id gnl|my_center|LOCUS_00490 53700 53059 gene locus_tag LOCUS_00500 53700 53059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 54966 53998 gene locus_tag LOCUS_00510 54966 53998 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_00510 56203 55013 gene locus_tag LOCUS_00520 56203 55013 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_00520 56563 56213 gene locus_tag LOCUS_00530 56563 56213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 56680 57081 gene locus_tag LOCUS_00540 gene sodN 56680 57081 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_00540 57235 57618 gene locus_tag LOCUS_00550 57235 57618 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_00550 57631 58434 gene locus_tag LOCUS_00560 57631 58434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 58877 58431 gene locus_tag LOCUS_00570 58877 58431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 60010 60261 gene locus_tag LOCUS_00580 60010 60261 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_00580 61732 60269 gene locus_tag LOCUS_00590 61732 60269 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_00590 61866 62180 gene locus_tag LOCUS_00600 61866 62180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 62177 63835 gene locus_tag LOCUS_00610 62177 63835 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973742.1 protein_id gnl|my_center|LOCUS_00610 63845 65509 gene locus_tag LOCUS_00620 63845 65509 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908709.1 protein_id gnl|my_center|LOCUS_00620 65515 66015 gene locus_tag LOCUS_00630 65515 66015 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223567.1 protein_id gnl|my_center|LOCUS_00630 66096 66761 gene locus_tag LOCUS_00640 66096 66761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 67195 66776 gene locus_tag LOCUS_00650 67195 66776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 67646 67374 gene locus_tag LOCUS_00660 gene rsrA 67646 67374 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973755.1 protein_id gnl|my_center|LOCUS_00660 68317 67643 gene locus_tag LOCUS_00670 gene sigR 68317 67643 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_00670 68286 68483 gene locus_tag LOCUS_00680 68286 68483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 69149 68463 gene locus_tag LOCUS_00690 69149 68463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973757.1 protein_id gnl|my_center|LOCUS_00690 69925 69146 gene locus_tag LOCUS_00700 69925 69146 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_00700 70710 69949 gene locus_tag LOCUS_00710 70710 69949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222899.1 protein_id gnl|my_center|LOCUS_00710 70954 75978 gene locus_tag LOCUS_00720 70954 75978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 76096 76707 gene locus_tag LOCUS_00730 76096 76707 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230942.1 protein_id gnl|my_center|LOCUS_00730 76775 78088 gene locus_tag LOCUS_00740 gene aroA 76775 78088 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_00740 78095 79153 gene locus_tag LOCUS_00750 gene rsgA 78095 79153 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_00750 79698 79228 gene locus_tag LOCUS_00760 79698 79228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 79848 80747 gene locus_tag LOCUS_00770 gene hisN 79848 80747 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_00770 81438 80692 gene locus_tag LOCUS_00780 81438 80692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 81543 81980 gene locus_tag LOCUS_00790 81543 81980 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729927.1 protein_id gnl|my_center|LOCUS_00790 >Feature sequence002 2926 242 gene locus_tag LOCUS_00800 gene valS 2926 242 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_00800 2975 4342 gene locus_tag LOCUS_00810 2975 4342 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_00810 4363 4725 gene locus_tag LOCUS_00820 4363 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 4782 5189 gene locus_tag LOCUS_00830 gene ndk 4782 5189 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412592.1 protein_id gnl|my_center|LOCUS_00830 5423 6124 gene locus_tag LOCUS_00840 5423 6124 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223636.1 protein_id gnl|my_center|LOCUS_00840 6289 7314 gene locus_tag LOCUS_00850 6289 7314 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_00850 7323 8243 gene locus_tag LOCUS_00860 gene mreC 7323 8243 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_00860 8240 8755 gene locus_tag LOCUS_00870 8240 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 8755 10914 gene locus_tag LOCUS_00880 gene mrdA 8755 10914 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_00880 10911 12128 gene locus_tag LOCUS_00890 gene rodA 10911 12128 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_00890 12186 14210 gene locus_tag LOCUS_00900 12186 14210 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_00900 15519 14275 gene locus_tag LOCUS_00910 15519 14275 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_00910 15591 16385 gene locus_tag LOCUS_00920 15591 16385 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_00920 16600 20529 gene locus_tag LOCUS_00930 16600 20529 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028446.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00930 20579 21007 gene locus_tag LOCUS_00940 20579 21007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 21090 21347 gene locus_tag LOCUS_00950 gene rpmA 21090 21347 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_00950 21509 23119 gene locus_tag LOCUS_00960 gene obgE 21509 23119 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_00960 23116 24240 gene locus_tag LOCUS_00970 gene proB 23116 24240 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_00970 24418 24801 gene locus_tag LOCUS_00980 24418 24801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 24827 26086 gene locus_tag LOCUS_00990 24827 26086 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_00990 26102 27277 gene locus_tag LOCUS_01000 26102 27277 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224665.1 protein_id gnl|my_center|LOCUS_01000 27337 27957 gene locus_tag LOCUS_01010 27337 27957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 27968 28114 gene locus_tag LOCUS_01020 27968 28114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 28136 28801 gene locus_tag LOCUS_01030 gene nadD 28136 28801 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_01030 28801 29181 gene locus_tag LOCUS_01040 gene rsfS 28801 29181 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_01040 29178 29822 gene locus_tag LOCUS_01050 29178 29822 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084950.1 protein_id gnl|my_center|LOCUS_01050 29902 29977 gene locus_tag LOCUS_t00020 29902 29977 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 30307 29966 gene locus_tag LOCUS_01060 30307 29966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 30501 30740 gene locus_tag LOCUS_01070 30501 30740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228333.1 protein_id gnl|my_center|LOCUS_01070 31552 31043 gene locus_tag LOCUS_01080 31552 31043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 32410 31649 gene locus_tag LOCUS_01090 32410 31649 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_01090 33429 32407 gene locus_tag LOCUS_01100 gene galE 33429 32407 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 protein_id gnl|my_center|LOCUS_01100 33579 35267 gene locus_tag LOCUS_01110 33579 35267 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229498.1 protein_id gnl|my_center|LOCUS_01110 35281 35601 gene locus_tag LOCUS_01120 35281 35601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229497.1 protein_id gnl|my_center|LOCUS_01120 35833 36213 gene locus_tag LOCUS_01130 35833 36213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 36437 38944 gene locus_tag LOCUS_01140 gene leuS 36437 38944 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_01140 39865 39221 gene locus_tag LOCUS_01150 39865 39221 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222032.1 protein_id gnl|my_center|LOCUS_01150 39955 40815 gene locus_tag LOCUS_01160 39955 40815 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_01160 40923 41900 gene locus_tag LOCUS_01170 40923 41900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 41900 44233 gene locus_tag LOCUS_01180 41900 44233 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 protein_id gnl|my_center|LOCUS_01180 46078 44282 gene locus_tag LOCUS_01190 46078 44282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 46281 47261 gene locus_tag LOCUS_01200 gene holA 46281 47261 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165922484.1 protein_id gnl|my_center|LOCUS_01200 47593 47333 gene locus_tag LOCUS_01210 gene rpsT 47593 47333 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907833.1 protein_id gnl|my_center|LOCUS_01210 48750 47773 gene locus_tag LOCUS_01220 48750 47773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 48913 50829 gene locus_tag LOCUS_01230 gene lepA 48913 50829 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083190386.1 protein_id gnl|my_center|LOCUS_01230 50844 51776 gene locus_tag LOCUS_01240 50844 51776 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_01240 51783 52469 gene locus_tag LOCUS_01250 51783 52469 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894928.1 protein_id gnl|my_center|LOCUS_01250 52564 54405 gene locus_tag LOCUS_01260 52564 54405 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_01260 54494 55723 gene locus_tag LOCUS_01270 gene hemW 54494 55723 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_01270 56559 55774 gene locus_tag LOCUS_01280 56559 55774 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728763.1 protein_id gnl|my_center|LOCUS_01280 56779 57432 gene locus_tag LOCUS_01290 56779 57432 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223869.1 protein_id gnl|my_center|LOCUS_01290 57429 57860 gene locus_tag LOCUS_01300 57429 57860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 58813 57932 gene locus_tag LOCUS_01310 58813 57932 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228583.1 protein_id gnl|my_center|LOCUS_01310 58844 59917 gene locus_tag LOCUS_01320 gene hrcA 58844 59917 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_01320 59925 61100 gene locus_tag LOCUS_01330 gene dnaJ 59925 61100 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_01330 61097 61834 gene locus_tag LOCUS_01340 61097 61834 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_01340 63005 62046 gene locus_tag LOCUS_01350 63005 62046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 63535 63002 gene locus_tag LOCUS_01360 63535 63002 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284396.1 protein_id gnl|my_center|LOCUS_01360 63633 63983 gene locus_tag LOCUS_01370 63633 63983 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_01370 64322 64053 gene locus_tag LOCUS_01380 64322 64053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 64595 66652 gene locus_tag LOCUS_01390 64595 66652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 >Feature sequence003 1131 190 gene locus_tag LOCUS_01400 1131 190 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225966.1 protein_id gnl|my_center|LOCUS_01400 1408 1220 gene locus_tag LOCUS_01410 1408 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 2190 1405 gene locus_tag LOCUS_01420 2190 1405 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775747.1 protein_id gnl|my_center|LOCUS_01420 3214 2192 gene locus_tag LOCUS_01430 3214 2192 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730921.1 protein_id gnl|my_center|LOCUS_01430 4065 3211 gene locus_tag LOCUS_01440 4065 3211 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_01440 5266 4067 gene locus_tag LOCUS_01450 5266 4067 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427766.1 protein_id gnl|my_center|LOCUS_01450 6857 5328 gene locus_tag LOCUS_01460 6857 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 7010 7507 gene locus_tag LOCUS_01470 gene tamR 7010 7507 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_01470 9506 7719 gene locus_tag LOCUS_01480 9506 7719 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_01480 10440 9508 gene locus_tag LOCUS_01490 10440 9508 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028794.1 protein_id gnl|my_center|LOCUS_01490 11339 10437 gene locus_tag LOCUS_01500 gene rsmA 11339 10437 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_01500 12522 11383 gene locus_tag LOCUS_01510 12522 11383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 13753 12854 gene locus_tag LOCUS_01520 13753 12854 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_01520 14627 13746 gene locus_tag LOCUS_01530 gene rsmI 14627 13746 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_01530 14727 16388 gene locus_tag LOCUS_01540 14727 16388 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_01540 16492 16803 gene locus_tag LOCUS_01550 16492 16803 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405748.1 protein_id gnl|my_center|LOCUS_01550 17093 18328 gene locus_tag LOCUS_01560 17093 18328 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083253.1 protein_id gnl|my_center|LOCUS_01560 19582 18377 gene locus_tag LOCUS_01570 gene hppD 19582 18377 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083248.1 protein_id gnl|my_center|LOCUS_01570 19657 20247 gene locus_tag LOCUS_01580 19657 20247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 21150 20356 gene locus_tag LOCUS_01590 21150 20356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 23439 21595 gene locus_tag LOCUS_01600 23439 21595 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104754.1 protein_id gnl|my_center|LOCUS_01600 24589 23669 gene locus_tag LOCUS_01610 24589 23669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 25909 24641 gene locus_tag LOCUS_01620 25909 24641 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230812.1 protein_id gnl|my_center|LOCUS_01620 25977 26978 gene locus_tag LOCUS_01630 25977 26978 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284397.1 protein_id gnl|my_center|LOCUS_01630 28655 27006 gene locus_tag LOCUS_01640 28655 27006 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090223.1 protein_id gnl|my_center|LOCUS_01640 29182 28670 gene locus_tag LOCUS_01650 29182 28670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 30167 29346 gene locus_tag LOCUS_01660 30167 29346 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223802.1 protein_id gnl|my_center|LOCUS_01660 30280 30600 gene locus_tag LOCUS_01670 30280 30600 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776253.1 protein_id gnl|my_center|LOCUS_01670 30678 31619 gene locus_tag LOCUS_01680 30678 31619 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230081.1 protein_id gnl|my_center|LOCUS_01680 32543 31710 gene locus_tag LOCUS_01690 32543 31710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 32621 33424 gene locus_tag LOCUS_01700 32621 33424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 33424 34149 gene locus_tag LOCUS_01710 33424 34149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 34939 34172 gene locus_tag LOCUS_01720 34939 34172 CDS product Stf0 family sulphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510205.1 protein_id gnl|my_center|LOCUS_01720 36515 34944 gene locus_tag LOCUS_01730 36515 34944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 38361 36550 gene locus_tag LOCUS_01740 38361 36550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 39926 38358 gene locus_tag LOCUS_01750 39926 38358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 42160 39923 gene locus_tag LOCUS_01760 42160 39923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 43256 42372 gene locus_tag LOCUS_01770 43256 42372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 43419 44291 gene locus_tag LOCUS_01780 43419 44291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 44639 44953 gene locus_tag LOCUS_01790 44639 44953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01790 45074 45436 gene locus_tag LOCUS_01800 45074 45436 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 protein_id gnl|my_center|LOCUS_01800 45461 46678 gene locus_tag LOCUS_01810 45461 46678 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228768.1 protein_id gnl|my_center|LOCUS_01810 47561 46776 gene locus_tag LOCUS_01820 47561 46776 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223724.1 protein_id gnl|my_center|LOCUS_01820 48392 47577 gene locus_tag LOCUS_01830 48392 47577 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_01830 49498 48389 gene locus_tag LOCUS_01840 49498 48389 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_01840 49636 50034 gene locus_tag LOCUS_01850 49636 50034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01850 49964 50197 gene locus_tag LOCUS_01860 49964 50197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01860 51181 50366 gene locus_tag LOCUS_01870 51181 50366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244800.1 protein_id gnl|my_center|LOCUS_01870 51440 51859 gene locus_tag LOCUS_01880 51440 51859 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888981.1 protein_id gnl|my_center|LOCUS_01880 52485 51841 gene locus_tag LOCUS_01890 52485 51841 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166534399.1 protein_id gnl|my_center|LOCUS_01890 54058 53327 gene locus_tag LOCUS_01900 54058 53327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 54750 54349 gene locus_tag LOCUS_01910 54750 54349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129903.1 protein_id gnl|my_center|LOCUS_01910 55857 54964 gene locus_tag LOCUS_01920 55857 54964 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222388.1 protein_id gnl|my_center|LOCUS_01920 55997 58828 gene locus_tag LOCUS_01930 55997 58828 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224347.1 protein_id gnl|my_center|LOCUS_01930 59349 58825 gene locus_tag LOCUS_01940 59349 58825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 59851 60105 gene locus_tag LOCUS_01950 59851 60105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 60703 60350 gene locus_tag LOCUS_01960 60703 60350 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727431.1 protein_id gnl|my_center|LOCUS_01960 60848 61528 gene locus_tag LOCUS_01970 60848 61528 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727432.1 protein_id gnl|my_center|LOCUS_01970 61854 62468 gene locus_tag LOCUS_01980 61854 62468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 62426 63181 gene locus_tag LOCUS_01990 62426 63181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 63206 63655 gene locus_tag LOCUS_02000 63206 63655 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928568.1 protein_id gnl|my_center|LOCUS_02000 64064 63696 gene locus_tag LOCUS_02010 64064 63696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 64473 64030 gene locus_tag LOCUS_02020 64473 64030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 64538 64846 gene locus_tag LOCUS_02030 64538 64846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 >Feature sequence004 1022 75 gene locus_tag LOCUS_02040 1022 75 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_02040 1236 1318 gene locus_tag LOCUS_t00030 1236 1318 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1377 2918 gene locus_tag LOCUS_02050 gene glmU 1377 2918 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929929.1 protein_id gnl|my_center|LOCUS_02050 2977 3960 gene locus_tag LOCUS_02060 2977 3960 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229964.1 protein_id gnl|my_center|LOCUS_02060 4222 4914 gene locus_tag LOCUS_02070 4222 4914 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405254.1 protein_id gnl|my_center|LOCUS_02070 4930 5523 gene locus_tag LOCUS_02080 gene pth 4930 5523 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_02080 5812 7287 gene locus_tag LOCUS_02090 5812 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7404 8210 gene locus_tag LOCUS_02100 7404 8210 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_02100 8230 8937 gene locus_tag LOCUS_02110 8230 8937 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886938.1 protein_id gnl|my_center|LOCUS_02110 9866 8904 gene locus_tag LOCUS_02120 gene ligD 9866 8904 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226451.1 protein_id gnl|my_center|LOCUS_02120 10093 13728 gene locus_tag LOCUS_02130 gene mfd 10093 13728 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_02130 13746 14432 gene locus_tag LOCUS_02140 13746 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 14435 15361 gene locus_tag LOCUS_02150 14435 15361 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 protein_id gnl|my_center|LOCUS_02150 15475 16761 gene locus_tag LOCUS_02160 gene eno 15475 16761 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_02160 16993 17427 gene locus_tag LOCUS_02170 16993 17427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 17424 17939 gene locus_tag LOCUS_02180 17424 17939 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_02180 17936 18859 gene locus_tag LOCUS_02190 17936 18859 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_02190 20864 18873 gene locus_tag LOCUS_02200 20864 18873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 21254 22753 gene locus_tag LOCUS_02210 21254 22753 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148882924.1 protein_id gnl|my_center|LOCUS_02210 22910 24862 gene locus_tag LOCUS_02220 22910 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 24909 25742 gene locus_tag LOCUS_02230 24909 25742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 25739 26890 gene locus_tag LOCUS_02240 25739 26890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 26980 27765 gene locus_tag LOCUS_02250 26980 27765 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836183.1 protein_id gnl|my_center|LOCUS_02250 27965 33457 gene locus_tag LOCUS_02260 27965 33457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 33729 34628 gene locus_tag LOCUS_02270 33729 34628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 35443 34670 gene locus_tag LOCUS_02280 35443 34670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 35794 37323 gene locus_tag LOCUS_02290 35794 37323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 37908 37435 gene locus_tag LOCUS_02300 37908 37435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 37964 38959 gene locus_tag LOCUS_02310 37964 38959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 39163 41811 gene locus_tag LOCUS_02320 39163 41811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 41826 43403 gene locus_tag LOCUS_02330 41826 43403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 43682 43912 gene locus_tag LOCUS_02340 43682 43912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 44075 44341 gene locus_tag LOCUS_02350 44075 44341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 47474 45054 gene locus_tag LOCUS_02360 47474 45054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 47713 48561 gene locus_tag LOCUS_02370 47713 48561 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730268.1 protein_id gnl|my_center|LOCUS_02370 48583 48658 gene locus_tag LOCUS_t00040 48583 48658 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48824 49126 gene locus_tag LOCUS_02380 48824 49126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 49312 50175 gene locus_tag LOCUS_02390 49312 50175 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_02390 51260 50238 gene locus_tag LOCUS_02400 51260 50238 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 protein_id gnl|my_center|LOCUS_02400 51296 52672 gene locus_tag LOCUS_02410 51296 52672 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229841.1 protein_id gnl|my_center|LOCUS_02410 53620 52736 gene locus_tag LOCUS_02420 53620 52736 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_02420 53711 54523 gene locus_tag LOCUS_02430 53711 54523 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_02430 54555 55337 gene locus_tag LOCUS_02440 54555 55337 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805161.1 protein_id gnl|my_center|LOCUS_02440 55385 56128 gene locus_tag LOCUS_02450 55385 56128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 56130 56618 gene locus_tag LOCUS_02460 56130 56618 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027466.1 protein_id gnl|my_center|LOCUS_02460 58404 56674 gene locus_tag LOCUS_02470 58404 56674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 58804 58415 gene locus_tag LOCUS_02480 58804 58415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence005 783 13 gene locus_tag LOCUS_02490 gene hisF 783 13 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 protein_id gnl|my_center|LOCUS_02490 1514 780 gene locus_tag LOCUS_02500 gene priA 1514 780 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976766.1 protein_id gnl|my_center|LOCUS_02500 2175 1543 gene locus_tag LOCUS_02510 2175 1543 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_02510 2211 4046 gene locus_tag LOCUS_02520 2211 4046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_02520 4073 5845 gene locus_tag LOCUS_02530 4073 5845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_02530 5883 6248 gene locus_tag LOCUS_02540 gene hisI 5883 6248 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_02540 6248 6829 gene locus_tag LOCUS_02550 6248 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 6895 7104 gene locus_tag LOCUS_02560 6895 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 7115 7543 gene locus_tag LOCUS_02570 7115 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 8047 7562 gene locus_tag LOCUS_02580 8047 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 8162 8968 gene locus_tag LOCUS_02590 gene trpC 8162 8968 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_02590 8982 10277 gene locus_tag LOCUS_02600 gene trpB 8982 10277 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_02600 10274 11083 gene locus_tag LOCUS_02610 gene trpA 10274 11083 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224169.1 protein_id gnl|my_center|LOCUS_02610 11076 12044 gene locus_tag LOCUS_02620 gene lgt 11076 12044 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971316.1 protein_id gnl|my_center|LOCUS_02620 12107 12841 gene locus_tag LOCUS_02630 12107 12841 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_02630 13032 17564 gene locus_tag LOCUS_02640 gene gltB 13032 17564 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_02640 17603 19069 gene locus_tag LOCUS_02650 17603 19069 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976791.1 protein_id gnl|my_center|LOCUS_02650 19242 20609 gene locus_tag LOCUS_02660 gene pyk 19242 20609 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_02660 21437 20658 gene locus_tag LOCUS_02670 21437 20658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 21565 21482 gene locus_tag LOCUS_t00050 21565 21482 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21678 22280 gene locus_tag LOCUS_02680 21678 22280 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_02680 22444 23739 gene locus_tag LOCUS_02690 22444 23739 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_02690 24615 23836 gene locus_tag LOCUS_02700 24615 23836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_02700 25648 24608 gene locus_tag LOCUS_02710 25648 24608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 26636 25638 gene locus_tag LOCUS_02720 26636 25638 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809696.1 protein_id gnl|my_center|LOCUS_02720 28040 26649 gene locus_tag LOCUS_02730 28040 26649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 29046 28252 gene locus_tag LOCUS_02740 29046 28252 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_02740 29239 29829 gene locus_tag LOCUS_02750 29239 29829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 29877 32621 gene locus_tag LOCUS_02760 gene polA 29877 32621 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111138.1 protein_id gnl|my_center|LOCUS_02760 34085 32805 gene locus_tag LOCUS_02770 34085 32805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 34912 34082 gene locus_tag LOCUS_02780 34912 34082 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_02780 35140 36639 gene locus_tag LOCUS_02790 gene rpsA 35140 36639 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_02790 36921 36739 gene locus_tag LOCUS_02800 36921 36739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 37003 37971 gene locus_tag LOCUS_02810 37003 37971 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055585491.1 protein_id gnl|my_center|LOCUS_02810 37976 38572 gene locus_tag LOCUS_02820 37976 38572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 39573 38623 gene locus_tag LOCUS_02830 39573 38623 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_02830 42022 39827 gene locus_tag LOCUS_02840 42022 39827 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898586.1 protein_id gnl|my_center|LOCUS_02840 43435 42032 gene locus_tag LOCUS_02850 43435 42032 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027755.1 protein_id gnl|my_center|LOCUS_02850 43657 44661 gene locus_tag LOCUS_02860 43657 44661 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179809238.1 protein_id gnl|my_center|LOCUS_02860 44710 46179 gene locus_tag LOCUS_02870 44710 46179 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_02870 46890 46372 gene locus_tag LOCUS_02880 46890 46372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 47050 47457 gene locus_tag LOCUS_02890 47050 47457 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 protein_id gnl|my_center|LOCUS_02890 47769 49166 gene locus_tag LOCUS_02900 47769 49166 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973202.1 protein_id gnl|my_center|LOCUS_02900 49580 49852 gene locus_tag LOCUS_02910 49580 49852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 50733 49864 gene locus_tag LOCUS_02920 50733 49864 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729048.1 protein_id gnl|my_center|LOCUS_02920 51259 50783 gene locus_tag LOCUS_02930 51259 50783 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079757.1 protein_id gnl|my_center|LOCUS_02930 51622 51392 gene locus_tag LOCUS_02940 51622 51392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_02940 52039 54129 gene locus_tag LOCUS_02950 52039 54129 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_02950 54637 54140 gene locus_tag LOCUS_02960 54637 54140 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 protein_id gnl|my_center|LOCUS_02960 56370 54634 gene locus_tag LOCUS_02970 56370 54634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 57106 56384 gene locus_tag LOCUS_02980 57106 56384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 <58561 57185 gene locus_tag LOCUS_02990 <58561 57185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030487.1:DNA topoisomerase IV subunit A >Feature sequence006 1234 173 gene locus_tag LOCUS_03000 1234 173 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_03000 2073 1255 gene locus_tag LOCUS_03010 2073 1255 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_03010 2530 2111 gene locus_tag LOCUS_03020 gene rplT 2530 2111 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_03020 2792 2598 gene locus_tag LOCUS_03030 gene rpmI 2792 2598 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_03030 3848 2874 gene locus_tag LOCUS_03040 3848 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 3967 4278 gene locus_tag LOCUS_03050 3967 4278 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977223.1 protein_id gnl|my_center|LOCUS_03050 4756 4241 gene locus_tag LOCUS_03060 4756 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 4801 5355 gene locus_tag LOCUS_03070 4801 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 5518 5700 gene locus_tag LOCUS_03080 5518 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 5831 6013 gene locus_tag LOCUS_03090 5831 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 6010 6630 gene locus_tag LOCUS_03100 6010 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03100 7721 6735 gene locus_tag LOCUS_03110 7721 6735 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_03110 8987 7851 gene locus_tag LOCUS_03120 8987 7851 CDS product ring-opening amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393610.1 protein_id gnl|my_center|LOCUS_03120 9934 8987 gene locus_tag LOCUS_03130 gene arcC 9934 8987 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_03130 10605 9937 gene locus_tag LOCUS_03140 10605 9937 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977492.1 protein_id gnl|my_center|LOCUS_03140 12643 10739 gene locus_tag LOCUS_03150 12643 10739 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258126.1 protein_id gnl|my_center|LOCUS_03150 13851 12640 gene locus_tag LOCUS_03160 13851 12640 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975437.1 protein_id gnl|my_center|LOCUS_03160 16052 13908 gene locus_tag LOCUS_03170 16052 13908 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067631220.1 protein_id gnl|my_center|LOCUS_03170 17482 16049 gene locus_tag LOCUS_03180 17482 16049 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_03180 18186 17476 gene locus_tag LOCUS_03190 18186 17476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03190 20573 18183 gene locus_tag LOCUS_03200 20573 18183 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929962.1 protein_id gnl|my_center|LOCUS_03200 21097 20570 gene locus_tag LOCUS_03210 21097 20570 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_03210 21942 21094 gene locus_tag LOCUS_03220 21942 21094 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_03220 23422 21980 gene locus_tag LOCUS_03230 23422 21980 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977375.1 protein_id gnl|my_center|LOCUS_03230 24646 23663 gene locus_tag LOCUS_03240 24646 23663 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728692.1 protein_id gnl|my_center|LOCUS_03240 25437 24643 gene locus_tag LOCUS_03250 25437 24643 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070943583.1 protein_id gnl|my_center|LOCUS_03250 26711 25434 gene locus_tag LOCUS_03260 26711 25434 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110021.1 protein_id gnl|my_center|LOCUS_03260 27351 26704 gene locus_tag LOCUS_03270 27351 26704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110018.1 protein_id gnl|my_center|LOCUS_03270 27523 28278 gene locus_tag LOCUS_03280 27523 28278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 28275 29753 gene locus_tag LOCUS_03290 gene fdrA 28275 29753 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_03290 29746 31137 gene locus_tag LOCUS_03300 29746 31137 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_03300 31680 31231 gene locus_tag LOCUS_03310 31680 31231 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977388.1 protein_id gnl|my_center|LOCUS_03310 32521 31664 gene locus_tag LOCUS_03320 gene hisG 32521 31664 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_03320 32800 32537 gene locus_tag LOCUS_03330 32800 32537 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054261.1 protein_id gnl|my_center|LOCUS_03330 32867 33007 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgagtcggcgcatccgcaggc 33612 33109 gene locus_tag LOCUS_03340 gene ribH 33612 33109 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977385.1 protein_id gnl|my_center|LOCUS_03340 34835 33609 gene locus_tag LOCUS_03350 34835 33609 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057753.1 protein_id gnl|my_center|LOCUS_03350 35554 34853 gene locus_tag LOCUS_03360 gene pnuC 35554 34853 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013360.1 protein_id gnl|my_center|LOCUS_03360 36165 35551 gene locus_tag LOCUS_03370 36165 35551 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_03370 37213 36167 gene locus_tag LOCUS_03380 gene ribD 37213 36167 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803669.1 protein_id gnl|my_center|LOCUS_03380 38121 37462 gene locus_tag LOCUS_03390 gene rpe 38121 37462 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_03390 39594 38197 gene locus_tag LOCUS_03400 39594 38197 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_03400 40517 39591 gene locus_tag LOCUS_03410 gene fmt 40517 39591 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_03410 41062 40517 gene locus_tag LOCUS_03420 gene def 41062 40517 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_03420 43577 41289 gene locus_tag LOCUS_03430 43577 41289 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 protein_id gnl|my_center|LOCUS_03430 45011 43815 gene locus_tag LOCUS_03440 gene metK 45011 43815 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_03440 46369 45089 gene locus_tag LOCUS_03450 gene coaBC 46369 45089 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_03450 46686 46381 gene locus_tag LOCUS_03460 gene rpoZ 46686 46381 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_03460 47290 46727 gene locus_tag LOCUS_03470 gene gmk 47290 46727 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_03470 47662 47342 gene locus_tag LOCUS_03480 47662 47342 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_03480 49841 47784 gene locus_tag LOCUS_03490 49841 47784 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226475.1 protein_id gnl|my_center|LOCUS_03490 50763 49930 gene locus_tag LOCUS_03500 gene pyrF 50763 49930 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_03500 51860 50760 gene locus_tag LOCUS_03510 51860 50760 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_03510 55171 51857 gene locus_tag LOCUS_03520 gene carB 55171 51857 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_03520 56324 55158 gene locus_tag LOCUS_03530 gene carA 56324 55158 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_03530 56887 56321 gene locus_tag LOCUS_03540 56887 56321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence007 285 1505 gene locus_tag LOCUS_03550 285 1505 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400620.1 protein_id gnl|my_center|LOCUS_03550 1836 1630 gene locus_tag LOCUS_03560 1836 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1993 2436 gene locus_tag LOCUS_03570 1993 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 2539 2997 gene locus_tag LOCUS_03580 2539 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223347.1 protein_id gnl|my_center|LOCUS_03580 3301 3921 gene locus_tag LOCUS_03590 3301 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 4848 3973 gene locus_tag LOCUS_03600 4848 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467192.1 protein_id gnl|my_center|LOCUS_03600 6305 4935 gene locus_tag LOCUS_03610 gene glnT 6305 4935 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897682.1 protein_id gnl|my_center|LOCUS_03610 7698 6313 gene locus_tag LOCUS_03620 7698 6313 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367224.1 protein_id gnl|my_center|LOCUS_03620 8420 7698 gene locus_tag LOCUS_03630 8420 7698 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762866.1 protein_id gnl|my_center|LOCUS_03630 9325 8408 gene locus_tag LOCUS_03640 9325 8408 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532904.1 protein_id gnl|my_center|LOCUS_03640 10187 9486 gene locus_tag LOCUS_03650 10187 9486 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895268.1 protein_id gnl|my_center|LOCUS_03650 10233 10874 gene locus_tag LOCUS_03660 10233 10874 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897687.1 protein_id gnl|my_center|LOCUS_03660 11028 12278 gene locus_tag LOCUS_03670 11028 12278 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246879.1 protein_id gnl|my_center|LOCUS_03670 12312 12593 gene locus_tag LOCUS_03680 12312 12593 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_03680 12590 15451 gene locus_tag LOCUS_03690 12590 15451 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524300.1 protein_id gnl|my_center|LOCUS_03690 15444 16109 gene locus_tag LOCUS_03700 15444 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 16123 16710 gene locus_tag LOCUS_03710 16123 16710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 17542 16844 gene locus_tag LOCUS_03720 17542 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 19084 17615 gene locus_tag LOCUS_03730 19084 17615 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532523.1 protein_id gnl|my_center|LOCUS_03730 19278 19081 gene locus_tag LOCUS_03740 19278 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 19739 19275 gene locus_tag LOCUS_03750 19739 19275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067502.1 protein_id gnl|my_center|LOCUS_03750 20131 19736 gene locus_tag LOCUS_03760 20131 19736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 21002 21358 gene locus_tag LOCUS_03770 21002 21358 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831581.1 protein_id gnl|my_center|LOCUS_03770 21491 22108 gene locus_tag LOCUS_03780 21491 22108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 22968 22177 gene locus_tag LOCUS_03790 22968 22177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 26008 23315 gene locus_tag LOCUS_03800 26008 23315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 27911 26022 gene locus_tag LOCUS_03810 27911 26022 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226676.1 protein_id gnl|my_center|LOCUS_03810 29230 27911 gene locus_tag LOCUS_03820 29230 27911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 30750 29227 gene locus_tag LOCUS_03830 30750 29227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 32699 30747 gene locus_tag LOCUS_03840 32699 30747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 35175 32728 gene locus_tag LOCUS_03850 35175 32728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 37625 35175 gene locus_tag LOCUS_03860 37625 35175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 38047 37625 gene locus_tag LOCUS_03870 38047 37625 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974730.1 protein_id gnl|my_center|LOCUS_03870 38691 38047 gene locus_tag LOCUS_03880 38691 38047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 39392 38688 gene locus_tag LOCUS_03890 39392 38688 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_03890 40459 39389 gene locus_tag LOCUS_03900 40459 39389 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941649.1 protein_id gnl|my_center|LOCUS_03900 40629 40459 gene locus_tag LOCUS_03910 40629 40459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 41413 40643 gene locus_tag LOCUS_03920 41413 40643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 41964 41410 gene locus_tag LOCUS_03930 41964 41410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 43433 41964 gene locus_tag LOCUS_03940 43433 41964 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226673.1 protein_id gnl|my_center|LOCUS_03940 43896 43441 gene locus_tag LOCUS_03950 43896 43441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 45698 43923 gene locus_tag LOCUS_03960 45698 43923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 46527 45748 gene locus_tag LOCUS_03970 46527 45748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 47096 46524 gene locus_tag LOCUS_03980 47096 46524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 47333 47746 gene locus_tag LOCUS_03990 47333 47746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 48190 47840 gene locus_tag LOCUS_04000 48190 47840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 49642 48515 gene locus_tag LOCUS_04010 49642 48515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 50083 50979 gene locus_tag LOCUS_04020 50083 50979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 51061 53175 gene locus_tag LOCUS_04030 51061 53175 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143126.1 protein_id gnl|my_center|LOCUS_04030 53353 53721 gene locus_tag LOCUS_04040 53353 53721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 53948 53640 gene locus_tag LOCUS_04050 53948 53640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 54294 53926 gene locus_tag LOCUS_04060 54294 53926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 54522 54677 gene locus_tag LOCUS_04070 54522 54677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 54693 54962 gene locus_tag LOCUS_04080 54693 54962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 55475 55203 gene locus_tag LOCUS_04090 55475 55203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 55689 55507 gene locus_tag LOCUS_04100 55689 55507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence008 1630 5241 gene locus_tag LOCUS_04110 gene smc 1630 5241 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_04110 5359 5526 gene locus_tag LOCUS_04120 5359 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 5703 6878 gene locus_tag LOCUS_04130 gene ftsY 5703 6878 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_04130 7049 8371 gene locus_tag LOCUS_04140 7049 8371 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_04140 8368 8706 gene locus_tag LOCUS_04150 8368 8706 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_04150 8844 9182 gene locus_tag LOCUS_04160 gene glnB 8844 9182 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414756.1 protein_id gnl|my_center|LOCUS_04160 9205 11472 gene locus_tag LOCUS_04170 9205 11472 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_04170 11552 13114 gene locus_tag LOCUS_04180 gene ffh 11552 13114 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_04180 13224 14384 gene locus_tag LOCUS_04190 13224 14384 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 protein_id gnl|my_center|LOCUS_04190 14803 14381 gene locus_tag LOCUS_04200 14803 14381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 15706 16248 gene locus_tag LOCUS_04210 gene rpsP 15706 16248 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111678.1 protein_id gnl|my_center|LOCUS_04210 16253 16495 gene locus_tag LOCUS_04220 16253 16495 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_04220 16537 17094 gene locus_tag LOCUS_04230 gene rimM 16537 17094 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 protein_id gnl|my_center|LOCUS_04230 17097 18275 gene locus_tag LOCUS_04240 17097 18275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 18513 18866 gene locus_tag LOCUS_04250 gene rplS 18513 18866 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 protein_id gnl|my_center|LOCUS_04250 18909 19661 gene locus_tag LOCUS_04260 18909 19661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04260 19706 20413 gene locus_tag LOCUS_04270 19706 20413 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728344.1 protein_id gnl|my_center|LOCUS_04270 20410 20718 gene locus_tag LOCUS_04280 20410 20718 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003965949.1 protein_id gnl|my_center|LOCUS_04280 20884 21267 gene locus_tag LOCUS_04290 20884 21267 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_04290 21269 22861 gene locus_tag LOCUS_04300 21269 22861 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_04300 22858 24009 gene locus_tag LOCUS_04310 gene dprA 22858 24009 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_04310 24044 25018 gene locus_tag LOCUS_04320 24044 25018 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728395.1 protein_id gnl|my_center|LOCUS_04320 25859 25044 gene locus_tag LOCUS_04330 25859 25044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 26292 27365 gene locus_tag LOCUS_04340 gene rpsB 26292 27365 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_04340 27490 28320 gene locus_tag LOCUS_04350 gene tsf 27490 28320 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899527.1 protein_id gnl|my_center|LOCUS_04350 28392 29108 gene locus_tag LOCUS_04360 gene pyrH 28392 29108 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973384.1 protein_id gnl|my_center|LOCUS_04360 29220 29777 gene locus_tag LOCUS_04370 gene frr 29220 29777 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_04370 29777 30601 gene locus_tag LOCUS_04380 29777 30601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04380 30691 31818 gene locus_tag LOCUS_04390 gene rlmN 30691 31818 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_04390 33076 31943 gene locus_tag LOCUS_04400 33076 31943 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284839.1 protein_id gnl|my_center|LOCUS_04400 33230 35116 gene locus_tag LOCUS_04410 33230 35116 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896800.1 protein_id gnl|my_center|LOCUS_04410 36443 35151 gene locus_tag LOCUS_04420 36443 35151 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_04420 37000 36557 gene locus_tag LOCUS_04430 37000 36557 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877152.1 protein_id gnl|my_center|LOCUS_04430 37228 38463 gene locus_tag LOCUS_04440 37228 38463 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973358.1 protein_id gnl|my_center|LOCUS_04440 38468 39655 gene locus_tag LOCUS_04450 38468 39655 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973357.1 protein_id gnl|my_center|LOCUS_04450 39652 40518 gene locus_tag LOCUS_04460 39652 40518 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_04460 40535 41332 gene locus_tag LOCUS_04470 40535 41332 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_04470 41451 42848 gene locus_tag LOCUS_04480 41451 42848 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226511.1 protein_id gnl|my_center|LOCUS_04480 44344 42935 gene locus_tag LOCUS_04490 44344 42935 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence009 135 743 gene locus_tag LOCUS_04500 135 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 922 2136 gene locus_tag LOCUS_04510 gene fdhA 922 2136 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 protein_id gnl|my_center|LOCUS_04510 2586 3101 gene locus_tag LOCUS_04520 2586 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3183 3365 gene locus_tag LOCUS_04530 3183 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 3491 3835 gene locus_tag LOCUS_04540 3491 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 3956 4711 gene locus_tag LOCUS_04550 3956 4711 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898763.1 protein_id gnl|my_center|LOCUS_04550 4962 5114 gene locus_tag LOCUS_04560 4962 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 5547 6161 gene locus_tag LOCUS_04570 5547 6161 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_04570 6151 7056 gene locus_tag LOCUS_04580 6151 7056 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 protein_id gnl|my_center|LOCUS_04580 7053 7385 gene locus_tag LOCUS_04590 7053 7385 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_04590 7378 8187 gene locus_tag LOCUS_04600 7378 8187 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027758.1 protein_id gnl|my_center|LOCUS_04600 8282 8668 gene locus_tag LOCUS_04610 gene gcvH 8282 8668 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908706.1 protein_id gnl|my_center|LOCUS_04610 8819 9370 gene locus_tag LOCUS_04620 8819 9370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 9376 10113 gene locus_tag LOCUS_04630 9376 10113 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_04630 10158 10625 gene locus_tag LOCUS_04640 10158 10625 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_04640 10826 11434 gene locus_tag LOCUS_04650 10826 11434 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_04650 11651 14551 gene locus_tag LOCUS_04660 gene gcvP 11651 14551 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_04660 14548 15879 gene locus_tag LOCUS_04670 14548 15879 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_04670 17483 16095 gene locus_tag LOCUS_04680 17483 16095 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_04680 19024 17498 gene locus_tag LOCUS_04690 19024 17498 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110223.1 protein_id gnl|my_center|LOCUS_04690 19565 19074 gene locus_tag LOCUS_04700 19565 19074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977943.1 protein_id gnl|my_center|LOCUS_04700 22736 19638 gene locus_tag LOCUS_04710 22736 19638 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229784.1 protein_id gnl|my_center|LOCUS_04710 23947 22736 gene locus_tag LOCUS_04720 23947 22736 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_04720 24869 23985 gene locus_tag LOCUS_04730 gene fdhD 24869 23985 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_04730 24898 25272 gene locus_tag LOCUS_04740 24898 25272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 25900 25289 gene locus_tag LOCUS_04750 25900 25289 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173662.1 protein_id gnl|my_center|LOCUS_04750 26649 25921 gene locus_tag LOCUS_04760 26649 25921 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228306.1 protein_id gnl|my_center|LOCUS_04760 28988 26880 gene locus_tag LOCUS_04770 gene malQ 28988 26880 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408795.1 protein_id gnl|my_center|LOCUS_04770 28987 30300 gene locus_tag LOCUS_04780 28987 30300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 30449 30297 gene locus_tag LOCUS_04790 30449 30297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 30826 30422 gene locus_tag LOCUS_04800 30826 30422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 31836 30793 gene locus_tag LOCUS_04810 31836 30793 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092926.1 protein_id gnl|my_center|LOCUS_04810 32126 34477 gene locus_tag LOCUS_04820 gene atsD 32126 34477 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_04820 34769 34509 gene locus_tag LOCUS_04830 34769 34509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 34654 34878 gene locus_tag LOCUS_04840 34654 34878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 35241 36980 gene locus_tag LOCUS_04850 35241 36980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 39432 37009 gene locus_tag LOCUS_04860 39432 37009 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_04860 39647 39429 gene locus_tag LOCUS_04870 39647 39429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 40102 39653 gene locus_tag LOCUS_04880 40102 39653 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891554.1 protein_id gnl|my_center|LOCUS_04880 40884 40150 gene locus_tag LOCUS_04890 40884 40150 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027093.1 protein_id gnl|my_center|LOCUS_04890 40982 41761 gene locus_tag LOCUS_04900 40982 41761 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887469.1 protein_id gnl|my_center|LOCUS_04900 42047 41787 gene locus_tag LOCUS_04910 42047 41787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence010 325 705 gene locus_tag LOCUS_04920 325 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 710 1549 gene locus_tag LOCUS_04930 710 1549 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104392.1 protein_id gnl|my_center|LOCUS_04930 1546 2583 gene locus_tag LOCUS_04940 1546 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 3445 2588 gene locus_tag LOCUS_04950 3445 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 3626 4150 gene locus_tag LOCUS_04960 3626 4150 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891350.1 protein_id gnl|my_center|LOCUS_04960 4171 5070 gene locus_tag LOCUS_04970 4171 5070 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_04970 5635 5237 gene locus_tag LOCUS_04980 5635 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 5799 6611 gene locus_tag LOCUS_04990 5799 6611 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 protein_id gnl|my_center|LOCUS_04990 8369 6615 gene locus_tag LOCUS_05000 gene pknB 8369 6615 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_05000 10054 8366 gene locus_tag LOCUS_05010 10054 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05010 11517 10051 gene locus_tag LOCUS_05020 11517 10051 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029268.1 protein_id gnl|my_center|LOCUS_05020 12917 11514 gene locus_tag LOCUS_05030 12917 11514 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_05030 14482 12914 gene locus_tag LOCUS_05040 14482 12914 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029266.1 protein_id gnl|my_center|LOCUS_05040 15005 14499 gene locus_tag LOCUS_05050 gene fhaB 15005 14499 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_05050 15747 14998 gene locus_tag LOCUS_05060 15747 14998 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776668.1 protein_id gnl|my_center|LOCUS_05060 15941 16025 gene locus_tag LOCUS_t00060 15941 16025 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17348 16101 gene locus_tag LOCUS_05070 17348 16101 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_05070 17850 17350 gene locus_tag LOCUS_05080 17850 17350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 18028 18234 gene locus_tag LOCUS_05090 18028 18234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 18327 18533 gene locus_tag LOCUS_05100 18327 18533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 20100 18613 gene locus_tag LOCUS_05110 20100 18613 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005130271.1 protein_id gnl|my_center|LOCUS_05110 20846 20097 gene locus_tag LOCUS_05120 20846 20097 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_05120 20944 22029 gene locus_tag LOCUS_05130 20944 22029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 22026 22955 gene locus_tag LOCUS_05140 22026 22955 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227736.1 protein_id gnl|my_center|LOCUS_05140 22952 23533 gene locus_tag LOCUS_05150 22952 23533 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227735.1 protein_id gnl|my_center|LOCUS_05150 23530 24744 gene locus_tag LOCUS_05160 23530 24744 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227734.1 protein_id gnl|my_center|LOCUS_05160 24744 24956 gene locus_tag LOCUS_05170 24744 24956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 25133 25768 gene locus_tag LOCUS_05180 25133 25768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 26374 25943 gene locus_tag LOCUS_05190 26374 25943 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_05190 27378 26371 gene locus_tag LOCUS_05200 gene arsB 27378 26371 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029172.1 protein_id gnl|my_center|LOCUS_05200 27863 27489 gene locus_tag LOCUS_05210 27863 27489 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_05210 27982 28482 gene locus_tag LOCUS_05220 27982 28482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 28533 28754 gene locus_tag LOCUS_05230 28533 28754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 32454 28930 gene locus_tag LOCUS_05240 gene mobF 32454 28930 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296243.1 protein_id gnl|my_center|LOCUS_05240 33105 32671 gene locus_tag LOCUS_05250 33105 32671 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141048.1 protein_id gnl|my_center|LOCUS_05250 33359 33105 gene locus_tag LOCUS_05260 33359 33105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 33724 34644 gene locus_tag LOCUS_05270 33724 34644 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015422.1 protein_id gnl|my_center|LOCUS_05270 34675 34857 gene locus_tag LOCUS_05280 34675 34857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015423.1 protein_id gnl|my_center|LOCUS_05280 35882 34893 gene locus_tag LOCUS_05290 35882 34893 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905400.1 protein_id gnl|my_center|LOCUS_05290 36928 36323 gene locus_tag LOCUS_05300 36928 36323 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730704.1 protein_id gnl|my_center|LOCUS_05300 37946 36975 gene locus_tag LOCUS_05310 37946 36975 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028671.1 protein_id gnl|my_center|LOCUS_05310 38596 37973 gene locus_tag LOCUS_05320 38596 37973 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400977.1 protein_id gnl|my_center|LOCUS_05320 39474 38596 gene locus_tag LOCUS_05330 39474 38596 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_05330 40066 39608 gene locus_tag LOCUS_05340 40066 39608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 >Feature sequence011 <1 1483 gene locus_tag LOCUS_05350 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975035.1:CCA tRNA nucleotidyltransferase 1506 2213 gene locus_tag LOCUS_05360 1506 2213 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804383.1 protein_id gnl|my_center|LOCUS_05360 3547 2252 gene locus_tag LOCUS_05370 3547 2252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_05370 4775 3696 gene locus_tag LOCUS_05380 4775 3696 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_05380 5396 4779 gene locus_tag LOCUS_05390 5396 4779 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_05390 5627 7822 gene locus_tag LOCUS_05400 5627 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 7822 9255 gene locus_tag LOCUS_05410 7822 9255 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_05410 9280 10389 gene locus_tag LOCUS_05420 9280 10389 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 protein_id gnl|my_center|LOCUS_05420 11516 10455 gene locus_tag LOCUS_05430 11516 10455 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975028.1 protein_id gnl|my_center|LOCUS_05430 12688 11516 gene locus_tag LOCUS_05440 12688 11516 CDS product peptidoglycan bridge formation peptidyltransferase VanK-Sc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029108.1 protein_id gnl|my_center|LOCUS_05440 13050 12787 gene locus_tag LOCUS_05450 13050 12787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 14051 13239 gene locus_tag LOCUS_05460 14051 13239 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467888.1 protein_id gnl|my_center|LOCUS_05460 14608 14111 gene locus_tag LOCUS_05470 14608 14111 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_05470 14889 15179 gene locus_tag LOCUS_05480 gene rpsF 14889 15179 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_05480 15279 15884 gene locus_tag LOCUS_05490 15279 15884 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_05490 15966 16202 gene locus_tag LOCUS_05500 gene rpsR 15966 16202 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_05500 16216 16668 gene locus_tag LOCUS_05510 gene rplI 16216 16668 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_05510 17288 16875 gene locus_tag LOCUS_05520 17288 16875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 17227 18942 gene locus_tag LOCUS_05530 17227 18942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 20405 19035 gene locus_tag LOCUS_05540 20405 19035 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_05540 20900 20682 gene locus_tag LOCUS_05550 20900 20682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 21046 22320 gene locus_tag LOCUS_05560 gene dnaB 21046 22320 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_05560 22596 22381 gene locus_tag LOCUS_05570 22596 22381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 23356 22610 gene locus_tag LOCUS_05580 23356 22610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 23439 23666 gene locus_tag LOCUS_05590 23439 23666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 24820 23948 gene locus_tag LOCUS_05600 24820 23948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 25055 25462 gene locus_tag LOCUS_05610 25055 25462 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225945.1 protein_id gnl|my_center|LOCUS_05610 25459 25968 gene locus_tag LOCUS_05620 25459 25968 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225944.1 protein_id gnl|my_center|LOCUS_05620 26069 27358 gene locus_tag LOCUS_05630 26069 27358 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804228.1 protein_id gnl|my_center|LOCUS_05630 27648 27971 gene locus_tag LOCUS_05640 27648 27971 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245961.1 protein_id gnl|my_center|LOCUS_05640 28150 28590 gene locus_tag LOCUS_05650 28150 28590 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870904.1 protein_id gnl|my_center|LOCUS_05650 29287 28670 gene locus_tag LOCUS_05660 29287 28670 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225045.1 protein_id gnl|my_center|LOCUS_05660 30327 29296 gene locus_tag LOCUS_05670 30327 29296 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079794.1 protein_id gnl|my_center|LOCUS_05670 30440 32413 gene locus_tag LOCUS_05680 30440 32413 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804249.1 protein_id gnl|my_center|LOCUS_05680 33052 32441 gene locus_tag LOCUS_05690 33052 32441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 33334 33903 gene locus_tag LOCUS_05700 33334 33903 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_05700 34656 33955 gene locus_tag LOCUS_05710 34656 33955 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401107.1 protein_id gnl|my_center|LOCUS_05710 34743 36668 gene locus_tag LOCUS_05720 34743 36668 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104297.1 protein_id gnl|my_center|LOCUS_05720 36691 36882 gene locus_tag LOCUS_05730 36691 36882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 36918 37841 gene locus_tag LOCUS_05740 36918 37841 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_05740 38035 39519 gene locus_tag LOCUS_05750 38035 39519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence012 967 1761 gene locus_tag LOCUS_05760 967 1761 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 protein_id gnl|my_center|LOCUS_05760 3621 2491 gene locus_tag LOCUS_05770 3621 2491 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742179.1 protein_id gnl|my_center|LOCUS_05770 3859 5475 gene locus_tag LOCUS_05780 3859 5475 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730684.1 protein_id gnl|my_center|LOCUS_05780 5472 7124 gene locus_tag LOCUS_05790 5472 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 10057 7172 gene locus_tag LOCUS_05800 10057 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 10152 11528 gene locus_tag LOCUS_05810 10152 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 11649 12044 gene locus_tag LOCUS_05820 11649 12044 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_05820 13542 12052 gene locus_tag LOCUS_05830 13542 12052 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_05830 13686 14465 gene locus_tag LOCUS_05840 13686 14465 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 protein_id gnl|my_center|LOCUS_05840 14778 14476 gene locus_tag LOCUS_05850 14778 14476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 14890 15246 gene locus_tag LOCUS_05860 14890 15246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 15251 16399 gene locus_tag LOCUS_05870 15251 16399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 16396 17292 gene locus_tag LOCUS_05880 16396 17292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 17329 18243 gene locus_tag LOCUS_05890 17329 18243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 protein_id gnl|my_center|LOCUS_05890 18240 19829 gene locus_tag LOCUS_05900 18240 19829 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_05900 19872 20321 gene locus_tag LOCUS_05910 19872 20321 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063625.1 protein_id gnl|my_center|LOCUS_05910 20318 21595 gene locus_tag LOCUS_05920 20318 21595 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_05920 21737 22957 gene locus_tag LOCUS_05930 21737 22957 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_05930 22941 23912 gene locus_tag LOCUS_05940 22941 23912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 24717 23932 gene locus_tag LOCUS_05950 24717 23932 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028174.1 protein_id gnl|my_center|LOCUS_05950 25935 24814 gene locus_tag LOCUS_05960 gene serC 25935 24814 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_05960 26060 26545 gene locus_tag LOCUS_05970 26060 26545 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223641.1 protein_id gnl|my_center|LOCUS_05970 27389 26565 gene locus_tag LOCUS_05980 27389 26565 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731143.1 protein_id gnl|my_center|LOCUS_05980 28508 27408 gene locus_tag LOCUS_05990 28508 27408 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_05990 28610 29272 gene locus_tag LOCUS_06000 gene pdxH 28610 29272 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_06000 29596 30852 gene locus_tag LOCUS_06010 29596 30852 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_06010 30997 32862 gene locus_tag LOCUS_06020 30997 32862 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 protein_id gnl|my_center|LOCUS_06020 33328 32966 gene locus_tag LOCUS_06030 33328 32966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 34993 33650 gene locus_tag LOCUS_06040 34993 33650 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230152.1 protein_id gnl|my_center|LOCUS_06040 35152 35835 gene locus_tag LOCUS_06050 35152 35835 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_06050 36770 35865 gene locus_tag LOCUS_06060 36770 35865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 protein_id gnl|my_center|LOCUS_06060 36845 37498 gene locus_tag LOCUS_06070 36845 37498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 37580 38428 gene locus_tag LOCUS_06080 37580 38428 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805101.1 protein_id gnl|my_center|LOCUS_06080 38724 38458 gene locus_tag LOCUS_06090 38724 38458 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089416.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence013 965 153 gene locus_tag LOCUS_06100 965 153 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977803.1 protein_id gnl|my_center|LOCUS_06100 1102 962 gene locus_tag LOCUS_06110 1102 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 1258 2388 gene locus_tag LOCUS_06120 gene kdgT 1258 2388 CDS product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230734.1 protein_id gnl|my_center|LOCUS_06120 2399 3655 gene locus_tag LOCUS_06130 2399 3655 CDS product ribulose-bisphosphate carboxylase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064440.1 protein_id gnl|my_center|LOCUS_06130 3662 4972 gene locus_tag LOCUS_06140 3662 4972 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808756.1 protein_id gnl|my_center|LOCUS_06140 5020 6063 gene locus_tag LOCUS_06150 gene tdh 5020 6063 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228031.1 protein_id gnl|my_center|LOCUS_06150 7316 7089 gene locus_tag LOCUS_06160 7316 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 8264 7482 gene locus_tag LOCUS_06170 8264 7482 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529020.1 protein_id gnl|my_center|LOCUS_06170 8447 8827 gene locus_tag LOCUS_06180 8447 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 8824 9255 gene locus_tag LOCUS_06190 8824 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 9272 10978 gene locus_tag LOCUS_06200 9272 10978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 11215 11547 gene locus_tag LOCUS_06210 11215 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 12306 11875 gene locus_tag LOCUS_06220 12306 11875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 14091 13027 gene locus_tag LOCUS_06230 14091 13027 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_06230 14870 14115 gene locus_tag LOCUS_06240 14870 14115 CDS product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409492.1 protein_id gnl|my_center|LOCUS_06240 15183 15779 gene locus_tag LOCUS_06250 15183 15779 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729354.1 protein_id gnl|my_center|LOCUS_06250 16170 15745 gene locus_tag LOCUS_06260 16170 15745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 16251 16880 gene locus_tag LOCUS_06270 16251 16880 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226060.1 protein_id gnl|my_center|LOCUS_06270 17896 17081 gene locus_tag LOCUS_06280 17896 17081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244800.1 protein_id gnl|my_center|LOCUS_06280 18920 17961 gene locus_tag LOCUS_06290 18920 17961 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223743.1 protein_id gnl|my_center|LOCUS_06290 20113 18917 gene locus_tag LOCUS_06300 20113 18917 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_06300 20311 21144 gene locus_tag LOCUS_06310 20311 21144 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122195341.1 protein_id gnl|my_center|LOCUS_06310 21281 22033 gene locus_tag LOCUS_06320 21281 22033 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810311.1 protein_id gnl|my_center|LOCUS_06320 23288 22056 gene locus_tag LOCUS_06330 23288 22056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_06330 24125 23325 gene locus_tag LOCUS_06340 24125 23325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 24825 24040 gene locus_tag LOCUS_06350 24825 24040 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227981.1 protein_id gnl|my_center|LOCUS_06350 25505 24822 gene locus_tag LOCUS_06360 25505 24822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 28440 25645 gene locus_tag LOCUS_06370 28440 25645 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257792.1 protein_id gnl|my_center|LOCUS_06370 30248 29556 gene locus_tag LOCUS_06380 30248 29556 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229457.1 protein_id gnl|my_center|LOCUS_06380 30519 31394 gene locus_tag LOCUS_06390 30519 31394 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896869.1 protein_id gnl|my_center|LOCUS_06390 31391 32875 gene locus_tag LOCUS_06400 31391 32875 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227811.1 protein_id gnl|my_center|LOCUS_06400 33008 38539 gene locus_tag LOCUS_06410 33008 38539 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 protein_id gnl|my_center|LOCUS_06410 >Feature sequence014 <1 713 gene locus_tag LOCUS_06420 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976894.1:Fe-S cluster assembly protein SufB 971 2149 gene locus_tag LOCUS_06430 gene sufD 971 2149 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_06430 2199 2528 gene locus_tag LOCUS_06440 2199 2528 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_06440 2566 3342 gene locus_tag LOCUS_06450 gene sufC 2566 3342 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805067.1 protein_id gnl|my_center|LOCUS_06450 3374 4651 gene locus_tag LOCUS_06460 3374 4651 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_06460 4657 5142 gene locus_tag LOCUS_06470 4657 5142 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976899.1 protein_id gnl|my_center|LOCUS_06470 5139 5534 gene locus_tag LOCUS_06480 5139 5534 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_06480 5559 6248 gene locus_tag LOCUS_06490 5559 6248 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_06490 6641 6396 gene locus_tag LOCUS_06500 6641 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 7435 6638 gene locus_tag LOCUS_06510 7435 6638 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337395.1 protein_id gnl|my_center|LOCUS_06510 9252 7432 gene locus_tag LOCUS_06520 9252 7432 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730559.1 protein_id gnl|my_center|LOCUS_06520 10055 10151 gene locus_tag LOCUS_t00070 10055 10151 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10823 10218 gene locus_tag LOCUS_06530 10823 10218 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391434.1 protein_id gnl|my_center|LOCUS_06530 11500 10820 gene locus_tag LOCUS_06540 11500 10820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889094.1 protein_id gnl|my_center|LOCUS_06540 12636 11491 gene locus_tag LOCUS_06550 12636 11491 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968893.1 protein_id gnl|my_center|LOCUS_06550 13525 12647 gene locus_tag LOCUS_06560 13525 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 14222 13629 gene locus_tag LOCUS_06570 14222 13629 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392649.1 protein_id gnl|my_center|LOCUS_06570 15132 14233 gene locus_tag LOCUS_06580 15132 14233 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222195.1 protein_id gnl|my_center|LOCUS_06580 15295 16845 gene locus_tag LOCUS_06590 15295 16845 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_06590 17371 18252 gene locus_tag LOCUS_06600 17371 18252 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_06600 18283 20154 gene locus_tag LOCUS_06610 18283 20154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_06610 20188 20943 gene locus_tag LOCUS_06620 20188 20943 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_06620 21675 20875 gene locus_tag LOCUS_06630 21675 20875 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729725.1 protein_id gnl|my_center|LOCUS_06630 21773 22771 gene locus_tag LOCUS_06640 gene moaA 21773 22771 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_06640 25150 22802 gene locus_tag LOCUS_06650 25150 22802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 25606 25217 gene locus_tag LOCUS_06660 25606 25217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 25985 25677 gene locus_tag LOCUS_06670 25985 25677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 26059 26271 gene locus_tag LOCUS_06680 26059 26271 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_06680 26375 27091 gene locus_tag LOCUS_06690 gene fabG 26375 27091 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_06690 27125 27895 gene locus_tag LOCUS_06700 gene fabI 27125 27895 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_06700 27931 29628 gene locus_tag LOCUS_06710 27931 29628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 32672 29892 gene locus_tag LOCUS_06720 gene cphA 32672 29892 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207603497.1 protein_id gnl|my_center|LOCUS_06720 33598 32669 gene locus_tag LOCUS_06730 33598 32669 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258640.1 protein_id gnl|my_center|LOCUS_06730 33681 34253 gene locus_tag LOCUS_06740 33681 34253 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_06740 35601 34378 gene locus_tag LOCUS_06750 gene serB 35601 34378 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_06750 36411 35614 gene locus_tag LOCUS_06760 36411 35614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 36410 37213 gene locus_tag LOCUS_06770 36410 37213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_06770 37253 37714 gene locus_tag LOCUS_06780 37253 37714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence015 <1 768 gene locus_tag LOCUS_06790 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258217.1:DICT sensory domain-containing protein 1234 749 gene locus_tag LOCUS_06800 gene bfr 1234 749 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707537.1 protein_id gnl|my_center|LOCUS_06800 1433 1221 gene locus_tag LOCUS_06810 1433 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3073 1526 gene locus_tag LOCUS_06820 gene asnB 3073 1526 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454564.1 protein_id gnl|my_center|LOCUS_06820 3145 4203 gene locus_tag LOCUS_06830 3145 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 4583 5767 gene locus_tag LOCUS_06840 4583 5767 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226129.1 protein_id gnl|my_center|LOCUS_06840 5764 6684 gene locus_tag LOCUS_06850 5764 6684 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036282.1 protein_id gnl|my_center|LOCUS_06850 6686 7162 gene locus_tag LOCUS_06860 6686 7162 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226133.1 protein_id gnl|my_center|LOCUS_06860 7162 8754 gene locus_tag LOCUS_06870 7162 8754 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031630.1 protein_id gnl|my_center|LOCUS_06870 10538 8799 gene locus_tag LOCUS_06880 10538 8799 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731564.1 protein_id gnl|my_center|LOCUS_06880 12083 10674 gene locus_tag LOCUS_06890 12083 10674 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_06890 13363 12086 gene locus_tag LOCUS_06900 13363 12086 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 protein_id gnl|my_center|LOCUS_06900 14874 13363 gene locus_tag LOCUS_06910 14874 13363 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_06910 15414 15241 gene locus_tag LOCUS_06920 15414 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 15625 16443 gene locus_tag LOCUS_06930 gene rfbF 15625 16443 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435696.1 protein_id gnl|my_center|LOCUS_06930 16445 17470 gene locus_tag LOCUS_06940 16445 17470 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257100.1 protein_id gnl|my_center|LOCUS_06940 17467 18042 gene locus_tag LOCUS_06950 gene rfbC 17467 18042 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142202.1 protein_id gnl|my_center|LOCUS_06950 18039 19328 gene locus_tag LOCUS_06960 18039 19328 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142201.1 protein_id gnl|my_center|LOCUS_06960 19331 20266 gene locus_tag LOCUS_06970 19331 20266 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061716.1 protein_id gnl|my_center|LOCUS_06970 21559 20294 gene locus_tag LOCUS_06980 21559 20294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978468.1 protein_id gnl|my_center|LOCUS_06980 22527 21556 gene locus_tag LOCUS_06990 22527 21556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 23883 22708 gene locus_tag LOCUS_07000 23883 22708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 24213 25370 gene locus_tag LOCUS_07010 24213 25370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 25367 26644 gene locus_tag LOCUS_07020 25367 26644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 26641 27651 gene locus_tag LOCUS_07030 gene exoA 26641 27651 CDS product succinoglycan biosynthesis glycosyltransferase ExoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434899.1 protein_id gnl|my_center|LOCUS_07030 28704 27664 gene locus_tag LOCUS_07040 28704 27664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 28865 30070 gene locus_tag LOCUS_07050 gene lhgO 28865 30070 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839995.1 protein_id gnl|my_center|LOCUS_07050 31479 30118 gene locus_tag LOCUS_07060 31479 30118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 33325 31694 gene locus_tag LOCUS_07070 33325 31694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 33805 33936 gene locus_tag LOCUS_07080 33805 33936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 33992 34366 gene locus_tag LOCUS_07090 33992 34366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 36327 34483 gene locus_tag LOCUS_07100 36327 34483 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230478.1 protein_id gnl|my_center|LOCUS_07100 37553 36492 gene locus_tag LOCUS_07110 37553 36492 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728088.1 protein_id gnl|my_center|LOCUS_07110 <38174 37550 gene locus_tag LOCUS_07120 <38174 37550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728089.1:ABC transporter permease >Feature sequence016 2 280 gene locus_tag LOCUS_07130 2 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 282 1136 gene locus_tag LOCUS_07140 282 1136 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776057.1 protein_id gnl|my_center|LOCUS_07140 1133 2062 gene locus_tag LOCUS_07150 1133 2062 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 protein_id gnl|my_center|LOCUS_07150 2103 2291 gene locus_tag LOCUS_07160 2103 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07160 2294 2683 gene locus_tag LOCUS_07170 2294 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2680 3129 gene locus_tag LOCUS_07180 2680 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 3126 3638 gene locus_tag LOCUS_07190 3126 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 3978 3658 gene locus_tag LOCUS_07200 3978 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 4418 5086 gene locus_tag LOCUS_07210 4418 5086 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151564919.1 protein_id gnl|my_center|LOCUS_07210 5614 5108 gene locus_tag LOCUS_07220 5614 5108 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235623980.1 protein_id gnl|my_center|LOCUS_07220 5680 6798 gene locus_tag LOCUS_07230 gene prfB 5680 6798 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728139.1 protein_id gnl|my_center|LOCUS_07230 6951 7640 gene locus_tag LOCUS_07240 gene ftsE 6951 7640 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_07240 7650 8570 gene locus_tag LOCUS_07250 gene ftsX 7650 8570 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_07250 8626 9945 gene locus_tag LOCUS_07260 8626 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 9991 10467 gene locus_tag LOCUS_07270 gene smpB 9991 10467 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_07270 10464 11357 gene locus_tag LOCUS_07280 10464 11357 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029384.1 protein_id gnl|my_center|LOCUS_07280 11747 12114 gene locus_tag LOCUS_tm00010 11747 12114 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 12332 12742 gene locus_tag LOCUS_07290 12332 12742 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_07290 13882 12830 gene locus_tag LOCUS_07300 13882 12830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 13990 15033 gene locus_tag LOCUS_07310 13990 15033 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_07310 15050 16507 gene locus_tag LOCUS_07320 15050 16507 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_07320 16500 17066 gene locus_tag LOCUS_07330 16500 17066 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_07330 17086 17331 gene locus_tag LOCUS_07340 17086 17331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 17328 19217 gene locus_tag LOCUS_07350 17328 19217 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975874.1 protein_id gnl|my_center|LOCUS_07350 20669 19269 gene locus_tag LOCUS_07360 gene xylB 20669 19269 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222654.1 protein_id gnl|my_center|LOCUS_07360 21952 20738 gene locus_tag LOCUS_07370 gene fahA 21952 20738 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224839.1 protein_id gnl|my_center|LOCUS_07370 22851 21949 gene locus_tag LOCUS_07380 22851 21949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113317.1 protein_id gnl|my_center|LOCUS_07380 23618 22947 gene locus_tag LOCUS_07390 23618 22947 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_07390 23781 23960 gene locus_tag LOCUS_07400 23781 23960 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222993.1 protein_id gnl|my_center|LOCUS_07400 25818 23983 gene locus_tag LOCUS_07410 25818 23983 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090032.1 protein_id gnl|my_center|LOCUS_07410 27071 25959 gene locus_tag LOCUS_07420 27071 25959 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323856.1 protein_id gnl|my_center|LOCUS_07420 28741 27032 gene locus_tag LOCUS_07430 28741 27032 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730685.1 protein_id gnl|my_center|LOCUS_07430 29558 28824 gene locus_tag LOCUS_07440 29558 28824 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776999.1 protein_id gnl|my_center|LOCUS_07440 31152 29671 gene locus_tag LOCUS_07450 31152 29671 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225068.1 protein_id gnl|my_center|LOCUS_07450 31454 31936 gene locus_tag LOCUS_07460 31454 31936 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_07460 32359 32018 gene locus_tag LOCUS_07470 32359 32018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 32420 32632 gene locus_tag LOCUS_07480 32420 32632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 33101 32700 gene locus_tag LOCUS_07490 33101 32700 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859527.1 protein_id gnl|my_center|LOCUS_07490 33230 34360 gene locus_tag LOCUS_07500 33230 34360 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029671.1 protein_id gnl|my_center|LOCUS_07500 34383 35648 gene locus_tag LOCUS_07510 34383 35648 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_07510 36015 36230 gene locus_tag LOCUS_07520 36015 36230 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222201.1 protein_id gnl|my_center|LOCUS_07520 36655 36281 gene locus_tag LOCUS_07530 36655 36281 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence017 235 579 gene locus_tag LOCUS_07540 235 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 595 2103 gene locus_tag LOCUS_07550 595 2103 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_07550 2228 2359 gene locus_tag LOCUS_07560 2228 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3897 2536 gene locus_tag LOCUS_07570 gene gabT 3897 2536 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973349.1 protein_id gnl|my_center|LOCUS_07570 3963 5069 gene locus_tag LOCUS_07580 gene dxr 3963 5069 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_07580 5066 6382 gene locus_tag LOCUS_07590 5066 6382 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 protein_id gnl|my_center|LOCUS_07590 6461 7618 gene locus_tag LOCUS_07600 gene ispG 6461 7618 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_07600 8314 7619 gene locus_tag LOCUS_07610 8314 7619 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227864.1 protein_id gnl|my_center|LOCUS_07610 9942 8311 gene locus_tag LOCUS_07620 9942 8311 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227865.1 protein_id gnl|my_center|LOCUS_07620 10103 11482 gene locus_tag LOCUS_07630 10103 11482 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 protein_id gnl|my_center|LOCUS_07630 11492 12337 gene locus_tag LOCUS_07640 11492 12337 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_07640 12440 14233 gene locus_tag LOCUS_07650 12440 14233 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 protein_id gnl|my_center|LOCUS_07650 14238 14954 gene locus_tag LOCUS_07660 14238 14954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 15410 14985 gene locus_tag LOCUS_07670 15410 14985 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030399.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07670 16042 15410 gene locus_tag LOCUS_07680 16042 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 16176 16682 gene locus_tag LOCUS_07690 gene rimP 16176 16682 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_07690 16689 17717 gene locus_tag LOCUS_07700 gene nusA 16689 17717 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_07700 18244 21303 gene locus_tag LOCUS_07710 18244 21303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 21462 21902 gene locus_tag LOCUS_07720 gene rbfA 21462 21902 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_07720 21899 22771 gene locus_tag LOCUS_07730 gene truB 21899 22771 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_07730 22848 23801 gene locus_tag LOCUS_07740 22848 23801 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_07740 24184 23927 gene locus_tag LOCUS_07750 24184 23927 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857409.1 protein_id gnl|my_center|LOCUS_07750 27023 24252 gene locus_tag LOCUS_07760 27023 24252 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028822.1 protein_id gnl|my_center|LOCUS_07760 28014 27034 gene locus_tag LOCUS_07770 28014 27034 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 protein_id gnl|my_center|LOCUS_07770 28778 28011 gene locus_tag LOCUS_07780 28778 28011 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_07780 28877 30562 gene locus_tag LOCUS_07790 28877 30562 CDS product phosphoenolpyruvate-utilizing N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104530.1 protein_id gnl|my_center|LOCUS_07790 30762 31037 gene locus_tag LOCUS_07800 gene rpsO 30762 31037 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052997.1 protein_id gnl|my_center|LOCUS_07800 31399 33642 gene locus_tag LOCUS_07810 31399 33642 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_07810 33644 34972 gene locus_tag LOCUS_07820 33644 34972 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_07820 35779 35072 gene locus_tag LOCUS_07830 35779 35072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 36459 35803 gene locus_tag LOCUS_07840 36459 35803 CDS product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730969.1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence018 616 92 gene locus_tag LOCUS_07850 616 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 763 1323 gene locus_tag LOCUS_07860 763 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1326 2003 gene locus_tag LOCUS_07870 1326 2003 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_07870 2032 2973 gene locus_tag LOCUS_07880 2032 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3123 4157 gene locus_tag LOCUS_07890 3123 4157 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_07890 4183 6324 gene locus_tag LOCUS_07900 4183 6324 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030473.1 protein_id gnl|my_center|LOCUS_07900 7142 6372 gene locus_tag LOCUS_07910 7142 6372 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892748.1 protein_id gnl|my_center|LOCUS_07910 7129 7764 gene locus_tag LOCUS_07920 7129 7764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727622.1 protein_id gnl|my_center|LOCUS_07920 7853 9229 gene locus_tag LOCUS_07930 7853 9229 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_07930 9226 10224 gene locus_tag LOCUS_07940 9226 10224 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404173.1 protein_id gnl|my_center|LOCUS_07940 10261 10743 gene locus_tag LOCUS_07950 10261 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 11329 10745 gene locus_tag LOCUS_07960 11329 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07960 11636 11412 gene locus_tag LOCUS_07970 11636 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 12869 11895 gene locus_tag LOCUS_07980 12869 11895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 14977 12986 gene locus_tag LOCUS_07990 gene pknB 14977 12986 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_07990 15157 15534 gene locus_tag LOCUS_08000 15157 15534 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_08000 15545 16015 gene locus_tag LOCUS_08010 15545 16015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 17116 16049 gene locus_tag LOCUS_08020 17116 16049 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_08020 17204 18130 gene locus_tag LOCUS_08030 gene metF 17204 18130 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_08030 19449 18145 gene locus_tag LOCUS_08040 19449 18145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 19775 19506 gene locus_tag LOCUS_08050 19775 19506 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897230.1 protein_id gnl|my_center|LOCUS_08050 21277 19889 gene locus_tag LOCUS_08060 21277 19889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 21873 21403 gene locus_tag LOCUS_08070 21873 21403 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 protein_id gnl|my_center|LOCUS_08070 22055 21870 gene locus_tag LOCUS_08080 22055 21870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 22200 22577 gene locus_tag LOCUS_08090 22200 22577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 22591 23139 gene locus_tag LOCUS_08100 22591 23139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 23132 27334 gene locus_tag LOCUS_08110 23132 27334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 27473 28252 gene locus_tag LOCUS_08120 27473 28252 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_08120 28321 29529 gene locus_tag LOCUS_08130 gene dinB 28321 29529 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_08130 29462 29854 gene locus_tag LOCUS_08140 29462 29854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 29910 30458 gene locus_tag LOCUS_08150 29910 30458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 30455 31180 gene locus_tag LOCUS_08160 gene whiG 30455 31180 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_08160 31286 31744 gene locus_tag LOCUS_08170 31286 31744 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_08170 34298 31869 gene locus_tag LOCUS_08180 34298 31869 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_08180 35596 34295 gene locus_tag LOCUS_08190 35596 34295 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence019 504 133 gene locus_tag LOCUS_08200 504 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974665.1 protein_id gnl|my_center|LOCUS_08200 548 1264 gene locus_tag LOCUS_08210 548 1264 CDS product copper homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230268.1 protein_id gnl|my_center|LOCUS_08210 1261 2460 gene locus_tag LOCUS_08220 1261 2460 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_08220 3114 2521 gene locus_tag LOCUS_08230 3114 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_08230 5267 3111 gene locus_tag LOCUS_08240 5267 3111 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_08240 5425 5799 gene locus_tag LOCUS_08250 5425 5799 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975801.1 protein_id gnl|my_center|LOCUS_08250 5789 6385 gene locus_tag LOCUS_08260 5789 6385 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729836.1 protein_id gnl|my_center|LOCUS_08260 7283 6393 gene locus_tag LOCUS_08270 7283 6393 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728945.1 protein_id gnl|my_center|LOCUS_08270 7367 8353 gene locus_tag LOCUS_08280 7367 8353 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728933.1 protein_id gnl|my_center|LOCUS_08280 8389 10752 gene locus_tag LOCUS_08290 gene lon 8389 10752 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729178.1 protein_id gnl|my_center|LOCUS_08290 10833 11153 gene locus_tag LOCUS_08300 10833 11153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 11754 11143 gene locus_tag LOCUS_08310 11754 11143 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973464.1 protein_id gnl|my_center|LOCUS_08310 11812 12762 gene locus_tag LOCUS_08320 11812 12762 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030296.1 protein_id gnl|my_center|LOCUS_08320 13942 12743 gene locus_tag LOCUS_08330 13942 12743 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087812.1 protein_id gnl|my_center|LOCUS_08330 14028 15059 gene locus_tag LOCUS_08340 14028 15059 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223562.1 protein_id gnl|my_center|LOCUS_08340 15575 15093 gene locus_tag LOCUS_08350 15575 15093 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414543.1 protein_id gnl|my_center|LOCUS_08350 17293 15572 gene locus_tag LOCUS_08360 17293 15572 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_08360 18946 17429 gene locus_tag LOCUS_08370 gene glpK 18946 17429 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226257.1 protein_id gnl|my_center|LOCUS_08370 19853 19008 gene locus_tag LOCUS_08380 19853 19008 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731513.1 protein_id gnl|my_center|LOCUS_08380 20018 20926 gene locus_tag LOCUS_08390 20018 20926 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_08390 21141 22196 gene locus_tag LOCUS_08400 21141 22196 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 protein_id gnl|my_center|LOCUS_08400 22193 23857 gene locus_tag LOCUS_08410 22193 23857 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229775.1 protein_id gnl|my_center|LOCUS_08410 23875 24903 gene locus_tag LOCUS_08420 23875 24903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229774.1 protein_id gnl|my_center|LOCUS_08420 24872 25987 gene locus_tag LOCUS_08430 24872 25987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 26566 28044 gene locus_tag LOCUS_08440 26566 28044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 28634 28140 gene locus_tag LOCUS_08450 28634 28140 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_08450 28744 30378 gene locus_tag LOCUS_08460 28744 30378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 30404 31486 gene locus_tag LOCUS_08470 30404 31486 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_08470 31506 32492 gene locus_tag LOCUS_08480 gene tilS 31506 32492 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_08480 32539 33090 gene locus_tag LOCUS_08490 gene hpt 32539 33090 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_08490 34044 33097 gene locus_tag LOCUS_08500 34044 33097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence020 1456 611 gene locus_tag LOCUS_08510 gene coxB 1456 611 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805014.1 protein_id gnl|my_center|LOCUS_08510 2640 1654 gene locus_tag LOCUS_08520 2640 1654 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_08520 3130 2762 gene locus_tag LOCUS_08530 3130 2762 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224070.1 protein_id gnl|my_center|LOCUS_08530 4350 3253 gene locus_tag LOCUS_08540 4350 3253 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 protein_id gnl|my_center|LOCUS_08540 4395 5294 gene locus_tag LOCUS_08550 4395 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 5873 5304 gene locus_tag LOCUS_08560 5873 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_08560 6878 5910 gene locus_tag LOCUS_08570 gene htpX 6878 5910 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_08570 7156 6878 gene locus_tag LOCUS_08580 7156 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_08580 7995 7153 gene locus_tag LOCUS_08590 7995 7153 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_08590 8254 8820 gene locus_tag LOCUS_08600 8254 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 8848 9855 gene locus_tag LOCUS_08610 8848 9855 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_08610 10157 9879 gene locus_tag LOCUS_08620 10157 9879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_08620 10483 11202 gene locus_tag LOCUS_08630 10483 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 11221 12360 gene locus_tag LOCUS_08640 11221 12360 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028280.1 protein_id gnl|my_center|LOCUS_08640 12357 14003 gene locus_tag LOCUS_08650 12357 14003 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028281.1 protein_id gnl|my_center|LOCUS_08650 14000 14851 gene locus_tag LOCUS_08660 14000 14851 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_08660 14848 16188 gene locus_tag LOCUS_08670 14848 16188 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869456.1 protein_id gnl|my_center|LOCUS_08670 16185 16976 gene locus_tag LOCUS_08680 16185 16976 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228811.1 protein_id gnl|my_center|LOCUS_08680 18095 16986 gene locus_tag LOCUS_08690 gene gcvT 18095 16986 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729697.1 protein_id gnl|my_center|LOCUS_08690 18211 19713 gene locus_tag LOCUS_08700 18211 19713 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_08700 20170 19853 gene locus_tag LOCUS_08710 20170 19853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_08710 20375 21751 gene locus_tag LOCUS_08720 gene lpdA 20375 21751 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_08720 21813 23786 gene locus_tag LOCUS_08730 gene sucB 21813 23786 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775679.1 protein_id gnl|my_center|LOCUS_08730 23921 24868 gene locus_tag LOCUS_08740 23921 24868 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_08740 25439 24861 gene locus_tag LOCUS_08750 25439 24861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 26237 25479 gene locus_tag LOCUS_08760 26237 25479 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_08760 27052 26234 gene locus_tag LOCUS_08770 gene murI 27052 26234 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 protein_id gnl|my_center|LOCUS_08770 27819 27142 gene locus_tag LOCUS_08780 27819 27142 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222957.1 protein_id gnl|my_center|LOCUS_08780 28903 27920 gene locus_tag LOCUS_08790 28903 27920 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222033.1 protein_id gnl|my_center|LOCUS_08790 29954 29007 gene locus_tag LOCUS_08800 29954 29007 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_08800 30250 29957 gene locus_tag LOCUS_08810 30250 29957 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730181.1 protein_id gnl|my_center|LOCUS_08810 30846 30298 gene locus_tag LOCUS_08820 30846 30298 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229460.1 protein_id gnl|my_center|LOCUS_08820 31446 30859 gene locus_tag LOCUS_08830 31446 30859 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_08830 31739 31443 gene locus_tag LOCUS_08840 gene clpS 31739 31443 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_08840 31757 33070 gene locus_tag LOCUS_08850 31757 33070 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_08850 33077 33844 gene locus_tag LOCUS_08860 33077 33844 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803873.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence021 863 18 gene locus_tag LOCUS_08870 863 18 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_08870 1252 1016 gene locus_tag LOCUS_08880 1252 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1200 1610 gene locus_tag LOCUS_08890 1200 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1890 2729 gene locus_tag LOCUS_08900 gene fabG 1890 2729 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257346.1 protein_id gnl|my_center|LOCUS_08900 2906 3289 gene locus_tag LOCUS_08910 2906 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 3302 5026 gene locus_tag LOCUS_08920 gene phaC 3302 5026 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389569.1 protein_id gnl|my_center|LOCUS_08920 5023 5781 gene locus_tag LOCUS_08930 gene phaZ 5023 5781 CDS product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739559.1 protein_id gnl|my_center|LOCUS_08930 5880 6356 gene locus_tag LOCUS_08940 5880 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 6385 7257 gene locus_tag LOCUS_08950 6385 7257 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400979.1 protein_id gnl|my_center|LOCUS_08950 9280 7325 gene locus_tag LOCUS_08960 9280 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 14855 9315 gene locus_tag LOCUS_08970 14855 9315 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 protein_id gnl|my_center|LOCUS_08970 16390 15086 gene locus_tag LOCUS_08980 16390 15086 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079030578.1 protein_id gnl|my_center|LOCUS_08980 16510 16986 gene locus_tag LOCUS_08990 16510 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 17019 17801 gene locus_tag LOCUS_09000 17019 17801 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529940.1 protein_id gnl|my_center|LOCUS_09000 18633 17893 gene locus_tag LOCUS_09010 18633 17893 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_09010 19070 18630 gene locus_tag LOCUS_09020 19070 18630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 19669 19070 gene locus_tag LOCUS_09030 19669 19070 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031560.1 protein_id gnl|my_center|LOCUS_09030 19815 19666 gene locus_tag LOCUS_09040 19815 19666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 19914 20543 gene locus_tag LOCUS_09050 19914 20543 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228176.1 protein_id gnl|my_center|LOCUS_09050 22025 20589 gene locus_tag LOCUS_09060 22025 20589 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_09060 22257 23441 gene locus_tag LOCUS_09070 gene galK 22257 23441 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_09070 23703 23491 gene locus_tag LOCUS_09080 23703 23491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 24336 23713 gene locus_tag LOCUS_09090 24336 23713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403957.1 protein_id gnl|my_center|LOCUS_09090 25085 24342 gene locus_tag LOCUS_09100 25085 24342 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005133116.1 protein_id gnl|my_center|LOCUS_09100 25278 25745 gene locus_tag LOCUS_09110 25278 25745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 25738 26178 gene locus_tag LOCUS_09120 25738 26178 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776727.1 protein_id gnl|my_center|LOCUS_09120 26175 26609 gene locus_tag LOCUS_09130 26175 26609 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727127.1 protein_id gnl|my_center|LOCUS_09130 26606 27682 gene locus_tag LOCUS_09140 26606 27682 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_09140 27669 27968 gene locus_tag LOCUS_09150 27669 27968 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776729.1 protein_id gnl|my_center|LOCUS_09150 27953 28513 gene locus_tag LOCUS_09160 gene def 27953 28513 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973751.1 protein_id gnl|my_center|LOCUS_09160 28718 30466 gene locus_tag LOCUS_09170 28718 30466 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143420.1 protein_id gnl|my_center|LOCUS_09170 31272 30454 gene locus_tag LOCUS_09180 31272 30454 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 protein_id gnl|my_center|LOCUS_09180 32687 31464 gene locus_tag LOCUS_09190 gene cobA 32687 31464 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226827.1 protein_id gnl|my_center|LOCUS_09190 33760 32684 gene locus_tag LOCUS_09200 33760 32684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 33976 34182 gene locus_tag LOCUS_09210 33976 34182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09210 >Feature sequence022 1887 2921 gene locus_tag LOCUS_09220 1887 2921 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966367.1 protein_id gnl|my_center|LOCUS_09220 2980 3055 gene locus_tag LOCUS_t00080 2980 3055 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3694 3158 gene locus_tag LOCUS_09230 3694 3158 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224991.1 protein_id gnl|my_center|LOCUS_09230 4670 3864 gene locus_tag LOCUS_09240 4670 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5239 4667 gene locus_tag LOCUS_09250 5239 4667 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222027.1 protein_id gnl|my_center|LOCUS_09250 5495 6553 gene locus_tag LOCUS_09260 gene pstS 5495 6553 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776547.1 protein_id gnl|my_center|LOCUS_09260 6561 7493 gene locus_tag LOCUS_09270 gene pstC 6561 7493 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776546.1 protein_id gnl|my_center|LOCUS_09270 7490 8572 gene locus_tag LOCUS_09280 gene pstA 7490 8572 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_09280 8582 9361 gene locus_tag LOCUS_09290 gene pstB 8582 9361 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230712.1 protein_id gnl|my_center|LOCUS_09290 9398 10552 gene locus_tag LOCUS_09300 9398 10552 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_09300 10549 11229 gene locus_tag LOCUS_09310 10549 11229 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_09310 13083 11533 gene locus_tag LOCUS_09320 13083 11533 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030460.1 protein_id gnl|my_center|LOCUS_09320 15415 13478 gene locus_tag LOCUS_09330 15415 13478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 15590 15949 gene locus_tag LOCUS_09340 15590 15949 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896802.1 protein_id gnl|my_center|LOCUS_09340 17006 16128 gene locus_tag LOCUS_09350 17006 16128 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776907.1 protein_id gnl|my_center|LOCUS_09350 17974 17021 gene locus_tag LOCUS_09360 17974 17021 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089403226.1 protein_id gnl|my_center|LOCUS_09360 19333 17984 gene locus_tag LOCUS_09370 19333 17984 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776909.1 protein_id gnl|my_center|LOCUS_09370 19532 21397 gene locus_tag LOCUS_09380 19532 21397 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229244.1 protein_id gnl|my_center|LOCUS_09380 22408 21428 gene locus_tag LOCUS_09390 22408 21428 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223213.1 protein_id gnl|my_center|LOCUS_09390 22585 22929 gene locus_tag LOCUS_09400 22585 22929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 23667 23077 gene locus_tag LOCUS_09410 23667 23077 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_09410 24800 24243 gene locus_tag LOCUS_09420 24800 24243 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227331.1 protein_id gnl|my_center|LOCUS_09420 25839 24952 gene locus_tag LOCUS_09430 25839 24952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 26842 26474 gene locus_tag LOCUS_09440 26842 26474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 27467 27264 gene locus_tag LOCUS_09450 27467 27264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 27627 27959 gene locus_tag LOCUS_09460 27627 27959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 27977 28783 gene locus_tag LOCUS_09470 27977 28783 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223025.1 protein_id gnl|my_center|LOCUS_09470 28943 29299 gene locus_tag LOCUS_09480 28943 29299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 29296 29685 gene locus_tag LOCUS_09490 29296 29685 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_09490 29909 30460 gene locus_tag LOCUS_09500 29909 30460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 30620 31087 gene locus_tag LOCUS_09510 30620 31087 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084746.1 protein_id gnl|my_center|LOCUS_09510 31110 31751 gene locus_tag LOCUS_09520 31110 31751 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence023 1597 1827 gene locus_tag LOCUS_09530 1597 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1941 2132 gene locus_tag LOCUS_09540 1941 2132 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029765.1 protein_id gnl|my_center|LOCUS_09540 2133 2777 gene locus_tag LOCUS_09550 2133 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09550 2659 3525 gene locus_tag LOCUS_09560 2659 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09560 3786 3703 gene locus_tag LOCUS_t00090 3786 3703 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3902 4393 gene locus_tag LOCUS_09570 3902 4393 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_09570 4818 4384 gene locus_tag LOCUS_09580 4818 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 5375 4815 gene locus_tag LOCUS_09590 5375 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 5887 5408 gene locus_tag LOCUS_09600 5887 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 6945 5935 gene locus_tag LOCUS_09610 6945 5935 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060315.1 protein_id gnl|my_center|LOCUS_09610 7772 6942 gene locus_tag LOCUS_09620 gene cysW 7772 6942 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_09620 8613 7765 gene locus_tag LOCUS_09630 gene cysT 8613 7765 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093159.1 protein_id gnl|my_center|LOCUS_09630 9630 8614 gene locus_tag LOCUS_09640 9630 8614 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895899.1 protein_id gnl|my_center|LOCUS_09640 9897 11780 gene locus_tag LOCUS_09650 9897 11780 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_09650 11777 12838 gene locus_tag LOCUS_09660 11777 12838 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_09660 13048 13965 gene locus_tag LOCUS_09670 gene rarD 13048 13965 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09670 15459 14371 gene locus_tag LOCUS_09680 15459 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 16831 15506 gene locus_tag LOCUS_09690 16831 15506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 17355 16885 gene locus_tag LOCUS_09700 17355 16885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 17955 17497 gene locus_tag LOCUS_09710 17955 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 18026 19234 gene locus_tag LOCUS_09720 18026 19234 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228864.1 protein_id gnl|my_center|LOCUS_09720 19632 19189 gene locus_tag LOCUS_09730 19632 19189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 19791 20609 gene locus_tag LOCUS_09740 19791 20609 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729731.1 protein_id gnl|my_center|LOCUS_09740 21639 20638 gene locus_tag LOCUS_09750 21639 20638 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_09750 23264 21663 gene locus_tag LOCUS_09760 gene nuoN 23264 21663 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_09760 24823 23261 gene locus_tag LOCUS_09770 24823 23261 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 protein_id gnl|my_center|LOCUS_09770 26748 24820 gene locus_tag LOCUS_09780 gene nuoL 26748 24820 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110664.1 protein_id gnl|my_center|LOCUS_09780 27062 26763 gene locus_tag LOCUS_09790 gene nuoK 27062 26763 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_09790 27925 27059 gene locus_tag LOCUS_09800 27925 27059 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 protein_id gnl|my_center|LOCUS_09800 28487 27930 gene locus_tag LOCUS_09810 28487 27930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 29858 28488 gene locus_tag LOCUS_09820 gene nuoH 29858 28488 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_09820 <31439 29855 gene locus_tag LOCUS_09830 <31439 29855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728121.1:NADH-quinone oxidoreductase subunit G >Feature sequence024 1909 11 gene locus_tag LOCUS_09840 gene typA 1909 11 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_09840 3519 2053 gene locus_tag LOCUS_09850 3519 2053 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227524.1 protein_id gnl|my_center|LOCUS_09850 4367 3597 gene locus_tag LOCUS_09860 4367 3597 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 protein_id gnl|my_center|LOCUS_09860 4531 5802 gene locus_tag LOCUS_09870 gene mshA 4531 5802 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_09870 5799 6302 gene locus_tag LOCUS_09880 5799 6302 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_09880 7322 6417 gene locus_tag LOCUS_09890 7322 6417 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_09890 8095 7418 gene locus_tag LOCUS_09900 8095 7418 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_09900 9354 8092 gene locus_tag LOCUS_09910 9354 8092 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_09910 9501 10169 gene locus_tag LOCUS_09920 gene phoU 9501 10169 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_09920 10215 10985 gene locus_tag LOCUS_09930 10215 10985 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228486.1 protein_id gnl|my_center|LOCUS_09930 11797 11042 gene locus_tag LOCUS_09940 11797 11042 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_09940 12419 11829 gene locus_tag LOCUS_09950 12419 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 13132 12416 gene locus_tag LOCUS_09960 13132 12416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 13337 13822 gene locus_tag LOCUS_09970 13337 13822 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_09970 13952 14650 gene locus_tag LOCUS_09980 13952 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 14960 14652 gene locus_tag LOCUS_09990 14960 14652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 15763 14957 gene locus_tag LOCUS_10000 15763 14957 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224063.1 protein_id gnl|my_center|LOCUS_10000 17196 15889 gene locus_tag LOCUS_10010 17196 15889 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257211.1 protein_id gnl|my_center|LOCUS_10010 17624 17211 gene locus_tag LOCUS_10020 17624 17211 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102257.1 protein_id gnl|my_center|LOCUS_10020 17992 17621 gene locus_tag LOCUS_10030 17992 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 18620 18033 gene locus_tag LOCUS_10040 18620 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 19240 18617 gene locus_tag LOCUS_10050 19240 18617 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257215.1 protein_id gnl|my_center|LOCUS_10050 19775 19395 gene locus_tag LOCUS_10060 19775 19395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 20770 19772 gene locus_tag LOCUS_10070 20770 19772 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070840.1 protein_id gnl|my_center|LOCUS_10070 22188 20857 gene locus_tag LOCUS_10080 22188 20857 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_10080 23288 22230 gene locus_tag LOCUS_10090 23288 22230 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529315.1 protein_id gnl|my_center|LOCUS_10090 24277 23300 gene locus_tag LOCUS_10100 24277 23300 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 protein_id gnl|my_center|LOCUS_10100 24526 25320 gene locus_tag LOCUS_10110 24526 25320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 25366 25722 gene locus_tag LOCUS_10120 gene nirD 25366 25722 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976316.1 protein_id gnl|my_center|LOCUS_10120 26241 25747 gene locus_tag LOCUS_10130 gene ispF 26241 25747 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804549.1 protein_id gnl|my_center|LOCUS_10130 26393 27895 gene locus_tag LOCUS_10140 26393 27895 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742208.1 protein_id gnl|my_center|LOCUS_10140 27903 29396 gene locus_tag LOCUS_10150 gene cysS 27903 29396 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence025 1454 678 gene locus_tag LOCUS_10160 1454 678 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098387.1 protein_id gnl|my_center|LOCUS_10160 1515 2279 gene locus_tag LOCUS_10170 1515 2279 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_10170 2850 2293 gene locus_tag LOCUS_10180 2850 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4080 3235 gene locus_tag LOCUS_10190 4080 3235 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286316.1 protein_id gnl|my_center|LOCUS_10190 4722 4105 gene locus_tag LOCUS_10200 4722 4105 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973815.1 protein_id gnl|my_center|LOCUS_10200 5637 4747 gene locus_tag LOCUS_10210 5637 4747 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_10210 6224 5676 gene locus_tag LOCUS_10220 6224 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 6380 6802 gene locus_tag LOCUS_10230 6380 6802 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223006.1 protein_id gnl|my_center|LOCUS_10230 7407 6799 gene locus_tag LOCUS_10240 7407 6799 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229706.1 protein_id gnl|my_center|LOCUS_10240 7968 7459 gene locus_tag LOCUS_10250 7968 7459 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030945.1 protein_id gnl|my_center|LOCUS_10250 8197 7973 gene locus_tag LOCUS_10260 8197 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 8336 9904 gene locus_tag LOCUS_10270 8336 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 9901 10203 gene locus_tag LOCUS_10280 9901 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 10606 10280 gene locus_tag LOCUS_10290 10606 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 11819 10620 gene locus_tag LOCUS_10300 11819 10620 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_10300 13035 11881 gene locus_tag LOCUS_10310 13035 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 13310 13053 gene locus_tag LOCUS_10320 13310 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 14908 13325 gene locus_tag LOCUS_10330 14908 13325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 15912 14944 gene locus_tag LOCUS_10340 15912 14944 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_10340 16951 16061 gene locus_tag LOCUS_10350 16951 16061 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_10350 18506 17115 gene locus_tag LOCUS_10360 18506 17115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 18541 19833 gene locus_tag LOCUS_10370 18541 19833 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_10370 19826 20422 gene locus_tag LOCUS_10380 19826 20422 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_10380 20456 21619 gene locus_tag LOCUS_10390 20456 21619 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_10390 21624 21953 gene locus_tag LOCUS_10400 21624 21953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 23314 21983 gene locus_tag LOCUS_10410 23314 21983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 23959 23378 gene locus_tag LOCUS_10420 23959 23378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 24579 23959 gene locus_tag LOCUS_10430 gene sigE 24579 23959 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_10430 24758 25471 gene locus_tag LOCUS_10440 24758 25471 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469700.1 protein_id gnl|my_center|LOCUS_10440 26219 25665 gene locus_tag LOCUS_10450 26219 25665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 27831 26299 gene locus_tag LOCUS_10460 27831 26299 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222970.1 protein_id gnl|my_center|LOCUS_10460 28168 28001 gene locus_tag LOCUS_10470 28168 28001 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_10470 28296 29153 gene locus_tag LOCUS_10480 28296 29153 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030580.1 protein_id gnl|my_center|LOCUS_10480 29150 29953 gene locus_tag LOCUS_10490 29150 29953 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030081.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence026 <1 628 gene locus_tag LOCUS_10500 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803816.1:Gfo/Idh/MocA family oxidoreductase 683 1336 gene locus_tag LOCUS_10510 683 1336 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284413.1 protein_id gnl|my_center|LOCUS_10510 1742 1341 gene locus_tag LOCUS_10520 gene msrB 1742 1341 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_10520 1796 2860 gene locus_tag LOCUS_10530 gene ligD 1796 2860 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_10530 3874 3077 gene locus_tag LOCUS_10540 3874 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 4462 3938 gene locus_tag LOCUS_10550 4462 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5607 4519 gene locus_tag LOCUS_10560 5607 4519 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 protein_id gnl|my_center|LOCUS_10560 5648 6661 gene locus_tag LOCUS_10570 gene zapE 5648 6661 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485435.1 protein_id gnl|my_center|LOCUS_10570 6718 7773 gene locus_tag LOCUS_10580 6718 7773 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962511.1 protein_id gnl|my_center|LOCUS_10580 7823 8050 gene locus_tag LOCUS_10590 7823 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 8047 8244 gene locus_tag LOCUS_10600 8047 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 8292 9185 gene locus_tag LOCUS_10610 8292 9185 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112196.1 protein_id gnl|my_center|LOCUS_10610 9196 9966 gene locus_tag LOCUS_10620 9196 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_10620 9963 10346 gene locus_tag LOCUS_10630 9963 10346 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_10630 11060 10503 gene locus_tag LOCUS_10640 11060 10503 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258738.1 protein_id gnl|my_center|LOCUS_10640 11362 11186 gene locus_tag LOCUS_10650 11362 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 12833 11424 gene locus_tag LOCUS_10660 gene lpdA 12833 11424 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 protein_id gnl|my_center|LOCUS_10660 13088 12852 gene locus_tag LOCUS_10670 13088 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 13045 14091 gene locus_tag LOCUS_10680 13045 14091 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467826.1 protein_id gnl|my_center|LOCUS_10680 14845 14102 gene locus_tag LOCUS_10690 14845 14102 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228436.1 protein_id gnl|my_center|LOCUS_10690 15622 14876 gene locus_tag LOCUS_10700 15622 14876 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_10700 15816 15619 gene locus_tag LOCUS_10710 15816 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 17594 15813 gene locus_tag LOCUS_10720 17594 15813 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228431.1 protein_id gnl|my_center|LOCUS_10720 18300 17902 gene locus_tag LOCUS_10730 18300 17902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 19114 18329 gene locus_tag LOCUS_10740 19114 18329 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899009.1 protein_id gnl|my_center|LOCUS_10740 19260 20702 gene locus_tag LOCUS_10750 19260 20702 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512914.1 protein_id gnl|my_center|LOCUS_10750 22432 20795 gene locus_tag LOCUS_10760 22432 20795 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 protein_id gnl|my_center|LOCUS_10760 22519 23535 gene locus_tag LOCUS_10770 22519 23535 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972813.1 protein_id gnl|my_center|LOCUS_10770 23542 24657 gene locus_tag LOCUS_10780 gene rsgA 23542 24657 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_10780 24857 25948 gene locus_tag LOCUS_10790 24857 25948 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975108.1 protein_id gnl|my_center|LOCUS_10790 26311 25973 gene locus_tag LOCUS_10800 26311 25973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 26491 26748 gene locus_tag LOCUS_10810 26491 26748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 26970 27275 gene locus_tag LOCUS_10820 26970 27275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 27699 27256 gene locus_tag LOCUS_10830 27699 27256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 27757 28359 gene locus_tag LOCUS_10840 27757 28359 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896747.1 protein_id gnl|my_center|LOCUS_10840 28526 28843 gene locus_tag LOCUS_10850 28526 28843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 28978 29817 gene locus_tag LOCUS_10860 28978 29817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence027 <1 577 gene locus_tag LOCUS_10870 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226764.1:ATP-binding protein 593 2530 gene locus_tag LOCUS_10880 593 2530 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_10880 3588 2623 gene locus_tag LOCUS_10890 3588 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730680.1 protein_id gnl|my_center|LOCUS_10890 4090 3728 gene locus_tag LOCUS_10900 4090 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 4857 4087 gene locus_tag LOCUS_10910 gene pcaD 4857 4087 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_10910 6094 4859 gene locus_tag LOCUS_10920 gene pcaB 6094 4859 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031114.1 protein_id gnl|my_center|LOCUS_10920 6698 6078 gene locus_tag LOCUS_10930 gene pcaG 6698 6078 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223754.1 protein_id gnl|my_center|LOCUS_10930 7414 6695 gene locus_tag LOCUS_10940 gene pcaH 7414 6695 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728462.1 protein_id gnl|my_center|LOCUS_10940 8603 7419 gene locus_tag LOCUS_10950 8603 7419 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031117.1 protein_id gnl|my_center|LOCUS_10950 8722 9498 gene locus_tag LOCUS_10960 8722 9498 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_10960 9532 10812 gene locus_tag LOCUS_10970 9532 10812 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229335.1 protein_id gnl|my_center|LOCUS_10970 11651 10896 gene locus_tag LOCUS_10980 11651 10896 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_10980 11720 12385 gene locus_tag LOCUS_10990 11720 12385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 13360 12404 gene locus_tag LOCUS_11000 13360 12404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 13441 14796 gene locus_tag LOCUS_11010 13441 14796 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051218217.1 protein_id gnl|my_center|LOCUS_11010 15816 14809 gene locus_tag LOCUS_11020 15816 14809 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878423.1 protein_id gnl|my_center|LOCUS_11020 16507 15884 gene locus_tag LOCUS_11030 16507 15884 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223203.1 protein_id gnl|my_center|LOCUS_11030 17592 16504 gene locus_tag LOCUS_11040 17592 16504 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_11040 18477 17692 gene locus_tag LOCUS_11050 18477 17692 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_11050 18587 18660 gene locus_tag LOCUS_t00100 18587 18660 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 18709 18783 gene locus_tag LOCUS_t00110 18709 18783 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18896 19066 gene locus_tag LOCUS_11060 gene rpmG 18896 19066 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776157.1 protein_id gnl|my_center|LOCUS_11060 19146 19553 gene locus_tag LOCUS_11070 19146 19553 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_11070 19550 19954 gene locus_tag LOCUS_11080 19550 19954 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_11080 19947 20990 gene locus_tag LOCUS_11090 19947 20990 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_11090 21556 21014 gene locus_tag LOCUS_11100 21556 21014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 22709 21702 gene locus_tag LOCUS_11110 22709 21702 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_11110 23980 22799 gene locus_tag LOCUS_11120 23980 22799 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_11120 24202 24275 gene locus_tag LOCUS_t00120 24202 24275 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 24356 24595 gene locus_tag LOCUS_11130 24356 24595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 24673 25557 gene locus_tag LOCUS_11140 gene nusG 24673 25557 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029791.1 protein_id gnl|my_center|LOCUS_11140 25613 26041 gene locus_tag LOCUS_11150 gene rplK 25613 26041 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 protein_id gnl|my_center|LOCUS_11150 26132 26845 gene locus_tag LOCUS_11160 gene rplA 26132 26845 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061480.1 protein_id gnl|my_center|LOCUS_11160 27211 27813 gene locus_tag LOCUS_11170 gene rplJ 27211 27813 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_11170 27885 28277 gene locus_tag LOCUS_11180 gene rplL 27885 28277 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence028 420 1421 gene locus_tag LOCUS_11190 gene dhaK 420 1421 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728174.1 protein_id gnl|my_center|LOCUS_11190 1425 2090 gene locus_tag LOCUS_11200 gene dhaL 1425 2090 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728173.1 protein_id gnl|my_center|LOCUS_11200 2155 2934 gene locus_tag LOCUS_11210 2155 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11210 3224 3508 gene locus_tag LOCUS_11220 3224 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11220 4617 3631 gene locus_tag LOCUS_11230 4617 3631 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028558.1 protein_id gnl|my_center|LOCUS_11230 5576 4614 gene locus_tag LOCUS_11240 5576 4614 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_11240 6507 5800 gene locus_tag LOCUS_11250 6507 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 7462 6500 gene locus_tag LOCUS_11260 7462 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11260 8517 7459 gene locus_tag LOCUS_11270 8517 7459 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168117700.1 protein_id gnl|my_center|LOCUS_11270 8912 8514 gene locus_tag LOCUS_11280 8912 8514 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_11280 9904 8900 gene locus_tag LOCUS_11290 9904 8900 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_11290 9964 10734 gene locus_tag LOCUS_11300 9964 10734 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031073.1 protein_id gnl|my_center|LOCUS_11300 10749 12392 gene locus_tag LOCUS_11310 10749 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226966.1 protein_id gnl|my_center|LOCUS_11310 12434 12946 gene locus_tag LOCUS_11320 12434 12946 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224600.1 protein_id gnl|my_center|LOCUS_11320 12943 13632 gene locus_tag LOCUS_11330 12943 13632 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224601.1 protein_id gnl|my_center|LOCUS_11330 13983 13579 gene locus_tag LOCUS_11340 13983 13579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 14830 14063 gene locus_tag LOCUS_11350 14830 14063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 14912 16123 gene locus_tag LOCUS_11360 14912 16123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 18595 16133 gene locus_tag LOCUS_11370 18595 16133 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_11370 20180 18612 gene locus_tag LOCUS_11380 20180 18612 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_11380 20973 20182 gene locus_tag LOCUS_11390 20973 20182 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807682.1 protein_id gnl|my_center|LOCUS_11390 21068 22408 gene locus_tag LOCUS_11400 21068 22408 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633142.1 protein_id gnl|my_center|LOCUS_11400 22463 23170 gene locus_tag LOCUS_11410 22463 23170 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_11410 23187 23564 gene locus_tag LOCUS_11420 23187 23564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 23561 24466 gene locus_tag LOCUS_11430 23561 24466 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975922.1 protein_id gnl|my_center|LOCUS_11430 24470 26467 gene locus_tag LOCUS_11440 24470 26467 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337730.1 protein_id gnl|my_center|LOCUS_11440 27022 26621 gene locus_tag LOCUS_11450 27022 26621 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528007.1 protein_id gnl|my_center|LOCUS_11450 <29355 27141 gene locus_tag LOCUS_11460 <29355 27141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728199.1:RNA polymerase recycling motor ATPase HelR >Feature sequence029 974 3 gene locus_tag LOCUS_11470 gene coaA 974 3 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776319.1 protein_id gnl|my_center|LOCUS_11470 1050 2903 gene locus_tag LOCUS_11480 gene glmS 1050 2903 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_11480 2947 3297 gene locus_tag LOCUS_11490 2947 3297 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_11490 3370 4779 gene locus_tag LOCUS_11500 3370 4779 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_11500 4770 5915 gene locus_tag LOCUS_11510 gene alr 4770 5915 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_11510 5912 6991 gene locus_tag LOCUS_11520 5912 6991 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_11520 6988 7467 gene locus_tag LOCUS_11530 gene tsaE 6988 7467 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_11530 7486 8130 gene locus_tag LOCUS_11540 gene tsaB 7486 8130 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_11540 8127 8552 gene locus_tag LOCUS_11550 gene rimI 8127 8552 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083620.1 protein_id gnl|my_center|LOCUS_11550 8560 9615 gene locus_tag LOCUS_11560 gene tsaD 8560 9615 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_11560 9661 10695 gene locus_tag LOCUS_11570 9661 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 10785 11909 gene locus_tag LOCUS_11580 10785 11909 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_11580 11909 12535 gene locus_tag LOCUS_11590 11909 12535 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229801.1 protein_id gnl|my_center|LOCUS_11590 12576 14939 gene locus_tag LOCUS_11600 gene treY 12576 14939 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224464.1 protein_id gnl|my_center|LOCUS_11600 14939 16678 gene locus_tag LOCUS_11610 gene treZ 14939 16678 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030636.1 protein_id gnl|my_center|LOCUS_11610 16718 17266 gene locus_tag LOCUS_11620 16718 17266 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050546857.1 protein_id gnl|my_center|LOCUS_11620 18712 17540 gene locus_tag LOCUS_11630 18712 17540 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_11630 18910 19203 gene locus_tag LOCUS_11640 gene groES 18910 19203 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_11640 19343 20968 gene locus_tag LOCUS_11650 gene groL 19343 20968 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_11650 21111 21512 gene locus_tag LOCUS_11660 21111 21512 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976191.1 protein_id gnl|my_center|LOCUS_11660 21693 23234 gene locus_tag LOCUS_11670 gene guaB 21693 23234 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804497.1 protein_id gnl|my_center|LOCUS_11670 23440 24546 gene locus_tag LOCUS_11680 23440 24546 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_11680 24869 26434 gene locus_tag LOCUS_11690 gene guaA 24869 26434 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_11690 27989 26463 gene locus_tag LOCUS_11700 27989 26463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence030 431 1015 gene locus_tag LOCUS_11710 431 1015 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 protein_id gnl|my_center|LOCUS_11710 1012 2655 gene locus_tag LOCUS_11720 1012 2655 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_11720 2887 4323 gene locus_tag LOCUS_11730 2887 4323 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_11730 4354 5400 gene locus_tag LOCUS_11740 gene cydB 4354 5400 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_11740 5397 8822 gene locus_tag LOCUS_11750 gene cydD 5397 8822 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029332.1 protein_id gnl|my_center|LOCUS_11750 8869 9741 gene locus_tag LOCUS_11760 8869 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 10687 9743 gene locus_tag LOCUS_11770 10687 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 13247 10800 gene locus_tag LOCUS_11780 13247 10800 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_11780 14336 13683 gene locus_tag LOCUS_11790 14336 13683 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_11790 14665 15603 gene locus_tag LOCUS_11800 14665 15603 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895405.1 protein_id gnl|my_center|LOCUS_11800 15639 16052 gene locus_tag LOCUS_11810 15639 16052 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730338.1 protein_id gnl|my_center|LOCUS_11810 17853 16303 gene locus_tag LOCUS_11820 gene crtI 17853 16303 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804092.1 protein_id gnl|my_center|LOCUS_11820 18770 17874 gene locus_tag LOCUS_11830 18770 17874 CDS product squalene/phytoene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930127.1 protein_id gnl|my_center|LOCUS_11830 19891 18767 gene locus_tag LOCUS_11840 19891 18767 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804096.1 protein_id gnl|my_center|LOCUS_11840 20006 20878 gene locus_tag LOCUS_11850 20006 20878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 20998 22686 gene locus_tag LOCUS_11860 20998 22686 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971843.1 protein_id gnl|my_center|LOCUS_11860 22727 24166 gene locus_tag LOCUS_11870 22727 24166 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031573.1 protein_id gnl|my_center|LOCUS_11870 25615 24329 gene locus_tag LOCUS_11880 gene larA 25615 24329 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224947.1 protein_id gnl|my_center|LOCUS_11880 25721 26236 gene locus_tag LOCUS_11890 25721 26236 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326320.1 protein_id gnl|my_center|LOCUS_11890 26965 26417 gene locus_tag LOCUS_11900 26965 26417 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224846.1 protein_id gnl|my_center|LOCUS_11900 28412 26967 gene locus_tag LOCUS_11910 28412 26967 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028622.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence031 1836 337 gene locus_tag LOCUS_11920 1836 337 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_11920 2224 1934 gene locus_tag LOCUS_11930 2224 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2901 2371 gene locus_tag LOCUS_11940 2901 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3301 2894 gene locus_tag LOCUS_11950 3301 2894 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029496.1 protein_id gnl|my_center|LOCUS_11950 5114 3408 gene locus_tag LOCUS_11960 5114 3408 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053633.1 protein_id gnl|my_center|LOCUS_11960 5816 5208 gene locus_tag LOCUS_11970 5816 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 7159 6023 gene locus_tag LOCUS_11980 7159 6023 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_11980 7046 8344 gene locus_tag LOCUS_11990 7046 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 8341 9285 gene locus_tag LOCUS_12000 8341 9285 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_12000 9340 9567 gene locus_tag LOCUS_12010 9340 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 9595 9810 gene locus_tag LOCUS_12020 9595 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 10383 9751 gene locus_tag LOCUS_12030 10383 9751 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 protein_id gnl|my_center|LOCUS_12030 10429 11280 gene locus_tag LOCUS_12040 gene rfbD 10429 11280 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_12040 11419 12606 gene locus_tag LOCUS_12050 11419 12606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 12644 13648 gene locus_tag LOCUS_12060 gene galE 12644 13648 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992438.1 protein_id gnl|my_center|LOCUS_12060 13724 14569 gene locus_tag LOCUS_12070 13724 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 15474 14566 gene locus_tag LOCUS_12080 15474 14566 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140467.1 protein_id gnl|my_center|LOCUS_12080 16222 15467 gene locus_tag LOCUS_12090 16222 15467 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976090.1 protein_id gnl|my_center|LOCUS_12090 17427 16219 gene locus_tag LOCUS_12100 17427 16219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 17548 18531 gene locus_tag LOCUS_12110 17548 18531 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017275914.1 protein_id gnl|my_center|LOCUS_12110 19241 18492 gene locus_tag LOCUS_12120 19241 18492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 20333 19299 gene locus_tag LOCUS_12130 20333 19299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 20555 21553 gene locus_tag LOCUS_12140 20555 21553 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173531.1 protein_id gnl|my_center|LOCUS_12140 22943 21600 gene locus_tag LOCUS_12150 22943 21600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 24014 23016 gene locus_tag LOCUS_12160 24014 23016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 24213 25166 gene locus_tag LOCUS_12170 24213 25166 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142190.1 protein_id gnl|my_center|LOCUS_12170 26693 25128 gene locus_tag LOCUS_12180 26693 25128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 26810 27880 gene locus_tag LOCUS_12190 26810 27880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence032 406 1182 gene locus_tag LOCUS_12200 gene rph 406 1182 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_12200 1163 1822 gene locus_tag LOCUS_12210 gene rdgB 1163 1822 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229451.1 protein_id gnl|my_center|LOCUS_12210 1897 1824 gene locus_tag LOCUS_t00130 1897 1824 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2404 1928 gene locus_tag LOCUS_12220 gene bcp 2404 1928 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093079.1 protein_id gnl|my_center|LOCUS_12220 2591 2860 gene locus_tag LOCUS_12230 2591 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2877 3197 gene locus_tag LOCUS_12240 2877 3197 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_12240 3831 3256 gene locus_tag LOCUS_12250 3831 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4919 3903 gene locus_tag LOCUS_12260 4919 3903 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_12260 5306 4932 gene locus_tag LOCUS_12270 5306 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087553.1 protein_id gnl|my_center|LOCUS_12270 6212 5316 gene locus_tag LOCUS_12280 6212 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 6600 6773 gene locus_tag LOCUS_12290 6600 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 6763 8058 gene locus_tag LOCUS_12300 6763 8058 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_12300 9045 8641 gene locus_tag LOCUS_12310 9045 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 9145 9918 gene locus_tag LOCUS_12320 9145 9918 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066563356.1 protein_id gnl|my_center|LOCUS_12320 9908 11263 gene locus_tag LOCUS_12330 9908 11263 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_12330 11315 12088 gene locus_tag LOCUS_12340 11315 12088 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227652.1 protein_id gnl|my_center|LOCUS_12340 12095 13714 gene locus_tag LOCUS_12350 12095 13714 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227653.1 protein_id gnl|my_center|LOCUS_12350 15401 13860 gene locus_tag LOCUS_12360 15401 13860 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726984.1 protein_id gnl|my_center|LOCUS_12360 16196 15576 gene locus_tag LOCUS_12370 16196 15576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 16249 16722 gene locus_tag LOCUS_12380 16249 16722 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227509.1 protein_id gnl|my_center|LOCUS_12380 16885 17523 gene locus_tag LOCUS_12390 16885 17523 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229966.1 protein_id gnl|my_center|LOCUS_12390 17699 18145 gene locus_tag LOCUS_12400 17699 18145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 18810 18442 gene locus_tag LOCUS_12410 18810 18442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 protein_id gnl|my_center|LOCUS_12410 19811 18873 gene locus_tag LOCUS_12420 19811 18873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 21244 19808 gene locus_tag LOCUS_12430 21244 19808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 21854 21423 gene locus_tag LOCUS_12440 21854 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 22605 22132 gene locus_tag LOCUS_12450 22605 22132 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224765.1 protein_id gnl|my_center|LOCUS_12450 24080 22602 gene locus_tag LOCUS_12460 24080 22602 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223436.1 protein_id gnl|my_center|LOCUS_12460 24385 25614 gene locus_tag LOCUS_12470 24385 25614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 25819 26526 gene locus_tag LOCUS_12480 25819 26526 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730633.1 protein_id gnl|my_center|LOCUS_12480 26945 27181 gene locus_tag LOCUS_12490 26945 27181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 27178 27492 gene locus_tag LOCUS_12500 27178 27492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 27646 27476 gene locus_tag LOCUS_12510 27646 27476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence033 185 685 gene locus_tag LOCUS_12520 gene lspA 185 685 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947675.1 protein_id gnl|my_center|LOCUS_12520 682 1641 gene locus_tag LOCUS_12530 682 1641 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_12530 1631 2365 gene locus_tag LOCUS_12540 1631 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2424 2846 gene locus_tag LOCUS_12550 2424 2846 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977952.1 protein_id gnl|my_center|LOCUS_12550 3041 6595 gene locus_tag LOCUS_12560 gene dnaE 3041 6595 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_12560 6595 7269 gene locus_tag LOCUS_12570 6595 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 7283 8137 gene locus_tag LOCUS_12580 7283 8137 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775992.1 protein_id gnl|my_center|LOCUS_12580 8641 8156 gene locus_tag LOCUS_12590 8641 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 9329 8778 gene locus_tag LOCUS_12600 9329 8778 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 protein_id gnl|my_center|LOCUS_12600 11346 9391 gene locus_tag LOCUS_12610 11346 9391 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460092.1 protein_id gnl|my_center|LOCUS_12610 12227 11346 gene locus_tag LOCUS_12620 12227 11346 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 protein_id gnl|my_center|LOCUS_12620 12904 12224 gene locus_tag LOCUS_12630 12904 12224 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_12630 13713 12901 gene locus_tag LOCUS_12640 13713 12901 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018701913.1 protein_id gnl|my_center|LOCUS_12640 13852 15291 gene locus_tag LOCUS_12650 13852 15291 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328727.1 protein_id gnl|my_center|LOCUS_12650 15573 15313 gene locus_tag LOCUS_12660 15573 15313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 16512 15622 gene locus_tag LOCUS_12670 gene purU 16512 15622 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_12670 16601 17413 gene locus_tag LOCUS_12680 16601 17413 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_12680 17599 18984 gene locus_tag LOCUS_12690 17599 18984 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224487.1 protein_id gnl|my_center|LOCUS_12690 19054 20772 gene locus_tag LOCUS_12700 gene betA 19054 20772 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_12700 20769 21839 gene locus_tag LOCUS_12710 20769 21839 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_12710 21842 23950 gene locus_tag LOCUS_12720 21842 23950 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_12720 24026 25003 gene locus_tag LOCUS_12730 24026 25003 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_12730 25155 27671 gene locus_tag LOCUS_12740 25155 27671 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775989.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence034 659 375 gene locus_tag LOCUS_12750 gene catC 659 375 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728004.1 protein_id gnl|my_center|LOCUS_12750 1512 670 gene locus_tag LOCUS_12760 gene catA 1512 670 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728003.1 protein_id gnl|my_center|LOCUS_12760 2673 1570 gene locus_tag LOCUS_12770 2673 1570 CDS product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728002.1 protein_id gnl|my_center|LOCUS_12770 3692 2670 gene locus_tag LOCUS_12780 3692 2670 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728001.1 protein_id gnl|my_center|LOCUS_12780 3829 5235 gene locus_tag LOCUS_12790 gene benA 3829 5235 CDS product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728000.1 protein_id gnl|my_center|LOCUS_12790 5237 5779 gene locus_tag LOCUS_12800 gene benB 5237 5779 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727999.1 protein_id gnl|my_center|LOCUS_12800 5812 8580 gene locus_tag LOCUS_12810 gene benC 5812 8580 CDS product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727998.1 protein_id gnl|my_center|LOCUS_12810 8638 11340 gene locus_tag LOCUS_12820 8638 11340 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727994.1 protein_id gnl|my_center|LOCUS_12820 12067 11396 gene locus_tag LOCUS_12830 12067 11396 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977695.1 protein_id gnl|my_center|LOCUS_12830 13662 12064 gene locus_tag LOCUS_12840 13662 12064 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027601.1 protein_id gnl|my_center|LOCUS_12840 13821 14843 gene locus_tag LOCUS_12850 13821 14843 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250323.1 protein_id gnl|my_center|LOCUS_12850 14840 15361 gene locus_tag LOCUS_12860 14840 15361 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027603.1 protein_id gnl|my_center|LOCUS_12860 15364 16923 gene locus_tag LOCUS_12870 15364 16923 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877971.1 protein_id gnl|my_center|LOCUS_12870 16920 17309 gene locus_tag LOCUS_12880 16920 17309 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 protein_id gnl|my_center|LOCUS_12880 17658 17338 gene locus_tag LOCUS_12890 17658 17338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 19205 17895 gene locus_tag LOCUS_12900 19205 17895 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028042.1 protein_id gnl|my_center|LOCUS_12900 19678 20970 gene locus_tag LOCUS_12910 gene ilvA 19678 20970 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223532.1 protein_id gnl|my_center|LOCUS_12910 21327 21088 gene locus_tag LOCUS_12920 21327 21088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892554.1 protein_id gnl|my_center|LOCUS_12920 21453 22040 gene locus_tag LOCUS_12930 21453 22040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 22568 22197 gene locus_tag LOCUS_12940 22568 22197 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_12940 22666 24516 gene locus_tag LOCUS_12950 22666 24516 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_12950 26002 24689 gene locus_tag LOCUS_12960 26002 24689 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970768.1 protein_id gnl|my_center|LOCUS_12960 26235 26011 gene locus_tag LOCUS_12970 26235 26011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 26556 26786 gene locus_tag LOCUS_12980 26556 26786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence035 267 968 gene locus_tag LOCUS_12990 267 968 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 protein_id gnl|my_center|LOCUS_12990 1979 996 gene locus_tag LOCUS_13000 1979 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405722.1 protein_id gnl|my_center|LOCUS_13000 3374 2196 gene locus_tag LOCUS_13010 3374 2196 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977076.1 protein_id gnl|my_center|LOCUS_13010 4747 3371 gene locus_tag LOCUS_13020 4747 3371 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889602.1 protein_id gnl|my_center|LOCUS_13020 5994 4789 gene locus_tag LOCUS_13030 gene serA 5994 4789 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054393.1 protein_id gnl|my_center|LOCUS_13030 6939 6022 gene locus_tag LOCUS_13040 6939 6022 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113182.1 protein_id gnl|my_center|LOCUS_13040 7012 8850 gene locus_tag LOCUS_13050 7012 8850 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026880.1 protein_id gnl|my_center|LOCUS_13050 9100 10467 gene locus_tag LOCUS_13060 9100 10467 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973100.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13060 10702 10484 gene locus_tag LOCUS_13070 10702 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 12785 10908 gene locus_tag LOCUS_13080 12785 10908 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_13080 14592 12907 gene locus_tag LOCUS_13090 14592 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 14774 15232 gene locus_tag LOCUS_13100 14774 15232 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920478.1 protein_id gnl|my_center|LOCUS_13100 15942 15283 gene locus_tag LOCUS_13110 15942 15283 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_13110 16453 15986 gene locus_tag LOCUS_13120 16453 15986 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084746.1 protein_id gnl|my_center|LOCUS_13120 17975 16476 gene locus_tag LOCUS_13130 17975 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 17863 18228 gene locus_tag LOCUS_13140 17863 18228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 18321 18247 gene locus_tag LOCUS_t00140 18321 18247 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 18395 18970 gene locus_tag LOCUS_13150 gene dcd 18395 18970 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_13150 21579 19075 gene locus_tag LOCUS_13160 21579 19075 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029156.1 protein_id gnl|my_center|LOCUS_13160 22634 21873 gene locus_tag LOCUS_13170 22634 21873 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 protein_id gnl|my_center|LOCUS_13170 22771 24318 gene locus_tag LOCUS_13180 gene hutH 22771 24318 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_13180 24315 25994 gene locus_tag LOCUS_13190 24315 25994 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028751.1 protein_id gnl|my_center|LOCUS_13190 26719 26078 gene locus_tag LOCUS_13200 26719 26078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence036 12 1913 gene locus_tag LOCUS_13210 12 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 2127 1933 gene locus_tag LOCUS_13220 2127 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2642 2301 gene locus_tag LOCUS_13230 2642 2301 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978015.1 protein_id gnl|my_center|LOCUS_13230 2905 2639 gene locus_tag LOCUS_13240 2905 2639 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978014.1 protein_id gnl|my_center|LOCUS_13240 3950 2928 gene locus_tag LOCUS_13250 3950 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 4619 4032 gene locus_tag LOCUS_13260 4619 4032 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727052.1 protein_id gnl|my_center|LOCUS_13260 6094 4616 gene locus_tag LOCUS_13270 6094 4616 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_13270 6894 6091 gene locus_tag LOCUS_13280 6894 6091 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 protein_id gnl|my_center|LOCUS_13280 8215 6941 gene locus_tag LOCUS_13290 8215 6941 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727047.1 protein_id gnl|my_center|LOCUS_13290 9742 8288 gene locus_tag LOCUS_13300 9742 8288 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226386.1 protein_id gnl|my_center|LOCUS_13300 11183 9744 gene locus_tag LOCUS_13310 11183 9744 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 protein_id gnl|my_center|LOCUS_13310 13278 11200 gene locus_tag LOCUS_13320 13278 11200 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467133.1 protein_id gnl|my_center|LOCUS_13320 14461 13283 gene locus_tag LOCUS_13330 gene rhaI 14461 13283 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727048.1 protein_id gnl|my_center|LOCUS_13330 14834 14463 gene locus_tag LOCUS_13340 14834 14463 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226382.1 protein_id gnl|my_center|LOCUS_13340 15859 14924 gene locus_tag LOCUS_13350 gene rhaS 15859 14924 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978052.1 protein_id gnl|my_center|LOCUS_13350 15864 16004 gene locus_tag LOCUS_13360 15864 16004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 17118 16021 gene locus_tag LOCUS_13370 17118 16021 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226380.1 protein_id gnl|my_center|LOCUS_13370 18145 17108 gene locus_tag LOCUS_13380 18145 17108 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226379.1 protein_id gnl|my_center|LOCUS_13380 19659 18142 gene locus_tag LOCUS_13390 19659 18142 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226378.1 protein_id gnl|my_center|LOCUS_13390 19855 20925 gene locus_tag LOCUS_13400 19855 20925 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226377.1 protein_id gnl|my_center|LOCUS_13400 21125 21457 gene locus_tag LOCUS_13410 21125 21457 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226694.1 protein_id gnl|my_center|LOCUS_13410 21639 22796 gene locus_tag LOCUS_13420 21639 22796 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891441.1 protein_id gnl|my_center|LOCUS_13420 22796 23554 gene locus_tag LOCUS_13430 22796 23554 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222055.1 protein_id gnl|my_center|LOCUS_13430 24095 23592 gene locus_tag LOCUS_13440 24095 23592 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776976.1 protein_id gnl|my_center|LOCUS_13440 25104 24100 gene locus_tag LOCUS_13450 25104 24100 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226137.1 protein_id gnl|my_center|LOCUS_13450 25452 25162 gene locus_tag LOCUS_13460 25452 25162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 26177 25635 gene locus_tag LOCUS_13470 26177 25635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 26580 26170 gene locus_tag LOCUS_13480 26580 26170 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029496.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence037 1972 992 gene locus_tag LOCUS_13490 1972 992 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_13490 2643 1969 gene locus_tag LOCUS_13500 gene pyrR 2643 1969 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_13500 3325 2837 gene locus_tag LOCUS_13510 3325 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3385 4026 gene locus_tag LOCUS_13520 3385 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 4903 4049 gene locus_tag LOCUS_13530 4903 4049 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776954.1 protein_id gnl|my_center|LOCUS_13530 6255 4903 gene locus_tag LOCUS_13540 6255 4903 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 protein_id gnl|my_center|LOCUS_13540 6419 7096 gene locus_tag LOCUS_13550 6419 7096 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_13550 7209 7589 gene locus_tag LOCUS_13560 7209 7589 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971972.1 protein_id gnl|my_center|LOCUS_13560 8023 7613 gene locus_tag LOCUS_13570 gene nusB 8023 7613 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728771.1 protein_id gnl|my_center|LOCUS_13570 8586 8023 gene locus_tag LOCUS_13580 gene efp 8586 8023 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_13580 8771 8920 gene locus_tag LOCUS_13590 8771 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 9925 8930 gene locus_tag LOCUS_13600 9925 8930 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111996.1 protein_id gnl|my_center|LOCUS_13600 9964 10503 gene locus_tag LOCUS_13610 9964 10503 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892919.1 protein_id gnl|my_center|LOCUS_13610 11626 10523 gene locus_tag LOCUS_13620 gene aroB 11626 10523 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_13620 12168 11623 gene locus_tag LOCUS_13630 12168 11623 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027814.1 protein_id gnl|my_center|LOCUS_13630 13424 12165 gene locus_tag LOCUS_13640 gene aroC 13424 12165 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_13640 14158 13388 gene locus_tag LOCUS_13650 14158 13388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 15073 14222 gene locus_tag LOCUS_13660 15073 14222 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_13660 16221 15070 gene locus_tag LOCUS_13670 gene mltG 16221 15070 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775669.1 protein_id gnl|my_center|LOCUS_13670 16678 16229 gene locus_tag LOCUS_13680 gene ruvX 16678 16229 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_13680 19389 16702 gene locus_tag LOCUS_13690 gene alaS 19389 16702 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_13690 19712 19389 gene locus_tag LOCUS_13700 19712 19389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 20239 19709 gene locus_tag LOCUS_13710 20239 19709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 21691 20297 gene locus_tag LOCUS_13720 21691 20297 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_13720 22678 21719 gene locus_tag LOCUS_13730 22678 21719 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_13730 23671 22691 gene locus_tag LOCUS_13740 23671 22691 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_13740 24810 23671 gene locus_tag LOCUS_13750 24810 23671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13750 25835 24807 gene locus_tag LOCUS_13760 25835 24807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727086.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence038 613 116 gene locus_tag LOCUS_13770 613 116 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_13770 552 809 gene locus_tag LOCUS_13780 552 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1869 742 gene locus_tag LOCUS_13790 1869 742 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727161.1 protein_id gnl|my_center|LOCUS_13790 3001 1862 gene locus_tag LOCUS_13800 3001 1862 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_13800 3921 2998 gene locus_tag LOCUS_13810 3921 2998 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_13810 4585 3992 gene locus_tag LOCUS_13820 4585 3992 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223758.1 protein_id gnl|my_center|LOCUS_13820 5719 4619 gene locus_tag LOCUS_13830 5719 4619 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729293.1 protein_id gnl|my_center|LOCUS_13830 6468 5716 gene locus_tag LOCUS_13840 6468 5716 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223274.1 protein_id gnl|my_center|LOCUS_13840 7341 6574 gene locus_tag LOCUS_13850 7341 6574 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_13850 7599 8549 gene locus_tag LOCUS_13860 7599 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 8581 9135 gene locus_tag LOCUS_13870 8581 9135 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943975.1 protein_id gnl|my_center|LOCUS_13870 9168 9809 gene locus_tag LOCUS_13880 9168 9809 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971839.1 protein_id gnl|my_center|LOCUS_13880 11151 9817 gene locus_tag LOCUS_13890 11151 9817 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222496.1 protein_id gnl|my_center|LOCUS_13890 11320 12561 gene locus_tag LOCUS_13900 11320 12561 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285879.1 protein_id gnl|my_center|LOCUS_13900 12579 13427 gene locus_tag LOCUS_13910 12579 13427 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978472.1 protein_id gnl|my_center|LOCUS_13910 13479 14120 gene locus_tag LOCUS_13920 13479 14120 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978471.1 protein_id gnl|my_center|LOCUS_13920 15870 14242 gene locus_tag LOCUS_13930 gene groL 15870 14242 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_13930 16568 16293 gene locus_tag LOCUS_13940 16568 16293 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_13940 17946 16642 gene locus_tag LOCUS_13950 gene thrC 17946 16642 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228462.1 protein_id gnl|my_center|LOCUS_13950 19224 18373 gene locus_tag LOCUS_13960 gene otsB 19224 18373 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_13960 19804 19271 gene locus_tag LOCUS_13970 19804 19271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 20093 19797 gene locus_tag LOCUS_13980 20093 19797 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892262.1 protein_id gnl|my_center|LOCUS_13980 20285 21364 gene locus_tag LOCUS_13990 20285 21364 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_13990 21411 22868 gene locus_tag LOCUS_14000 21411 22868 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730872.1 protein_id gnl|my_center|LOCUS_14000 24914 23499 gene locus_tag LOCUS_14010 24914 23499 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224565.1 protein_id gnl|my_center|LOCUS_14010 25378 24962 gene locus_tag LOCUS_14020 25378 24962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence039 172 1656 gene locus_tag LOCUS_14030 172 1656 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742083.1 protein_id gnl|my_center|LOCUS_14030 2870 1944 gene locus_tag LOCUS_14040 2870 1944 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_14040 2979 3416 gene locus_tag LOCUS_14050 2979 3416 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_14050 6415 3614 gene locus_tag LOCUS_14060 6415 3614 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_14060 6939 6538 gene locus_tag LOCUS_14070 6939 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 7834 6941 gene locus_tag LOCUS_14080 gene tatC 7834 6941 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_14080 8178 7876 gene locus_tag LOCUS_14090 gene tatA 8178 7876 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226712.1 protein_id gnl|my_center|LOCUS_14090 9221 8250 gene locus_tag LOCUS_14100 9221 8250 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_14100 10198 9218 gene locus_tag LOCUS_14110 10198 9218 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410775.1 protein_id gnl|my_center|LOCUS_14110 11224 10256 gene locus_tag LOCUS_14120 11224 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 12701 11340 gene locus_tag LOCUS_14130 gene pafA 12701 11340 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_14130 14413 12776 gene locus_tag LOCUS_14140 14413 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 15419 14598 gene locus_tag LOCUS_14150 gene prcA 15419 14598 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_14150 16284 15454 gene locus_tag LOCUS_14160 gene prcB 16284 15454 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_14160 16485 16288 gene locus_tag LOCUS_14170 16485 16288 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_14170 18049 16559 gene locus_tag LOCUS_14180 gene dop 18049 16559 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_14180 18108 18674 gene locus_tag LOCUS_14190 18108 18674 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892833.1 protein_id gnl|my_center|LOCUS_14190 18736 18888 gene locus_tag LOCUS_14200 18736 18888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 20688 18931 gene locus_tag LOCUS_14210 gene arc 20688 18931 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_14210 21793 20861 gene locus_tag LOCUS_14220 21793 20861 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_14220 22985 21834 gene locus_tag LOCUS_14230 22985 21834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14230 23086 23964 gene locus_tag LOCUS_14240 23086 23964 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_14240 24822 24001 gene locus_tag LOCUS_14250 24822 24001 CDS product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029509.1 protein_id gnl|my_center|LOCUS_14250 25493 24822 gene locus_tag LOCUS_14260 25493 24822 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467175.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence040 314 685 gene locus_tag LOCUS_14270 gene rplN 314 685 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403649.1 protein_id gnl|my_center|LOCUS_14270 689 1138 gene locus_tag LOCUS_14280 gene rplX 689 1138 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974256.1 protein_id gnl|my_center|LOCUS_14280 1138 1755 gene locus_tag LOCUS_14290 gene rplE 1138 1755 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_14290 1852 2037 gene locus_tag LOCUS_14300 1852 2037 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_14300 2183 2629 gene locus_tag LOCUS_14310 gene rpsH 2183 2629 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_14310 2656 3198 gene locus_tag LOCUS_14320 gene rplF 2656 3198 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_14320 3200 3583 gene locus_tag LOCUS_14330 gene rplR 3200 3583 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130474831.1 protein_id gnl|my_center|LOCUS_14330 3628 4227 gene locus_tag LOCUS_14340 gene rpsE 3628 4227 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_14340 4224 4409 gene locus_tag LOCUS_14350 gene rpmD 4224 4409 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_14350 4411 4851 gene locus_tag LOCUS_14360 gene rplO 4411 4851 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_14360 5052 6344 gene locus_tag LOCUS_14370 gene secY 5052 6344 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_14370 6344 6919 gene locus_tag LOCUS_14380 6344 6919 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_14380 6929 7750 gene locus_tag LOCUS_14390 gene map 6929 7750 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_14390 8252 8473 gene locus_tag LOCUS_14400 gene infA 8252 8473 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_14400 8864 9238 gene locus_tag LOCUS_14410 gene rpsM 8864 9238 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418360.1 protein_id gnl|my_center|LOCUS_14410 9310 9717 gene locus_tag LOCUS_14420 gene rpsK 9310 9717 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558885.1 protein_id gnl|my_center|LOCUS_14420 9754 10362 gene locus_tag LOCUS_14430 gene rpsD 9754 10362 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 protein_id gnl|my_center|LOCUS_14430 10486 11499 gene locus_tag LOCUS_14440 10486 11499 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_14440 11553 12362 gene locus_tag LOCUS_14450 11553 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 12674 13507 gene locus_tag LOCUS_14460 gene truA 12674 13507 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_14460 13500 14096 gene locus_tag LOCUS_14470 13500 14096 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804681.1 protein_id gnl|my_center|LOCUS_14470 14261 15295 gene locus_tag LOCUS_14480 gene mgrA 14261 15295 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_14480 15412 15612 gene locus_tag LOCUS_14490 15412 15612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 15664 17358 gene locus_tag LOCUS_14500 15664 17358 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114333.1 protein_id gnl|my_center|LOCUS_14500 17365 17724 gene locus_tag LOCUS_14510 17365 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 18267 17671 gene locus_tag LOCUS_14520 18267 17671 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_14520 19840 18482 gene locus_tag LOCUS_14530 19840 18482 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_14530 20083 20526 gene locus_tag LOCUS_14540 gene rplM 20083 20526 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_14540 20580 21104 gene locus_tag LOCUS_14550 gene rpsI 20580 21104 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_14550 21123 22481 gene locus_tag LOCUS_14560 gene glmM 21123 22481 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_14560 22495 23526 gene locus_tag LOCUS_14570 22495 23526 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_14570 24514 23537 gene locus_tag LOCUS_14580 24514 23537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 24654 24511 gene locus_tag LOCUS_14590 24654 24511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 24742 25755 gene locus_tag LOCUS_14600 24742 25755 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence041 4182 424 gene locus_tag LOCUS_14610 4182 424 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775897.1 protein_id gnl|my_center|LOCUS_14610 5411 4179 gene locus_tag LOCUS_14620 5411 4179 CDS product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026930.1 protein_id gnl|my_center|LOCUS_14620 6101 5793 gene locus_tag LOCUS_14630 6101 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 6525 6094 gene locus_tag LOCUS_14640 6525 6094 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258525.1 protein_id gnl|my_center|LOCUS_14640 7402 6512 gene locus_tag LOCUS_14650 7402 6512 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257192.1 protein_id gnl|my_center|LOCUS_14650 8524 7418 gene locus_tag LOCUS_14660 8524 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 8788 8961 gene locus_tag LOCUS_14670 8788 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 9194 8958 gene locus_tag LOCUS_14680 9194 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 9528 10574 gene locus_tag LOCUS_14690 9528 10574 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228127.1 protein_id gnl|my_center|LOCUS_14690 11647 10571 gene locus_tag LOCUS_14700 11647 10571 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228448.1 protein_id gnl|my_center|LOCUS_14700 12066 11857 gene locus_tag LOCUS_14710 12066 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 12174 12890 gene locus_tag LOCUS_14720 12174 12890 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 protein_id gnl|my_center|LOCUS_14720 13000 13719 gene locus_tag LOCUS_14730 13000 13719 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_14730 13810 14712 gene locus_tag LOCUS_14740 13810 14712 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485278.1 protein_id gnl|my_center|LOCUS_14740 15351 14917 gene locus_tag LOCUS_14750 gene hsp18 15351 14917 CDS product molecular chaperone Hsp18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908539.1 protein_id gnl|my_center|LOCUS_14750 15488 15931 gene locus_tag LOCUS_14760 15488 15931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 15959 17521 gene locus_tag LOCUS_14770 15959 17521 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_14770 17529 19541 gene locus_tag LOCUS_14780 17529 19541 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_14780 19538 20497 gene locus_tag LOCUS_14790 19538 20497 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028581.1 protein_id gnl|my_center|LOCUS_14790 20608 22341 gene locus_tag LOCUS_14800 20608 22341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_14800 22338 24308 gene locus_tag LOCUS_14810 22338 24308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976340.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence042 2160 3434 gene locus_tag LOCUS_14820 2160 3434 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383259.1 protein_id gnl|my_center|LOCUS_14820 4907 3639 gene locus_tag LOCUS_14830 4907 3639 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_14830 6967 4904 gene locus_tag LOCUS_14840 6967 4904 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742167.1 protein_id gnl|my_center|LOCUS_14840 7038 7703 gene locus_tag LOCUS_14850 7038 7703 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_14850 7703 8368 gene locus_tag LOCUS_14860 7703 8368 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_14860 9144 8410 gene locus_tag LOCUS_14870 9144 8410 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 protein_id gnl|my_center|LOCUS_14870 9542 9150 gene locus_tag LOCUS_14880 9542 9150 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_14880 10177 9539 gene locus_tag LOCUS_14890 10177 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 10647 10177 gene locus_tag LOCUS_14900 gene dut 10647 10177 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_14900 10756 11463 gene locus_tag LOCUS_14910 10756 11463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 11456 11596 gene locus_tag LOCUS_14920 11456 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 12103 11678 gene locus_tag LOCUS_14930 12103 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 12992 12171 gene locus_tag LOCUS_14940 12992 12171 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894144.1 protein_id gnl|my_center|LOCUS_14940 14092 12995 gene locus_tag LOCUS_14950 14092 12995 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_14950 14117 15322 gene locus_tag LOCUS_14960 14117 15322 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_14960 16151 15282 gene locus_tag LOCUS_14970 16151 15282 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113910.1 protein_id gnl|my_center|LOCUS_14970 16337 16840 gene locus_tag LOCUS_14980 16337 16840 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_14980 16966 17925 gene locus_tag LOCUS_14990 gene sepH 16966 17925 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 protein_id gnl|my_center|LOCUS_14990 18859 18002 gene locus_tag LOCUS_15000 18859 18002 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030499.1 protein_id gnl|my_center|LOCUS_15000 18926 19108 gene locus_tag LOCUS_15010 18926 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 19764 19111 gene locus_tag LOCUS_15020 19764 19111 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_15020 20908 19787 gene locus_tag LOCUS_15030 20908 19787 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_15030 21501 20905 gene locus_tag LOCUS_15040 21501 20905 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_15040 24289 21554 gene locus_tag LOCUS_15050 24289 21554 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence043 1711 2982 gene locus_tag LOCUS_15060 1711 2982 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168581903.1 protein_id gnl|my_center|LOCUS_15060 3136 3330 gene locus_tag LOCUS_15070 3136 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 4970 3327 gene locus_tag LOCUS_15080 4970 3327 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230133.1 protein_id gnl|my_center|LOCUS_15080 5520 5338 gene locus_tag LOCUS_15090 5520 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 5919 6794 gene locus_tag LOCUS_15100 5919 6794 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_15100 7739 6816 gene locus_tag LOCUS_15110 7739 6816 CDS product DNA-3-methyladenine glycosylase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139979125.1 protein_id gnl|my_center|LOCUS_15110 7823 9364 gene locus_tag LOCUS_15120 7823 9364 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877353.1 protein_id gnl|my_center|LOCUS_15120 10675 9368 gene locus_tag LOCUS_15130 10675 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 11703 10843 gene locus_tag LOCUS_15140 11703 10843 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_15140 12670 11711 gene locus_tag LOCUS_15150 12670 11711 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_15150 12838 13194 gene locus_tag LOCUS_15160 12838 13194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 13247 13555 gene locus_tag LOCUS_15170 13247 13555 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337732.1 protein_id gnl|my_center|LOCUS_15170 13552 14451 gene locus_tag LOCUS_15180 13552 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 15689 14487 gene locus_tag LOCUS_15190 15689 14487 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_15190 17614 15710 gene locus_tag LOCUS_15200 gene dxs 17614 15710 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081956.1 protein_id gnl|my_center|LOCUS_15200 18329 17832 gene locus_tag LOCUS_15210 18329 17832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 18722 18339 gene locus_tag LOCUS_15220 18722 18339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 18819 19493 gene locus_tag LOCUS_15230 18819 19493 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466681.1 protein_id gnl|my_center|LOCUS_15230 19490 20509 gene locus_tag LOCUS_15240 19490 20509 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_15240 21009 20605 gene locus_tag LOCUS_15250 21009 20605 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_15250 21313 21002 gene locus_tag LOCUS_15260 21313 21002 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_15260 24333 21430 gene locus_tag LOCUS_15270 24333 21430 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226785.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence044 <1 675 gene locus_tag LOCUS_15280 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228819.1:precorrin-4 C(11)-methyltransferase 2149 632 gene locus_tag LOCUS_15290 2149 632 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228824.1 protein_id gnl|my_center|LOCUS_15290 2796 2146 gene locus_tag LOCUS_15300 2796 2146 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_15300 3740 2793 gene locus_tag LOCUS_15310 3740 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3793 7404 gene locus_tag LOCUS_15320 gene cobN 3793 7404 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228832.1 protein_id gnl|my_center|LOCUS_15320 7401 8159 gene locus_tag LOCUS_15330 gene cobF 7401 8159 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228664.1 protein_id gnl|my_center|LOCUS_15330 8764 9783 gene locus_tag LOCUS_15340 8764 9783 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313850.1 protein_id gnl|my_center|LOCUS_15340 10019 11482 gene locus_tag LOCUS_15350 10019 11482 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224551.1 protein_id gnl|my_center|LOCUS_15350 12133 12654 gene locus_tag LOCUS_15360 12133 12654 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776788.1 protein_id gnl|my_center|LOCUS_15360 13267 12902 gene locus_tag LOCUS_15370 13267 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 13824 13270 gene locus_tag LOCUS_15380 13824 13270 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036411.1 protein_id gnl|my_center|LOCUS_15380 13958 15403 gene locus_tag LOCUS_15390 13958 15403 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224359.1 protein_id gnl|my_center|LOCUS_15390 15540 18815 gene locus_tag LOCUS_15400 gene lysX 15540 18815 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223114.1 protein_id gnl|my_center|LOCUS_15400 19620 18826 gene locus_tag LOCUS_15410 19620 18826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 20693 19617 gene locus_tag LOCUS_15420 20693 19617 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975437.1 protein_id gnl|my_center|LOCUS_15420 20711 20962 gene locus_tag LOCUS_15430 20711 20962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 21648 20890 gene locus_tag LOCUS_15440 21648 20890 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226228.1 protein_id gnl|my_center|LOCUS_15440 21740 22381 gene locus_tag LOCUS_15450 gene folE 21740 22381 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 protein_id gnl|my_center|LOCUS_15450 22414 23679 gene locus_tag LOCUS_15460 22414 23679 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence045 486 397 gene locus_tag LOCUS_t00150 486 397 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 763 530 gene locus_tag LOCUS_15470 763 530 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877243.1 protein_id gnl|my_center|LOCUS_15470 1584 805 gene locus_tag LOCUS_15480 1584 805 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_15480 1621 2280 gene locus_tag LOCUS_15490 1621 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15490 2327 2632 gene locus_tag LOCUS_15500 2327 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15500 2666 3643 gene locus_tag LOCUS_15510 2666 3643 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_15510 3653 4291 gene locus_tag LOCUS_15520 3653 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 5090 4326 gene locus_tag LOCUS_15530 5090 4326 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078515.1 protein_id gnl|my_center|LOCUS_15530 6999 5122 gene locus_tag LOCUS_15540 6999 5122 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_15540 7786 7001 gene locus_tag LOCUS_15550 7786 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_15550 8152 7877 gene locus_tag LOCUS_15560 8152 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 9140 8334 gene locus_tag LOCUS_15570 9140 8334 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_15570 10039 9218 gene locus_tag LOCUS_15580 10039 9218 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_15580 11316 10036 gene locus_tag LOCUS_15590 gene serS 11316 10036 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_15590 11470 13047 gene locus_tag LOCUS_15600 11470 13047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 13072 14157 gene locus_tag LOCUS_15610 13072 14157 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257273.1 protein_id gnl|my_center|LOCUS_15610 14673 14248 gene locus_tag LOCUS_15620 14673 14248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 15635 14697 gene locus_tag LOCUS_15630 gene pheA 15635 14697 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_15630 15669 16361 gene locus_tag LOCUS_15640 gene larB 15669 16361 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057031.1 protein_id gnl|my_center|LOCUS_15640 16358 17554 gene locus_tag LOCUS_15650 gene larC 16358 17554 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015146.1 protein_id gnl|my_center|LOCUS_15650 17564 18169 gene locus_tag LOCUS_15660 17564 18169 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028297.1 protein_id gnl|my_center|LOCUS_15660 18542 19816 gene locus_tag LOCUS_15670 gene arcA 18542 19816 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730543.1 protein_id gnl|my_center|LOCUS_15670 20961 20005 gene locus_tag LOCUS_15680 20961 20005 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_15680 21428 20991 gene locus_tag LOCUS_15690 21428 20991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 22266 21460 gene locus_tag LOCUS_15700 22266 21460 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 protein_id gnl|my_center|LOCUS_15700 23567 22368 gene locus_tag LOCUS_15710 23567 22368 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_15710 23922 23641 gene locus_tag LOCUS_15720 23922 23641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence046 423 2618 gene locus_tag LOCUS_15730 423 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15730 2713 3138 gene locus_tag LOCUS_15740 2713 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3138 3734 gene locus_tag LOCUS_15750 gene recR 3138 3734 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_15750 3731 4408 gene locus_tag LOCUS_15760 3731 4408 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975322.1 protein_id gnl|my_center|LOCUS_15760 4564 5832 gene locus_tag LOCUS_15770 4564 5832 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_15770 5829 6872 gene locus_tag LOCUS_15780 5829 6872 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_15780 8232 6865 gene locus_tag LOCUS_15790 8232 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 8736 8660 gene locus_tag LOCUS_t00160 8736 8660 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9863 8886 gene locus_tag LOCUS_15800 9863 8886 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899637.1 protein_id gnl|my_center|LOCUS_15800 9948 10406 gene locus_tag LOCUS_15810 9948 10406 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_15810 12776 10410 gene locus_tag LOCUS_15820 12776 10410 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_15820 13164 13478 gene locus_tag LOCUS_15830 gene wblA 13164 13478 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_15830 14780 13515 gene locus_tag LOCUS_15840 14780 13515 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_15840 15816 14761 gene locus_tag LOCUS_15850 15816 14761 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_15850 15918 16706 gene locus_tag LOCUS_15860 15918 16706 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727991.1 protein_id gnl|my_center|LOCUS_15860 16703 17353 gene locus_tag LOCUS_15870 16703 17353 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_15870 18549 17611 gene locus_tag LOCUS_15880 18549 17611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 protein_id gnl|my_center|LOCUS_15880 20634 18838 gene locus_tag LOCUS_15890 20634 18838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 21397 20579 gene locus_tag LOCUS_15900 21397 20579 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115372.1 protein_id gnl|my_center|LOCUS_15900 21453 21590 gene locus_tag LOCUS_15910 21453 21590 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776605.1 protein_id gnl|my_center|LOCUS_15910 21587 22045 gene locus_tag LOCUS_15920 21587 22045 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092109.1 protein_id gnl|my_center|LOCUS_15920 22051 22929 gene locus_tag LOCUS_15930 22051 22929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_15930 22926 23711 gene locus_tag LOCUS_15940 22926 23711 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence047 1259 132 gene locus_tag LOCUS_15950 1259 132 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_15950 2222 1323 gene locus_tag LOCUS_15960 2222 1323 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_15960 2745 2170 gene locus_tag LOCUS_15970 2745 2170 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_15970 4573 2780 gene locus_tag LOCUS_15980 gene metG 4573 2780 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775786.1 protein_id gnl|my_center|LOCUS_15980 5333 4689 gene locus_tag LOCUS_15990 5333 4689 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_15990 5444 8029 gene locus_tag LOCUS_16000 gene pepN 5444 8029 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_16000 8417 8034 gene locus_tag LOCUS_16010 8417 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 8736 8404 gene locus_tag LOCUS_16020 8736 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 8886 9860 gene locus_tag LOCUS_16030 8886 9860 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978023.1 protein_id gnl|my_center|LOCUS_16030 10312 9887 gene locus_tag LOCUS_16040 10312 9887 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_16040 10209 10832 gene locus_tag LOCUS_16050 10209 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 11266 10829 gene locus_tag LOCUS_16060 11266 10829 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_16060 11709 11263 gene locus_tag LOCUS_16070 11709 11263 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_16070 11798 13015 gene locus_tag LOCUS_16080 11798 13015 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_16080 13669 13112 gene locus_tag LOCUS_16090 13669 13112 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_16090 13785 14255 gene locus_tag LOCUS_16100 13785 14255 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930002.1 protein_id gnl|my_center|LOCUS_16100 16292 14610 gene locus_tag LOCUS_16110 gene ettA 16292 14610 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412708.1 protein_id gnl|my_center|LOCUS_16110 16859 16359 gene locus_tag LOCUS_16120 16859 16359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 18689 17019 gene locus_tag LOCUS_16130 18689 17019 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_16130 20404 18686 gene locus_tag LOCUS_16140 20404 18686 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_16140 21708 20479 gene locus_tag LOCUS_16150 21708 20479 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230460.1 protein_id gnl|my_center|LOCUS_16150 21803 23242 gene locus_tag LOCUS_16160 21803 23242 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 protein_id gnl|my_center|LOCUS_16160 23315 23390 gene locus_tag LOCUS_t00170 23315 23390 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23877 23611 gene locus_tag LOCUS_16170 23877 23611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence048 24 575 gene locus_tag LOCUS_16180 24 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 572 2191 gene locus_tag LOCUS_16190 572 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2518 2225 gene locus_tag LOCUS_16200 2518 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 2690 4135 gene locus_tag LOCUS_16210 gene zwf 2690 4135 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_16210 4508 4188 gene locus_tag LOCUS_16220 4508 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 5773 4508 gene locus_tag LOCUS_16230 5773 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 5918 7234 gene locus_tag LOCUS_16240 5918 7234 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_16240 7231 7881 gene locus_tag LOCUS_16250 7231 7881 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_16250 7968 10409 gene locus_tag LOCUS_16260 gene pcrA 7968 10409 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_16260 11226 10516 gene locus_tag LOCUS_16270 11226 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 11755 12165 gene locus_tag LOCUS_16280 11755 12165 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_16280 13150 12176 gene locus_tag LOCUS_16290 13150 12176 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043788179.1 protein_id gnl|my_center|LOCUS_16290 14113 13229 gene locus_tag LOCUS_16300 14113 13229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 14174 15412 gene locus_tag LOCUS_16310 gene sucC 14174 15412 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222715.1 protein_id gnl|my_center|LOCUS_16310 15423 16307 gene locus_tag LOCUS_16320 gene sucD 15423 16307 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804538.1 protein_id gnl|my_center|LOCUS_16320 16931 16386 gene locus_tag LOCUS_16330 16931 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 18246 17002 gene locus_tag LOCUS_16340 gene kynU 18246 17002 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550795.1 protein_id gnl|my_center|LOCUS_16340 19569 18283 gene locus_tag LOCUS_16350 19569 18283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 19700 20908 gene locus_tag LOCUS_16360 19700 20908 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029881.1 protein_id gnl|my_center|LOCUS_16360 20964 21590 gene locus_tag LOCUS_16370 gene purN 20964 21590 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_16370 21587 23182 gene locus_tag LOCUS_16380 gene purH 21587 23182 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence049 65 138 gene locus_tag LOCUS_t00180 65 138 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1126 3408 gene locus_tag LOCUS_16390 1126 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4126 3419 gene locus_tag LOCUS_16400 4126 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 5373 4651 gene locus_tag LOCUS_16410 5373 4651 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_16410 5981 6772 gene locus_tag LOCUS_16420 5981 6772 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_16420 6904 7137 gene locus_tag LOCUS_16430 6904 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 7748 7494 gene locus_tag LOCUS_16440 7748 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 8059 8346 gene locus_tag LOCUS_16450 8059 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 8396 9013 gene locus_tag LOCUS_16460 8396 9013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 9084 11297 gene locus_tag LOCUS_16470 9084 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 12357 11794 gene locus_tag LOCUS_16480 12357 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 12666 13085 gene locus_tag LOCUS_16490 12666 13085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 13102 13878 gene locus_tag LOCUS_16500 13102 13878 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703303.1 protein_id gnl|my_center|LOCUS_16500 13932 15416 gene locus_tag LOCUS_16510 13932 15416 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059312.1 protein_id gnl|my_center|LOCUS_16510 15470 16837 gene locus_tag LOCUS_16520 15470 16837 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039681.1 protein_id gnl|my_center|LOCUS_16520 17829 18134 gene locus_tag LOCUS_16530 17829 18134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 19045 18236 gene locus_tag LOCUS_16540 19045 18236 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228939.1 protein_id gnl|my_center|LOCUS_16540 20310 19042 gene locus_tag LOCUS_16550 gene mftD 20310 19042 CDS product mycofactocin biosynthesis FMN-dependent deaminase MftD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877068.1 protein_id gnl|my_center|LOCUS_16550 21560 20325 gene locus_tag LOCUS_16560 gene mftC 21560 20325 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727659.1 protein_id gnl|my_center|LOCUS_16560 21871 21557 gene locus_tag LOCUS_16570 gene mftB 21871 21557 CDS product mycofactocin biosynthesis chaperone MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403486.1 protein_id gnl|my_center|LOCUS_16570 22015 21884 gene locus_tag LOCUS_16580 22015 21884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 22217 23332 gene locus_tag LOCUS_16590 22217 23332 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416075.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence050 1995 640 gene locus_tag LOCUS_16600 1995 640 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_16600 3377 2001 gene locus_tag LOCUS_16610 gene glnA4 3377 2001 CDS product gamma-glutamylethanolamide synthetase GlnA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027883.1 protein_id gnl|my_center|LOCUS_16610 4192 3413 gene locus_tag LOCUS_16620 4192 3413 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466719.1 protein_id gnl|my_center|LOCUS_16620 4324 5880 gene locus_tag LOCUS_16630 4324 5880 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 protein_id gnl|my_center|LOCUS_16630 5882 6802 gene locus_tag LOCUS_16640 5882 6802 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528033.1 protein_id gnl|my_center|LOCUS_16640 6792 9200 gene locus_tag LOCUS_16650 6792 9200 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061787.1 protein_id gnl|my_center|LOCUS_16650 9904 9197 gene locus_tag LOCUS_16660 9904 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 10248 10084 gene locus_tag LOCUS_16670 10248 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 10346 10822 gene locus_tag LOCUS_16680 10346 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 10819 11262 gene locus_tag LOCUS_16690 gene paaI 10819 11262 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965794.1 protein_id gnl|my_center|LOCUS_16690 11262 12548 gene locus_tag LOCUS_16700 gene paaF 11262 12548 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223460.1 protein_id gnl|my_center|LOCUS_16700 12749 12552 gene locus_tag LOCUS_16710 12749 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 12856 12978 gene locus_tag LOCUS_16720 12856 12978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 14382 12988 gene locus_tag LOCUS_16730 14382 12988 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975127.1 protein_id gnl|my_center|LOCUS_16730 15938 14427 gene locus_tag LOCUS_16740 15938 14427 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_16740 16946 15969 gene locus_tag LOCUS_16750 16946 15969 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_16750 18169 16943 gene locus_tag LOCUS_16760 gene pdhA 18169 16943 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_16760 18483 18959 gene locus_tag LOCUS_16770 18483 18959 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079984.1 protein_id gnl|my_center|LOCUS_16770 18961 19923 gene locus_tag LOCUS_16780 18961 19923 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 protein_id gnl|my_center|LOCUS_16780 20056 20475 gene locus_tag LOCUS_16790 20056 20475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 21645 20545 gene locus_tag LOCUS_16800 gene hisC 21645 20545 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_16800 22835 21951 gene locus_tag LOCUS_16810 22835 21951 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089035.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence051 3606 199 gene locus_tag LOCUS_16820 3606 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4281 3979 gene locus_tag LOCUS_16830 4281 3979 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_16830 4407 5117 gene locus_tag LOCUS_16840 gene glnR 4407 5117 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_16840 5461 5144 gene locus_tag LOCUS_16850 5461 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 5497 6402 gene locus_tag LOCUS_16860 5497 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 6456 8690 gene locus_tag LOCUS_16870 6456 8690 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_16870 8988 9869 gene locus_tag LOCUS_16880 8988 9869 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_16880 10061 11179 gene locus_tag LOCUS_16890 gene pstS 10061 11179 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776547.1 protein_id gnl|my_center|LOCUS_16890 11239 12168 gene locus_tag LOCUS_16900 gene pstC 11239 12168 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776546.1 protein_id gnl|my_center|LOCUS_16900 12165 13322 gene locus_tag LOCUS_16910 gene pstA 12165 13322 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_16910 13351 14130 gene locus_tag LOCUS_16920 gene pstB 13351 14130 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230712.1 protein_id gnl|my_center|LOCUS_16920 15328 14318 gene locus_tag LOCUS_16930 gene pitH 15328 14318 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_16930 15987 15331 gene locus_tag LOCUS_16940 15987 15331 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_16940 16105 16395 gene locus_tag LOCUS_16950 16105 16395 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726761.1 protein_id gnl|my_center|LOCUS_16950 16461 16661 gene locus_tag LOCUS_16960 16461 16661 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730261.1 protein_id gnl|my_center|LOCUS_16960 16691 18814 gene locus_tag LOCUS_16970 16691 18814 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_16970 19072 18875 gene locus_tag LOCUS_16980 19072 18875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 19478 19275 gene locus_tag LOCUS_16990 19478 19275 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_16990 20130 19738 gene locus_tag LOCUS_17000 20130 19738 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729159.1 protein_id gnl|my_center|LOCUS_17000 20778 20227 gene locus_tag LOCUS_17010 20778 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 21566 21105 gene locus_tag LOCUS_17020 21566 21105 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_17020 22194 21817 gene locus_tag LOCUS_17030 22194 21817 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_17030 22276 22734 gene locus_tag LOCUS_17040 22276 22734 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727472.1 protein_id gnl|my_center|LOCUS_17040 22843 22916 gene locus_tag LOCUS_t00190 22843 22916 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence052 369 2006 gene locus_tag LOCUS_17050 369 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2214 3839 gene locus_tag LOCUS_17060 gene cimA 2214 3839 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_17060 3934 5313 gene locus_tag LOCUS_17070 3934 5313 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_17070 5324 6730 gene locus_tag LOCUS_17080 5324 6730 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804864.1 protein_id gnl|my_center|LOCUS_17080 6812 8719 gene locus_tag LOCUS_17090 6812 8719 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223434.1 protein_id gnl|my_center|LOCUS_17090 9671 8799 gene locus_tag LOCUS_17100 9671 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_17100 9748 10548 gene locus_tag LOCUS_17110 9748 10548 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 protein_id gnl|my_center|LOCUS_17110 10559 12037 gene locus_tag LOCUS_17120 gene gltX 10559 12037 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775887.1 protein_id gnl|my_center|LOCUS_17120 12034 13050 gene locus_tag LOCUS_17130 12034 13050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 13137 13209 gene locus_tag LOCUS_t00200 13137 13209 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13252 13325 gene locus_tag LOCUS_t00210 13252 13325 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13422 14930 gene locus_tag LOCUS_17140 13422 14930 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972517.1 protein_id gnl|my_center|LOCUS_17140 14957 15481 gene locus_tag LOCUS_17150 14957 15481 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226746.1 protein_id gnl|my_center|LOCUS_17150 16309 15590 gene locus_tag LOCUS_17160 gene ndgR 16309 15590 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_17160 16434 17843 gene locus_tag LOCUS_17170 gene leuC 16434 17843 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_17170 17854 18441 gene locus_tag LOCUS_17180 gene leuD 17854 18441 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 protein_id gnl|my_center|LOCUS_17180 18597 19226 gene locus_tag LOCUS_17190 18597 19226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17190 20136 19300 gene locus_tag LOCUS_17200 20136 19300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 20266 21069 gene locus_tag LOCUS_17210 20266 21069 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_17210 21066 22067 gene locus_tag LOCUS_17220 21066 22067 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_17220 <22715 22110 gene locus_tag LOCUS_17230 <22715 22110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257747.1:PLP-dependent aspartate aminotransferase family protein >Feature sequence053 322 1500 gene locus_tag LOCUS_17240 gene dnaJ 322 1500 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_17240 1497 1994 gene locus_tag LOCUS_17250 1497 1994 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_17250 2010 4613 gene locus_tag LOCUS_17260 gene clpB 2010 4613 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_17260 5288 4659 gene locus_tag LOCUS_17270 gene idi 5288 4659 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898999.1 protein_id gnl|my_center|LOCUS_17270 6304 5285 gene locus_tag LOCUS_17280 6304 5285 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_17280 6831 6304 gene locus_tag LOCUS_17290 6831 6304 CDS product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727206.1 protein_id gnl|my_center|LOCUS_17290 7898 6828 gene locus_tag LOCUS_17300 7898 6828 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_17300 9108 7912 gene locus_tag LOCUS_17310 9108 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 9251 10330 gene locus_tag LOCUS_17320 9251 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 11542 10367 gene locus_tag LOCUS_17330 11542 10367 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_17330 11601 12197 gene locus_tag LOCUS_17340 gene pyrE 11601 12197 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_17340 12194 12856 gene locus_tag LOCUS_17350 12194 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 13562 12906 gene locus_tag LOCUS_17360 13562 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 13676 14338 gene locus_tag LOCUS_17370 13676 14338 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 protein_id gnl|my_center|LOCUS_17370 14405 15442 gene locus_tag LOCUS_17380 gene fbaA 14405 15442 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_17380 15459 15875 gene locus_tag LOCUS_17390 15459 15875 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_17390 16962 16045 gene locus_tag LOCUS_17400 16962 16045 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 protein_id gnl|my_center|LOCUS_17400 17124 18407 gene locus_tag LOCUS_17410 17124 18407 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_17410 18404 19648 gene locus_tag LOCUS_17420 gene purD 18404 19648 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_17420 19645 21063 gene locus_tag LOCUS_17430 gene purB 19645 21063 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_17430 21895 21341 gene locus_tag LOCUS_17440 21895 21341 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811345.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence054 <1 812 gene locus_tag LOCUS_17450 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977080.1:S1 family peptidase 1591 1013 gene locus_tag LOCUS_17460 1591 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2235 1678 gene locus_tag LOCUS_17470 2235 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 3713 2232 gene locus_tag LOCUS_17480 gene boxB 3713 2232 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230333.1 protein_id gnl|my_center|LOCUS_17480 3811 4221 gene locus_tag LOCUS_17490 3811 4221 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877767.1 protein_id gnl|my_center|LOCUS_17490 4418 5284 gene locus_tag LOCUS_17500 gene mmuM 4418 5284 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911868.1 protein_id gnl|my_center|LOCUS_17500 5376 5855 gene locus_tag LOCUS_17510 5376 5855 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 protein_id gnl|my_center|LOCUS_17510 7508 5871 gene locus_tag LOCUS_17520 gene pgm 7508 5871 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_17520 8725 7505 gene locus_tag LOCUS_17530 8725 7505 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229184.1 protein_id gnl|my_center|LOCUS_17530 9540 8725 gene locus_tag LOCUS_17540 9540 8725 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091316930.1 protein_id gnl|my_center|LOCUS_17540 9629 9874 gene locus_tag LOCUS_17550 9629 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 9891 11012 gene locus_tag LOCUS_17560 9891 11012 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191120.1 protein_id gnl|my_center|LOCUS_17560 11498 11079 gene locus_tag LOCUS_17570 11498 11079 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031354.1 protein_id gnl|my_center|LOCUS_17570 12072 11557 gene locus_tag LOCUS_17580 12072 11557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 12662 12078 gene locus_tag LOCUS_17590 12662 12078 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 protein_id gnl|my_center|LOCUS_17590 12779 13624 gene locus_tag LOCUS_17600 12779 13624 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_17600 15192 14365 gene locus_tag LOCUS_17610 15192 14365 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466752.1 protein_id gnl|my_center|LOCUS_17610 16178 15189 gene locus_tag LOCUS_17620 16178 15189 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_17620 17750 16278 gene locus_tag LOCUS_17630 17750 16278 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230428.1 protein_id gnl|my_center|LOCUS_17630 17812 18213 gene locus_tag LOCUS_17640 17812 18213 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027381.1 protein_id gnl|my_center|LOCUS_17640 19569 18304 gene locus_tag LOCUS_17650 19569 18304 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742232.1 protein_id gnl|my_center|LOCUS_17650 20324 19566 gene locus_tag LOCUS_17660 20324 19566 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227662.1 protein_id gnl|my_center|LOCUS_17660 21223 20321 gene locus_tag LOCUS_17670 21223 20321 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227663.1 protein_id gnl|my_center|LOCUS_17670 22137 21220 gene locus_tag LOCUS_17680 22137 21220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence055 1958 129 gene locus_tag LOCUS_17690 1958 129 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_17690 4103 2289 gene locus_tag LOCUS_17700 gene aspS 4103 2289 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805009.1 protein_id gnl|my_center|LOCUS_17700 5461 4100 gene locus_tag LOCUS_17710 gene hisS 5461 4100 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_17710 6186 5467 gene locus_tag LOCUS_17720 6186 5467 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_17720 6279 6566 gene locus_tag LOCUS_17730 6279 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 6563 8005 gene locus_tag LOCUS_17740 6563 8005 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_17740 10564 8330 gene locus_tag LOCUS_17750 gene relA 10564 8330 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_17750 11311 10760 gene locus_tag LOCUS_17760 11311 10760 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_17760 12561 11308 gene locus_tag LOCUS_17770 gene secF 12561 11308 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_17770 14441 12561 gene locus_tag LOCUS_17780 gene secD 14441 12561 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_17780 14811 14488 gene locus_tag LOCUS_17790 14811 14488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 16182 14962 gene locus_tag LOCUS_17800 gene ruvB 16182 14962 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_17800 16796 16179 gene locus_tag LOCUS_17810 gene ruvA 16796 16179 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_17810 17401 16793 gene locus_tag LOCUS_17820 gene ruvC 17401 16793 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_17820 18224 17457 gene locus_tag LOCUS_17830 18224 17457 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_17830 18869 18243 gene locus_tag LOCUS_17840 gene pdxT 18869 18243 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 protein_id gnl|my_center|LOCUS_17840 19449 18880 gene locus_tag LOCUS_17850 19449 18880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 20372 19455 gene locus_tag LOCUS_17860 gene pdxS 20372 19455 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_17860 21098 20544 gene locus_tag LOCUS_17870 21098 20544 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_17870 22204 21098 gene locus_tag LOCUS_17880 22204 21098 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence056 3295 1313 gene locus_tag LOCUS_17890 3295 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 4265 3306 gene locus_tag LOCUS_17900 4265 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 4225 4476 gene locus_tag LOCUS_17910 4225 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 4492 4752 gene locus_tag LOCUS_17920 4492 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4876 8433 gene locus_tag LOCUS_17930 4876 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 8745 11825 gene locus_tag LOCUS_17940 8745 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 11836 13455 gene locus_tag LOCUS_17950 11836 13455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 13654 16506 gene locus_tag LOCUS_17960 13654 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 16539 17030 gene locus_tag LOCUS_17970 16539 17030 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457918.1 protein_id gnl|my_center|LOCUS_17970 17027 18508 gene locus_tag LOCUS_17980 17027 18508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 19395 18412 gene locus_tag LOCUS_17990 19395 18412 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_17990 19600 20472 gene locus_tag LOCUS_18000 19600 20472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18000 20469 21335 gene locus_tag LOCUS_18010 gene panC 20469 21335 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230458.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence057 2160 523 gene locus_tag LOCUS_18020 2160 523 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726853.1 protein_id gnl|my_center|LOCUS_18020 3733 2456 gene locus_tag LOCUS_18030 3733 2456 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869305.1 protein_id gnl|my_center|LOCUS_18030 5100 3823 gene locus_tag LOCUS_18040 5100 3823 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 protein_id gnl|my_center|LOCUS_18040 6421 5498 gene locus_tag LOCUS_18050 6421 5498 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 protein_id gnl|my_center|LOCUS_18050 7478 6588 gene locus_tag LOCUS_18060 7478 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 7519 8664 gene locus_tag LOCUS_18070 7519 8664 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085842.1 protein_id gnl|my_center|LOCUS_18070 8727 9188 gene locus_tag LOCUS_18080 8727 9188 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027611.1 protein_id gnl|my_center|LOCUS_18080 10728 9232 gene locus_tag LOCUS_18090 10728 9232 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895076.1 protein_id gnl|my_center|LOCUS_18090 10919 12343 gene locus_tag LOCUS_18100 10919 12343 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_18100 14088 12373 gene locus_tag LOCUS_18110 14088 12373 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143814.1 protein_id gnl|my_center|LOCUS_18110 14188 15006 gene locus_tag LOCUS_18120 14188 15006 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222911.1 protein_id gnl|my_center|LOCUS_18120 15079 16017 gene locus_tag LOCUS_18130 15079 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 16400 16053 gene locus_tag LOCUS_18140 16400 16053 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_18140 16520 16593 gene locus_tag LOCUS_t00220 16520 16593 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16673 16749 gene locus_tag LOCUS_t00230 16673 16749 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 17662 17738 gene locus_tag LOCUS_t00240 17662 17738 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 18692 17886 gene locus_tag LOCUS_18150 18692 17886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 18978 20093 gene locus_tag LOCUS_18160 18978 20093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 20107 20556 gene locus_tag LOCUS_18170 20107 20556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 21027 20572 gene locus_tag LOCUS_18180 21027 20572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence058 2 3259 gene locus_tag LOCUS_18190 2 3259 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170213355.1 protein_id gnl|my_center|LOCUS_18190 3984 3349 gene locus_tag LOCUS_18200 3984 3349 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111108.1 protein_id gnl|my_center|LOCUS_18200 4230 7079 gene locus_tag LOCUS_18210 4230 7079 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 protein_id gnl|my_center|LOCUS_18210 7260 8771 gene locus_tag LOCUS_18220 7260 8771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 protein_id gnl|my_center|LOCUS_18220 8920 9288 gene locus_tag LOCUS_18230 8920 9288 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272733.1 protein_id gnl|my_center|LOCUS_18230 9291 10412 gene locus_tag LOCUS_18240 9291 10412 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_18240 10367 10534 gene locus_tag LOCUS_18250 10367 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 11480 10629 gene locus_tag LOCUS_18260 11480 10629 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_18260 11684 11490 gene locus_tag LOCUS_18270 11684 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 13233 11860 gene locus_tag LOCUS_18280 13233 11860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 13635 13399 gene locus_tag LOCUS_18290 13635 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 14528 13827 gene locus_tag LOCUS_18300 14528 13827 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229457.1 protein_id gnl|my_center|LOCUS_18300 15791 14664 gene locus_tag LOCUS_18310 15791 14664 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653894.1 protein_id gnl|my_center|LOCUS_18310 17471 15969 gene locus_tag LOCUS_18320 17471 15969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 18559 17633 gene locus_tag LOCUS_18330 18559 17633 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_18330 18670 19197 gene locus_tag LOCUS_18340 18670 19197 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224854.1 protein_id gnl|my_center|LOCUS_18340 19194 19532 gene locus_tag LOCUS_18350 19194 19532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 20061 19600 gene locus_tag LOCUS_18360 20061 19600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence059 <1 538 gene locus_tag LOCUS_18370 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027460.1:Fpg/Nei family DNA glycosylase 552 902 gene locus_tag LOCUS_18380 552 902 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897834.1 protein_id gnl|my_center|LOCUS_18380 1633 938 gene locus_tag LOCUS_18390 gene aat 1633 938 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_18390 1769 2449 gene locus_tag LOCUS_18400 1769 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 3645 2410 gene locus_tag LOCUS_18410 3645 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 4919 3642 gene locus_tag LOCUS_18420 4919 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 6093 5005 gene locus_tag LOCUS_18430 6093 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 6201 6881 gene locus_tag LOCUS_18440 6201 6881 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110169.1 protein_id gnl|my_center|LOCUS_18440 8230 6962 gene locus_tag LOCUS_18450 8230 6962 CDS product sialate:H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900427.1 protein_id gnl|my_center|LOCUS_18450 9216 8299 gene locus_tag LOCUS_18460 9216 8299 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167379699.1 protein_id gnl|my_center|LOCUS_18460 10605 9823 gene locus_tag LOCUS_18470 10605 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 11573 10602 gene locus_tag LOCUS_18480 11573 10602 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776493.1 protein_id gnl|my_center|LOCUS_18480 12017 13585 gene locus_tag LOCUS_18490 12017 13585 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 protein_id gnl|my_center|LOCUS_18490 15644 13653 gene locus_tag LOCUS_18500 15644 13653 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089548.1 protein_id gnl|my_center|LOCUS_18500 15721 16023 gene locus_tag LOCUS_18510 15721 16023 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888479.1 protein_id gnl|my_center|LOCUS_18510 17001 16033 gene locus_tag LOCUS_18520 17001 16033 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893402.1 protein_id gnl|my_center|LOCUS_18520 17142 17906 gene locus_tag LOCUS_18530 17142 17906 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031654.1 protein_id gnl|my_center|LOCUS_18530 19158 17923 gene locus_tag LOCUS_18540 19158 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence060 591 322 gene locus_tag LOCUS_18550 591 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 848 630 gene locus_tag LOCUS_18560 848 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3372 1000 gene locus_tag LOCUS_18570 3372 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3575 3369 gene locus_tag LOCUS_18580 3575 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 3826 3572 gene locus_tag LOCUS_18590 3826 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 4647 3823 gene locus_tag LOCUS_18600 4647 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 4971 4741 gene locus_tag LOCUS_18610 4971 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 5088 5636 gene locus_tag LOCUS_18620 5088 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 5572 6699 gene locus_tag LOCUS_18630 5572 6699 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_18630 8208 6778 gene locus_tag LOCUS_18640 gene glnA 8208 6778 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976617.1 protein_id gnl|my_center|LOCUS_18640 8470 8898 gene locus_tag LOCUS_18650 8470 8898 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_18650 9726 8980 gene locus_tag LOCUS_18660 9726 8980 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_18660 10724 9726 gene locus_tag LOCUS_18670 gene lipA 10724 9726 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976621.1 protein_id gnl|my_center|LOCUS_18670 11503 10775 gene locus_tag LOCUS_18680 gene lipB 11503 10775 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895681.1 protein_id gnl|my_center|LOCUS_18680 11650 12831 gene locus_tag LOCUS_18690 11650 12831 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412771.1 protein_id gnl|my_center|LOCUS_18690 13724 12996 gene locus_tag LOCUS_18700 13724 12996 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_18700 13822 14580 gene locus_tag LOCUS_18710 13822 14580 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_18710 14570 15589 gene locus_tag LOCUS_18720 14570 15589 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_18720 15586 16548 gene locus_tag LOCUS_18730 15586 16548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 16545 18710 gene locus_tag LOCUS_18740 16545 18710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 <20002 19001 gene locus_tag LOCUS_18750 <20002 19001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029952.1:acyl-CoA carboxylase subunit beta >Feature sequence061 <1 1473 gene locus_tag LOCUS_18760 <1 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224530.1:L-glutamate gamma-semialdehyde dehydrogenase 2212 1733 gene locus_tag LOCUS_18770 2212 1733 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222385.1 protein_id gnl|my_center|LOCUS_18770 2697 2209 gene locus_tag LOCUS_18780 2697 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 2741 3649 gene locus_tag LOCUS_18790 2741 3649 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228729.1 protein_id gnl|my_center|LOCUS_18790 3783 8720 gene locus_tag LOCUS_18800 3783 8720 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_18800 8929 10224 gene locus_tag LOCUS_18810 8929 10224 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_18810 11393 10314 gene locus_tag LOCUS_18820 11393 10314 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878394.1 protein_id gnl|my_center|LOCUS_18820 11484 12422 gene locus_tag LOCUS_18830 11484 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 12415 13329 gene locus_tag LOCUS_18840 gene ligD 12415 13329 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467071.1 protein_id gnl|my_center|LOCUS_18840 13607 14896 gene locus_tag LOCUS_18850 13607 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 14820 16190 gene locus_tag LOCUS_18860 14820 16190 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776585.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18860 16561 16226 gene locus_tag LOCUS_18870 16561 16226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 16749 17615 gene locus_tag LOCUS_18880 16749 17615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 17938 18102 gene locus_tag LOCUS_18890 17938 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 18104 18409 gene locus_tag LOCUS_18900 18104 18409 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284194.1 protein_id gnl|my_center|LOCUS_18900 19792 18449 gene locus_tag LOCUS_18910 19792 18449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence062 <1 1080 gene locus_tag LOCUS_18920 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730341.1:nitrate reductase subunit beta 1077 1781 gene locus_tag LOCUS_18930 1077 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1781 2503 gene locus_tag LOCUS_18940 gene narI 1781 2503 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775894.1 protein_id gnl|my_center|LOCUS_18940 2577 3011 gene locus_tag LOCUS_18950 2577 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3213 3626 gene locus_tag LOCUS_18960 3213 3626 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383881.1 protein_id gnl|my_center|LOCUS_18960 3766 4026 gene locus_tag LOCUS_18970 3766 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 7464 4366 gene locus_tag LOCUS_18980 7464 4366 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 protein_id gnl|my_center|LOCUS_18980 8054 7557 gene locus_tag LOCUS_18990 8054 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 8766 8080 gene locus_tag LOCUS_19000 8766 8080 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901437.1 protein_id gnl|my_center|LOCUS_19000 8960 9595 gene locus_tag LOCUS_19010 gene folE 8960 9595 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 protein_id gnl|my_center|LOCUS_19010 9592 10815 gene locus_tag LOCUS_19020 9592 10815 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 protein_id gnl|my_center|LOCUS_19020 10845 11615 gene locus_tag LOCUS_19030 gene fabG 10845 11615 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726797.1 protein_id gnl|my_center|LOCUS_19030 12275 11622 gene locus_tag LOCUS_19040 12275 11622 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142341.1 protein_id gnl|my_center|LOCUS_19040 12774 12283 gene locus_tag LOCUS_19050 12774 12283 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728168.1 protein_id gnl|my_center|LOCUS_19050 13004 12771 gene locus_tag LOCUS_19060 13004 12771 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 protein_id gnl|my_center|LOCUS_19060 13180 13986 gene locus_tag LOCUS_19070 13180 13986 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224595.1 protein_id gnl|my_center|LOCUS_19070 13983 15242 gene locus_tag LOCUS_19080 13983 15242 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224594.1 protein_id gnl|my_center|LOCUS_19080 15245 16366 gene locus_tag LOCUS_19090 gene nagA 15245 16366 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_19090 19200 16372 gene locus_tag LOCUS_19100 19200 16372 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031757.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence063 1892 369 gene locus_tag LOCUS_19110 1892 369 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230704.1 protein_id gnl|my_center|LOCUS_19110 2047 3234 gene locus_tag LOCUS_19120 gene xylA 2047 3234 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228546.1 protein_id gnl|my_center|LOCUS_19120 3266 4522 gene locus_tag LOCUS_19130 3266 4522 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 protein_id gnl|my_center|LOCUS_19130 4673 5452 gene locus_tag LOCUS_19140 4673 5452 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_19140 5449 6876 gene locus_tag LOCUS_19150 5449 6876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_19150 6873 8114 gene locus_tag LOCUS_19160 6873 8114 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 protein_id gnl|my_center|LOCUS_19160 8808 8158 gene locus_tag LOCUS_19170 8808 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901515.1 protein_id gnl|my_center|LOCUS_19170 9569 8814 gene locus_tag LOCUS_19180 9569 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 10192 9662 gene locus_tag LOCUS_19190 gene thpR 10192 9662 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_19190 10266 10637 gene locus_tag LOCUS_19200 10266 10637 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977138.1 protein_id gnl|my_center|LOCUS_19200 12725 10698 gene locus_tag LOCUS_19210 12725 10698 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804338.1 protein_id gnl|my_center|LOCUS_19210 12869 13912 gene locus_tag LOCUS_19220 12869 13912 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_19220 15132 13936 gene locus_tag LOCUS_19230 15132 13936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 15447 15136 gene locus_tag LOCUS_19240 15447 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 16910 15669 gene locus_tag LOCUS_19250 16910 15669 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728197.1 protein_id gnl|my_center|LOCUS_19250 18719 17133 gene locus_tag LOCUS_19260 18719 17133 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142816.1 protein_id gnl|my_center|LOCUS_19260 18792 19712 gene locus_tag LOCUS_19270 18792 19712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 19727 19800 gene locus_tag LOCUS_t00250 19727 19800 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence064 <1 1055 gene locus_tag LOCUS_19280 <1 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486348.1:ATP-dependent DNA helicase 1838 2746 gene locus_tag LOCUS_19290 gene nudC 1838 2746 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_19290 3007 2756 gene locus_tag LOCUS_19300 3007 2756 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_19300 3211 5298 gene locus_tag LOCUS_19310 3211 5298 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_19310 5439 5675 gene locus_tag LOCUS_19320 5439 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 5802 6092 gene locus_tag LOCUS_19330 5802 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 6147 6308 gene locus_tag LOCUS_19340 6147 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 6567 6752 gene locus_tag LOCUS_19350 6567 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 8111 6756 gene locus_tag LOCUS_19360 8111 6756 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_19360 9065 8187 gene locus_tag LOCUS_19370 9065 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19370 9429 9181 gene locus_tag LOCUS_19380 9429 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 9801 10859 gene locus_tag LOCUS_19390 9801 10859 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_19390 10869 11453 gene locus_tag LOCUS_19400 10869 11453 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_19400 12077 11514 gene locus_tag LOCUS_19410 12077 11514 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222931.1 protein_id gnl|my_center|LOCUS_19410 13465 12074 gene locus_tag LOCUS_19420 13465 12074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 13525 13968 gene locus_tag LOCUS_19430 13525 13968 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_19430 14023 14334 gene locus_tag LOCUS_19440 14023 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 14406 15461 gene locus_tag LOCUS_19450 14406 15461 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_19450 15458 16033 gene locus_tag LOCUS_19460 15458 16033 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167526720.1 protein_id gnl|my_center|LOCUS_19460 16127 19138 gene locus_tag LOCUS_19470 16127 19138 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_19470 19199 19275 gene locus_tag LOCUS_t00260 19199 19275 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence065 779 39 gene locus_tag LOCUS_19480 gene pgl 779 39 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_19480 1737 781 gene locus_tag LOCUS_19490 gene opcA 1737 781 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976880.1 protein_id gnl|my_center|LOCUS_19490 3343 1790 gene locus_tag LOCUS_19500 gene zwf 3343 1790 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031084.1 protein_id gnl|my_center|LOCUS_19500 4980 3340 gene locus_tag LOCUS_19510 4980 3340 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_19510 6107 4977 gene locus_tag LOCUS_19520 gene tal 6107 4977 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_19520 8255 6165 gene locus_tag LOCUS_19530 gene tkt 8255 6165 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_19530 8694 9569 gene locus_tag LOCUS_19540 8694 9569 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_19540 9574 10122 gene locus_tag LOCUS_19550 gene mug 9574 10122 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_19550 11135 10179 gene locus_tag LOCUS_19560 11135 10179 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_19560 12123 11140 gene locus_tag LOCUS_19570 12123 11140 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775774.1 protein_id gnl|my_center|LOCUS_19570 14684 12120 gene locus_tag LOCUS_19580 14684 12120 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775775.1 protein_id gnl|my_center|LOCUS_19580 15706 14681 gene locus_tag LOCUS_19590 15706 14681 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775776.1 protein_id gnl|my_center|LOCUS_19590 16521 15796 gene locus_tag LOCUS_19600 16521 15796 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_19600 17543 16590 gene locus_tag LOCUS_19610 17543 16590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_19610 17713 18492 gene locus_tag LOCUS_19620 17713 18492 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence066 <1 924 gene locus_tag LOCUS_19630 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046236296.1:SDR family oxidoreductase 921 2039 gene locus_tag LOCUS_19640 921 2039 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228741.1 protein_id gnl|my_center|LOCUS_19640 2036 2698 gene locus_tag LOCUS_19650 2036 2698 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228740.1 protein_id gnl|my_center|LOCUS_19650 2843 3316 gene locus_tag LOCUS_19660 2843 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 3473 4108 gene locus_tag LOCUS_19670 3473 4108 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224746.1 protein_id gnl|my_center|LOCUS_19670 5184 4120 gene locus_tag LOCUS_19680 5184 4120 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889126.1 protein_id gnl|my_center|LOCUS_19680 6533 5181 gene locus_tag LOCUS_19690 6533 5181 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_19690 7102 6611 gene locus_tag LOCUS_19700 7102 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 7654 8817 gene locus_tag LOCUS_19710 7654 8817 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224755.1 protein_id gnl|my_center|LOCUS_19710 8844 9623 gene locus_tag LOCUS_19720 8844 9623 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082912.1 protein_id gnl|my_center|LOCUS_19720 9749 11995 gene locus_tag LOCUS_19730 9749 11995 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223681.1 protein_id gnl|my_center|LOCUS_19730 12456 14396 gene locus_tag LOCUS_19740 gene phzE 12456 14396 CDS product phenazine biosynthesis protein PhzE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118954.1 protein_id gnl|my_center|LOCUS_19740 15834 14434 gene locus_tag LOCUS_19750 15834 14434 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230057.1 protein_id gnl|my_center|LOCUS_19750 17459 15960 gene locus_tag LOCUS_19760 17459 15960 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230060.1 protein_id gnl|my_center|LOCUS_19760 18169 17456 gene locus_tag LOCUS_19770 18169 17456 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_19770 18627 18244 gene locus_tag LOCUS_19780 18627 18244 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_19780 19341 18673 gene locus_tag LOCUS_19790 19341 18673 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726717.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence067 <1 1002 gene locus_tag LOCUS_19800 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028131.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 999 2408 gene locus_tag LOCUS_19810 999 2408 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_19810 2405 3469 gene locus_tag LOCUS_19820 gene mraY 2405 3469 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_19820 3466 4908 gene locus_tag LOCUS_19830 gene murD 3466 4908 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_19830 4961 6235 gene locus_tag LOCUS_19840 gene ftsW 4961 6235 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_19840 6232 7320 gene locus_tag LOCUS_19850 gene murG 6232 7320 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_19850 7317 8744 gene locus_tag LOCUS_19860 gene murC 7317 8744 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_19860 8741 9526 gene locus_tag LOCUS_19870 8741 9526 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228035.1 protein_id gnl|my_center|LOCUS_19870 9672 9484 gene locus_tag LOCUS_19880 9672 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 10133 11389 gene locus_tag LOCUS_19890 gene ftsZ 10133 11389 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_19890 11448 12233 gene locus_tag LOCUS_19900 gene pgeF 11448 12233 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 protein_id gnl|my_center|LOCUS_19900 12235 12954 gene locus_tag LOCUS_19910 12235 12954 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_19910 13016 13516 gene locus_tag LOCUS_19920 gene sepF 13016 13516 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_19920 13557 13847 gene locus_tag LOCUS_19930 13557 13847 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 protein_id gnl|my_center|LOCUS_19930 13955 14692 gene locus_tag LOCUS_19940 gene wag31 13955 14692 CDS product cell wall synthesis protein Wag31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729650.1 protein_id gnl|my_center|LOCUS_19940 17983 14765 gene locus_tag LOCUS_19950 gene ileS 17983 14765 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_19950 18380 19144 gene locus_tag LOCUS_19960 18380 19144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence068 184 2931 gene locus_tag LOCUS_19970 gene ppdK 184 2931 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_19970 3949 3128 gene locus_tag LOCUS_19980 3949 3128 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037882.1 protein_id gnl|my_center|LOCUS_19980 4275 4805 gene locus_tag LOCUS_19990 4275 4805 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_19990 6286 4841 gene locus_tag LOCUS_20000 6286 4841 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060587.1 protein_id gnl|my_center|LOCUS_20000 7524 6283 gene locus_tag LOCUS_20010 7524 6283 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_20010 7929 7681 gene locus_tag LOCUS_20020 7929 7681 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976417.1 protein_id gnl|my_center|LOCUS_20020 9007 8009 gene locus_tag LOCUS_20030 9007 8009 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067528888.1 protein_id gnl|my_center|LOCUS_20030 10191 9004 gene locus_tag LOCUS_20040 10191 9004 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_20040 11488 10283 gene locus_tag LOCUS_20050 gene fasR 11488 10283 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_20050 11622 12584 gene locus_tag LOCUS_20060 11622 12584 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_20060 15521 12663 gene locus_tag LOCUS_20070 gene aceE 15521 12663 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_20070 15890 16324 gene locus_tag LOCUS_20080 15890 16324 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224000.1 protein_id gnl|my_center|LOCUS_20080 16378 17973 gene locus_tag LOCUS_20090 16378 17973 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224962.1 protein_id gnl|my_center|LOCUS_20090 17970 18431 gene locus_tag LOCUS_20100 17970 18431 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_20100 18717 18526 gene locus_tag LOCUS_20110 18717 18526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence069 59 745 gene locus_tag LOCUS_20120 59 745 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 protein_id gnl|my_center|LOCUS_20120 815 1705 gene locus_tag LOCUS_20130 815 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2548 1715 gene locus_tag LOCUS_20140 2548 1715 CDS product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804446.1 protein_id gnl|my_center|LOCUS_20140 3903 2545 gene locus_tag LOCUS_20150 gene allB 3903 2545 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 protein_id gnl|my_center|LOCUS_20150 5698 3920 gene locus_tag LOCUS_20160 gene gcl 5698 3920 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030737.1 protein_id gnl|my_center|LOCUS_20160 6579 5695 gene locus_tag LOCUS_20170 6579 5695 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896872.1 protein_id gnl|my_center|LOCUS_20170 7403 6576 gene locus_tag LOCUS_20180 7403 6576 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730562.1 protein_id gnl|my_center|LOCUS_20180 8761 7400 gene locus_tag LOCUS_20190 8761 7400 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_20190 9573 8776 gene locus_tag LOCUS_20200 9573 8776 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730745.1 protein_id gnl|my_center|LOCUS_20200 11098 9575 gene locus_tag LOCUS_20210 11098 9575 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730746.1 protein_id gnl|my_center|LOCUS_20210 12031 11345 gene locus_tag LOCUS_20220 12031 11345 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057387.1 protein_id gnl|my_center|LOCUS_20220 13196 12189 gene locus_tag LOCUS_20230 13196 12189 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836183.1 protein_id gnl|my_center|LOCUS_20230 13710 13240 gene locus_tag LOCUS_20240 13710 13240 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 protein_id gnl|my_center|LOCUS_20240 13805 14605 gene locus_tag LOCUS_20250 13805 14605 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_20250 14709 15560 gene locus_tag LOCUS_20260 gene pdxY 14709 15560 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_20260 15650 15575 gene locus_tag LOCUS_t00270 15650 15575 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15784 15957 gene locus_tag LOCUS_20270 15784 15957 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_20270 16932 16027 gene locus_tag LOCUS_20280 16932 16027 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 protein_id gnl|my_center|LOCUS_20280 17621 16929 gene locus_tag LOCUS_20290 17621 16929 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030391327.1 protein_id gnl|my_center|LOCUS_20290 17676 18119 gene locus_tag LOCUS_20300 gene soxR 17676 18119 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224136.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence070 395 506 gene locus_tag LOCUS_r00010 395 506 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 734 1633 gene locus_tag LOCUS_20310 734 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 1757 2257 gene locus_tag LOCUS_20320 1757 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 3555 2332 gene locus_tag LOCUS_20330 3555 2332 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_20330 3642 4658 gene locus_tag LOCUS_20340 3642 4658 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_20340 4704 4907 gene locus_tag LOCUS_20350 4704 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 5009 4806 gene locus_tag LOCUS_20360 5009 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 5062 5898 gene locus_tag LOCUS_20370 5062 5898 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_20370 5895 6872 gene locus_tag LOCUS_20380 5895 6872 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_20380 6865 8712 gene locus_tag LOCUS_20390 gene recN 6865 8712 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_20390 8858 10030 gene locus_tag LOCUS_20400 gene steA 8858 10030 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286379.1 protein_id gnl|my_center|LOCUS_20400 10027 10998 gene locus_tag LOCUS_20410 10027 10998 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_20410 11185 12906 gene locus_tag LOCUS_20420 11185 12906 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063606961.1 protein_id gnl|my_center|LOCUS_20420 12937 13527 gene locus_tag LOCUS_20430 12937 13527 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_20430 13726 14841 gene locus_tag LOCUS_20440 gene ald 13726 14841 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_20440 14849 15817 gene locus_tag LOCUS_20450 gene xerD 14849 15817 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_20450 16099 17196 gene locus_tag LOCUS_20460 16099 17196 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_20460 17181 17537 gene locus_tag LOCUS_20470 17181 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence071 <1 1407 gene locus_tag LOCUS_20480 <1 1407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730341.1:nitrate reductase subunit beta 1404 2075 gene locus_tag LOCUS_20490 1404 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2075 2797 gene locus_tag LOCUS_20500 gene narI 2075 2797 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775894.1 protein_id gnl|my_center|LOCUS_20500 2807 3277 gene locus_tag LOCUS_20510 2807 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 3689 3312 gene locus_tag LOCUS_20520 3689 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 4702 3674 gene locus_tag LOCUS_20530 4702 3674 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742152.1 protein_id gnl|my_center|LOCUS_20530 6506 4695 gene locus_tag LOCUS_20540 6506 4695 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227542.1 protein_id gnl|my_center|LOCUS_20540 5698 5607 gene locus_tag LOCUS_t00280 5698 5607 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7018 6551 gene locus_tag LOCUS_20550 7018 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 7175 7624 gene locus_tag LOCUS_20560 7175 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 7624 8265 gene locus_tag LOCUS_20570 7624 8265 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936452.1 protein_id gnl|my_center|LOCUS_20570 8325 9971 gene locus_tag LOCUS_20580 8325 9971 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534221.1 protein_id gnl|my_center|LOCUS_20580 9952 11745 gene locus_tag LOCUS_20590 9952 11745 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225166.1 protein_id gnl|my_center|LOCUS_20590 11780 12880 gene locus_tag LOCUS_20600 11780 12880 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228346.1 protein_id gnl|my_center|LOCUS_20600 12891 13961 gene locus_tag LOCUS_20610 12891 13961 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183337994.1 protein_id gnl|my_center|LOCUS_20610 14060 16585 gene locus_tag LOCUS_20620 14060 16585 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728610.1 protein_id gnl|my_center|LOCUS_20620 16585 17304 gene locus_tag LOCUS_20630 16585 17304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 17577 17338 gene locus_tag LOCUS_20640 17577 17338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228349.1 protein_id gnl|my_center|LOCUS_20640 >Feature sequence072 <1 2211 gene locus_tag LOCUS_20650 <1 2211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970454.1:DEAD/DEAH box helicase 2208 3398 gene locus_tag LOCUS_20660 2208 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 3865 4209 gene locus_tag LOCUS_20670 3865 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 4253 5590 gene locus_tag LOCUS_20680 4253 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 5997 5587 gene locus_tag LOCUS_20690 gene vsr 5997 5587 CDS product DNA mismatch endonuclease Vsr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940109.1 protein_id gnl|my_center|LOCUS_20690 7413 6007 gene locus_tag LOCUS_20700 7413 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 7807 7732 gene locus_tag LOCUS_t00290 7807 7732 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7974 7849 gene locus_tag LOCUS_20710 7974 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 8079 8005 gene locus_tag LOCUS_t00300 8079 8005 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 8931 8176 gene locus_tag LOCUS_20720 8931 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 11660 8955 gene locus_tag LOCUS_20730 gene gyrA 11660 8955 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_20730 13903 11741 gene locus_tag LOCUS_20740 gene gyrB 13903 11741 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221960.1 protein_id gnl|my_center|LOCUS_20740 14778 14221 gene locus_tag LOCUS_20750 14778 14221 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221959.1 protein_id gnl|my_center|LOCUS_20750 15976 14768 gene locus_tag LOCUS_20760 gene recF 15976 14768 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_20760 16915 16007 gene locus_tag LOCUS_20770 gene gnd 16915 16007 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 protein_id gnl|my_center|LOCUS_20770 17275 16952 gene locus_tag LOCUS_20780 17275 16952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence073 345 1472 gene locus_tag LOCUS_20790 345 1472 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_20790 1469 1774 gene locus_tag LOCUS_20800 1469 1774 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_20800 1771 3174 gene locus_tag LOCUS_20810 1771 3174 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223979.1 protein_id gnl|my_center|LOCUS_20810 3834 3193 gene locus_tag LOCUS_20820 gene upp 3834 3193 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_20820 3945 4448 gene locus_tag LOCUS_20830 3945 4448 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112944.1 protein_id gnl|my_center|LOCUS_20830 4496 4939 gene locus_tag LOCUS_20840 gene tadA 4496 4939 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_20840 5002 5089 gene locus_tag LOCUS_t00310 5002 5089 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5343 6047 gene locus_tag LOCUS_20850 5343 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 6308 6541 gene locus_tag LOCUS_20860 6308 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 6694 7401 gene locus_tag LOCUS_20870 6694 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 8596 7385 gene locus_tag LOCUS_20880 8596 7385 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419356.1 protein_id gnl|my_center|LOCUS_20880 8697 10202 gene locus_tag LOCUS_20890 8697 10202 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975632.1 protein_id gnl|my_center|LOCUS_20890 10737 10213 gene locus_tag LOCUS_20900 10737 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 11050 10742 gene locus_tag LOCUS_20910 11050 10742 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_20910 11451 11146 gene locus_tag LOCUS_20920 11451 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 11798 11595 gene locus_tag LOCUS_20930 11798 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 11890 12858 gene locus_tag LOCUS_20940 11890 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 13459 12962 gene locus_tag LOCUS_20950 gene aroQ 13459 12962 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224605.1 protein_id gnl|my_center|LOCUS_20950 13629 14624 gene locus_tag LOCUS_20960 13629 14624 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226270.1 protein_id gnl|my_center|LOCUS_20960 14767 16128 gene locus_tag LOCUS_20970 14767 16128 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226203.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence074 3032 513 gene locus_tag LOCUS_20980 3032 513 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_20980 3221 3484 gene locus_tag LOCUS_20990 3221 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 4057 3662 gene locus_tag LOCUS_21000 4057 3662 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021844.1 protein_id gnl|my_center|LOCUS_21000 6622 4310 gene locus_tag LOCUS_21010 6622 4310 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_21010 6831 7595 gene locus_tag LOCUS_21020 6831 7595 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_21020 7669 8220 gene locus_tag LOCUS_21030 7669 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 9408 8296 gene locus_tag LOCUS_21040 9408 8296 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_21040 10589 9420 gene locus_tag LOCUS_21050 10589 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 11138 10602 gene locus_tag LOCUS_21060 11138 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 11296 11952 gene locus_tag LOCUS_21070 11296 11952 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_21070 12220 12867 gene locus_tag LOCUS_21080 12220 12867 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886738.1 protein_id gnl|my_center|LOCUS_21080 12873 14000 gene locus_tag LOCUS_21090 12873 14000 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886737.1 protein_id gnl|my_center|LOCUS_21090 13997 15154 gene locus_tag LOCUS_21100 13997 15154 CDS product beta-carotene 2-hydroxylase CYP287A1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889098.1 protein_id gnl|my_center|LOCUS_21100 15151 15495 gene locus_tag LOCUS_21110 15151 15495 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225922.1 protein_id gnl|my_center|LOCUS_21110 15492 15902 gene locus_tag LOCUS_21120 15492 15902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 15850 16695 gene locus_tag LOCUS_21130 15850 16695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence075 200 1114 gene locus_tag LOCUS_21140 gene dapA 200 1114 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_21140 1129 2820 gene locus_tag LOCUS_21150 1129 2820 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_21150 2904 5483 gene locus_tag LOCUS_21160 2904 5483 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_21160 5480 7321 gene locus_tag LOCUS_21170 5480 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 7373 8890 gene locus_tag LOCUS_21180 gene rimO 7373 8890 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228069.1 protein_id gnl|my_center|LOCUS_21180 8887 9501 gene locus_tag LOCUS_21190 gene pgsA 8887 9501 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_21190 11366 9549 gene locus_tag LOCUS_21200 11366 9549 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223305.1 protein_id gnl|my_center|LOCUS_21200 11607 11948 gene locus_tag LOCUS_21210 11607 11948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 12241 11972 gene locus_tag LOCUS_21220 12241 11972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 13733 12813 gene locus_tag LOCUS_21230 13733 12813 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_21230 14508 13726 gene locus_tag LOCUS_21240 14508 13726 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061364.1 protein_id gnl|my_center|LOCUS_21240 <16697 15066 gene locus_tag LOCUS_21250 <16697 15066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109508967.1:ATP-dependent helicase >Feature sequence076 2198 1284 gene locus_tag LOCUS_21260 2198 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2330 3268 gene locus_tag LOCUS_21270 2330 3268 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901674.1 protein_id gnl|my_center|LOCUS_21270 4862 3270 gene locus_tag LOCUS_21280 4862 3270 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229295.1 protein_id gnl|my_center|LOCUS_21280 5303 6850 gene locus_tag LOCUS_21290 5303 6850 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_21290 6847 7140 gene locus_tag LOCUS_21300 6847 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 7498 7151 gene locus_tag LOCUS_21310 7498 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 7671 8150 gene locus_tag LOCUS_21320 7671 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 8515 9126 gene locus_tag LOCUS_21330 8515 9126 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_21330 11927 9138 gene locus_tag LOCUS_21340 11927 9138 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977982.1 protein_id gnl|my_center|LOCUS_21340 12373 12119 gene locus_tag LOCUS_21350 12373 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 12801 14318 gene locus_tag LOCUS_21360 12801 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 14379 14621 gene locus_tag LOCUS_21370 14379 14621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 14637 14822 gene locus_tag LOCUS_21380 14637 14822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 15847 15656 gene locus_tag LOCUS_21390 15847 15656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21390 15753 16079 gene locus_tag LOCUS_21400 15753 16079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence077 1335 169 gene locus_tag LOCUS_21410 1335 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2118 1402 gene locus_tag LOCUS_21420 2118 1402 CDS product DUF2652 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950737.1 protein_id gnl|my_center|LOCUS_21420 3891 2221 gene locus_tag LOCUS_21430 3891 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 4505 4011 gene locus_tag LOCUS_21440 4505 4011 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729409.1 protein_id gnl|my_center|LOCUS_21440 5291 4683 gene locus_tag LOCUS_21450 5291 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 5205 6023 gene locus_tag LOCUS_21460 5205 6023 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978337.1 protein_id gnl|my_center|LOCUS_21460 6205 6594 gene locus_tag LOCUS_21470 6205 6594 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387149.1 protein_id gnl|my_center|LOCUS_21470 7434 6814 gene locus_tag LOCUS_21480 7434 6814 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258321.1 protein_id gnl|my_center|LOCUS_21480 7940 7434 gene locus_tag LOCUS_21490 7940 7434 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 protein_id gnl|my_center|LOCUS_21490 8297 7944 gene locus_tag LOCUS_21500 8297 7944 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081309.1 protein_id gnl|my_center|LOCUS_21500 8620 9222 gene locus_tag LOCUS_21510 8620 9222 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166534399.1 protein_id gnl|my_center|LOCUS_21510 12424 9563 gene locus_tag LOCUS_21520 12424 9563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 12777 13046 gene locus_tag LOCUS_21530 12777 13046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 14204 13389 gene locus_tag LOCUS_21540 14204 13389 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189232801.1 protein_id gnl|my_center|LOCUS_21540 15618 14236 gene locus_tag LOCUS_21550 15618 14236 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226023.1 protein_id gnl|my_center|LOCUS_21550 15738 16202 gene locus_tag LOCUS_21560 15738 16202 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728757.1 protein_id gnl|my_center|LOCUS_21560 16548 16210 gene locus_tag LOCUS_21570 16548 16210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence078 1128 1265 gene locus_tag LOCUS_21580 gene rpmH 1128 1265 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855320.1 protein_id gnl|my_center|LOCUS_21580 1341 1694 gene locus_tag LOCUS_21590 1341 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 1691 1936 gene locus_tag LOCUS_21600 gene yidD 1691 1936 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_21600 1937 3055 gene locus_tag LOCUS_21610 gene yidC 1937 3055 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029289.1 protein_id gnl|my_center|LOCUS_21610 3082 4002 gene locus_tag LOCUS_21620 3082 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 3999 4772 gene locus_tag LOCUS_21630 gene rsmG 3999 4772 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_21630 4756 6126 gene locus_tag LOCUS_21640 4756 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 6123 7469 gene locus_tag LOCUS_21650 6123 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 8610 7585 gene locus_tag LOCUS_21660 8610 7585 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089460.1 protein_id gnl|my_center|LOCUS_21660 9444 8677 gene locus_tag LOCUS_21670 9444 8677 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_21670 10471 9455 gene locus_tag LOCUS_21680 10471 9455 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_21680 11862 10471 gene locus_tag LOCUS_21690 11862 10471 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_21690 12640 12724 gene locus_tag LOCUS_t00320 12640 12724 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13913 12726 gene locus_tag LOCUS_21700 13913 12726 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898354.1 protein_id gnl|my_center|LOCUS_21700 14406 14080 gene locus_tag LOCUS_21710 gene trxA 14406 14080 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_21710 15634 14585 gene locus_tag LOCUS_21720 gene trxB 15634 14585 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence079 581 1087 gene locus_tag LOCUS_21730 581 1087 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_21730 1148 2890 gene locus_tag LOCUS_21740 1148 2890 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_21740 2939 3868 gene locus_tag LOCUS_21750 2939 3868 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775931.1 protein_id gnl|my_center|LOCUS_21750 3901 4107 gene locus_tag LOCUS_21760 3901 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 4255 5136 gene locus_tag LOCUS_21770 gene sigJ 4255 5136 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_21770 6060 5122 gene locus_tag LOCUS_21780 6060 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 8246 6060 gene locus_tag LOCUS_21790 gene glgB 8246 6060 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_21790 9790 8243 gene locus_tag LOCUS_21800 9790 8243 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731333.1 protein_id gnl|my_center|LOCUS_21800 11553 9787 gene locus_tag LOCUS_21810 gene treS 11553 9787 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973556.1 protein_id gnl|my_center|LOCUS_21810 13544 11550 gene locus_tag LOCUS_21820 13544 11550 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 protein_id gnl|my_center|LOCUS_21820 13658 16252 gene locus_tag LOCUS_21830 13658 16252 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence080 1813 83 gene locus_tag LOCUS_21840 1813 83 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_21840 2925 1810 gene locus_tag LOCUS_21850 2925 1810 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_21850 3785 2922 gene locus_tag LOCUS_21860 3785 2922 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_21860 4408 3830 gene locus_tag LOCUS_21870 4408 3830 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_21870 4407 4601 gene locus_tag LOCUS_21880 4407 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 4598 5032 gene locus_tag LOCUS_21890 4598 5032 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416410.1 protein_id gnl|my_center|LOCUS_21890 5080 6111 gene locus_tag LOCUS_21900 gene trpD 5080 6111 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_21900 6466 6188 gene locus_tag LOCUS_21910 6466 6188 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_21910 8303 6477 gene locus_tag LOCUS_21920 8303 6477 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_21920 8438 8686 gene locus_tag LOCUS_21930 8438 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_21930 8683 10017 gene locus_tag LOCUS_21940 8683 10017 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_21940 10113 10319 gene locus_tag LOCUS_21950 10113 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 10588 11670 gene locus_tag LOCUS_21960 10588 11670 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_21960 11744 12979 gene locus_tag LOCUS_21970 11744 12979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 12976 14079 gene locus_tag LOCUS_21980 12976 14079 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_21980 15032 14385 gene locus_tag LOCUS_21990 15032 14385 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227326.1 protein_id gnl|my_center|LOCUS_21990 <16357 15029 gene locus_tag LOCUS_22000 <16357 15029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929427.1:PAS domain S-box protein >Feature sequence081 469 1653 gene locus_tag LOCUS_22010 469 1653 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_22010 1646 3064 gene locus_tag LOCUS_22020 gene glmL 1646 3064 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_22020 3070 4338 gene locus_tag LOCUS_22030 3070 4338 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_22030 4841 4335 gene locus_tag LOCUS_22040 4841 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 4929 6158 gene locus_tag LOCUS_22050 gene ilvA 4929 6158 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_22050 6672 6160 gene locus_tag LOCUS_22060 gene greA 6672 6160 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_22060 7275 6802 gene locus_tag LOCUS_22070 7275 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 7252 8130 gene locus_tag LOCUS_22080 gene mca 7252 8130 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_22080 8127 8366 gene locus_tag LOCUS_22090 8127 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 9012 8353 gene locus_tag LOCUS_22100 9012 8353 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 protein_id gnl|my_center|LOCUS_22100 9446 9063 gene locus_tag LOCUS_22110 gene trxA 9446 9063 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_22110 9867 10307 gene locus_tag LOCUS_22120 9867 10307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 11903 10521 gene locus_tag LOCUS_22130 11903 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 13607 11976 gene locus_tag LOCUS_22140 13607 11976 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026469007.1 protein_id gnl|my_center|LOCUS_22140 13804 13607 gene locus_tag LOCUS_22150 13804 13607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 14171 14446 gene locus_tag LOCUS_22160 14171 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence082 3431 1872 gene locus_tag LOCUS_22170 gene hflX 3431 1872 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_22170 4379 3501 gene locus_tag LOCUS_22180 gene dapF 4379 3501 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030458.1 protein_id gnl|my_center|LOCUS_22180 4410 5060 gene locus_tag LOCUS_22190 4410 5060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230956.1 protein_id gnl|my_center|LOCUS_22190 5057 6538 gene locus_tag LOCUS_22200 5057 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 6612 6809 gene locus_tag LOCUS_22210 6612 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 7898 6894 gene locus_tag LOCUS_22220 7898 6894 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013444.1 protein_id gnl|my_center|LOCUS_22220 9115 7895 gene locus_tag LOCUS_22230 9115 7895 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013443.1 protein_id gnl|my_center|LOCUS_22230 9276 10295 gene locus_tag LOCUS_22240 9276 10295 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013442.1 protein_id gnl|my_center|LOCUS_22240 11228 10362 gene locus_tag LOCUS_22250 11228 10362 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268318.1 protein_id gnl|my_center|LOCUS_22250 12282 11275 gene locus_tag LOCUS_22260 12282 11275 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399736.1 protein_id gnl|my_center|LOCUS_22260 13259 12336 gene locus_tag LOCUS_22270 13259 12336 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729995.1 protein_id gnl|my_center|LOCUS_22270 14780 13284 gene locus_tag LOCUS_22280 14780 13284 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224909.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence083 <1 1062 gene locus_tag LOCUS_22290 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775984.1:oligoribonuclease 1151 1417 gene locus_tag LOCUS_22300 1151 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 1565 3355 gene locus_tag LOCUS_22310 1565 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 4911 3382 gene locus_tag LOCUS_22320 4911 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 5709 5125 gene locus_tag LOCUS_22330 5709 5125 CDS product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776334.1 protein_id gnl|my_center|LOCUS_22330 5824 6315 gene locus_tag LOCUS_22340 5824 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 6761 6336 gene locus_tag LOCUS_22350 6761 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 7139 6861 gene locus_tag LOCUS_22360 7139 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 8595 7333 gene locus_tag LOCUS_22370 8595 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 9004 10095 gene locus_tag LOCUS_22380 9004 10095 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028408.1 protein_id gnl|my_center|LOCUS_22380 10092 10400 gene locus_tag LOCUS_22390 10092 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 10434 12692 gene locus_tag LOCUS_22400 10434 12692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 12689 13906 gene locus_tag LOCUS_22410 12689 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 13903 14571 gene locus_tag LOCUS_22420 13903 14571 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 protein_id gnl|my_center|LOCUS_22420 14568 14996 gene locus_tag LOCUS_22430 14568 14996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence084 436 4191 gene locus_tag LOCUS_22440 436 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 4188 4619 gene locus_tag LOCUS_22450 4188 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 4668 5807 gene locus_tag LOCUS_22460 4668 5807 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226131.1 protein_id gnl|my_center|LOCUS_22460 5874 6164 gene locus_tag LOCUS_22470 5874 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 6270 7652 gene locus_tag LOCUS_22480 6270 7652 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230385.1 protein_id gnl|my_center|LOCUS_22480 7753 8538 gene locus_tag LOCUS_22490 7753 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 8535 9560 gene locus_tag LOCUS_22500 8535 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 9557 10891 gene locus_tag LOCUS_22510 9557 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 11079 11483 gene locus_tag LOCUS_22520 11079 11483 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228348.1 protein_id gnl|my_center|LOCUS_22520 11571 12509 gene locus_tag LOCUS_22530 11571 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 12506 13675 gene locus_tag LOCUS_22540 12506 13675 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence085 2 529 gene locus_tag LOCUS_22550 2 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 1391 600 gene locus_tag LOCUS_22560 1391 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2322 1381 gene locus_tag LOCUS_22570 2322 1381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_22570 2829 2329 gene locus_tag LOCUS_22580 2829 2329 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487439.1 protein_id gnl|my_center|LOCUS_22580 4954 3011 gene locus_tag LOCUS_22590 4954 3011 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_22590 5122 5454 gene locus_tag LOCUS_22600 5122 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 5526 6599 gene locus_tag LOCUS_22610 5526 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 6596 7270 gene locus_tag LOCUS_22620 6596 7270 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_22620 7715 7641 gene locus_tag LOCUS_t00330 7715 7641 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7926 9089 gene locus_tag LOCUS_22630 7926 9089 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056294.1 protein_id gnl|my_center|LOCUS_22630 9130 9930 gene locus_tag LOCUS_22640 9130 9930 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_22640 10051 9976 gene locus_tag LOCUS_t00340 10051 9976 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10640 10104 gene locus_tag LOCUS_22650 10640 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 12523 10637 gene locus_tag LOCUS_22660 gene dnaG 12523 10637 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 protein_id gnl|my_center|LOCUS_22660 12665 13591 gene locus_tag LOCUS_22670 12665 13591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 14827 13604 gene locus_tag LOCUS_22680 14827 13604 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence086 1915 1010 gene locus_tag LOCUS_22690 gene phaZ 1915 1010 CDS product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095866.1 protein_id gnl|my_center|LOCUS_22690 2138 1899 gene locus_tag LOCUS_22700 2138 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3631 2135 gene locus_tag LOCUS_22710 3631 2135 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_22710 4631 3801 gene locus_tag LOCUS_22720 4631 3801 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226050.1 protein_id gnl|my_center|LOCUS_22720 4787 5692 gene locus_tag LOCUS_22730 gene mshB 4787 5692 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_22730 5689 6027 gene locus_tag LOCUS_22740 5689 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 6037 7752 gene locus_tag LOCUS_22750 6037 7752 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_22750 8786 7719 gene locus_tag LOCUS_22760 8786 7719 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030076.1 protein_id gnl|my_center|LOCUS_22760 8971 9297 gene locus_tag LOCUS_22770 8971 9297 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803685.1 protein_id gnl|my_center|LOCUS_22770 9294 10466 gene locus_tag LOCUS_22780 gene dapC 9294 10466 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903345.1 protein_id gnl|my_center|LOCUS_22780 11475 10480 gene locus_tag LOCUS_22790 11475 10480 CDS product heavy metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486364.1 protein_id gnl|my_center|LOCUS_22790 12461 11481 gene locus_tag LOCUS_22800 gene dapD 12461 11481 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730317.1 protein_id gnl|my_center|LOCUS_22800 12579 13664 gene locus_tag LOCUS_22810 gene dapE 12579 13664 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_22810 13815 14144 gene locus_tag LOCUS_22820 13815 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 14147 14656 gene locus_tag LOCUS_22830 14147 14656 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222966.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence087 102 1160 gene locus_tag LOCUS_22840 gene kdd 102 1160 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_22840 1157 2776 gene locus_tag LOCUS_22850 1157 2776 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 protein_id gnl|my_center|LOCUS_22850 2773 4365 gene locus_tag LOCUS_22860 2773 4365 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_22860 4362 5123 gene locus_tag LOCUS_22870 4362 5123 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_22870 5120 5551 gene locus_tag LOCUS_22880 5120 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 5995 7620 gene locus_tag LOCUS_22890 gene lnt 5995 7620 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109789858.1 protein_id gnl|my_center|LOCUS_22890 7617 8414 gene locus_tag LOCUS_22900 7617 8414 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_22900 8411 8932 gene locus_tag LOCUS_22910 8411 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 9343 8960 gene locus_tag LOCUS_22920 9343 8960 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977404.1 protein_id gnl|my_center|LOCUS_22920 10894 9524 gene locus_tag LOCUS_22930 10894 9524 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 protein_id gnl|my_center|LOCUS_22930 11703 10891 gene locus_tag LOCUS_22940 11703 10891 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180933263.1 protein_id gnl|my_center|LOCUS_22940 13476 11950 gene locus_tag LOCUS_22950 13476 11950 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_22950 13585 14469 gene locus_tag LOCUS_22960 13585 14469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence088 24 899 gene locus_tag LOCUS_22970 24 899 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_22970 907 1203 gene locus_tag LOCUS_22980 907 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2253 1363 gene locus_tag LOCUS_22990 gene ppk2 2253 1363 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776404.1 protein_id gnl|my_center|LOCUS_22990 3284 2295 gene locus_tag LOCUS_23000 3284 2295 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406301.1 protein_id gnl|my_center|LOCUS_23000 3881 3357 gene locus_tag LOCUS_23010 3881 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3862 4029 gene locus_tag LOCUS_23020 3862 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 4257 6521 gene locus_tag LOCUS_23030 4257 6521 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031369.1 protein_id gnl|my_center|LOCUS_23030 7455 6559 gene locus_tag LOCUS_23040 7455 6559 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_23040 7701 9158 gene locus_tag LOCUS_23050 7701 9158 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113973.1 protein_id gnl|my_center|LOCUS_23050 9257 10252 gene locus_tag LOCUS_23060 gene trpS 9257 10252 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_23060 10264 10821 gene locus_tag LOCUS_23070 10264 10821 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_23070 10909 11796 gene locus_tag LOCUS_23080 10909 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 11860 12102 gene locus_tag LOCUS_23090 11860 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 12906 12202 gene locus_tag LOCUS_23100 12906 12202 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974116.1 protein_id gnl|my_center|LOCUS_23100 <14448 12914 gene locus_tag LOCUS_23110 <14448 12914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222763.1:succinate dehydrogenase flavoprotein subunit >Feature sequence089 331 1299 gene locus_tag LOCUS_23120 331 1299 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094641.1 protein_id gnl|my_center|LOCUS_23120 1439 3340 gene locus_tag LOCUS_23130 1439 3340 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104754.1 protein_id gnl|my_center|LOCUS_23130 4171 3344 gene locus_tag LOCUS_23140 4171 3344 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229423.1 protein_id gnl|my_center|LOCUS_23140 5493 4168 gene locus_tag LOCUS_23150 5493 4168 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230367.1 protein_id gnl|my_center|LOCUS_23150 5904 5527 gene locus_tag LOCUS_23160 5904 5527 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082918.1 protein_id gnl|my_center|LOCUS_23160 6027 6695 gene locus_tag LOCUS_23170 6027 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 8023 6746 gene locus_tag LOCUS_23180 8023 6746 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104544.1 protein_id gnl|my_center|LOCUS_23180 9327 8062 gene locus_tag LOCUS_23190 9327 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 9767 9324 gene locus_tag LOCUS_23200 9767 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 9873 11348 gene locus_tag LOCUS_23210 gene ggt 9873 11348 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974729.1 protein_id gnl|my_center|LOCUS_23210 <14298 11661 gene locus_tag LOCUS_23220 <14298 11661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224267.1:vitamin B12-dependent ribonucleotide reductase >Feature sequence090 1869 724 gene locus_tag LOCUS_23230 1869 724 CDS product septum site determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223396159.1 protein_id gnl|my_center|LOCUS_23230 2280 3131 gene locus_tag LOCUS_23240 2280 3131 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_23240 4117 3383 gene locus_tag LOCUS_23250 4117 3383 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_23250 4887 4366 gene locus_tag LOCUS_23260 4887 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730256.1 protein_id gnl|my_center|LOCUS_23260 4948 5796 gene locus_tag LOCUS_23270 4948 5796 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417461.1 protein_id gnl|my_center|LOCUS_23270 5935 6552 gene locus_tag LOCUS_23280 5935 6552 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261778.1 protein_id gnl|my_center|LOCUS_23280 6647 8611 gene locus_tag LOCUS_23290 gene acs 6647 8611 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_23290 8692 9117 gene locus_tag LOCUS_23300 8692 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 9110 10060 gene locus_tag LOCUS_23310 9110 10060 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_23310 11229 10057 gene locus_tag LOCUS_23320 11229 10057 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230547.1 protein_id gnl|my_center|LOCUS_23320 11948 11226 gene locus_tag LOCUS_23330 11948 11226 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_23330 12608 11979 gene locus_tag LOCUS_23340 12608 11979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 13306 12605 gene locus_tag LOCUS_23350 13306 12605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 13430 14107 gene locus_tag LOCUS_23360 13430 14107 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence091 351 662 gene locus_tag LOCUS_23370 351 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 1847 633 gene locus_tag LOCUS_23380 1847 633 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 protein_id gnl|my_center|LOCUS_23380 1984 3372 gene locus_tag LOCUS_23390 1984 3372 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031698.1 protein_id gnl|my_center|LOCUS_23390 3375 4400 gene locus_tag LOCUS_23400 3375 4400 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031697.1 protein_id gnl|my_center|LOCUS_23400 4397 5272 gene locus_tag LOCUS_23410 4397 5272 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971654.1 protein_id gnl|my_center|LOCUS_23410 5300 6355 gene locus_tag LOCUS_23420 5300 6355 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 protein_id gnl|my_center|LOCUS_23420 6352 7416 gene locus_tag LOCUS_23430 6352 7416 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976168.1 protein_id gnl|my_center|LOCUS_23430 7413 8777 gene locus_tag LOCUS_23440 7413 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 8774 10468 gene locus_tag LOCUS_23450 8774 10468 CDS product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990053.1 protein_id gnl|my_center|LOCUS_23450 10751 11077 gene locus_tag LOCUS_23460 10751 11077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23460 11446 11862 gene locus_tag LOCUS_23470 11446 11862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 12048 12317 gene locus_tag LOCUS_23480 12048 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence092 1840 920 gene locus_tag LOCUS_23490 1840 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 1722 4265 gene locus_tag LOCUS_23500 1722 4265 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_23500 5288 4326 gene locus_tag LOCUS_23510 5288 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 5454 7133 gene locus_tag LOCUS_23520 5454 7133 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720843.1 protein_id gnl|my_center|LOCUS_23520 7294 7683 gene locus_tag LOCUS_23530 7294 7683 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_23530 7716 9794 gene locus_tag LOCUS_23540 gene pta 7716 9794 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727187.1 protein_id gnl|my_center|LOCUS_23540 9791 10990 gene locus_tag LOCUS_23550 9791 10990 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_23550 12523 11078 gene locus_tag LOCUS_23560 12523 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206056.1 protein_id gnl|my_center|LOCUS_23560 12666 13463 gene locus_tag LOCUS_23570 12666 13463 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence093 90 15 gene locus_tag LOCUS_t00350 90 15 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1071 169 gene locus_tag LOCUS_23580 1071 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975639.1 protein_id gnl|my_center|LOCUS_23580 1744 1163 gene locus_tag LOCUS_23590 1744 1163 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_23590 2253 1783 gene locus_tag LOCUS_23600 2253 1783 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_23600 2747 2250 gene locus_tag LOCUS_23610 gene moaC 2747 2250 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_23610 4017 2749 gene locus_tag LOCUS_23620 4017 2749 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_23620 5414 4041 gene locus_tag LOCUS_23630 5414 4041 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_23630 5450 6088 gene locus_tag LOCUS_23640 5450 6088 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_23640 8723 6066 gene locus_tag LOCUS_23650 8723 6066 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_23650 8929 9285 gene locus_tag LOCUS_23660 8929 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 9349 9978 gene locus_tag LOCUS_23670 9349 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 10014 10412 gene locus_tag LOCUS_23680 gene mscL 10014 10412 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230043.1 protein_id gnl|my_center|LOCUS_23680 10766 10530 gene locus_tag LOCUS_23690 10766 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 11677 10763 gene locus_tag LOCUS_23700 11677 10763 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776014.1 protein_id gnl|my_center|LOCUS_23700 13060 11897 gene locus_tag LOCUS_23710 gene glgA 13060 11897 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226306.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence094 <1 767 gene locus_tag LOCUS_23720 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005092091.1:HNH endonuclease signature motif containing protein 1012 2490 gene locus_tag LOCUS_23730 gene ligD 1012 2490 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226036.1 protein_id gnl|my_center|LOCUS_23730 4406 3096 gene locus_tag LOCUS_23740 4406 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 5204 4443 gene locus_tag LOCUS_23750 5204 4443 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731441.1 protein_id gnl|my_center|LOCUS_23750 6211 5201 gene locus_tag LOCUS_23760 6211 5201 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163795785.1 protein_id gnl|my_center|LOCUS_23760 7751 6198 gene locus_tag LOCUS_23770 7751 6198 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_23770 9007 7796 gene locus_tag LOCUS_23780 9007 7796 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529879.1 protein_id gnl|my_center|LOCUS_23780 9917 9042 gene locus_tag LOCUS_23790 9917 9042 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383500.1 protein_id gnl|my_center|LOCUS_23790 11350 10205 gene locus_tag LOCUS_23800 11350 10205 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731331.1 protein_id gnl|my_center|LOCUS_23800 12538 11363 gene locus_tag LOCUS_23810 12538 11363 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731330.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence095 752 1930 gene locus_tag LOCUS_23820 752 1930 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_23820 2410 2012 gene locus_tag LOCUS_23830 2410 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2748 2512 gene locus_tag LOCUS_23840 2748 2512 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_23840 2869 3822 gene locus_tag LOCUS_23850 2869 3822 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_23850 4080 3895 gene locus_tag LOCUS_23860 gene rpmB 4080 3895 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_23860 4286 5989 gene locus_tag LOCUS_23870 4286 5989 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_23870 6002 8224 gene locus_tag LOCUS_23880 gene recG 6002 8224 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_23880 8260 8823 gene locus_tag LOCUS_23890 gene rsmD 8260 8823 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_23890 8872 9354 gene locus_tag LOCUS_23900 gene coaD 8872 9354 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_23900 9564 10124 gene locus_tag LOCUS_23910 9564 10124 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_23910 10202 10387 gene locus_tag LOCUS_23920 gene rpmF 10202 10387 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223689.1 protein_id gnl|my_center|LOCUS_23920 10414 11127 gene locus_tag LOCUS_23930 gene rnc 10414 11127 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_23930 11134 12024 gene locus_tag LOCUS_23940 gene mutM 11134 12024 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_23940 12251 11955 gene locus_tag LOCUS_23950 12251 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 12359 12565 gene locus_tag LOCUS_23960 12359 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence096 669 2012 gene locus_tag LOCUS_23970 669 2012 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_23970 2466 2083 gene locus_tag LOCUS_23980 2466 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 3451 2483 gene locus_tag LOCUS_23990 gene rfbB 3451 2483 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_23990 3484 4350 gene locus_tag LOCUS_24000 gene rfbA 3484 4350 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062166.1 protein_id gnl|my_center|LOCUS_24000 4398 4595 gene locus_tag LOCUS_24010 4398 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 5057 4620 gene locus_tag LOCUS_24020 5057 4620 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975886.1 protein_id gnl|my_center|LOCUS_24020 6120 5272 gene locus_tag LOCUS_24030 gene rfbD 6120 5272 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_24030 6177 6794 gene locus_tag LOCUS_24040 6177 6794 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 protein_id gnl|my_center|LOCUS_24040 6905 6750 gene locus_tag LOCUS_24050 6905 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 7959 6982 gene locus_tag LOCUS_24060 7959 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 9287 7956 gene locus_tag LOCUS_24070 9287 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 9374 10354 gene locus_tag LOCUS_24080 9374 10354 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_24080 10517 11224 gene locus_tag LOCUS_24090 10517 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 11252 13009 gene locus_tag LOCUS_24100 11252 13009 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053633.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence097 1388 171 gene locus_tag LOCUS_24110 1388 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 2104 1436 gene locus_tag LOCUS_24120 2104 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2152 2592 gene locus_tag LOCUS_24130 2152 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2639 3154 gene locus_tag LOCUS_24140 2639 3154 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730399.1 protein_id gnl|my_center|LOCUS_24140 3356 3997 gene locus_tag LOCUS_24150 3356 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 4420 4031 gene locus_tag LOCUS_24160 4420 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 5058 4549 gene locus_tag LOCUS_24170 gene hsp18 5058 4549 CDS product molecular chaperone Hsp18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908539.1 protein_id gnl|my_center|LOCUS_24170 8397 5221 gene locus_tag LOCUS_24180 8397 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 8682 10190 gene locus_tag LOCUS_24190 8682 10190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085590.1 protein_id gnl|my_center|LOCUS_24190 10190 12235 gene locus_tag LOCUS_24200 10190 12235 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence098 957 271 gene locus_tag LOCUS_24210 957 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 3121 1403 gene locus_tag LOCUS_24220 3121 1403 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759730.1 protein_id gnl|my_center|LOCUS_24220 5475 3118 gene locus_tag LOCUS_24230 5475 3118 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_24230 6521 5529 gene locus_tag LOCUS_24240 6521 5529 CDS product ScbA/BarX family gamma-butyrolactone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190059139.1 protein_id gnl|my_center|LOCUS_24240 8134 6518 gene locus_tag LOCUS_24250 8134 6518 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544143.1 protein_id gnl|my_center|LOCUS_24250 8802 8131 gene locus_tag LOCUS_24260 8802 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 9566 8898 gene locus_tag LOCUS_24270 9566 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 12908 9570 gene locus_tag LOCUS_24280 12908 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence099 2193 391 gene locus_tag LOCUS_24290 2193 391 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259371.1 protein_id gnl|my_center|LOCUS_24290 2561 2211 gene locus_tag LOCUS_24300 2561 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 3128 3319 gene locus_tag LOCUS_24310 3128 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 4124 5227 gene locus_tag LOCUS_24320 4124 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 5444 6304 gene locus_tag LOCUS_24330 5444 6304 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027435.1 protein_id gnl|my_center|LOCUS_24330 6411 7259 gene locus_tag LOCUS_24340 6411 7259 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_24340 7297 8463 gene locus_tag LOCUS_24350 7297 8463 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_24350 8481 9770 gene locus_tag LOCUS_24360 gene efeB 8481 9770 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730522.1 protein_id gnl|my_center|LOCUS_24360 10994 9777 gene locus_tag LOCUS_24370 10994 9777 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228752.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence100 285 1508 gene locus_tag LOCUS_24380 285 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 1501 2394 gene locus_tag LOCUS_24390 1501 2394 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_24390 3579 2473 gene locus_tag LOCUS_24400 3579 2473 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031591.1 protein_id gnl|my_center|LOCUS_24400 4827 3661 gene locus_tag LOCUS_24410 4827 3661 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_24410 4905 5330 gene locus_tag LOCUS_24420 4905 5330 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_24420 5327 7420 gene locus_tag LOCUS_24430 5327 7420 CDS product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889128.1 protein_id gnl|my_center|LOCUS_24430 8223 7702 gene locus_tag LOCUS_24440 gene purE 8223 7702 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_24440 9434 8220 gene locus_tag LOCUS_24450 9434 8220 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_24450 9816 9472 gene locus_tag LOCUS_24460 9816 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 10941 9955 gene locus_tag LOCUS_24470 10941 9955 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 protein_id gnl|my_center|LOCUS_24470 11906 11118 gene locus_tag LOCUS_24480 11906 11118 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence101 1239 490 gene locus_tag LOCUS_24490 1239 490 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893955.1 protein_id gnl|my_center|LOCUS_24490 1317 2114 gene locus_tag LOCUS_24500 gene pcaH 1317 2114 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728462.1 protein_id gnl|my_center|LOCUS_24500 2116 2682 gene locus_tag LOCUS_24510 gene pcaG 2116 2682 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728463.1 protein_id gnl|my_center|LOCUS_24510 2679 3944 gene locus_tag LOCUS_24520 gene pcaB 2679 3944 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728464.1 protein_id gnl|my_center|LOCUS_24520 3941 5119 gene locus_tag LOCUS_24530 gene pcaD 3941 5119 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 protein_id gnl|my_center|LOCUS_24530 6458 5136 gene locus_tag LOCUS_24540 6458 5136 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804132.1 protein_id gnl|my_center|LOCUS_24540 7595 6537 gene locus_tag LOCUS_24550 7595 6537 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533092.1 protein_id gnl|my_center|LOCUS_24550 8461 7592 gene locus_tag LOCUS_24560 8461 7592 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533093.1 protein_id gnl|my_center|LOCUS_24560 9177 8458 gene locus_tag LOCUS_24570 9177 8458 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533094.1 protein_id gnl|my_center|LOCUS_24570 9932 9174 gene locus_tag LOCUS_24580 9932 9174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089146.1 protein_id gnl|my_center|LOCUS_24580 11293 9932 gene locus_tag LOCUS_24590 11293 9932 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533096.1 protein_id gnl|my_center|LOCUS_24590 12219 11434 gene locus_tag LOCUS_24600 12219 11434 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence102 2285 360 gene locus_tag LOCUS_24610 2285 360 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_24610 3394 2318 gene locus_tag LOCUS_24620 gene msiK 3394 2318 CDS product diacetylchitobiose ABC transporter ATP-binding protein MsiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 protein_id gnl|my_center|LOCUS_24620 4580 3522 gene locus_tag LOCUS_24630 4580 3522 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_24630 5363 4584 gene locus_tag LOCUS_24640 5363 4584 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_24640 6211 5360 gene locus_tag LOCUS_24650 6211 5360 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 protein_id gnl|my_center|LOCUS_24650 7208 6237 gene locus_tag LOCUS_24660 7208 6237 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_24660 7207 7455 gene locus_tag LOCUS_24670 7207 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 8209 7523 gene locus_tag LOCUS_24680 8209 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 8223 8987 gene locus_tag LOCUS_24690 8223 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 9023 10405 gene locus_tag LOCUS_24700 9023 10405 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_24700 11036 10506 gene locus_tag LOCUS_24710 11036 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 12001 11033 gene locus_tag LOCUS_24720 12001 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 <12678 12024 gene locus_tag LOCUS_24730 <12678 12024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020639906.1:alpha-galactosidase >Feature sequence103 1228 128 gene locus_tag LOCUS_24740 1228 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1553 2104 gene locus_tag LOCUS_24750 1553 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2996 2139 gene locus_tag LOCUS_24760 2996 2139 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 protein_id gnl|my_center|LOCUS_24760 3378 4397 gene locus_tag LOCUS_24770 3378 4397 CDS product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_24770 5105 4413 gene locus_tag LOCUS_24780 5105 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 6228 5293 gene locus_tag LOCUS_24790 gene rbsK 6228 5293 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269062.1 protein_id gnl|my_center|LOCUS_24790 6590 6264 gene locus_tag LOCUS_24800 6590 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 6766 8265 gene locus_tag LOCUS_24810 6766 8265 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391605.1 protein_id gnl|my_center|LOCUS_24810 8279 9253 gene locus_tag LOCUS_24820 8279 9253 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331879.1 protein_id gnl|my_center|LOCUS_24820 9250 10086 gene locus_tag LOCUS_24830 9250 10086 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532185.1 protein_id gnl|my_center|LOCUS_24830 10127 10945 gene locus_tag LOCUS_24840 10127 10945 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 protein_id gnl|my_center|LOCUS_24840 10989 11564 gene locus_tag LOCUS_24850 gene pgiA 10989 11564 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250062.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence104 813 139 gene locus_tag LOCUS_24860 gene nucS 813 139 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_24860 887 2677 gene locus_tag LOCUS_24870 887 2677 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229492.1 protein_id gnl|my_center|LOCUS_24870 2674 3273 gene locus_tag LOCUS_24880 2674 3273 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_24880 3270 3509 gene locus_tag LOCUS_24890 3270 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 3520 4266 gene locus_tag LOCUS_24900 3520 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 5903 4917 gene locus_tag LOCUS_24910 5903 4917 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_24910 7240 6053 gene locus_tag LOCUS_24920 7240 6053 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 protein_id gnl|my_center|LOCUS_24920 8722 7385 gene locus_tag LOCUS_24930 gene ccrA 8722 7385 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_24930 9391 8921 gene locus_tag LOCUS_24940 gene mce 9391 8921 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 protein_id gnl|my_center|LOCUS_24940 9520 10707 gene locus_tag LOCUS_24950 9520 10707 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_24950 10754 11698 gene locus_tag LOCUS_24960 gene meaB 10754 11698 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_24960 12213 11767 gene locus_tag LOCUS_24970 12213 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227671.1 protein_id gnl|my_center|LOCUS_24970 12279 12434 gene locus_tag LOCUS_24980 12279 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence105 2156 1353 gene locus_tag LOCUS_24990 2156 1353 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_24990 2269 2823 gene locus_tag LOCUS_25000 2269 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 4045 2825 gene locus_tag LOCUS_25010 4045 2825 CDS product glucose-1-phosphate adenylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350023.1 protein_id gnl|my_center|LOCUS_25010 5782 4115 gene locus_tag LOCUS_25020 5782 4115 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_25020 7756 6875 gene locus_tag LOCUS_25030 gene ilvE 7756 6875 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816735.1 protein_id gnl|my_center|LOCUS_25030 7978 7784 gene locus_tag LOCUS_25040 7978 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 8154 8654 gene locus_tag LOCUS_25050 8154 8654 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_25050 9544 8714 gene locus_tag LOCUS_25060 9544 8714 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229343.1 protein_id gnl|my_center|LOCUS_25060 10481 9669 gene locus_tag LOCUS_25070 10481 9669 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_25070 11306 10485 gene locus_tag LOCUS_25080 11306 10485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392394.1 protein_id gnl|my_center|LOCUS_25080 12298 11306 gene locus_tag LOCUS_25090 12298 11306 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence106 <1 1423 gene locus_tag LOCUS_25100 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804545.1:LCP family protein note possible pseudo, internal stop codon, frameshifted 1465 3261 gene locus_tag LOCUS_25110 1465 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 3295 4467 gene locus_tag LOCUS_25120 gene glf 3295 4467 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222174.1 protein_id gnl|my_center|LOCUS_25120 4464 6476 gene locus_tag LOCUS_25130 4464 6476 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776100.1 protein_id gnl|my_center|LOCUS_25130 6473 7411 gene locus_tag LOCUS_25140 6473 7411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112141.1 protein_id gnl|my_center|LOCUS_25140 7443 8237 gene locus_tag LOCUS_25150 7443 8237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_25150 8367 10460 gene locus_tag LOCUS_25160 8367 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 11346 10570 gene locus_tag LOCUS_25170 11346 10570 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence107 <1 997 gene locus_tag LOCUS_25180 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977229.1:phenylalanine--tRNA ligase subunit alpha 997 3480 gene locus_tag LOCUS_25190 gene pheT 997 3480 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_25190 4583 3663 gene locus_tag LOCUS_25200 4583 3663 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_25200 4665 5789 gene locus_tag LOCUS_25210 gene argC 4665 5789 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_25210 5786 6937 gene locus_tag LOCUS_25220 gene argJ 5786 6937 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_25220 6948 7937 gene locus_tag LOCUS_25230 gene argB 6948 7937 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_25230 7984 9141 gene locus_tag LOCUS_25240 7984 9141 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 protein_id gnl|my_center|LOCUS_25240 9138 10082 gene locus_tag LOCUS_25250 gene argF 9138 10082 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041322775.1 protein_id gnl|my_center|LOCUS_25250 10079 10597 gene locus_tag LOCUS_25260 10079 10597 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_25260 10636 12066 gene locus_tag LOCUS_25270 gene argG 10636 12066 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972108.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence108 352 1962 gene locus_tag LOCUS_25280 352 1962 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230332.1 protein_id gnl|my_center|LOCUS_25280 1962 2966 gene locus_tag LOCUS_25290 1962 2966 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284007.1 protein_id gnl|my_center|LOCUS_25290 2977 3306 gene locus_tag LOCUS_25300 2977 3306 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410065.1 protein_id gnl|my_center|LOCUS_25300 3311 4186 gene locus_tag LOCUS_25310 3311 4186 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230331.1 protein_id gnl|my_center|LOCUS_25310 4183 4644 gene locus_tag LOCUS_25320 4183 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 4687 5448 gene locus_tag LOCUS_25330 gene fabG 4687 5448 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_25330 6325 5462 gene locus_tag LOCUS_25340 6325 5462 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141460.1 protein_id gnl|my_center|LOCUS_25340 6747 6322 gene locus_tag LOCUS_25350 6747 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 6906 7418 gene locus_tag LOCUS_25360 6906 7418 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_25360 8124 7399 gene locus_tag LOCUS_25370 8124 7399 CDS product DUF6390 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894094.1 protein_id gnl|my_center|LOCUS_25370 9206 8139 gene locus_tag LOCUS_25380 gene hypE 9206 8139 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_25380 10316 9216 gene locus_tag LOCUS_25390 gene hypD 10316 9216 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_25390 10621 10313 gene locus_tag LOCUS_25400 10621 10313 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_25400 <12229 10654 gene locus_tag LOCUS_25410 <12229 10654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894095.1:carbamoyltransferase HypF >Feature sequence109 1208 294 gene locus_tag LOCUS_25420 1208 294 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_25420 1248 2075 gene locus_tag LOCUS_25430 1248 2075 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889178.1 protein_id gnl|my_center|LOCUS_25430 2072 2494 gene locus_tag LOCUS_25440 gene arfB 2072 2494 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_25440 4516 3044 gene locus_tag LOCUS_25450 4516 3044 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_25450 4634 5014 gene locus_tag LOCUS_25460 4634 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25460 8992 5096 gene locus_tag LOCUS_25470 gene hrpA 8992 5096 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029425.1 protein_id gnl|my_center|LOCUS_25470 9183 9914 gene locus_tag LOCUS_25480 9183 9914 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_25480 9917 11482 gene locus_tag LOCUS_25490 9917 11482 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228517.1 protein_id gnl|my_center|LOCUS_25490 11668 11811 gene locus_tag LOCUS_25500 11668 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence110 1070 75 gene locus_tag LOCUS_25510 1070 75 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_25510 1295 1134 gene locus_tag LOCUS_25520 1295 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 1514 3343 gene locus_tag LOCUS_25530 gene relZ 1514 3343 CDS product bifunctional ribonuclease/(p)ppGpp synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730844.1 protein_id gnl|my_center|LOCUS_25530 4321 3440 gene locus_tag LOCUS_25540 4321 3440 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036276.1 protein_id gnl|my_center|LOCUS_25540 5078 4314 gene locus_tag LOCUS_25550 5078 4314 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036275.1 protein_id gnl|my_center|LOCUS_25550 5182 5493 gene locus_tag LOCUS_25560 5182 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 5490 6140 gene locus_tag LOCUS_25570 5490 6140 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_25570 6861 6133 gene locus_tag LOCUS_25580 6861 6133 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947313.1 protein_id gnl|my_center|LOCUS_25580 7520 6996 gene locus_tag LOCUS_25590 7520 6996 CDS product YfcE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228757.1 protein_id gnl|my_center|LOCUS_25590 8620 7517 gene locus_tag LOCUS_25600 8620 7517 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_25600 9339 8617 gene locus_tag LOCUS_25610 9339 8617 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_25610 10624 9326 gene locus_tag LOCUS_25620 10624 9326 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_25620 11776 10718 gene locus_tag LOCUS_25630 11776 10718 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897538.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence111 1315 371 gene locus_tag LOCUS_25640 1315 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 2196 1312 gene locus_tag LOCUS_25650 2196 1312 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_25650 3118 2189 gene locus_tag LOCUS_25660 3118 2189 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624137.1 protein_id gnl|my_center|LOCUS_25660 4497 3196 gene locus_tag LOCUS_25670 4497 3196 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726997.1 protein_id gnl|my_center|LOCUS_25670 6347 4575 gene locus_tag LOCUS_25680 gene araD 6347 4575 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067522.1 protein_id gnl|my_center|LOCUS_25680 7264 6344 gene locus_tag LOCUS_25690 7264 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028332.1 protein_id gnl|my_center|LOCUS_25690 7647 8513 gene locus_tag LOCUS_25700 7647 8513 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_25700 8522 9520 gene locus_tag LOCUS_25710 8522 9520 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976404.1 protein_id gnl|my_center|LOCUS_25710 <11970 9764 gene locus_tag LOCUS_25720 <11970 9764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030467.1:vitamin B12-dependent ribonucleotide reductase >Feature sequence112 14 250 gene locus_tag LOCUS_25730 gene rpsR 14 250 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_25730 265 714 gene locus_tag LOCUS_25740 gene rplI 265 714 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_25740 1346 858 gene locus_tag LOCUS_25750 1346 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 1321 2832 gene locus_tag LOCUS_25760 1321 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3143 4750 gene locus_tag LOCUS_25770 3143 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 6121 4760 gene locus_tag LOCUS_25780 6121 4760 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_25780 6575 6393 gene locus_tag LOCUS_25790 6575 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 6578 8014 gene locus_tag LOCUS_25800 gene dnaB 6578 8014 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_25800 9496 8123 gene locus_tag LOCUS_25810 9496 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25810 11138 9756 gene locus_tag LOCUS_25820 11138 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25820 11497 11135 gene locus_tag LOCUS_25830 11497 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence113 4276 2786 gene locus_tag LOCUS_25840 4276 2786 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_25840 6590 4281 gene locus_tag LOCUS_25850 6590 4281 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449634.1 protein_id gnl|my_center|LOCUS_25850 7343 6921 gene locus_tag LOCUS_25860 7343 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 7686 7348 gene locus_tag LOCUS_25870 gene bldG 7686 7348 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_25870 7905 10211 gene locus_tag LOCUS_25880 7905 10211 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_25880 10564 10253 gene locus_tag LOCUS_25890 10564 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 10959 10630 gene locus_tag LOCUS_25900 10959 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence114 <1 1093 gene locus_tag LOCUS_25910 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_049749196.1:PQQ-dependent sugar dehydrogenase 2804 1299 gene locus_tag LOCUS_25920 gene gatB 2804 1299 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_25920 4336 2801 gene locus_tag LOCUS_25930 gene gatA 4336 2801 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775913.1 protein_id gnl|my_center|LOCUS_25930 4728 4333 gene locus_tag LOCUS_25940 gene gatC 4728 4333 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_25940 6937 4811 gene locus_tag LOCUS_25950 gene ligA 6937 4811 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111766.1 protein_id gnl|my_center|LOCUS_25950 7055 7693 gene locus_tag LOCUS_25960 7055 7693 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224735.1 protein_id gnl|my_center|LOCUS_25960 7791 8387 gene locus_tag LOCUS_25970 7791 8387 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407773.1 protein_id gnl|my_center|LOCUS_25970 8496 10100 gene locus_tag LOCUS_25980 8496 10100 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_25980 11349 10351 gene locus_tag LOCUS_25990 11349 10351 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence115 1396 638 gene locus_tag LOCUS_26000 1396 638 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224595.1 protein_id gnl|my_center|LOCUS_26000 1499 2563 gene locus_tag LOCUS_26010 1499 2563 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230308.1 protein_id gnl|my_center|LOCUS_26010 2560 2793 gene locus_tag LOCUS_26020 2560 2793 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 protein_id gnl|my_center|LOCUS_26020 2790 3245 gene locus_tag LOCUS_26030 2790 3245 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224597.1 protein_id gnl|my_center|LOCUS_26030 4219 3266 gene locus_tag LOCUS_26040 4219 3266 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455728.1 protein_id gnl|my_center|LOCUS_26040 4261 5142 gene locus_tag LOCUS_26050 4261 5142 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804236.1 protein_id gnl|my_center|LOCUS_26050 6486 5332 gene locus_tag LOCUS_26060 6486 5332 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804442.1 protein_id gnl|my_center|LOCUS_26060 6675 8288 gene locus_tag LOCUS_26070 6675 8288 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225218.1 protein_id gnl|my_center|LOCUS_26070 8285 9085 gene locus_tag LOCUS_26080 8285 9085 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230091.1 protein_id gnl|my_center|LOCUS_26080 9512 9108 gene locus_tag LOCUS_26090 9512 9108 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230092.1 protein_id gnl|my_center|LOCUS_26090 10300 9509 gene locus_tag LOCUS_26100 10300 9509 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_26100 11139 10297 gene locus_tag LOCUS_26110 11139 10297 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973042.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence116 1435 3465 gene locus_tag LOCUS_26120 1435 3465 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_26120 3655 3749 gene locus_tag LOCUS_t00360 3655 3749 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5069 4335 gene locus_tag LOCUS_26130 5069 4335 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_26130 5178 5954 gene locus_tag LOCUS_26140 5178 5954 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_26140 6304 7623 gene locus_tag LOCUS_26150 6304 7623 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_26150 7808 8566 gene locus_tag LOCUS_26160 7808 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 9618 8575 gene locus_tag LOCUS_26170 9618 8575 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775815.1 protein_id gnl|my_center|LOCUS_26170 9819 11123 gene locus_tag LOCUS_26180 9819 11123 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930026.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence117 570 1658 gene locus_tag LOCUS_26190 570 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1693 2373 gene locus_tag LOCUS_26200 1693 2373 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_26200 2374 3717 gene locus_tag LOCUS_26210 2374 3717 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851586.1 protein_id gnl|my_center|LOCUS_26210 3802 5364 gene locus_tag LOCUS_26220 3802 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 5374 6162 gene locus_tag LOCUS_26230 5374 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 7962 6148 gene locus_tag LOCUS_26240 7962 6148 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028953.1 protein_id gnl|my_center|LOCUS_26240 6607 6511 gene locus_tag LOCUS_t00370 6607 6511 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7910 8068 gene locus_tag LOCUS_26250 7910 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 8083 9600 gene locus_tag LOCUS_26260 8083 9600 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_26260 9605 10093 gene locus_tag LOCUS_26270 9605 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 10090 10914 gene locus_tag LOCUS_26280 10090 10914 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223631.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence118 2262 1285 gene locus_tag LOCUS_26290 gene miaA 2262 1285 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224257.1 protein_id gnl|my_center|LOCUS_26290 2292 2690 gene locus_tag LOCUS_26300 2292 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 2701 2928 gene locus_tag LOCUS_26310 2701 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2925 3401 gene locus_tag LOCUS_26320 2925 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 3404 3898 gene locus_tag LOCUS_26330 3404 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 5491 3869 gene locus_tag LOCUS_26340 gene miaB 5491 3869 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_26340 6776 5562 gene locus_tag LOCUS_26350 6776 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 6979 7758 gene locus_tag LOCUS_26360 6979 7758 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_26360 7976 8371 gene locus_tag LOCUS_26370 7976 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 8422 9144 gene locus_tag LOCUS_26380 8422 9144 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_26380 10362 9319 gene locus_tag LOCUS_26390 10362 9319 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_26390 <11206 10562 gene locus_tag LOCUS_26400 <11206 10562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742135.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence119 185 739 gene locus_tag LOCUS_26410 185 739 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_26410 736 1512 gene locus_tag LOCUS_26420 736 1512 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_26420 1575 2873 gene locus_tag LOCUS_26430 1575 2873 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_26430 2870 3595 gene locus_tag LOCUS_26440 2870 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 3592 4923 gene locus_tag LOCUS_26450 gene nuoF 3592 4923 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893427.1 protein_id gnl|my_center|LOCUS_26450 4965 7490 gene locus_tag LOCUS_26460 4965 7490 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916519.1 protein_id gnl|my_center|LOCUS_26460 7487 8818 gene locus_tag LOCUS_26470 gene nuoH 7487 8818 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_26470 8818 9492 gene locus_tag LOCUS_26480 8818 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 9555 10334 gene locus_tag LOCUS_26490 9555 10334 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893423.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence120 1009 281 gene locus_tag LOCUS_26500 1009 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 1596 1006 gene locus_tag LOCUS_26510 1596 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 1686 2696 gene locus_tag LOCUS_26520 gene paaA 1686 2696 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031683.1 protein_id gnl|my_center|LOCUS_26520 2693 2983 gene locus_tag LOCUS_26530 gene paaB 2693 2983 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_26530 3124 3810 gene locus_tag LOCUS_26540 gene paaC 3124 3810 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813293.1 protein_id gnl|my_center|LOCUS_26540 3804 4286 gene locus_tag LOCUS_26550 gene paaJ 3804 4286 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_26550 4286 5386 gene locus_tag LOCUS_26560 4286 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 6016 5438 gene locus_tag LOCUS_26570 6016 5438 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222749.1 protein_id gnl|my_center|LOCUS_26570 6830 6009 gene locus_tag LOCUS_26580 6830 6009 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_26580 6905 7714 gene locus_tag LOCUS_26590 6905 7714 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969714.1 protein_id gnl|my_center|LOCUS_26590 7711 8256 gene locus_tag LOCUS_26600 7711 8256 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816386.1 protein_id gnl|my_center|LOCUS_26600 8308 10104 gene locus_tag LOCUS_26610 gene sppA 8308 10104 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727691.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence121 394 146 gene locus_tag LOCUS_26620 394 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_26620 482 2293 gene locus_tag LOCUS_26630 482 2293 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_26630 2337 2615 gene locus_tag LOCUS_26640 2337 2615 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_26640 4634 2589 gene locus_tag LOCUS_26650 4634 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 4770 5522 gene locus_tag LOCUS_26660 4770 5522 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878191.1 protein_id gnl|my_center|LOCUS_26660 5519 5899 gene locus_tag LOCUS_26670 5519 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 5892 6710 gene locus_tag LOCUS_26680 5892 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 7920 6697 gene locus_tag LOCUS_26690 7920 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083474.1 protein_id gnl|my_center|LOCUS_26690 9099 7993 gene locus_tag LOCUS_26700 9099 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 9220 10170 gene locus_tag LOCUS_26710 9220 10170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence122 <1 915 gene locus_tag LOCUS_26720 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050760733.1:ABC transporter substrate-binding protein 1013 2035 gene locus_tag LOCUS_26730 1013 2035 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087153.1 protein_id gnl|my_center|LOCUS_26730 2052 2996 gene locus_tag LOCUS_26740 2052 2996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115089.1 protein_id gnl|my_center|LOCUS_26740 2996 4072 gene locus_tag LOCUS_26750 2996 4072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080229.1 protein_id gnl|my_center|LOCUS_26750 4056 5396 gene locus_tag LOCUS_26760 4056 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 6840 5875 gene locus_tag LOCUS_26770 6840 5875 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_26770 6942 8102 gene locus_tag LOCUS_26780 6942 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26780 8140 9120 gene locus_tag LOCUS_26790 8140 9120 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence123 1311 469 gene locus_tag LOCUS_26800 gene panB 1311 469 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_26800 1481 3532 gene locus_tag LOCUS_26810 1481 3532 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729965.1 protein_id gnl|my_center|LOCUS_26810 3622 4959 gene locus_tag LOCUS_26820 gene glnA 3622 4959 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_26820 5006 5776 gene locus_tag LOCUS_26830 5006 5776 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 protein_id gnl|my_center|LOCUS_26830 5773 8757 gene locus_tag LOCUS_26840 5773 8757 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_26840 8897 9484 gene locus_tag LOCUS_26850 8897 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 9672 9929 gene locus_tag LOCUS_26860 9672 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence124 2552 522 gene locus_tag LOCUS_26870 2552 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2437 2703 gene locus_tag LOCUS_26880 2437 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 5055 2731 gene locus_tag LOCUS_26890 5055 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 6560 5277 gene locus_tag LOCUS_26900 gene clpX 6560 5277 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562779.1 protein_id gnl|my_center|LOCUS_26900 7388 6711 gene locus_tag LOCUS_26910 7388 6711 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_26910 8027 7398 gene locus_tag LOCUS_26920 8027 7398 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_26920 9568 8123 gene locus_tag LOCUS_26930 gene tig 9568 8123 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_26930 9752 9677 gene locus_tag LOCUS_t00380 9752 9677 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9981 10054 gene locus_tag LOCUS_t00390 9981 10054 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence125 1115 198 gene locus_tag LOCUS_26940 1115 198 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224549.1 protein_id gnl|my_center|LOCUS_26940 1723 1133 gene locus_tag LOCUS_26950 1723 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 3813 1786 gene locus_tag LOCUS_26960 3813 1786 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840716.1 protein_id gnl|my_center|LOCUS_26960 4186 3878 gene locus_tag LOCUS_26970 4186 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 4356 5678 gene locus_tag LOCUS_26980 gene murA 4356 5678 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 protein_id gnl|my_center|LOCUS_26980 5752 6324 gene locus_tag LOCUS_26990 5752 6324 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_26990 6783 6343 gene locus_tag LOCUS_27000 6783 6343 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_27000 7147 6797 gene locus_tag LOCUS_27010 7147 6797 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_27010 8606 7149 gene locus_tag LOCUS_27020 gene atpD 8606 7149 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120484.1 protein_id gnl|my_center|LOCUS_27020 9592 8642 gene locus_tag LOCUS_27030 9592 8642 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence126 2004 193 gene locus_tag LOCUS_27040 2004 193 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_27040 2133 2585 gene locus_tag LOCUS_27050 2133 2585 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_27050 2582 3757 gene locus_tag LOCUS_27060 2582 3757 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224322.1 protein_id gnl|my_center|LOCUS_27060 3790 4143 gene locus_tag LOCUS_27070 3790 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 4144 5088 gene locus_tag LOCUS_27080 4144 5088 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_27080 6365 5121 gene locus_tag LOCUS_27090 6365 5121 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_27090 7055 6426 gene locus_tag LOCUS_27100 7055 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976691.1 protein_id gnl|my_center|LOCUS_27100 7822 7052 gene locus_tag LOCUS_27110 7822 7052 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_27110 7903 8703 gene locus_tag LOCUS_27120 7903 8703 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080236.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence127 309 384 gene locus_tag LOCUS_t00400 309 384 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1438 344 gene locus_tag LOCUS_27130 1438 344 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 protein_id gnl|my_center|LOCUS_27130 2236 1463 gene locus_tag LOCUS_27140 2236 1463 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223189.1 protein_id gnl|my_center|LOCUS_27140 2782 2312 gene locus_tag LOCUS_27150 2782 2312 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_27150 2837 3487 gene locus_tag LOCUS_27160 gene orn 2837 3487 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_27160 3534 3609 gene locus_tag LOCUS_t00410 3534 3609 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4674 3685 gene locus_tag LOCUS_27170 4674 3685 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_27170 5483 4773 gene locus_tag LOCUS_27180 5483 4773 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229255.1 protein_id gnl|my_center|LOCUS_27180 6058 5483 gene locus_tag LOCUS_27190 6058 5483 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_27190 6197 6270 gene locus_tag LOCUS_t00420 6197 6270 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6986 6351 gene locus_tag LOCUS_27200 6986 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 7670 7185 gene locus_tag LOCUS_27210 7670 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 9012 7981 gene locus_tag LOCUS_27220 9012 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 9347 9775 gene locus_tag LOCUS_27230 9347 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence128 674 195 gene locus_tag LOCUS_27240 674 195 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228095.1 protein_id gnl|my_center|LOCUS_27240 1423 683 gene locus_tag LOCUS_27250 1423 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 2504 1494 gene locus_tag LOCUS_27260 2504 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 3559 2501 gene locus_tag LOCUS_27270 gene cofD 3559 2501 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222933.1 protein_id gnl|my_center|LOCUS_27270 3779 4033 gene locus_tag LOCUS_27280 3779 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 4479 4078 gene locus_tag LOCUS_27290 4479 4078 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628643.1 protein_id gnl|my_center|LOCUS_27290 4641 5012 gene locus_tag LOCUS_27300 4641 5012 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27300 5067 6443 gene locus_tag LOCUS_27310 5067 6443 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_27310 6440 6616 gene locus_tag LOCUS_27320 6440 6616 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_27320 6622 7656 gene locus_tag LOCUS_27330 6622 7656 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 protein_id gnl|my_center|LOCUS_27330 7845 8828 gene locus_tag LOCUS_27340 7845 8828 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence129 1281 568 gene locus_tag LOCUS_27350 1281 568 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326434.1 protein_id gnl|my_center|LOCUS_27350 1892 1281 gene locus_tag LOCUS_27360 1892 1281 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031938971.1 protein_id gnl|my_center|LOCUS_27360 2111 2830 gene locus_tag LOCUS_27370 2111 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 2827 3612 gene locus_tag LOCUS_27380 2827 3612 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_27380 3724 4641 gene locus_tag LOCUS_27390 3724 4641 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027205.1 protein_id gnl|my_center|LOCUS_27390 5304 4651 gene locus_tag LOCUS_27400 5304 4651 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_27400 5629 5321 gene locus_tag LOCUS_27410 5629 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 6126 9062 gene locus_tag LOCUS_27420 gene uvrA 6126 9062 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_27420 9191 9706 gene locus_tag LOCUS_27430 9191 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence130 1684 203 gene locus_tag LOCUS_27440 1684 203 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223014.1 protein_id gnl|my_center|LOCUS_27440 1866 2603 gene locus_tag LOCUS_27450 1866 2603 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_27450 3739 2702 gene locus_tag LOCUS_27460 3739 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 4177 3953 gene locus_tag LOCUS_27470 4177 3953 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 protein_id gnl|my_center|LOCUS_27470 4936 4250 gene locus_tag LOCUS_27480 4936 4250 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_27480 5037 6260 gene locus_tag LOCUS_27490 gene moeZ 5037 6260 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_27490 6282 6614 gene locus_tag LOCUS_27500 6282 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 >Feature sequence131 <1 1164 gene locus_tag LOCUS_27510 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031124.1:DUF1080 domain-containing protein 1281 1799 gene locus_tag LOCUS_27520 1281 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1893 3422 gene locus_tag LOCUS_27530 1893 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 3566 3381 gene locus_tag LOCUS_27540 3566 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 3565 4497 gene locus_tag LOCUS_27550 3565 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 4785 4710 gene locus_tag LOCUS_t00430 4785 4710 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4991 6313 gene locus_tag LOCUS_27560 4991 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 6456 6626 gene locus_tag LOCUS_27570 6456 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 6675 7115 gene locus_tag LOCUS_27580 6675 7115 CDS product OsmC family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224811.1 protein_id gnl|my_center|LOCUS_27580 8154 7162 gene locus_tag LOCUS_27590 8154 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682355.1 protein_id gnl|my_center|LOCUS_27590 8798 8151 gene locus_tag LOCUS_27600 8798 8151 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224664.1 protein_id gnl|my_center|LOCUS_27600 <9525 8898 gene locus_tag LOCUS_27610 <9525 8898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977066.1:ribosome biogenesis GTPase Der >Feature sequence132 1 1146 gene locus_tag LOCUS_27620 1 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1156 1770 gene locus_tag LOCUS_27630 gene folE 1156 1770 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_27630 1839 2609 gene locus_tag LOCUS_27640 1839 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 3148 2618 gene locus_tag LOCUS_27650 3148 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 3328 4209 gene locus_tag LOCUS_27660 gene folP 3328 4209 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_27660 4202 4624 gene locus_tag LOCUS_27670 4202 4624 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_27670 4658 5098 gene locus_tag LOCUS_27680 gene folB 4658 5098 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_27680 5091 5657 gene locus_tag LOCUS_27690 gene folK 5091 5657 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_27690 5681 6214 gene locus_tag LOCUS_27700 5681 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 6231 6848 gene locus_tag LOCUS_27710 6231 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence133 371 2221 gene locus_tag LOCUS_27720 371 2221 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230959.1 protein_id gnl|my_center|LOCUS_27720 4783 2228 gene locus_tag LOCUS_27730 4783 2228 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230375.1 protein_id gnl|my_center|LOCUS_27730 5318 4794 gene locus_tag LOCUS_27740 5318 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230376.1 protein_id gnl|my_center|LOCUS_27740 5938 5318 gene locus_tag LOCUS_27750 5938 5318 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086837759.1 protein_id gnl|my_center|LOCUS_27750 7584 5935 gene locus_tag LOCUS_27760 7584 5935 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230378.1 protein_id gnl|my_center|LOCUS_27760 8082 7993 gene locus_tag LOCUS_t00440 8082 7993 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8638 8171 gene locus_tag LOCUS_27770 8638 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 >Feature sequence134 362 604 gene locus_tag LOCUS_27780 gene purS 362 604 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_27780 601 1287 gene locus_tag LOCUS_27790 gene purQ 601 1287 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230758.1 protein_id gnl|my_center|LOCUS_27790 2286 1297 gene locus_tag LOCUS_27800 2286 1297 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084237.1 protein_id gnl|my_center|LOCUS_27800 2783 2349 gene locus_tag LOCUS_27810 2783 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2743 3057 gene locus_tag LOCUS_27820 2743 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 3118 5388 gene locus_tag LOCUS_27830 gene purL 3118 5388 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_27830 6764 5412 gene locus_tag LOCUS_27840 6764 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 6899 7264 gene locus_tag LOCUS_27850 6899 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 8698 7283 gene locus_tag LOCUS_27860 8698 7283 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182573247.1 protein_id gnl|my_center|LOCUS_27860 8903 8733 gene locus_tag LOCUS_27870 8903 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence135 <1 568 gene locus_tag LOCUS_27880 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726857.1:DUF1446 domain-containing protein 561 884 gene locus_tag LOCUS_27890 561 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 978 1328 gene locus_tag LOCUS_27900 978 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 1393 1782 gene locus_tag LOCUS_27910 1393 1782 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_27910 2365 1796 gene locus_tag LOCUS_27920 2365 1796 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226947.1 protein_id gnl|my_center|LOCUS_27920 2488 3309 gene locus_tag LOCUS_27930 2488 3309 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222332.1 protein_id gnl|my_center|LOCUS_27930 5386 3338 gene locus_tag LOCUS_27940 5386 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 5908 7650 gene locus_tag LOCUS_27950 5908 7650 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence136 2025 931 gene locus_tag LOCUS_27960 2025 931 CDS product hydrogenase expression protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728543.1 protein_id gnl|my_center|LOCUS_27960 2892 2122 gene locus_tag LOCUS_27970 gene hypB 2892 2122 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728544.1 protein_id gnl|my_center|LOCUS_27970 3238 2909 gene locus_tag LOCUS_27980 3238 2909 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225637.1 protein_id gnl|my_center|LOCUS_27980 4663 3251 gene locus_tag LOCUS_27990 4663 3251 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081095.1 protein_id gnl|my_center|LOCUS_27990 4739 6859 gene locus_tag LOCUS_28000 gene glgX 4739 6859 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804991.1 protein_id gnl|my_center|LOCUS_28000 6958 7893 gene locus_tag LOCUS_28010 6958 7893 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899798.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence137 <1 1164 gene locus_tag LOCUS_28020 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206761.1:ABC transporter substrate-binding protein 1168 2205 gene locus_tag LOCUS_28030 1168 2205 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206744.1 protein_id gnl|my_center|LOCUS_28030 2270 3139 gene locus_tag LOCUS_28040 2270 3139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257247.1 protein_id gnl|my_center|LOCUS_28040 3139 4944 gene locus_tag LOCUS_28050 3139 4944 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206746.1 protein_id gnl|my_center|LOCUS_28050 4977 6143 gene locus_tag LOCUS_28060 4977 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 6169 6966 gene locus_tag LOCUS_28070 6169 6966 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_28070 7083 7640 gene locus_tag LOCUS_28080 7083 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 7637 8797 gene locus_tag LOCUS_28090 7637 8797 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242878.1 protein_id gnl|my_center|LOCUS_28090 >Feature sequence138 837 1298 gene locus_tag LOCUS_28100 837 1298 CDS product MSMEG_6728 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731493.1 protein_id gnl|my_center|LOCUS_28100 1321 1986 gene locus_tag LOCUS_28110 1321 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 2090 3679 gene locus_tag LOCUS_28120 gene serA 2090 3679 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_28120 3791 5455 gene locus_tag LOCUS_28130 3791 5455 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957525.1 protein_id gnl|my_center|LOCUS_28130 5966 5460 gene locus_tag LOCUS_28140 5966 5460 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974472.1 protein_id gnl|my_center|LOCUS_28140 6442 6603 gene locus_tag LOCUS_28150 6442 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 6613 7722 gene locus_tag LOCUS_28160 6613 7722 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223592.1 protein_id gnl|my_center|LOCUS_28160 >Feature sequence139 <1 1310 gene locus_tag LOCUS_28170 <1 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029792.1:DNA-directed RNA polymerase subunit beta 1423 5304 gene locus_tag LOCUS_28180 1423 5304 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_28180 5419 5892 gene locus_tag LOCUS_28190 5419 5892 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776942.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence140 322 1254 gene locus_tag LOCUS_28200 322 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 1843 2844 gene locus_tag LOCUS_28210 1843 2844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 protein_id gnl|my_center|LOCUS_28210 2841 3623 gene locus_tag LOCUS_28220 2841 3623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973847.1 protein_id gnl|my_center|LOCUS_28220 3689 4792 gene locus_tag LOCUS_28230 3689 4792 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091312173.1 protein_id gnl|my_center|LOCUS_28230 4789 5406 gene locus_tag LOCUS_28240 4789 5406 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_28240 6196 5441 gene locus_tag LOCUS_28250 6196 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 7105 6353 gene locus_tag LOCUS_28260 7105 6353 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225351.1 protein_id gnl|my_center|LOCUS_28260 7374 7571 gene locus_tag LOCUS_28270 7374 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 7618 7773 gene locus_tag LOCUS_28280 7618 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 8532 7789 gene locus_tag LOCUS_28290 gene egtC 8532 7789 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027440.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence141 <1 571 gene locus_tag LOCUS_28300 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085375.1:EAL domain-containing protein 2270 558 gene locus_tag LOCUS_28310 2270 558 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641784.1 protein_id gnl|my_center|LOCUS_28310 3862 2354 gene locus_tag LOCUS_28320 3862 2354 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_28320 4513 5130 gene locus_tag LOCUS_28330 4513 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 5405 6004 gene locus_tag LOCUS_28340 5405 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 6006 7109 gene locus_tag LOCUS_28350 6006 7109 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526239.1 protein_id gnl|my_center|LOCUS_28350 7271 7996 gene locus_tag LOCUS_28360 7271 7996 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223518.1 protein_id gnl|my_center|LOCUS_28360 8524 8186 gene locus_tag LOCUS_28370 8524 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence142 173 3583 gene locus_tag LOCUS_28380 173 3583 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027194.1 protein_id gnl|my_center|LOCUS_28380 4810 3602 gene locus_tag LOCUS_28390 4810 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 4846 5775 gene locus_tag LOCUS_28400 4846 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 7189 5789 gene locus_tag LOCUS_28410 7189 5789 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_28410 7255 7707 gene locus_tag LOCUS_28420 7255 7707 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727858.1 protein_id gnl|my_center|LOCUS_28420 7704 8507 gene locus_tag LOCUS_28430 7704 8507 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974056.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence143 2253 358 gene locus_tag LOCUS_28440 gene recD 2253 358 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900979.1 protein_id gnl|my_center|LOCUS_28440 5582 2253 gene locus_tag LOCUS_28450 gene recB 5582 2253 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727605.1 protein_id gnl|my_center|LOCUS_28450 <8542 5579 gene locus_tag LOCUS_28460 <8542 5579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003900193.1:exodeoxyribonuclease V subunit gamma >Feature sequence144 622 428 gene locus_tag LOCUS_28470 622 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 1438 959 gene locus_tag LOCUS_28480 1438 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1738 1665 gene locus_tag LOCUS_t00450 1738 1665 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2766 1879 gene locus_tag LOCUS_28490 2766 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 2858 4450 gene locus_tag LOCUS_28500 2858 4450 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142816.1 protein_id gnl|my_center|LOCUS_28500 4883 4467 gene locus_tag LOCUS_28510 4883 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 5372 4911 gene locus_tag LOCUS_28520 5372 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 5326 5595 gene locus_tag LOCUS_28530 5326 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 5684 6520 gene locus_tag LOCUS_28540 5684 6520 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_28540 6517 6816 gene locus_tag LOCUS_28550 6517 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 7802 6765 gene locus_tag LOCUS_28560 7802 6765 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729463.1 protein_id gnl|my_center|LOCUS_28560 <8521 7805 gene locus_tag LOCUS_28570 <8521 7805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730628.1:mannitol dehydrogenase family protein >Feature sequence145 <1 1129 gene locus_tag LOCUS_28580 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775896.1:nitrate reductase subunit beta 1126 1737 gene locus_tag LOCUS_28590 1126 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 1734 2483 gene locus_tag LOCUS_28600 gene narI 1734 2483 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026935.1 protein_id gnl|my_center|LOCUS_28600 2505 2840 gene locus_tag LOCUS_28610 2505 2840 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029816.1 protein_id gnl|my_center|LOCUS_28610 4136 2883 gene locus_tag LOCUS_28620 4136 2883 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226226.1 protein_id gnl|my_center|LOCUS_28620 4569 4207 gene locus_tag LOCUS_28630 4569 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 5400 4657 gene locus_tag LOCUS_28640 5400 4657 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072477587.1 protein_id gnl|my_center|LOCUS_28640 5887 5501 gene locus_tag LOCUS_28650 5887 5501 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 protein_id gnl|my_center|LOCUS_28650 7257 6025 gene locus_tag LOCUS_28660 7257 6025 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228768.1 protein_id gnl|my_center|LOCUS_28660 7623 7261 gene locus_tag LOCUS_28670 7623 7261 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 protein_id gnl|my_center|LOCUS_28670 7998 8150 gene locus_tag LOCUS_28680 7998 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 >Feature sequence146 <1 1365 gene locus_tag LOCUS_28690 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005121857.1:FAD-binding oxidoreductase 1362 2669 gene locus_tag LOCUS_28700 1362 2669 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897704.1 protein_id gnl|my_center|LOCUS_28700 2720 3637 gene locus_tag LOCUS_28710 gene era 2720 3637 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_28710 4602 3727 gene locus_tag LOCUS_28720 4602 3727 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243358.1 protein_id gnl|my_center|LOCUS_28720 5298 4828 gene locus_tag LOCUS_28730 5298 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 5674 7440 gene locus_tag LOCUS_28740 gene leuA 5674 7440 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976275.1 protein_id gnl|my_center|LOCUS_28740 7533 7934 gene locus_tag LOCUS_28750 7533 7934 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005123490.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence147 1670 822 gene locus_tag LOCUS_28760 1670 822 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_28760 2535 1657 gene locus_tag LOCUS_28770 2535 1657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_28770 3716 2583 gene locus_tag LOCUS_28780 3716 2583 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974363.1 protein_id gnl|my_center|LOCUS_28780 3797 4453 gene locus_tag LOCUS_28790 3797 4453 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_28790 4464 5891 gene locus_tag LOCUS_28800 4464 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 6025 6777 gene locus_tag LOCUS_28810 6025 6777 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805196.1 protein_id gnl|my_center|LOCUS_28810 6764 7252 gene locus_tag LOCUS_28820 6764 7252 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930319.1 protein_id gnl|my_center|LOCUS_28820 8210 7335 gene locus_tag LOCUS_28830 8210 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 >Feature sequence148 420 1718 gene locus_tag LOCUS_28840 420 1718 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_28840 1785 2144 gene locus_tag LOCUS_28850 1785 2144 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_28850 2173 2727 gene locus_tag LOCUS_28860 2173 2727 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_28860 2724 3527 gene locus_tag LOCUS_28870 2724 3527 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416425.1 protein_id gnl|my_center|LOCUS_28870 3527 4891 gene locus_tag LOCUS_28880 3527 4891 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_28880 4888 5703 gene locus_tag LOCUS_28890 gene nuoE 4888 5703 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_28890 5700 7037 gene locus_tag LOCUS_28900 gene nuoF 5700 7037 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893427.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence149 843 331 gene locus_tag LOCUS_28910 843 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 1700 849 gene locus_tag LOCUS_28920 1700 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 1809 2090 gene locus_tag LOCUS_28930 1809 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 2118 2450 gene locus_tag LOCUS_28940 2118 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 3221 2532 gene locus_tag LOCUS_28950 3221 2532 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079514.1 protein_id gnl|my_center|LOCUS_28950 4418 3288 gene locus_tag LOCUS_28960 4418 3288 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223031.1 protein_id gnl|my_center|LOCUS_28960 4777 4415 gene locus_tag LOCUS_28970 gene nirD 4777 4415 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223030.1 protein_id gnl|my_center|LOCUS_28970 7317 4777 gene locus_tag LOCUS_28980 gene nirB 7317 4777 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223029.1 protein_id gnl|my_center|LOCUS_28980 <8048 7314 gene locus_tag LOCUS_28990 <8048 7314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223027.1:FAD-dependent oxidoreductase >Feature sequence150 <1 2471 gene locus_tag LOCUS_29000 <1 2471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776321.1:DEAD/DEAH box helicase 3586 2501 gene locus_tag LOCUS_29010 3586 2501 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728115.1 protein_id gnl|my_center|LOCUS_29010 3812 4177 gene locus_tag LOCUS_29020 3812 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29020 4181 5578 gene locus_tag LOCUS_29030 4181 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225898.1 protein_id gnl|my_center|LOCUS_29030 5670 7070 gene locus_tag LOCUS_29040 5670 7070 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296681.1 protein_id gnl|my_center|LOCUS_29040 >Feature sequence151 571 188 gene locus_tag LOCUS_29050 571 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 944 558 gene locus_tag LOCUS_29060 944 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 1120 941 gene locus_tag LOCUS_29070 1120 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 1050 1958 gene locus_tag LOCUS_29080 1050 1958 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_29080 1987 2415 gene locus_tag LOCUS_29090 1987 2415 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_29090 2842 2393 gene locus_tag LOCUS_29100 2842 2393 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_29100 3276 2839 gene locus_tag LOCUS_29110 3276 2839 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_29110 3350 4567 gene locus_tag LOCUS_29120 3350 4567 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_29120 5155 4601 gene locus_tag LOCUS_29130 5155 4601 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_29130 5251 5751 gene locus_tag LOCUS_29140 5251 5751 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930002.1 protein_id gnl|my_center|LOCUS_29140 5776 6123 gene locus_tag LOCUS_29150 5776 6123 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776272.1 protein_id gnl|my_center|LOCUS_29150 7837 6110 gene locus_tag LOCUS_29160 gene ettA 7837 6110 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412708.1 protein_id gnl|my_center|LOCUS_29160 >Feature sequence152 1143 364 gene locus_tag LOCUS_29170 gene sigM 1143 364 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_29170 3305 1140 gene locus_tag LOCUS_29180 3305 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 5156 3378 gene locus_tag LOCUS_29190 5156 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29190 7528 5153 gene locus_tag LOCUS_29200 7528 5153 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029298.1 protein_id gnl|my_center|LOCUS_29200 >Feature sequence153 810 1481 gene locus_tag LOCUS_29210 810 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 1552 4911 gene locus_tag LOCUS_29220 1552 4911 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111768112.1 protein_id gnl|my_center|LOCUS_29220 6385 5225 gene locus_tag LOCUS_29230 6385 5225 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_29230 6933 6382 gene locus_tag LOCUS_29240 6933 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 7056 7430 gene locus_tag LOCUS_29250 7056 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence154 2 1888 gene locus_tag LOCUS_29260 2 1888 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887578.1 protein_id gnl|my_center|LOCUS_29260 2361 1915 gene locus_tag LOCUS_29270 gene hsp18 2361 1915 CDS product molecular chaperone Hsp18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908539.1 protein_id gnl|my_center|LOCUS_29270 2497 2814 gene locus_tag LOCUS_29280 2497 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 2811 3245 gene locus_tag LOCUS_29290 2811 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776367.1 protein_id gnl|my_center|LOCUS_29290 4061 3258 gene locus_tag LOCUS_29300 4061 3258 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_29300 4834 4133 gene locus_tag LOCUS_29310 4834 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29310 5470 4844 gene locus_tag LOCUS_29320 5470 4844 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_29320 5581 5784 gene locus_tag LOCUS_29330 5581 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 6581 5904 gene locus_tag LOCUS_29340 gene mpt83 6581 5904 CDS product cell surface glycolipoprotein Mpt83 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414630.1 protein_id gnl|my_center|LOCUS_29340 <7591 6676 gene locus_tag LOCUS_29350 <7591 6676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027201.1:sulfite oxidase >Feature sequence155 719 366 gene locus_tag LOCUS_29360 719 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 849 2360 gene locus_tag LOCUS_29370 849 2360 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970040.1 protein_id gnl|my_center|LOCUS_29370 2442 2993 gene locus_tag LOCUS_29380 2442 2993 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222272.1 protein_id gnl|my_center|LOCUS_29380 3114 4070 gene locus_tag LOCUS_29390 3114 4070 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029113.1 protein_id gnl|my_center|LOCUS_29390 4202 4522 gene locus_tag LOCUS_29400 4202 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 4533 5453 gene locus_tag LOCUS_29410 4533 5453 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023149.1 protein_id gnl|my_center|LOCUS_29410 5450 6238 gene locus_tag LOCUS_29420 5450 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence156 4557 850 gene locus_tag LOCUS_29430 4557 850 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026932.1 protein_id gnl|my_center|LOCUS_29430 5911 4697 gene locus_tag LOCUS_29440 5911 4697 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537612.1 protein_id gnl|my_center|LOCUS_29440 6914 5922 gene locus_tag LOCUS_29450 6914 5922 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_29450 7213 6917 gene locus_tag LOCUS_29460 7213 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence157 1086 130 gene locus_tag LOCUS_29470 1086 130 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_29470 1691 1086 gene locus_tag LOCUS_29480 1691 1086 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_29480 2305 1751 gene locus_tag LOCUS_29490 2305 1751 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_29490 4299 2302 gene locus_tag LOCUS_29500 gene thrS 4299 2302 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_29500 4725 4652 gene locus_tag LOCUS_t00460 4725 4652 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5023 5463 gene locus_tag LOCUS_29510 5023 5463 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975886.1 protein_id gnl|my_center|LOCUS_29510 6298 5477 gene locus_tag LOCUS_29520 6298 5477 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_29520 6421 6494 gene locus_tag LOCUS_t00470 6421 6494 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6519 6590 gene locus_tag LOCUS_t00480 6519 6590 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6630 6704 gene locus_tag LOCUS_t00490 6630 6704 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence158 1128 436 gene locus_tag LOCUS_29530 1128 436 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031142.1 protein_id gnl|my_center|LOCUS_29530 1289 2515 gene locus_tag LOCUS_29540 1289 2515 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031183.1 protein_id gnl|my_center|LOCUS_29540 2552 4795 gene locus_tag LOCUS_29550 2552 4795 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083313.1 protein_id gnl|my_center|LOCUS_29550 5667 5152 gene locus_tag LOCUS_29560 5667 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 5755 7005 gene locus_tag LOCUS_29570 5755 7005 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090631.1 protein_id gnl|my_center|LOCUS_29570 >Feature sequence159 <1 979 gene locus_tag LOCUS_29580 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057431.1:branched-chain amino acid ABC transporter permease 988 1986 gene locus_tag LOCUS_29590 988 1986 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391162.1 protein_id gnl|my_center|LOCUS_29590 1976 2962 gene locus_tag LOCUS_29600 1976 2962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_29600 2955 3776 gene locus_tag LOCUS_29610 2955 3776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_29610 5091 3964 gene locus_tag LOCUS_29620 5091 3964 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_29620 5084 5266 gene locus_tag LOCUS_29630 5084 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 6069 5434 gene locus_tag LOCUS_29640 6069 5434 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_29640 6158 6241 gene locus_tag LOCUS_t00500 6158 6241 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence160 570 1298 gene locus_tag LOCUS_29650 gene recO 570 1298 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_29650 1757 1311 gene locus_tag LOCUS_29660 1757 1311 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666375.1 protein_id gnl|my_center|LOCUS_29660 1834 2616 gene locus_tag LOCUS_29670 1834 2616 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 protein_id gnl|my_center|LOCUS_29670 3017 2613 gene locus_tag LOCUS_29680 3017 2613 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228384.1 protein_id gnl|my_center|LOCUS_29680 4017 3004 gene locus_tag LOCUS_29690 4017 3004 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_29690 4814 4014 gene locus_tag LOCUS_29700 4814 4014 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_29700 5683 4811 gene locus_tag LOCUS_29710 5683 4811 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_29710 6126 5806 gene locus_tag LOCUS_29720 6126 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence161 1040 45 gene locus_tag LOCUS_29730 1040 45 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031566.1 protein_id gnl|my_center|LOCUS_29730 3250 1082 gene locus_tag LOCUS_29740 3250 1082 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030047.1 protein_id gnl|my_center|LOCUS_29740 3504 5138 gene locus_tag LOCUS_29750 3504 5138 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 protein_id gnl|my_center|LOCUS_29750 5533 5153 gene locus_tag LOCUS_29760 5533 5153 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227562.1 protein_id gnl|my_center|LOCUS_29760 >Feature sequence162 1723 1247 gene locus_tag LOCUS_29770 1723 1247 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894097.1 protein_id gnl|my_center|LOCUS_29770 1944 1732 gene locus_tag LOCUS_29780 1944 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 2100 1981 gene locus_tag LOCUS_29790 2100 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 3483 2104 gene locus_tag LOCUS_29800 3483 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728540.1 protein_id gnl|my_center|LOCUS_29800 4148 3480 gene locus_tag LOCUS_29810 4148 3480 CDS product DUF6084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225643.1 protein_id gnl|my_center|LOCUS_29810 4792 4145 gene locus_tag LOCUS_29820 4792 4145 CDS product DUF5947 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467021.1 protein_id gnl|my_center|LOCUS_29820 5768 4824 gene locus_tag LOCUS_29830 5768 4824 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894102.1 protein_id gnl|my_center|LOCUS_29830 <6860 5798 gene locus_tag LOCUS_29840 <6860 5798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894103.1:nickel-dependent hydrogenase large subunit >Feature sequence163 1032 25 gene locus_tag LOCUS_29850 1032 25 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_29850 1293 2261 gene locus_tag LOCUS_29860 1293 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 2495 3325 gene locus_tag LOCUS_29870 2495 3325 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412786.1 protein_id gnl|my_center|LOCUS_29870 3327 3965 gene locus_tag LOCUS_29880 3327 3965 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_29880 3962 4384 gene locus_tag LOCUS_29890 3962 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 4463 4639 gene locus_tag LOCUS_29900 4463 4639 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776605.1 protein_id gnl|my_center|LOCUS_29900 4639 5097 gene locus_tag LOCUS_29910 4639 5097 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_29910 5099 5962 gene locus_tag LOCUS_29920 5099 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_29920 5955 6770 gene locus_tag LOCUS_29930 5955 6770 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_29930 >Feature sequence164 1891 1022 gene locus_tag LOCUS_29940 1891 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 2434 3237 gene locus_tag LOCUS_29950 2434 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 3500 5884 gene locus_tag LOCUS_29960 3500 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 6719 5814 gene locus_tag LOCUS_29970 6719 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 >Feature sequence165 115 1260 gene locus_tag LOCUS_29980 115 1260 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224177.1 protein_id gnl|my_center|LOCUS_29980 2760 1345 gene locus_tag LOCUS_29990 2760 1345 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_29990 4119 2953 gene locus_tag LOCUS_30000 4119 2953 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_30000 6131 4119 gene locus_tag LOCUS_30010 6131 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 6438 6220 gene locus_tag LOCUS_30020 6438 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 >Feature sequence166 <1 890 gene locus_tag LOCUS_30030 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107016.1:glycoside hydrolase family 25 protein 1729 1034 gene locus_tag LOCUS_30040 1729 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 1784 2830 gene locus_tag LOCUS_30050 1784 2830 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227082.1 protein_id gnl|my_center|LOCUS_30050 3365 3090 gene locus_tag LOCUS_30060 3365 3090 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776230.1 protein_id gnl|my_center|LOCUS_30060 3913 3365 gene locus_tag LOCUS_30070 3913 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 4290 3910 gene locus_tag LOCUS_30080 4290 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 4378 5385 gene locus_tag LOCUS_30090 4378 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 <6623 5464 gene locus_tag LOCUS_30100 <6623 5464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028809.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence167 964 2745 gene locus_tag LOCUS_30110 gene uidA 964 2745 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945913.1 protein_id gnl|my_center|LOCUS_30110 3850 3101 gene locus_tag LOCUS_30120 3850 3101 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229188.1 protein_id gnl|my_center|LOCUS_30120 4059 5603 gene locus_tag LOCUS_30130 4059 5603 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_30130 5661 6275 gene locus_tag LOCUS_30140 5661 6275 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730704.1 protein_id gnl|my_center|LOCUS_30140 >Feature sequence168 1808 351 gene locus_tag LOCUS_30150 1808 351 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_30150 1914 3239 gene locus_tag LOCUS_30160 1914 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084962.1 protein_id gnl|my_center|LOCUS_30160 4512 3208 gene locus_tag LOCUS_30170 4512 3208 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776070.1 protein_id gnl|my_center|LOCUS_30170 5162 4509 gene locus_tag LOCUS_30180 5162 4509 CDS product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776071.1 protein_id gnl|my_center|LOCUS_30180 5375 5665 gene locus_tag LOCUS_30190 5375 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 6212 5670 gene locus_tag LOCUS_30200 6212 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 >Feature sequence169 2892 1459 gene locus_tag LOCUS_30210 2892 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 3487 3624 gene locus_tag LOCUS_30220 gene rpmH 3487 3624 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400206.1 protein_id gnl|my_center|LOCUS_30220 3673 4071 gene locus_tag LOCUS_30230 gene rnpA 3673 4071 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_30230 4076 4324 gene locus_tag LOCUS_30240 4076 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 4328 5350 gene locus_tag LOCUS_30250 4328 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 5347 5958 gene locus_tag LOCUS_30260 5347 5958 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_30260 >Feature sequence170 <1 615 gene locus_tag LOCUS_30270 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224631.1:gamma-glutamyltransferase 1375 635 gene locus_tag LOCUS_30280 1375 635 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896033.1 protein_id gnl|my_center|LOCUS_30280 1569 2525 gene locus_tag LOCUS_30290 gene iolC 1569 2525 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857138.1 protein_id gnl|my_center|LOCUS_30290 2531 3412 gene locus_tag LOCUS_30300 2531 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857137.1 protein_id gnl|my_center|LOCUS_30300 3409 4359 gene locus_tag LOCUS_30310 gene iolB 3409 4359 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729993.1 protein_id gnl|my_center|LOCUS_30310 >Feature sequence171 1263 1691 gene locus_tag LOCUS_30320 gene mraZ 1263 1691 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_30320 1938 2960 gene locus_tag LOCUS_30330 gene rsmH 1938 2960 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_30330 3043 3648 gene locus_tag LOCUS_30340 3043 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 3780 5501 gene locus_tag LOCUS_30350 gene ftsI 3780 5501 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence172 3 224 gene locus_tag LOCUS_30360 3 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 1243 245 gene locus_tag LOCUS_30370 1243 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 1343 2371 gene locus_tag LOCUS_30380 1343 2371 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729197.1 protein_id gnl|my_center|LOCUS_30380 3062 2382 gene locus_tag LOCUS_30390 3062 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 3210 3392 gene locus_tag LOCUS_30400 3210 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 3385 4815 gene locus_tag LOCUS_30410 3385 4815 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804132.1 protein_id gnl|my_center|LOCUS_30410 5580 4825 gene locus_tag LOCUS_30420 5580 4825 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777030.1 protein_id gnl|my_center|LOCUS_30420 >Feature sequence173 421 1587 gene locus_tag LOCUS_30430 421 1587 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_30430 1670 2779 gene locus_tag LOCUS_30440 1670 2779 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296788.1 protein_id gnl|my_center|LOCUS_30440 2776 5442 gene locus_tag LOCUS_30450 2776 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 <6165 5401 gene locus_tag LOCUS_30460 <6165 5401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243463.1:teichoic acid poly(glycerol phosphate) polymerase >Feature sequence174 2804 1074 gene locus_tag LOCUS_30470 2804 1074 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 protein_id gnl|my_center|LOCUS_30470 2856 4589 gene locus_tag LOCUS_30480 gene argS 2856 4589 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804295.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence175 1450 2232 gene locus_tag LOCUS_30490 gene yaaA 1450 2232 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_30490 3355 2219 gene locus_tag LOCUS_30500 3355 2219 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729720.1 protein_id gnl|my_center|LOCUS_30500 3870 3382 gene locus_tag LOCUS_30510 3870 3382 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 protein_id gnl|my_center|LOCUS_30510 5319 4174 gene locus_tag LOCUS_30520 5319 4174 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110434.1 protein_id gnl|my_center|LOCUS_30520 5790 5863 gene locus_tag LOCUS_t00510 5790 5863 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence176 426 959 gene locus_tag LOCUS_30530 gene rimJ 426 959 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263577.1 protein_id gnl|my_center|LOCUS_30530 1064 2359 gene locus_tag LOCUS_30540 1064 2359 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466963.1 protein_id gnl|my_center|LOCUS_30540 3837 2692 gene locus_tag LOCUS_30550 3837 2692 CDS product long-chain specific acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031182.1 protein_id gnl|my_center|LOCUS_30550 4877 3834 gene locus_tag LOCUS_30560 4877 3834 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031181.1 protein_id gnl|my_center|LOCUS_30560 4969 5640 gene locus_tag LOCUS_30570 gene npdG 4969 5640 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_30570 >Feature sequence177 1467 640 gene locus_tag LOCUS_30580 1467 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30580 1867 1403 gene locus_tag LOCUS_30590 1867 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 2143 2925 gene locus_tag LOCUS_30600 2143 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 3249 4568 gene locus_tag LOCUS_30610 gene aspS 3249 4568 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193209104.1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence178 39 287 gene locus_tag LOCUS_30620 39 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 769 311 gene locus_tag LOCUS_30630 769 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 2580 766 gene locus_tag LOCUS_30640 2580 766 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223921.1 protein_id gnl|my_center|LOCUS_30640 2677 3885 gene locus_tag LOCUS_30650 2677 3885 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_30650 3980 5404 gene locus_tag LOCUS_30660 3980 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 >Feature sequence179 1548 3245 gene locus_tag LOCUS_30670 1548 3245 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525090.1 protein_id gnl|my_center|LOCUS_30670 3974 3276 gene locus_tag LOCUS_30680 3974 3276 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729079.1 protein_id gnl|my_center|LOCUS_30680 4057 4743 gene locus_tag LOCUS_30690 4057 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 5146 4922 gene locus_tag LOCUS_30700 5146 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence180 18 1067 gene locus_tag LOCUS_30710 18 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 2400 1135 gene locus_tag LOCUS_30720 2400 1135 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_30720 2491 4326 gene locus_tag LOCUS_30730 2491 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 5003 4323 gene locus_tag LOCUS_30740 5003 4323 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence181 1136 279 gene locus_tag LOCUS_30750 1136 279 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467152.1 protein_id gnl|my_center|LOCUS_30750 2284 1142 gene locus_tag LOCUS_30760 2284 1142 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_30760 3237 2281 gene locus_tag LOCUS_30770 3237 2281 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929894.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30770 3594 3746 gene locus_tag LOCUS_30780 3594 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3846 4439 gene locus_tag LOCUS_30790 3846 4439 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728478.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence182 143 1447 gene locus_tag LOCUS_30800 143 1447 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080124.1 protein_id gnl|my_center|LOCUS_30800 2139 1537 gene locus_tag LOCUS_30810 2139 1537 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031579.1 protein_id gnl|my_center|LOCUS_30810 2345 2157 gene locus_tag LOCUS_30820 2345 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence183 1758 250 gene locus_tag LOCUS_30830 gene dop 1758 250 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_30830 1881 3353 gene locus_tag LOCUS_30840 1881 3353 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940879.1 protein_id gnl|my_center|LOCUS_30840 3376 3915 gene locus_tag LOCUS_30850 3376 3915 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226727.1 protein_id gnl|my_center|LOCUS_30850 4091 3939 gene locus_tag LOCUS_30860 4091 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 <4998 4138 gene locus_tag LOCUS_30870 <4998 4138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027900.1:proteasome ATPase >Feature sequence184 1585 224 gene locus_tag LOCUS_30880 1585 224 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 protein_id gnl|my_center|LOCUS_30880 2777 1866 gene locus_tag LOCUS_30890 2777 1866 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226439.1 protein_id gnl|my_center|LOCUS_30890 3283 2822 gene locus_tag LOCUS_30900 3283 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 4124 3267 gene locus_tag LOCUS_30910 gene hisG 4124 3267 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_30910 4440 4177 gene locus_tag LOCUS_30920 4440 4177 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054261.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence185 <1 1246 gene locus_tag LOCUS_30930 <1 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030027.1:exodeoxyribonuclease VII large subunit 1239 1493 gene locus_tag LOCUS_30940 1239 1493 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030026.1 protein_id gnl|my_center|LOCUS_30940 2168 1497 gene locus_tag LOCUS_30950 2168 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 2097 3356 gene locus_tag LOCUS_30960 2097 3356 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 protein_id gnl|my_center|LOCUS_30960 4351 3365 gene locus_tag LOCUS_30970 4351 3365 CDS product TIGR03557 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227034.1 protein_id gnl|my_center|LOCUS_30970 >Feature sequence186 499 2487 gene locus_tag LOCUS_30980 gene uvrC 499 2487 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 protein_id gnl|my_center|LOCUS_30980 2487 3401 gene locus_tag LOCUS_30990 gene rapZ 2487 3401 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_30990 3401 4405 gene locus_tag LOCUS_31000 gene yvcK 3401 4405 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_31000 >Feature sequence187 448 1269 gene locus_tag LOCUS_31010 448 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 1266 2477 gene locus_tag LOCUS_31020 1266 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 2474 3589 gene locus_tag LOCUS_31030 2474 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 4625 4455 gene locus_tag LOCUS_31040 4625 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 >Feature sequence188 1303 1037 gene locus_tag LOCUS_31050 1303 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 1461 1727 gene locus_tag LOCUS_31060 1461 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 1755 2123 gene locus_tag LOCUS_31070 gene rnpA 1755 2123 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_31070 2120 2374 gene locus_tag LOCUS_31080 gene yidD 2120 2374 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_31080 2375 3466 gene locus_tag LOCUS_31090 2375 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 3557 4213 gene locus_tag LOCUS_31100 3557 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 >Feature sequence189 575 315 gene locus_tag LOCUS_31110 575 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 576 1415 gene locus_tag LOCUS_31120 576 1415 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226059.1 protein_id gnl|my_center|LOCUS_31120 1948 1682 gene locus_tag LOCUS_31130 1948 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 2224 1973 gene locus_tag LOCUS_31140 2224 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 2980 2423 gene locus_tag LOCUS_31150 2980 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31150 3180 2899 gene locus_tag LOCUS_31160 3180 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31160 3941 3177 gene locus_tag LOCUS_31170 3941 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 4251 3991 gene locus_tag LOCUS_31180 4251 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 >Feature sequence190 1646 366 gene locus_tag LOCUS_31190 1646 366 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229159.1 protein_id gnl|my_center|LOCUS_31190 2128 2796 gene locus_tag LOCUS_31200 2128 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 3708 2845 gene locus_tag LOCUS_31210 gene rfbA 3708 2845 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062166.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence191 178 1008 gene locus_tag LOCUS_31220 gene prcB 178 1008 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_31220 1055 1912 gene locus_tag LOCUS_31230 gene prcA 1055 1912 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_31230 2088 3725 gene locus_tag LOCUS_31240 2088 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 >Feature sequence192 653 2623 gene locus_tag LOCUS_31250 653 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 3556 2741 gene locus_tag LOCUS_31260 3556 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 4111 3689 gene locus_tag LOCUS_31270 4111 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 >Feature sequence193 <1 1161 gene locus_tag LOCUS_31280 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029287.1:chromosomal replication initiator protein DnaA 1592 2740 gene locus_tag LOCUS_31290 gene dnaN 1592 2740 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_31290 2849 3754 gene locus_tag LOCUS_31300 gene gnd 2849 3754 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence194 178 873 gene locus_tag LOCUS_31310 178 873 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_31310 1215 946 gene locus_tag LOCUS_31320 1215 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 2074 1583 gene locus_tag LOCUS_31330 2074 1583 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226980.1 protein_id gnl|my_center|LOCUS_31330 2619 2194 gene locus_tag LOCUS_31340 2619 2194 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088783.1 protein_id gnl|my_center|LOCUS_31340 <4080 2616 gene locus_tag LOCUS_31350 <4080 2616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877772.1:malate synthase G >Feature sequence195 1560 202 gene locus_tag LOCUS_31360 1560 202 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728383.1 protein_id gnl|my_center|LOCUS_31360 3059 1587 gene locus_tag LOCUS_31370 3059 1587 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897068.1 protein_id gnl|my_center|LOCUS_31370 4031 3087 gene locus_tag LOCUS_31380 gene speB 4031 3087 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_31380 >Feature sequence196 976 2097 gene locus_tag LOCUS_31390 976 2097 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056552.1 protein_id gnl|my_center|LOCUS_31390 2388 2969 gene locus_tag LOCUS_31400 2388 2969 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 protein_id gnl|my_center|LOCUS_31400 <4058 3008 gene locus_tag LOCUS_31410 <4058 3008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005118518.1:MFS transporter >Feature sequence197 <1 770 gene locus_tag LOCUS_31420 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776549.1:NUDIX hydrolase 2509 842 gene locus_tag LOCUS_31430 2509 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 2831 3730 gene locus_tag LOCUS_31440 2831 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 >Feature sequence198 2308 599 gene locus_tag LOCUS_31450 2308 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 2940 2308 gene locus_tag LOCUS_31460 2940 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 3695 3009 gene locus_tag LOCUS_31470 3695 3009 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_31470 >Feature sequence199 347 141 gene locus_tag LOCUS_31480 347 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 1149 826 gene locus_tag LOCUS_31490 1149 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 1144 1941 gene locus_tag LOCUS_31500 1144 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 3739 2093 gene locus_tag LOCUS_31510 3739 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 3904 3746 gene locus_tag LOCUS_31520 3904 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence200 <1 1634 gene locus_tag LOCUS_31530 <1 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726854.1:biotin carboxylase N-terminal domain-containing protein 1720 2520 gene locus_tag LOCUS_31540 1720 2520 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110556.1 protein_id gnl|my_center|LOCUS_31540 >Feature sequence201 1517 354 gene locus_tag LOCUS_31550 1517 354 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191279629.1 protein_id gnl|my_center|LOCUS_31550 2669 1554 gene locus_tag LOCUS_31560 2669 1554 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950854.1 protein_id gnl|my_center|LOCUS_31560 >Feature sequence202 1040 294 gene locus_tag LOCUS_31570 1040 294 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230235.1 protein_id gnl|my_center|LOCUS_31570 1202 2524 gene locus_tag LOCUS_31580 1202 2524 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666804.1 protein_id gnl|my_center|LOCUS_31580 3124 2555 gene locus_tag LOCUS_31590 3124 2555 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence203 66 419 gene locus_tag LOCUS_31600 66 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 736 1584 gene locus_tag LOCUS_31610 736 1584 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730790.1 protein_id gnl|my_center|LOCUS_31610 1584 1880 gene locus_tag LOCUS_31620 1584 1880 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974805.1 protein_id gnl|my_center|LOCUS_31620 <3617 1965 gene locus_tag LOCUS_31630 <3617 1965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030059.1:SpoIIE family protein phosphatase >Feature sequence204 2357 171 gene locus_tag LOCUS_31640 2357 171 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878283.1 protein_id gnl|my_center|LOCUS_31640 2883 2425 gene locus_tag LOCUS_31650 2883 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 3005 3376 gene locus_tag LOCUS_31660 3005 3376 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061701.1 protein_id gnl|my_center|LOCUS_31660 >Feature sequence205 101 973 gene locus_tag LOCUS_31670 101 973 CDS product DNA-3-methyladenine glycosylase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139979125.1 protein_id gnl|my_center|LOCUS_31670 1361 918 gene locus_tag LOCUS_31680 1361 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 2740 1358 gene locus_tag LOCUS_31690 2740 1358 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_31690 2997 2743 gene locus_tag LOCUS_31700 2997 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 >Feature sequence206 866 1519 gene locus_tag LOCUS_31710 866 1519 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229800.1 protein_id gnl|my_center|LOCUS_31710 2585 1506 gene locus_tag LOCUS_31720 2585 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 3409 2603 gene locus_tag LOCUS_31730 3409 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31730 >Feature sequence207 418 1338 gene locus_tag LOCUS_31740 418 1338 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_31740 1760 3265 gene locus_tag LOCUS_31750 1760 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 >Feature sequence208 1660 533 gene locus_tag LOCUS_31760 gene dusB 1660 533 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_31760 2385 1852 gene locus_tag LOCUS_31770 2385 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 <3364 2573 gene locus_tag LOCUS_31780 <3364 2573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228379.1:glycine--tRNA ligase >Feature sequence209 <1 1468 gene locus_tag LOCUS_31790 <1 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030150.1:multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit 1481 1660 gene locus_tag LOCUS_31800 1481 1660 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_31800 3225 2257 gene locus_tag LOCUS_31810 3225 2257 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_31810 >Feature sequence210 <1 566 gene locus_tag LOCUS_31820 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973239.1:HAMP domain-containing sensor histidine kinase 1263 640 gene locus_tag LOCUS_31830 1263 640 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223072.1 protein_id gnl|my_center|LOCUS_31830 1927 1370 gene locus_tag LOCUS_31840 1927 1370 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_31840 <3290 1944 gene locus_tag LOCUS_31850 <3290 1944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227831.1:argininosuccinate lyase >Feature sequence211 271 993 gene locus_tag LOCUS_31860 271 993 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705159.1 protein_id gnl|my_center|LOCUS_31860 997 2175 gene locus_tag LOCUS_31870 997 2175 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978505.1 protein_id gnl|my_center|LOCUS_31870 >Feature sequence212 1111 479 gene locus_tag LOCUS_31880 1111 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 2402 1410 gene locus_tag LOCUS_31890 2402 1410 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013444.1 protein_id gnl|my_center|LOCUS_31890 <3240 2438 gene locus_tag LOCUS_31900 <3240 2438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013443.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence213 303 788 gene locus_tag LOCUS_31910 303 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 2794 1064 gene locus_tag LOCUS_31920 2794 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 >Feature sequence214 74 2038 gene locus_tag LOCUS_31930 74 2038 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223197.1 protein_id gnl|my_center|LOCUS_31930 2792 2184 gene locus_tag LOCUS_31940 2792 2184 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858634.1 protein_id gnl|my_center|LOCUS_31940 >Feature sequence215 <1 1249 gene locus_tag LOCUS_31950 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222413.1:molybdopterin-dependent oxidoreductase 1946 1236 gene locus_tag LOCUS_31960 1946 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 2569 2057 gene locus_tag LOCUS_31970 2569 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 >Feature sequence216 648 1451 gene locus_tag LOCUS_31980 648 1451 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_31980 2578 1367 gene locus_tag LOCUS_31990 2578 1367 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898354.1 protein_id gnl|my_center|LOCUS_31990 >Feature sequence217 1343 540 gene locus_tag LOCUS_32000 1343 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 <2356 1472 gene locus_tag LOCUS_32010 <2356 1472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389586.1:MoxR family ATPase >Feature sequence218 <2315 1226 gene locus_tag LOCUS_32020 <2315 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728197.1:CoA transferase >Feature sequence219 690 1451 gene locus_tag LOCUS_32030 690 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 >Feature sequence220 673 11 gene locus_tag LOCUS_32040 673 11 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776448.1 protein_id gnl|my_center|LOCUS_32040 1177 743 gene locus_tag LOCUS_32050 1177 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973287.1 protein_id gnl|my_center|LOCUS_32050 1939 1181 gene locus_tag LOCUS_32060 gene dapB 1939 1181 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081787.1 protein_id gnl|my_center|LOCUS_32060 >Feature sequence221 1242 691 gene locus_tag LOCUS_32070 1242 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070