>Feature sequence1 1545 1695 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2872 3022 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3411 3561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6023 4746 gene locus_tag LOCUS_00010 6023 4746 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021469.1 protein_id gnl|my_center|LOCUS_00010 7536 6250 gene locus_tag LOCUS_00020 7536 6250 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318432.1 protein_id gnl|my_center|LOCUS_00020 8192 7605 gene locus_tag LOCUS_00030 8192 7605 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_00030 8554 9744 gene locus_tag LOCUS_00040 8554 9744 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020662.1 protein_id gnl|my_center|LOCUS_00040 9755 11101 gene locus_tag LOCUS_00050 9755 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 11098 13089 gene locus_tag LOCUS_00060 gene hdrA 11098 13089 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_00060 13816 13100 gene locus_tag LOCUS_00070 13816 13100 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_00070 14656 13835 gene locus_tag LOCUS_00080 14656 13835 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_00080 15510 14653 gene locus_tag LOCUS_00090 15510 14653 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_00090 15983 15564 gene locus_tag LOCUS_00100 15983 15564 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878788.1 protein_id gnl|my_center|LOCUS_00100 17312 16116 gene locus_tag LOCUS_00110 17312 16116 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878787.1 protein_id gnl|my_center|LOCUS_00110 17577 17419 gene locus_tag LOCUS_00120 17577 17419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 18026 17625 gene locus_tag LOCUS_00130 18026 17625 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021394.1 protein_id gnl|my_center|LOCUS_00130 20299 18179 gene locus_tag LOCUS_00140 gene hdrA 20299 18179 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_00140 21995 20325 gene locus_tag LOCUS_00150 21995 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 23639 22197 gene locus_tag LOCUS_00160 gene aspS 23639 22197 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_00160 24154 23771 gene locus_tag LOCUS_00170 24154 23771 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868249.1 protein_id gnl|my_center|LOCUS_00170 25109 24285 gene locus_tag LOCUS_00180 25109 24285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 25171 26052 gene locus_tag LOCUS_00190 25171 26052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 26200 27054 gene locus_tag LOCUS_00200 26200 27054 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878217.1 protein_id gnl|my_center|LOCUS_00200 27151 27762 gene locus_tag LOCUS_00210 27151 27762 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_00210 27755 27958 gene locus_tag LOCUS_00220 27755 27958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 28107 28472 gene locus_tag LOCUS_00230 28107 28472 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 protein_id gnl|my_center|LOCUS_00230 28438 29511 gene locus_tag LOCUS_00240 gene twy1 28438 29511 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020099.1 protein_id gnl|my_center|LOCUS_00240 29874 29545 gene locus_tag LOCUS_00250 29874 29545 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064407.1 protein_id gnl|my_center|LOCUS_00250 31319 29934 gene locus_tag LOCUS_00260 31319 29934 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598734.1 protein_id gnl|my_center|LOCUS_00260 31386 31459 gene locus_tag LOCUS_t00010 31386 31459 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 31709 32746 gene locus_tag LOCUS_00270 31709 32746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32753 32905 gene locus_tag LOCUS_00280 32753 32905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33059 33901 gene locus_tag LOCUS_00290 33059 33901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 33980 34762 gene locus_tag LOCUS_00300 33980 34762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36416 34923 gene locus_tag LOCUS_00310 gene lysS 36416 34923 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066108.1 protein_id gnl|my_center|LOCUS_00310 37474 36470 gene locus_tag LOCUS_00320 37474 36470 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024123.1 protein_id gnl|my_center|LOCUS_00320 38467 37529 gene locus_tag LOCUS_00330 38467 37529 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_00330 38981 38550 gene locus_tag LOCUS_00340 38981 38550 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064575.1 protein_id gnl|my_center|LOCUS_00340 39471 38998 gene locus_tag LOCUS_00350 39471 38998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 39842 39468 gene locus_tag LOCUS_00360 39842 39468 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392925.1 protein_id gnl|my_center|LOCUS_00360 40262 39927 gene locus_tag LOCUS_00370 40262 39927 CDS product DUF5320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879879.1 protein_id gnl|my_center|LOCUS_00370 40567 40409 gene locus_tag LOCUS_00380 40567 40409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 41031 40849 gene locus_tag LOCUS_00390 41031 40849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41148 41792 gene locus_tag LOCUS_00400 41148 41792 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060730.1 protein_id gnl|my_center|LOCUS_00400 42503 41784 gene locus_tag LOCUS_00410 42503 41784 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879510.1 protein_id gnl|my_center|LOCUS_00410 43492 42623 gene locus_tag LOCUS_00420 gene hisG 43492 42623 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_00420 43605 44804 gene locus_tag LOCUS_00430 gene priS 43605 44804 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_00430 45132 46010 gene locus_tag LOCUS_00440 45132 46010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00440 46307 47191 gene locus_tag LOCUS_00450 46307 47191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 47288 47497 gene locus_tag LOCUS_00460 47288 47497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 47620 47796 gene locus_tag LOCUS_00470 47620 47796 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250050.1 protein_id gnl|my_center|LOCUS_00470 47892 48701 gene locus_tag LOCUS_00480 47892 48701 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_00480 49328 48741 gene locus_tag LOCUS_00490 49328 48741 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879016.1 protein_id gnl|my_center|LOCUS_00490 50102 49461 gene locus_tag LOCUS_00500 50102 49461 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878334.1 protein_id gnl|my_center|LOCUS_00500 50520 50122 gene locus_tag LOCUS_00510 50520 50122 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_00510 51307 50621 gene locus_tag LOCUS_00520 51307 50621 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_00520 52758 51337 gene locus_tag LOCUS_00530 52758 51337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 52842 53225 gene locus_tag LOCUS_00540 52842 53225 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878647.1 protein_id gnl|my_center|LOCUS_00540 53720 55231 gene locus_tag LOCUS_00550 53720 55231 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_00550 55472 56737 gene locus_tag LOCUS_00560 55472 56737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 56740 57267 gene locus_tag LOCUS_00570 56740 57267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 57607 57936 gene locus_tag LOCUS_00580 57607 57936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 58322 59122 gene locus_tag LOCUS_00590 gene frhB 58322 59122 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496371.1 protein_id gnl|my_center|LOCUS_00590 59124 60725 gene locus_tag LOCUS_00600 59124 60725 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546886.1 protein_id gnl|my_center|LOCUS_00600 60959 60777 gene locus_tag LOCUS_00610 60959 60777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 61165 61716 gene locus_tag LOCUS_00620 61165 61716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 61761 62963 gene locus_tag LOCUS_00630 gene ftsY 61761 62963 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024000.1 protein_id gnl|my_center|LOCUS_00630 63025 63606 gene locus_tag LOCUS_00640 63025 63606 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020740.1 protein_id gnl|my_center|LOCUS_00640 64412 63660 gene locus_tag LOCUS_00650 64412 63660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 64665 64432 gene locus_tag LOCUS_00660 64665 64432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 66326 64662 gene locus_tag LOCUS_00670 66326 64662 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869499.1 protein_id gnl|my_center|LOCUS_00670 67651 66431 gene locus_tag LOCUS_00680 67651 66431 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_00680 67992 67759 gene locus_tag LOCUS_00690 67992 67759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 68528 67977 gene locus_tag LOCUS_00700 68528 67977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 68924 68580 gene locus_tag LOCUS_00710 68924 68580 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_00710 69031 70395 gene locus_tag LOCUS_00720 gene pscS 69031 70395 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966499.1 protein_id gnl|my_center|LOCUS_00720 70409 71554 gene locus_tag LOCUS_00730 70409 71554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 71931 71536 gene locus_tag LOCUS_00740 71931 71536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 72007 72918 gene locus_tag LOCUS_00750 72007 72918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875877.1 protein_id gnl|my_center|LOCUS_00750 76419 72928 gene locus_tag LOCUS_00760 76419 72928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 76589 77224 gene locus_tag LOCUS_00770 76589 77224 CDS product DUF2119 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870002.1 protein_id gnl|my_center|LOCUS_00770 78276 77200 gene locus_tag LOCUS_00780 78276 77200 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877877.1 protein_id gnl|my_center|LOCUS_00780 78332 79420 gene locus_tag LOCUS_00790 78332 79420 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_00790 79417 79968 gene locus_tag LOCUS_00800 79417 79968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 79940 80410 gene locus_tag LOCUS_00810 79940 80410 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_00810 80420 80707 gene locus_tag LOCUS_00820 80420 80707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 81742 80756 gene locus_tag LOCUS_00830 81742 80756 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_00830 82728 81814 gene locus_tag LOCUS_00840 gene cofD 82728 81814 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878417.1 protein_id gnl|my_center|LOCUS_00840 83801 82725 gene locus_tag LOCUS_00850 83801 82725 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_00850 83920 85800 gene locus_tag LOCUS_00860 83920 85800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 85951 86235 gene locus_tag LOCUS_00870 85951 86235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 86348 86923 gene locus_tag LOCUS_00880 86348 86923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 88444 87065 gene locus_tag LOCUS_00890 88444 87065 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_00890 90159 88504 gene locus_tag LOCUS_00900 gene thsB 90159 88504 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_00900 90968 90528 gene locus_tag LOCUS_00910 90968 90528 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_00910 91636 91067 gene locus_tag LOCUS_00920 91636 91067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 92166 91633 gene locus_tag LOCUS_00930 92166 91633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00930 92408 92163 gene locus_tag LOCUS_00940 92408 92163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 93027 92509 gene locus_tag LOCUS_00950 93027 92509 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_00950 93442 93113 gene locus_tag LOCUS_00960 gene mnhG 93442 93113 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249571.1 protein_id gnl|my_center|LOCUS_00960 93717 93439 gene locus_tag LOCUS_00970 93717 93439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 93896 94489 gene locus_tag LOCUS_00980 93896 94489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249130.1 protein_id gnl|my_center|LOCUS_00980 99942 94612 gene locus_tag LOCUS_00990 99942 94612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 100606 100202 gene locus_tag LOCUS_01000 100606 100202 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229002.1 protein_id gnl|my_center|LOCUS_01000 100983 100603 gene locus_tag LOCUS_01010 100983 100603 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249913.1 protein_id gnl|my_center|LOCUS_01010 101579 101007 gene locus_tag LOCUS_01020 101579 101007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01020 104411 101715 gene locus_tag LOCUS_01030 gene rad50 104411 101715 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251161.1 protein_id gnl|my_center|LOCUS_01030 105749 104505 gene locus_tag LOCUS_01040 105749 104505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 107508 105862 gene locus_tag LOCUS_01050 107508 105862 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583972.1 protein_id gnl|my_center|LOCUS_01050 109080 107794 gene locus_tag LOCUS_01060 109080 107794 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583971.1 protein_id gnl|my_center|LOCUS_01060 109130 110134 gene locus_tag LOCUS_01070 109130 110134 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_01070 110183 111079 gene locus_tag LOCUS_01080 110183 111079 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 protein_id gnl|my_center|LOCUS_01080 111363 111151 gene locus_tag LOCUS_01090 111363 111151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 112368 111427 gene locus_tag LOCUS_01100 gene ilvE 112368 111427 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_01100 112479 113345 gene locus_tag LOCUS_01110 gene purQ 112479 113345 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_01110 114822 113335 gene locus_tag LOCUS_01120 114822 113335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 114917 115501 gene locus_tag LOCUS_01130 114917 115501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 115694 118618 gene locus_tag LOCUS_01140 115694 118618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 118655 119470 gene locus_tag LOCUS_01150 gene truA 118655 119470 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064445.1 protein_id gnl|my_center|LOCUS_01150 120372 119479 gene locus_tag LOCUS_01160 gene dapA 120372 119479 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_01160 120703 120470 gene locus_tag LOCUS_01170 120703 120470 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878411.1 protein_id gnl|my_center|LOCUS_01170 120963 120733 gene locus_tag LOCUS_01180 120963 120733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 121536 121078 gene locus_tag LOCUS_01190 121536 121078 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869527.1 protein_id gnl|my_center|LOCUS_01190 122461 121928 gene locus_tag LOCUS_01200 122461 121928 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393700.1 protein_id gnl|my_center|LOCUS_01200 123979 122666 gene locus_tag LOCUS_01210 123979 122666 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_01210 124134 124499 gene locus_tag LOCUS_01220 gene rplX 124134 124499 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869967.1 protein_id gnl|my_center|LOCUS_01220 125143 124517 gene locus_tag LOCUS_01230 125143 124517 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870283.1 protein_id gnl|my_center|LOCUS_01230 125670 125116 gene locus_tag LOCUS_01240 125670 125116 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066543.1 protein_id gnl|my_center|LOCUS_01240 125808 127046 gene locus_tag LOCUS_01250 125808 127046 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_01250 127072 128343 gene locus_tag LOCUS_01260 127072 128343 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879688.1 protein_id gnl|my_center|LOCUS_01260 129193 128381 gene locus_tag LOCUS_01270 129193 128381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 129891 129821 gene locus_tag LOCUS_t00020 129891 129821 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 130537 129926 gene locus_tag LOCUS_01280 130537 129926 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_01280 132110 130632 gene locus_tag LOCUS_01290 132110 130632 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870510.1 protein_id gnl|my_center|LOCUS_01290 132259 132332 gene locus_tag LOCUS_t00030 132259 132332 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 132347 132844 gene locus_tag LOCUS_01300 132347 132844 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_01300 132882 133754 gene locus_tag LOCUS_01310 gene pheA 132882 133754 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066451.1 protein_id gnl|my_center|LOCUS_01310 133904 134815 gene locus_tag LOCUS_01320 133904 134815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 135618 135028 gene locus_tag LOCUS_01330 gene yjjX 135618 135028 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250698.1 protein_id gnl|my_center|LOCUS_01330 135690 136019 gene locus_tag LOCUS_01340 135690 136019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 136181 136486 gene locus_tag LOCUS_01350 136181 136486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 136501 136770 gene locus_tag LOCUS_01360 136501 136770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 136712 137788 gene locus_tag LOCUS_01370 136712 137788 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064863.1 protein_id gnl|my_center|LOCUS_01370 138659 137739 gene locus_tag LOCUS_01380 138659 137739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 138781 139053 gene locus_tag LOCUS_01390 138781 139053 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_01390 139108 140445 gene locus_tag LOCUS_01400 139108 140445 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878861.1 protein_id gnl|my_center|LOCUS_01400 140521 141582 gene locus_tag LOCUS_01410 gene thiL 140521 141582 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_01410 143328 141607 gene locus_tag LOCUS_01420 143328 141607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 144561 143410 gene locus_tag LOCUS_01430 144561 143410 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867980.1 protein_id gnl|my_center|LOCUS_01430 145722 144712 gene locus_tag LOCUS_01440 145722 144712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 145911 145765 gene locus_tag LOCUS_01450 145911 145765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 146082 145954 gene locus_tag LOCUS_01460 146082 145954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 146292 146140 gene locus_tag LOCUS_01470 146292 146140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01470 146590 146279 gene locus_tag LOCUS_01480 146590 146279 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066199.1 protein_id gnl|my_center|LOCUS_01480 146991 146662 gene locus_tag LOCUS_01490 146991 146662 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582723.1 protein_id gnl|my_center|LOCUS_01490 147508 147101 gene locus_tag LOCUS_01500 147508 147101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 147747 147505 gene locus_tag LOCUS_01510 147747 147505 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250027.1 protein_id gnl|my_center|LOCUS_01510 148018 147800 gene locus_tag LOCUS_01520 148018 147800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 148454 148038 gene locus_tag LOCUS_01530 148454 148038 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248971.1 protein_id gnl|my_center|LOCUS_01530 148687 148451 gene locus_tag LOCUS_01540 148687 148451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 151061 148836 gene locus_tag LOCUS_01550 151061 148836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 152638 151058 gene locus_tag LOCUS_01560 152638 151058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 152879 152751 gene locus_tag LOCUS_01570 152879 152751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 153873 153055 gene locus_tag LOCUS_01580 153873 153055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 154108 153875 gene locus_tag LOCUS_01590 154108 153875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 155733 154108 gene locus_tag LOCUS_01600 155733 154108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 156303 155764 gene locus_tag LOCUS_01610 156303 155764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 157478 156429 gene locus_tag LOCUS_01620 157478 156429 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020113.1 protein_id gnl|my_center|LOCUS_01620 157522 159576 gene locus_tag LOCUS_01630 157522 159576 CDS product IGHMBP2 family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838098.1 protein_id gnl|my_center|LOCUS_01630 159813 165407 gene locus_tag LOCUS_01640 159813 165407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 165421 166320 gene locus_tag LOCUS_01650 165421 166320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 166597 166364 gene locus_tag LOCUS_01660 166597 166364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 166653 166928 gene locus_tag LOCUS_01670 166653 166928 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_01670 167644 166925 gene locus_tag LOCUS_01680 167644 166925 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_01680 168277 167675 gene locus_tag LOCUS_01690 168277 167675 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_01690 168446 168361 gene locus_tag LOCUS_t00040 168446 168361 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 168737 168498 gene locus_tag LOCUS_01700 168737 168498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 169138 168740 gene locus_tag LOCUS_01710 gene rpl14p 169138 168740 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879408.1 protein_id gnl|my_center|LOCUS_01710 169652 169278 gene locus_tag LOCUS_01720 169652 169278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 170669 169830 gene locus_tag LOCUS_01730 170669 169830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 170813 171868 gene locus_tag LOCUS_01740 gene wtpA 170813 171868 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020338.1 protein_id gnl|my_center|LOCUS_01740 171913 172728 gene locus_tag LOCUS_01750 171913 172728 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020339.1 protein_id gnl|my_center|LOCUS_01750 172753 173961 gene locus_tag LOCUS_01760 gene wtpC 172753 173961 CDS product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_01760 173999 174073 gene locus_tag LOCUS_t00050 173999 174073 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 174180 174569 gene locus_tag LOCUS_01770 174180 174569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 174649 175863 gene locus_tag LOCUS_01780 174649 175863 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082727.1 protein_id gnl|my_center|LOCUS_01780 176131 177252 gene locus_tag LOCUS_01790 gene rtcA 176131 177252 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_01790 177366 178748 gene locus_tag LOCUS_01800 gene gatD 177366 178748 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_01800 181052 178866 gene locus_tag LOCUS_01810 181052 178866 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879387.1 protein_id gnl|my_center|LOCUS_01810 182427 181204 gene locus_tag LOCUS_01820 gene hmgA 182427 181204 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146539.1 protein_id gnl|my_center|LOCUS_01820 183548 182445 gene locus_tag LOCUS_01830 gene hisC 183548 182445 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879516.1 protein_id gnl|my_center|LOCUS_01830 183901 183584 gene locus_tag LOCUS_01840 183901 183584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878292.1 protein_id gnl|my_center|LOCUS_01840 185466 183973 gene locus_tag LOCUS_01850 gene glnA 185466 183973 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318802.1 protein_id gnl|my_center|LOCUS_01850 186465 185695 gene locus_tag LOCUS_01860 186465 185695 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061072.1 protein_id gnl|my_center|LOCUS_01860 186642 188297 gene locus_tag LOCUS_01870 gene guaA 186642 188297 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880099.1 protein_id gnl|my_center|LOCUS_01870 188367 189401 gene locus_tag LOCUS_01880 gene pdxS 188367 189401 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878015.1 protein_id gnl|my_center|LOCUS_01880 189398 190054 gene locus_tag LOCUS_01890 gene pdxT 189398 190054 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878016.1 protein_id gnl|my_center|LOCUS_01890 190706 190077 gene locus_tag LOCUS_01900 190706 190077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 191224 190703 gene locus_tag LOCUS_01910 191224 190703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 192240 191377 gene locus_tag LOCUS_01920 gene ahbD 192240 191377 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_01920 192368 192237 gene locus_tag LOCUS_01930 192368 192237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 192538 193248 gene locus_tag LOCUS_01940 192538 193248 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877867.1 protein_id gnl|my_center|LOCUS_01940 193979 193590 gene locus_tag LOCUS_01950 193979 193590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 194974 194162 gene locus_tag LOCUS_01960 194974 194162 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_01960 195046 198471 gene locus_tag LOCUS_01970 195046 198471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 199605 198472 gene locus_tag LOCUS_01980 199605 198472 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870394.1 protein_id gnl|my_center|LOCUS_01980 199732 200283 gene locus_tag LOCUS_01990 199732 200283 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_01990 200815 200321 gene locus_tag LOCUS_02000 200815 200321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 202541 200916 gene locus_tag LOCUS_02010 202541 200916 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969265.1 protein_id gnl|my_center|LOCUS_02010 204167 202542 gene locus_tag LOCUS_02020 204167 202542 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_02020 206303 204465 gene locus_tag LOCUS_02030 206303 204465 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396787.1 protein_id gnl|my_center|LOCUS_02030 206487 206296 gene locus_tag LOCUS_02040 206487 206296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 207121 206666 gene locus_tag LOCUS_02050 207121 206666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 207552 207118 gene locus_tag LOCUS_02060 207552 207118 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_02060 208750 207566 gene locus_tag LOCUS_02070 208750 207566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 211042 209192 gene locus_tag LOCUS_02080 211042 209192 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967805.1 protein_id gnl|my_center|LOCUS_02080 211301 211062 gene locus_tag LOCUS_02090 211301 211062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 211657 211346 gene locus_tag LOCUS_02100 211657 211346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 213017 211785 gene locus_tag LOCUS_02110 213017 211785 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064535.1 protein_id gnl|my_center|LOCUS_02110 213486 213061 gene locus_tag LOCUS_02120 213486 213061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 214946 213576 gene locus_tag LOCUS_02130 214946 213576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 215730 214996 gene locus_tag LOCUS_02140 215730 214996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 216272 215769 gene locus_tag LOCUS_02150 216272 215769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 216595 216269 gene locus_tag LOCUS_02160 216595 216269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 216786 216580 gene locus_tag LOCUS_02170 216786 216580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 217135 216965 gene locus_tag LOCUS_02180 217135 216965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 217673 217215 gene locus_tag LOCUS_02190 217673 217215 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879882.1 protein_id gnl|my_center|LOCUS_02190 217760 219631 gene locus_tag LOCUS_02200 gene infB 217760 219631 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878271.1 protein_id gnl|my_center|LOCUS_02200 219664 220083 gene locus_tag LOCUS_02210 219664 220083 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878018.1 protein_id gnl|my_center|LOCUS_02210 220019 220186 gene locus_tag LOCUS_02220 220019 220186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 220795 220310 gene locus_tag LOCUS_02230 220795 220310 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_02230 222125 221016 gene locus_tag LOCUS_02240 222125 221016 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_02240 222979 222182 gene locus_tag LOCUS_02250 222979 222182 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_02250 224483 223161 gene locus_tag LOCUS_02260 224483 223161 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870834.1 protein_id gnl|my_center|LOCUS_02260 224536 225285 gene locus_tag LOCUS_02270 224536 225285 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_02270 225385 226602 gene locus_tag LOCUS_02280 gene trpB 225385 226602 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496708.1 protein_id gnl|my_center|LOCUS_02280 226599 227570 gene locus_tag LOCUS_02290 226599 227570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 227574 228983 gene locus_tag LOCUS_02300 227574 228983 CDS product lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679156.1 protein_id gnl|my_center|LOCUS_02300 230430 229084 gene locus_tag LOCUS_02310 230430 229084 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_02310 231321 230506 gene locus_tag LOCUS_02320 231321 230506 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477179.1 protein_id gnl|my_center|LOCUS_02320 231471 231881 gene locus_tag LOCUS_02330 231471 231881 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_02330 231951 233198 gene locus_tag LOCUS_02340 231951 233198 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250137.1 protein_id gnl|my_center|LOCUS_02340 233356 234216 gene locus_tag LOCUS_02350 233356 234216 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925142.1 protein_id gnl|my_center|LOCUS_02350 235243 234260 gene locus_tag LOCUS_02360 gene cofG 235243 234260 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878300.1 protein_id gnl|my_center|LOCUS_02360 235271 236224 gene locus_tag LOCUS_02370 235271 236224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 237813 236278 gene locus_tag LOCUS_02380 237813 236278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 238302 237913 gene locus_tag LOCUS_02390 238302 237913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 239418 238330 gene locus_tag LOCUS_02400 239418 238330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 239686 240435 gene locus_tag LOCUS_02410 gene aroD 239686 240435 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_02410 240863 240453 gene locus_tag LOCUS_02420 240863 240453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 240922 241443 gene locus_tag LOCUS_02430 240922 241443 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146480.1 protein_id gnl|my_center|LOCUS_02430 241465 242847 gene locus_tag LOCUS_02440 gene thiD 241465 242847 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023132.1 protein_id gnl|my_center|LOCUS_02440 243011 243622 gene locus_tag LOCUS_02450 243011 243622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 243630 244811 gene locus_tag LOCUS_02460 243630 244811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 244816 246024 gene locus_tag LOCUS_02470 244816 246024 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860356.1 protein_id gnl|my_center|LOCUS_02470 246041 247162 gene locus_tag LOCUS_02480 246041 247162 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_02480 247743 247126 gene locus_tag LOCUS_02490 247743 247126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545105.1 protein_id gnl|my_center|LOCUS_02490 248542 247997 gene locus_tag LOCUS_02500 248542 247997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 249126 248548 gene locus_tag LOCUS_02510 gene hisB 249126 248548 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 protein_id gnl|my_center|LOCUS_02510 250815 249172 gene locus_tag LOCUS_02520 250815 249172 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020198.1 protein_id gnl|my_center|LOCUS_02520 251462 250884 gene locus_tag LOCUS_02530 251462 250884 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868022.1 protein_id gnl|my_center|LOCUS_02530 252407 251541 gene locus_tag LOCUS_02540 252407 251541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 252775 253293 gene locus_tag LOCUS_02550 252775 253293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 253461 253982 gene locus_tag LOCUS_02560 253461 253982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 255229 254033 gene locus_tag LOCUS_02570 255229 254033 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_02570 255819 255316 gene locus_tag LOCUS_02580 255819 255316 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_02580 257452 255860 gene locus_tag LOCUS_02590 gene serS 257452 255860 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870589.1 protein_id gnl|my_center|LOCUS_02590 258213 257449 gene locus_tag LOCUS_02600 258213 257449 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_02600 258336 259424 gene locus_tag LOCUS_02610 258336 259424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 260236 259421 gene locus_tag LOCUS_02620 260236 259421 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060998.1 protein_id gnl|my_center|LOCUS_02620 260798 260217 gene locus_tag LOCUS_02630 260798 260217 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 protein_id gnl|my_center|LOCUS_02630 261001 260795 gene locus_tag LOCUS_02640 261001 260795 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_02640 263817 261073 gene locus_tag LOCUS_02650 263817 261073 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878004.1 protein_id gnl|my_center|LOCUS_02650 266014 263891 gene locus_tag LOCUS_02660 266014 263891 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_02660 266388 267662 gene locus_tag LOCUS_02670 gene secY 266388 267662 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319363.1 protein_id gnl|my_center|LOCUS_02670 267742 268113 gene locus_tag LOCUS_02680 267742 268113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 268204 268374 gene locus_tag LOCUS_02690 268204 268374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 268376 268666 gene locus_tag LOCUS_02700 268376 268666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 268749 268940 gene locus_tag LOCUS_02710 268749 268940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 268947 271166 gene locus_tag LOCUS_02720 gene rqcH 268947 271166 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020698.1 protein_id gnl|my_center|LOCUS_02720 271219 272838 gene locus_tag LOCUS_02730 gene trpE 271219 272838 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 protein_id gnl|my_center|LOCUS_02730 272853 273422 gene locus_tag LOCUS_02740 272853 273422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02740 273484 274494 gene locus_tag LOCUS_02750 gene trpD 273484 274494 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_02750 275128 274481 gene locus_tag LOCUS_02760 gene coaE 275128 274481 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_02760 275989 275147 gene locus_tag LOCUS_02770 275989 275147 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_02770 276135 276353 gene locus_tag LOCUS_02780 276135 276353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 276241 277170 gene locus_tag LOCUS_02790 276241 277170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 277250 277615 gene locus_tag LOCUS_02800 277250 277615 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878679.1 protein_id gnl|my_center|LOCUS_02800 279012 277642 gene locus_tag LOCUS_02810 279012 277642 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_02810 279699 279082 gene locus_tag LOCUS_02820 279699 279082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 279843 280856 gene locus_tag LOCUS_02830 279843 280856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485789.1 protein_id gnl|my_center|LOCUS_02830 281036 281623 gene locus_tag LOCUS_02840 281036 281623 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941409.1 protein_id gnl|my_center|LOCUS_02840 281670 281900 gene locus_tag LOCUS_02850 281670 281900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 282654 283865 gene locus_tag LOCUS_02860 282654 283865 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_02860 284120 283944 gene locus_tag LOCUS_02870 284120 283944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 285274 284117 gene locus_tag LOCUS_02880 285274 284117 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877728.1 protein_id gnl|my_center|LOCUS_02880 285427 287349 gene locus_tag LOCUS_02890 gene gatE 285427 287349 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_02890 287342 287914 gene locus_tag LOCUS_02900 gene nudF 287342 287914 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_02900 288156 289583 gene locus_tag LOCUS_02910 288156 289583 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023126.1 protein_id gnl|my_center|LOCUS_02910 289844 290890 gene locus_tag LOCUS_02920 289844 290890 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250659.1 protein_id gnl|my_center|LOCUS_02920 290890 291993 gene locus_tag LOCUS_02930 290890 291993 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_02930 292506 291910 gene locus_tag LOCUS_02940 292506 291910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 292788 293834 gene locus_tag LOCUS_02950 gene priL 292788 293834 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_02950 293842 294816 gene locus_tag LOCUS_02960 gene nadA 293842 294816 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877429.1 protein_id gnl|my_center|LOCUS_02960 294835 295869 gene locus_tag LOCUS_02970 gene fhcD 294835 295869 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869816.1 protein_id gnl|my_center|LOCUS_02970 296013 296085 gene locus_tag LOCUS_t00060 296013 296085 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 296934 296134 gene locus_tag LOCUS_02980 296934 296134 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875872.1 protein_id gnl|my_center|LOCUS_02980 297755 298768 gene locus_tag LOCUS_02990 297755 298768 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007784895.1 protein_id gnl|my_center|LOCUS_02990 298765 299814 gene locus_tag LOCUS_03000 298765 299814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 300205 299921 gene locus_tag LOCUS_03010 300205 299921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 300471 300812 gene locus_tag LOCUS_03020 300471 300812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 300799 301557 gene locus_tag LOCUS_03030 300799 301557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761990.1 protein_id gnl|my_center|LOCUS_03030 301711 302358 gene locus_tag LOCUS_03040 301711 302358 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_03040 305300 302562 gene locus_tag LOCUS_03050 305300 302562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 305473 307206 gene locus_tag LOCUS_03060 305473 307206 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930711.1 protein_id gnl|my_center|LOCUS_03060 307352 307504 gene locus_tag LOCUS_03070 307352 307504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 307586 308134 gene locus_tag LOCUS_03080 307586 308134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 protein_id gnl|my_center|LOCUS_03080 308669 308136 gene locus_tag LOCUS_03090 308669 308136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 310704 309082 gene locus_tag LOCUS_03100 310704 309082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 310792 311376 gene locus_tag LOCUS_03110 310792 311376 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531832.1 protein_id gnl|my_center|LOCUS_03110 312717 311425 gene locus_tag LOCUS_03120 312717 311425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 312863 313444 gene locus_tag LOCUS_03130 312863 313444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 313687 314724 gene locus_tag LOCUS_03140 313687 314724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 314731 315255 gene locus_tag LOCUS_03150 314731 315255 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869779.1 protein_id gnl|my_center|LOCUS_03150 315274 315843 gene locus_tag LOCUS_03160 315274 315843 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_03160 316066 316581 gene locus_tag LOCUS_03170 gene rplJ 316066 316581 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_03170 318126 316666 gene locus_tag LOCUS_03180 318126 316666 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902931.1 protein_id gnl|my_center|LOCUS_03180 318903 318253 gene locus_tag LOCUS_03190 318903 318253 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902085.1 protein_id gnl|my_center|LOCUS_03190 321908 318993 gene locus_tag LOCUS_03200 gene alaS 321908 318993 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_03200 322776 323840 gene locus_tag LOCUS_03210 322776 323840 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_03210 323882 324268 gene locus_tag LOCUS_03220 323882 324268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 324354 324800 gene locus_tag LOCUS_03230 324354 324800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 324773 325384 gene locus_tag LOCUS_03240 324773 325384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 325917 325408 gene locus_tag LOCUS_03250 325917 325408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 326450 325989 gene locus_tag LOCUS_03260 326450 325989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 326718 327887 gene locus_tag LOCUS_03270 gene dnaJ 326718 327887 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582445.1 protein_id gnl|my_center|LOCUS_03270 328558 327884 gene locus_tag LOCUS_03280 328558 327884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 328596 329573 gene locus_tag LOCUS_03290 328596 329573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021970.1 protein_id gnl|my_center|LOCUS_03290 329603 330682 gene locus_tag LOCUS_03300 329603 330682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 330745 331629 gene locus_tag LOCUS_03310 330745 331629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 331626 332462 gene locus_tag LOCUS_03320 331626 332462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 332462 332971 gene locus_tag LOCUS_03330 332462 332971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 333032 333799 gene locus_tag LOCUS_03340 gene cobS 333032 333799 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867168.1 protein_id gnl|my_center|LOCUS_03340 334621 333803 gene locus_tag LOCUS_03350 334621 333803 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_03350 334752 335903 gene locus_tag LOCUS_03360 gene mfnA 334752 335903 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020065.1 protein_id gnl|my_center|LOCUS_03360 337495 335924 gene locus_tag LOCUS_03370 337495 335924 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061161.1 protein_id gnl|my_center|LOCUS_03370 337913 338590 gene locus_tag LOCUS_03380 337913 338590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 338617 339561 gene locus_tag LOCUS_03390 338617 339561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 341775 339868 gene locus_tag LOCUS_03400 341775 339868 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871102.1 protein_id gnl|my_center|LOCUS_03400 342451 341885 gene locus_tag LOCUS_03410 342451 341885 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871101.1 protein_id gnl|my_center|LOCUS_03410 343347 342484 gene locus_tag LOCUS_03420 343347 342484 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022865.1 protein_id gnl|my_center|LOCUS_03420 343693 343337 gene locus_tag LOCUS_03430 343693 343337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 344923 343697 gene locus_tag LOCUS_03440 344923 343697 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023766.1 protein_id gnl|my_center|LOCUS_03440 345363 345229 gene locus_tag LOCUS_03450 345363 345229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 345861 345427 gene locus_tag LOCUS_03460 345861 345427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 347053 345833 gene locus_tag LOCUS_03470 347053 345833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 349988 347304 gene locus_tag LOCUS_03480 349988 347304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 350878 350018 gene locus_tag LOCUS_03490 350878 350018 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_03490 351517 350903 gene locus_tag LOCUS_03500 351517 350903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 352607 351543 gene locus_tag LOCUS_03510 352607 351543 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_03510 353020 352604 gene locus_tag LOCUS_03520 353020 352604 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_03520 354571 353120 gene locus_tag LOCUS_03530 gene gatB 354571 353120 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064531.1 protein_id gnl|my_center|LOCUS_03530 354685 355215 gene locus_tag LOCUS_03540 354685 355215 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870197.1 protein_id gnl|my_center|LOCUS_03540 355235 355585 gene locus_tag LOCUS_03550 355235 355585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 355688 356518 gene locus_tag LOCUS_03560 355688 356518 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_03560 356536 357018 gene locus_tag LOCUS_03570 356536 357018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 358986 357052 gene locus_tag LOCUS_03580 358986 357052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 359170 360534 gene locus_tag LOCUS_03590 359170 360534 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064221.1 protein_id gnl|my_center|LOCUS_03590 360574 362085 gene locus_tag LOCUS_03600 360574 362085 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877864.1 protein_id gnl|my_center|LOCUS_03600 362924 362178 gene locus_tag LOCUS_03610 362924 362178 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064299.1 protein_id gnl|my_center|LOCUS_03610 363314 363607 gene locus_tag LOCUS_03620 363314 363607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 366813 363700 gene locus_tag LOCUS_03630 gene leuS 366813 363700 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867994.1 protein_id gnl|my_center|LOCUS_03630 367546 367079 gene locus_tag LOCUS_03640 367546 367079 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879874.1 protein_id gnl|my_center|LOCUS_03640 368052 367765 gene locus_tag LOCUS_03650 368052 367765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 368216 368052 gene locus_tag LOCUS_03660 368216 368052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 369141 368203 gene locus_tag LOCUS_03670 369141 368203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 369335 369144 gene locus_tag LOCUS_03680 369335 369144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 369796 369335 gene locus_tag LOCUS_03690 369796 369335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 369823 370260 gene locus_tag LOCUS_03700 369823 370260 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_03700 370340 371953 gene locus_tag LOCUS_03710 gene secY 370340 371953 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319363.1 protein_id gnl|my_center|LOCUS_03710 372031 373452 gene locus_tag LOCUS_03720 372031 373452 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876966.1 protein_id gnl|my_center|LOCUS_03720 373536 374333 gene locus_tag LOCUS_03730 373536 374333 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870188.1 protein_id gnl|my_center|LOCUS_03730 374849 374445 gene locus_tag LOCUS_03740 374849 374445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 375647 374952 gene locus_tag LOCUS_03750 375647 374952 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_03750 375966 375682 gene locus_tag LOCUS_03760 375966 375682 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868107.1 protein_id gnl|my_center|LOCUS_03760 376030 376103 gene locus_tag LOCUS_t00070 376030 376103 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 376186 376569 gene locus_tag LOCUS_03770 376186 376569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 376677 377867 gene locus_tag LOCUS_03780 376677 377867 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 protein_id gnl|my_center|LOCUS_03780 378106 378402 gene locus_tag LOCUS_03790 378106 378402 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020159.1 protein_id gnl|my_center|LOCUS_03790 378399 378743 gene locus_tag LOCUS_03800 378399 378743 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_03800 378913 379233 gene locus_tag LOCUS_03810 378913 379233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 381277 379505 gene locus_tag LOCUS_03820 gene argS 381277 379505 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_03820 381363 382133 gene locus_tag LOCUS_03830 gene dph5 381363 382133 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_03830 382527 382318 gene locus_tag LOCUS_03840 382527 382318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 383991 382783 gene locus_tag LOCUS_03850 383991 382783 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878822.1 protein_id gnl|my_center|LOCUS_03850 383909 384913 gene locus_tag LOCUS_03860 383909 384913 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022219.1 protein_id gnl|my_center|LOCUS_03860 384935 385765 gene locus_tag LOCUS_03870 384935 385765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 385976 385755 gene locus_tag LOCUS_03880 385976 385755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 386619 386239 gene locus_tag LOCUS_03890 386619 386239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 387760 386669 gene locus_tag LOCUS_03900 387760 386669 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846769.1 protein_id gnl|my_center|LOCUS_03900 389117 387846 gene locus_tag LOCUS_03910 gene ahcY 389117 387846 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_03910 389310 389642 gene locus_tag LOCUS_03920 389310 389642 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 protein_id gnl|my_center|LOCUS_03920 389757 390419 gene locus_tag LOCUS_03930 389757 390419 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879028.1 protein_id gnl|my_center|LOCUS_03930 390472 392508 gene locus_tag LOCUS_03940 gene hdrA 390472 392508 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_03940 392587 396108 gene locus_tag LOCUS_03950 392587 396108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 396719 396159 gene locus_tag LOCUS_03960 396719 396159 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_03960 396903 397991 gene locus_tag LOCUS_03970 396903 397991 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_03970 398139 398942 gene locus_tag LOCUS_03980 398139 398942 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_03980 399202 400071 gene locus_tag LOCUS_03990 399202 400071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_03990 400165 401868 gene locus_tag LOCUS_04000 gene ilvD 400165 401868 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546643.1 protein_id gnl|my_center|LOCUS_04000 402074 402562 gene locus_tag LOCUS_04010 402074 402562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 402583 403443 gene locus_tag LOCUS_04020 402583 403443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 403440 405254 gene locus_tag LOCUS_04030 403440 405254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 405471 407198 gene locus_tag LOCUS_04040 405471 407198 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_04040 407183 407665 gene locus_tag LOCUS_04050 gene ilvN 407183 407665 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879215.1 protein_id gnl|my_center|LOCUS_04050 409201 407945 gene locus_tag LOCUS_04060 409201 407945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 410808 409228 gene locus_tag LOCUS_04070 410808 409228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 411493 410990 gene locus_tag LOCUS_04080 411493 410990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 411767 412750 gene locus_tag LOCUS_04090 gene ilvC 411767 412750 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_04090 413346 412795 gene locus_tag LOCUS_04100 gene afpA 413346 412795 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064401.1 protein_id gnl|my_center|LOCUS_04100 413412 414860 gene locus_tag LOCUS_04110 413412 414860 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 protein_id gnl|my_center|LOCUS_04110 415058 415696 gene locus_tag LOCUS_04120 415058 415696 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020734.1 protein_id gnl|my_center|LOCUS_04120 416314 415742 gene locus_tag LOCUS_04130 416314 415742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 416793 416311 gene locus_tag LOCUS_04140 416793 416311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 417266 417922 gene locus_tag LOCUS_04150 gene rpsB 417266 417922 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250447.1 protein_id gnl|my_center|LOCUS_04150 418131 419264 gene locus_tag LOCUS_04160 gene ftsZ 418131 419264 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_04160 419307 419537 gene locus_tag LOCUS_04170 419307 419537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 419726 419971 gene locus_tag LOCUS_04180 gene purS 419726 419971 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879434.1 protein_id gnl|my_center|LOCUS_04180 419961 421358 gene locus_tag LOCUS_04190 419961 421358 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_04190 421526 421600 gene locus_tag LOCUS_t00080 421526 421600 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 423122 421629 gene locus_tag LOCUS_04200 423122 421629 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 protein_id gnl|my_center|LOCUS_04200 423263 424417 gene locus_tag LOCUS_04210 gene purC 423263 424417 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582681.1 protein_id gnl|my_center|LOCUS_04210 424448 425032 gene locus_tag LOCUS_04220 gene pyrE 424448 425032 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547500.1 protein_id gnl|my_center|LOCUS_04220 426413 425157 gene locus_tag LOCUS_04230 426413 425157 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_04230 427077 426481 gene locus_tag LOCUS_04240 427077 426481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 428206 427235 gene locus_tag LOCUS_04250 428206 427235 CDS product CfrBI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546529.1 protein_id gnl|my_center|LOCUS_04250 429628 428216 gene locus_tag LOCUS_04260 429628 428216 CDS product DNA methyltransferase C1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545124.1 protein_id gnl|my_center|LOCUS_04260 429871 429629 gene locus_tag LOCUS_04270 429871 429629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 430760 429852 gene locus_tag LOCUS_04280 430760 429852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 431341 430757 gene locus_tag LOCUS_04290 431341 430757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 431972 431331 gene locus_tag LOCUS_04300 431972 431331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 434020 431969 gene locus_tag LOCUS_04310 434020 431969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 435767 434505 gene locus_tag LOCUS_04320 435767 434505 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_04320 435856 436413 gene locus_tag LOCUS_04330 435856 436413 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024515.1 protein_id gnl|my_center|LOCUS_04330 437143 436616 gene locus_tag LOCUS_04340 437143 436616 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496749.1 protein_id gnl|my_center|LOCUS_04340 437210 438802 gene locus_tag LOCUS_04350 437210 438802 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024485.1 protein_id gnl|my_center|LOCUS_04350 438854 440047 gene locus_tag LOCUS_04360 438854 440047 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 protein_id gnl|my_center|LOCUS_04360 440213 445687 gene locus_tag LOCUS_04370 440213 445687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 446673 445981 gene locus_tag LOCUS_04380 446673 445981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 447289 446783 gene locus_tag LOCUS_04390 447289 446783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 447862 448539 gene locus_tag LOCUS_04400 447862 448539 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_04400 449423 448536 gene locus_tag LOCUS_04410 gene larB 449423 448536 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061016.1 protein_id gnl|my_center|LOCUS_04410 449482 451233 gene locus_tag LOCUS_04420 gene polX 449482 451233 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_04420 451535 451266 gene locus_tag LOCUS_04430 451535 451266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 454217 451707 gene locus_tag LOCUS_04440 gene gyrA 454217 451707 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903616.1 protein_id gnl|my_center|LOCUS_04440 456485 454410 gene locus_tag LOCUS_04450 gene gyrB 456485 454410 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_04450 457050 456619 gene locus_tag LOCUS_04460 457050 456619 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011019287.1 protein_id gnl|my_center|LOCUS_04460 457143 457226 gene locus_tag LOCUS_t00090 457143 457226 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 459085 457283 gene locus_tag LOCUS_04470 gene mutL 459085 457283 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_04470 459812 459063 gene locus_tag LOCUS_04480 459812 459063 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978652.1 protein_id gnl|my_center|LOCUS_04480 461154 459814 gene locus_tag LOCUS_04490 gene pgk 461154 459814 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_04490 462271 461267 gene locus_tag LOCUS_04500 gene purM 462271 461267 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_04500 462774 462268 gene locus_tag LOCUS_04510 gene rimI 462774 462268 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251164.1 protein_id gnl|my_center|LOCUS_04510 462977 463050 gene locus_tag LOCUS_t00100 462977 463050 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 463124 464101 gene locus_tag LOCUS_04520 gene htpX 463124 464101 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980430.1 protein_id gnl|my_center|LOCUS_04520 464232 464627 gene locus_tag LOCUS_04530 464232 464627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 464658 464924 gene locus_tag LOCUS_04540 464658 464924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 464973 465332 gene locus_tag LOCUS_04550 464973 465332 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_04550 465477 465737 gene locus_tag LOCUS_04560 465477 465737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 465804 465944 gene locus_tag LOCUS_04570 465804 465944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 466084 466755 gene locus_tag LOCUS_04580 466084 466755 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_04580 466811 467110 gene locus_tag LOCUS_04590 466811 467110 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879121.1 protein_id gnl|my_center|LOCUS_04590 467116 468108 gene locus_tag LOCUS_04600 467116 468108 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 protein_id gnl|my_center|LOCUS_04600 469328 468198 gene locus_tag LOCUS_04610 469328 468198 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876774.1 protein_id gnl|my_center|LOCUS_04610 470193 469390 gene locus_tag LOCUS_04620 gene sufC 470193 469390 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_04620 471105 470260 gene locus_tag LOCUS_04630 471105 470260 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_04630 471188 471733 gene locus_tag LOCUS_04640 471188 471733 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892795.1 protein_id gnl|my_center|LOCUS_04640 471751 472992 gene locus_tag LOCUS_04650 471751 472992 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879741.1 protein_id gnl|my_center|LOCUS_04650 474934 473300 gene locus_tag LOCUS_04660 474934 473300 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_04660 475903 475067 gene locus_tag LOCUS_04670 gene hisF 475903 475067 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061292.1 protein_id gnl|my_center|LOCUS_04670 476063 476824 gene locus_tag LOCUS_04680 476063 476824 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_04680 476815 477576 gene locus_tag LOCUS_04690 476815 477576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 478893 477628 gene locus_tag LOCUS_04700 gene ahbC 478893 477628 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_04700 479456 479268 gene locus_tag LOCUS_04710 479456 479268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 480676 479576 gene locus_tag LOCUS_04720 480676 479576 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_04720 481864 480698 gene locus_tag LOCUS_04730 gene ahbD 481864 480698 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_04730 482696 481938 gene locus_tag LOCUS_04740 482696 481938 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_04740 482967 482677 gene locus_tag LOCUS_04750 482967 482677 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020862.1 protein_id gnl|my_center|LOCUS_04750 483074 484246 gene locus_tag LOCUS_04760 483074 484246 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020066.1 protein_id gnl|my_center|LOCUS_04760 484629 484219 gene locus_tag LOCUS_04770 484629 484219 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496513.1 protein_id gnl|my_center|LOCUS_04770 485440 484715 gene locus_tag LOCUS_04780 485440 484715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 485578 486219 gene locus_tag LOCUS_04790 gene ppaX 485578 486219 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222403.1 protein_id gnl|my_center|LOCUS_04790 486216 487352 gene locus_tag LOCUS_04800 486216 487352 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 protein_id gnl|my_center|LOCUS_04800 488561 487368 gene locus_tag LOCUS_04810 488561 487368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 489957 488701 gene locus_tag LOCUS_04820 489957 488701 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 protein_id gnl|my_center|LOCUS_04820 490213 489920 gene locus_tag LOCUS_04830 490213 489920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 490386 492347 gene locus_tag LOCUS_04840 gene arcS 490386 492347 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_04840 493648 492377 gene locus_tag LOCUS_04850 493648 492377 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251201.1 protein_id gnl|my_center|LOCUS_04850 494437 494700 gene locus_tag LOCUS_04860 494437 494700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 494706 495197 gene locus_tag LOCUS_04870 494706 495197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 496118 495237 gene locus_tag LOCUS_04880 496118 495237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 496419 496739 gene locus_tag LOCUS_04890 496419 496739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 496835 497563 gene locus_tag LOCUS_04900 496835 497563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 497697 498788 gene locus_tag LOCUS_04910 gene hisC 497697 498788 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_04910 498850 500097 gene locus_tag LOCUS_04920 gene mpgS 498850 500097 CDS product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868345.1 protein_id gnl|my_center|LOCUS_04920 500138 500989 gene locus_tag LOCUS_04930 gene mpgP 500138 500989 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 protein_id gnl|my_center|LOCUS_04930 500982 503933 gene locus_tag LOCUS_04940 500982 503933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 505777 503942 gene locus_tag LOCUS_04950 505777 503942 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023773.1 protein_id gnl|my_center|LOCUS_04950 506392 505790 gene locus_tag LOCUS_04960 506392 505790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 506546 508327 gene locus_tag LOCUS_04970 506546 508327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 508654 509097 gene locus_tag LOCUS_04980 508654 509097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 509088 509612 gene locus_tag LOCUS_04990 509088 509612 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065441.1 protein_id gnl|my_center|LOCUS_04990 509665 510672 gene locus_tag LOCUS_05000 509665 510672 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_05000 510775 511089 gene locus_tag LOCUS_05010 510775 511089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 511171 511671 gene locus_tag LOCUS_05020 511171 511671 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877470.1 protein_id gnl|my_center|LOCUS_05020 511672 512889 gene locus_tag LOCUS_05030 511672 512889 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877471.1 protein_id gnl|my_center|LOCUS_05030 513497 514789 gene locus_tag LOCUS_05040 513497 514789 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_05040 515009 514776 gene locus_tag LOCUS_05050 515009 514776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 515174 516139 gene locus_tag LOCUS_05060 515174 516139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 516494 517885 gene locus_tag LOCUS_05070 516494 517885 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_05070 517940 520330 gene locus_tag LOCUS_05080 517940 520330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05080 520327 521922 gene locus_tag LOCUS_05090 520327 521922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05090 522002 524083 gene locus_tag LOCUS_05100 522002 524083 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_05100 524100 524660 gene locus_tag LOCUS_05110 524100 524660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 524771 527851 gene locus_tag LOCUS_05120 524771 527851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 528016 528990 gene locus_tag LOCUS_05130 528016 528990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 529211 532078 gene locus_tag LOCUS_05140 529211 532078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 532484 533326 gene locus_tag LOCUS_05150 532484 533326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 533439 534686 gene locus_tag LOCUS_05160 533439 534686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 534692 535768 gene locus_tag LOCUS_05170 534692 535768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 535775 537214 gene locus_tag LOCUS_05180 535775 537214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 537581 538972 gene locus_tag LOCUS_05190 537581 538972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 539015 551977 gene locus_tag LOCUS_05200 539015 551977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 552136 552351 gene locus_tag LOCUS_05210 552136 552351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 552379 553698 gene locus_tag LOCUS_05220 552379 553698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 553905 554477 gene locus_tag LOCUS_05230 553905 554477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 554534 555592 gene locus_tag LOCUS_05240 554534 555592 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868388.1 protein_id gnl|my_center|LOCUS_05240 555935 555594 gene locus_tag LOCUS_05250 555935 555594 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869714.1 protein_id gnl|my_center|LOCUS_05250 556630 555926 gene locus_tag LOCUS_05260 556630 555926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 556992 556645 gene locus_tag LOCUS_05270 556992 556645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 557141 557623 gene locus_tag LOCUS_05280 557141 557623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 557620 558435 gene locus_tag LOCUS_05290 557620 558435 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485719.1 protein_id gnl|my_center|LOCUS_05290 558518 558877 gene locus_tag LOCUS_05300 gene rlmH 558518 558877 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083264.1 protein_id gnl|my_center|LOCUS_05300 558932 559105 gene locus_tag LOCUS_05310 558932 559105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 559403 559756 gene locus_tag LOCUS_05320 559403 559756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 559774 559917 gene locus_tag LOCUS_05330 559774 559917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 560198 560668 gene locus_tag LOCUS_05340 560198 560668 CDS product PaREP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761857.1 protein_id gnl|my_center|LOCUS_05340 560684 560857 gene locus_tag LOCUS_05350 560684 560857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 560859 561533 gene locus_tag LOCUS_05360 560859 561533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 561530 562639 gene locus_tag LOCUS_05370 561530 562639 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_05370 562636 563949 gene locus_tag LOCUS_05380 562636 563949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 563942 564850 gene locus_tag LOCUS_05390 563942 564850 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965470.1 protein_id gnl|my_center|LOCUS_05390 566129 564900 gene locus_tag LOCUS_05400 566129 564900 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545872.1 protein_id gnl|my_center|LOCUS_05400 566791 566126 gene locus_tag LOCUS_05410 566791 566126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 566882 567118 gene locus_tag LOCUS_05420 566882 567118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 567075 568220 gene locus_tag LOCUS_05430 567075 568220 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_05430 568217 569290 gene locus_tag LOCUS_05440 568217 569290 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880338.1 protein_id gnl|my_center|LOCUS_05440 569307 569585 gene locus_tag LOCUS_05450 569307 569585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 569542 569799 gene locus_tag LOCUS_05460 569542 569799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 569815 570207 gene locus_tag LOCUS_05470 569815 570207 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879111.1 protein_id gnl|my_center|LOCUS_05470 570200 570526 gene locus_tag LOCUS_05480 570200 570526 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_05480 572015 570570 gene locus_tag LOCUS_05490 572015 570570 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878099.1 protein_id gnl|my_center|LOCUS_05490 573180 572032 gene locus_tag LOCUS_05500 573180 572032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 573575 573177 gene locus_tag LOCUS_05510 573575 573177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 573880 573572 gene locus_tag LOCUS_05520 573880 573572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 574091 573762 gene locus_tag LOCUS_05530 574091 573762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 574503 574093 gene locus_tag LOCUS_05540 574503 574093 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168156.1 protein_id gnl|my_center|LOCUS_05540 574669 574493 gene locus_tag LOCUS_05550 574669 574493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 574919 574689 gene locus_tag LOCUS_05560 574919 574689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 575089 574916 gene locus_tag LOCUS_05570 575089 574916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 576301 575204 gene locus_tag LOCUS_05580 576301 575204 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_05580 577316 576306 gene locus_tag LOCUS_05590 577316 576306 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022155.1 protein_id gnl|my_center|LOCUS_05590 578419 577313 gene locus_tag LOCUS_05600 578419 577313 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_05600 579386 578493 gene locus_tag LOCUS_05610 579386 578493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 579405 579555 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 579574 580467 gene locus_tag LOCUS_05620 579574 580467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 580541 581647 gene locus_tag LOCUS_05630 580541 581647 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_05630 581644 582654 gene locus_tag LOCUS_05640 581644 582654 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022155.1 protein_id gnl|my_center|LOCUS_05640 582659 583756 gene locus_tag LOCUS_05650 582659 583756 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_05650 583871 584044 gene locus_tag LOCUS_05660 583871 584044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 584041 584271 gene locus_tag LOCUS_05670 584041 584271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 584291 584467 gene locus_tag LOCUS_05680 584291 584467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 584457 584867 gene locus_tag LOCUS_05690 584457 584867 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168156.1 protein_id gnl|my_center|LOCUS_05690 584869 585198 gene locus_tag LOCUS_05700 584869 585198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 585080 585388 gene locus_tag LOCUS_05710 585080 585388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 585385 585783 gene locus_tag LOCUS_05720 585385 585783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 585780 586928 gene locus_tag LOCUS_05730 585780 586928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 586945 588390 gene locus_tag LOCUS_05740 586945 588390 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878099.1 protein_id gnl|my_center|LOCUS_05740 588760 588434 gene locus_tag LOCUS_05750 588760 588434 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_05750 589145 588753 gene locus_tag LOCUS_05760 589145 588753 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879111.1 protein_id gnl|my_center|LOCUS_05760 589418 589161 gene locus_tag LOCUS_05770 589418 589161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 589653 589375 gene locus_tag LOCUS_05780 589653 589375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 590743 589670 gene locus_tag LOCUS_05790 590743 589670 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880338.1 protein_id gnl|my_center|LOCUS_05790 591885 590740 gene locus_tag LOCUS_05800 591885 590740 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_05800 592078 591842 gene locus_tag LOCUS_05810 592078 591842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 592169 592834 gene locus_tag LOCUS_05820 592169 592834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 592831 594060 gene locus_tag LOCUS_05830 592831 594060 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545872.1 protein_id gnl|my_center|LOCUS_05830 595018 594110 gene locus_tag LOCUS_05840 595018 594110 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965470.1 protein_id gnl|my_center|LOCUS_05840 596324 595011 gene locus_tag LOCUS_05850 596324 595011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 597430 596321 gene locus_tag LOCUS_05860 597430 596321 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_05860 598101 597427 gene locus_tag LOCUS_05870 598101 597427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 598276 598103 gene locus_tag LOCUS_05880 598276 598103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 598762 598292 gene locus_tag LOCUS_05890 598762 598292 CDS product PaREP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761857.1 protein_id gnl|my_center|LOCUS_05890 599071 598817 gene locus_tag LOCUS_05900 599071 598817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 599189 599025 gene locus_tag LOCUS_05910 599189 599025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 599560 599207 gene locus_tag LOCUS_05920 599560 599207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 600031 599732 gene locus_tag LOCUS_05930 600031 599732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 600445 600086 gene locus_tag LOCUS_05940 gene rlmH 600445 600086 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083264.1 protein_id gnl|my_center|LOCUS_05940 601340 600528 gene locus_tag LOCUS_05950 601340 600528 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485719.1 protein_id gnl|my_center|LOCUS_05950 601819 601337 gene locus_tag LOCUS_05960 601819 601337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 601968 602315 gene locus_tag LOCUS_05970 601968 602315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 602330 603034 gene locus_tag LOCUS_05980 602330 603034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 603025 603366 gene locus_tag LOCUS_05990 603025 603366 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869714.1 protein_id gnl|my_center|LOCUS_05990 604426 603368 gene locus_tag LOCUS_06000 604426 603368 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868388.1 protein_id gnl|my_center|LOCUS_06000 605049 604483 gene locus_tag LOCUS_06010 605049 604483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 606581 605262 gene locus_tag LOCUS_06020 606581 605262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 606824 606609 gene locus_tag LOCUS_06030 606824 606609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 619945 606983 gene locus_tag LOCUS_06040 619945 606983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 621379 619988 gene locus_tag LOCUS_06050 621379 619988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 623185 621746 gene locus_tag LOCUS_06060 623185 621746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 624268 623192 gene locus_tag LOCUS_06070 624268 623192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 625521 624274 gene locus_tag LOCUS_06080 625521 624274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 626476 625634 gene locus_tag LOCUS_06090 626476 625634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 629749 626882 gene locus_tag LOCUS_06100 629749 626882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 630944 629970 gene locus_tag LOCUS_06110 630944 629970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 634189 631109 gene locus_tag LOCUS_06120 634189 631109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 634860 634300 gene locus_tag LOCUS_06130 634860 634300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 636958 634877 gene locus_tag LOCUS_06140 636958 634877 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_06140 638633 637038 gene locus_tag LOCUS_06150 638633 637038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06150 641020 638630 gene locus_tag LOCUS_06160 641020 638630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06160 642466 641075 gene locus_tag LOCUS_06170 642466 641075 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860152.1 protein_id gnl|my_center|LOCUS_06170 643786 642821 gene locus_tag LOCUS_06180 643786 642821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 643951 644184 gene locus_tag LOCUS_06190 643951 644184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 645463 644171 gene locus_tag LOCUS_06200 645463 644171 CDS product acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531219.1 protein_id gnl|my_center|LOCUS_06200 647276 646059 gene locus_tag LOCUS_06210 647276 646059 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877471.1 protein_id gnl|my_center|LOCUS_06210 647777 647277 gene locus_tag LOCUS_06220 647777 647277 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877470.1 protein_id gnl|my_center|LOCUS_06220 648173 647859 gene locus_tag LOCUS_06230 648173 647859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 649283 648276 gene locus_tag LOCUS_06240 649283 648276 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_06240 649860 649336 gene locus_tag LOCUS_06250 649860 649336 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065441.1 protein_id gnl|my_center|LOCUS_06250 650294 649851 gene locus_tag LOCUS_06260 650294 649851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 652402 650621 gene locus_tag LOCUS_06270 652402 650621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 652556 653158 gene locus_tag LOCUS_06280 652556 653158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 653171 655006 gene locus_tag LOCUS_06290 653171 655006 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023773.1 protein_id gnl|my_center|LOCUS_06290 657966 655015 gene locus_tag LOCUS_06300 657966 655015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 658822 657959 gene locus_tag LOCUS_06310 gene mpgP 658822 657959 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 protein_id gnl|my_center|LOCUS_06310 660110 658863 gene locus_tag LOCUS_06320 gene mpgS 660110 658863 CDS product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868345.1 protein_id gnl|my_center|LOCUS_06320 661263 660172 gene locus_tag LOCUS_06330 gene hisC 661263 660172 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_06330 662125 661397 gene locus_tag LOCUS_06340 662125 661397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 662538 662218 gene locus_tag LOCUS_06350 662538 662218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 662839 663717 gene locus_tag LOCUS_06360 662839 663717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 664248 663757 gene locus_tag LOCUS_06370 664248 663757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 664517 664254 gene locus_tag LOCUS_06380 664517 664254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 665306 666577 gene locus_tag LOCUS_06390 665306 666577 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251201.1 protein_id gnl|my_center|LOCUS_06390 668568 666607 gene locus_tag LOCUS_06400 gene arcS 668568 666607 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_06400 668741 669034 gene locus_tag LOCUS_06410 668741 669034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 668997 670253 gene locus_tag LOCUS_06420 668997 670253 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 protein_id gnl|my_center|LOCUS_06420 670393 671586 gene locus_tag LOCUS_06430 670393 671586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 672738 671602 gene locus_tag LOCUS_06440 672738 671602 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 protein_id gnl|my_center|LOCUS_06440 673376 672735 gene locus_tag LOCUS_06450 gene ppaX 673376 672735 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222403.1 protein_id gnl|my_center|LOCUS_06450 673514 674239 gene locus_tag LOCUS_06460 673514 674239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 674325 674735 gene locus_tag LOCUS_06470 674325 674735 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496513.1 protein_id gnl|my_center|LOCUS_06470 675880 674708 gene locus_tag LOCUS_06480 675880 674708 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020066.1 protein_id gnl|my_center|LOCUS_06480 675987 676277 gene locus_tag LOCUS_06490 675987 676277 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020862.1 protein_id gnl|my_center|LOCUS_06490 676258 677016 gene locus_tag LOCUS_06500 676258 677016 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_06500 677090 678256 gene locus_tag LOCUS_06510 gene ahbD 677090 678256 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_06510 678278 679378 gene locus_tag LOCUS_06520 678278 679378 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_06520 679498 679686 gene locus_tag LOCUS_06530 679498 679686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 680061 681326 gene locus_tag LOCUS_06540 gene ahbC 680061 681326 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_06540 682139 681378 gene locus_tag LOCUS_06550 682139 681378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 682891 682130 gene locus_tag LOCUS_06560 682891 682130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_06560 683049 683885 gene locus_tag LOCUS_06570 gene hisF 683049 683885 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061292.1 protein_id gnl|my_center|LOCUS_06570 684018 685652 gene locus_tag LOCUS_06580 684018 685652 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_06580 687201 685960 gene locus_tag LOCUS_06590 687201 685960 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879741.1 protein_id gnl|my_center|LOCUS_06590 687764 687219 gene locus_tag LOCUS_06600 687764 687219 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892795.1 protein_id gnl|my_center|LOCUS_06600 687847 688692 gene locus_tag LOCUS_06610 687847 688692 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_06610 688759 689562 gene locus_tag LOCUS_06620 gene sufC 688759 689562 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_06620 689624 690754 gene locus_tag LOCUS_06630 689624 690754 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876774.1 protein_id gnl|my_center|LOCUS_06630 691836 690844 gene locus_tag LOCUS_06640 691836 690844 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 protein_id gnl|my_center|LOCUS_06640 692141 691842 gene locus_tag LOCUS_06650 692141 691842 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879121.1 protein_id gnl|my_center|LOCUS_06650 692868 692197 gene locus_tag LOCUS_06660 692868 692197 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_06660 693148 693008 gene locus_tag LOCUS_06670 693148 693008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 693475 693215 gene locus_tag LOCUS_06680 693475 693215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 693979 693620 gene locus_tag LOCUS_06690 693979 693620 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_06690 694294 694028 gene locus_tag LOCUS_06700 694294 694028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 694720 694325 gene locus_tag LOCUS_06710 694720 694325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 695828 694851 gene locus_tag LOCUS_06720 gene htpX 695828 694851 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980430.1 protein_id gnl|my_center|LOCUS_06720 695975 695902 gene locus_tag LOCUS_t00110 695975 695902 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 696178 696684 gene locus_tag LOCUS_06730 gene rimI 696178 696684 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251164.1 protein_id gnl|my_center|LOCUS_06730 696681 697685 gene locus_tag LOCUS_06740 gene purM 696681 697685 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_06740 697798 699138 gene locus_tag LOCUS_06750 gene pgk 697798 699138 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_06750 699140 699889 gene locus_tag LOCUS_06760 699140 699889 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978652.1 protein_id gnl|my_center|LOCUS_06760 699867 701669 gene locus_tag LOCUS_06770 gene mutL 699867 701669 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_06770 701809 701726 gene locus_tag LOCUS_t00120 701809 701726 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 701902 702333 gene locus_tag LOCUS_06780 701902 702333 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011019287.1 protein_id gnl|my_center|LOCUS_06780 702467 704542 gene locus_tag LOCUS_06790 gene gyrB 702467 704542 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_06790 704735 707239 gene locus_tag LOCUS_06800 gene gyrA 704735 707239 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_06800 707411 707680 gene locus_tag LOCUS_06810 707411 707680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 709464 707713 gene locus_tag LOCUS_06820 gene polX 709464 707713 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_06820 709523 710410 gene locus_tag LOCUS_06830 gene larB 709523 710410 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061016.1 protein_id gnl|my_center|LOCUS_06830 711084 710407 gene locus_tag LOCUS_06840 711084 710407 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_06840 711657 712163 gene locus_tag LOCUS_06850 711657 712163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 712273 712965 gene locus_tag LOCUS_06860 712273 712965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 718733 713259 gene locus_tag LOCUS_06870 718733 713259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 720092 718899 gene locus_tag LOCUS_06880 720092 718899 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 protein_id gnl|my_center|LOCUS_06880 721736 720144 gene locus_tag LOCUS_06890 721736 720144 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024485.1 protein_id gnl|my_center|LOCUS_06890 721803 722330 gene locus_tag LOCUS_06900 721803 722330 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496749.1 protein_id gnl|my_center|LOCUS_06900 723090 722533 gene locus_tag LOCUS_06910 723090 722533 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024515.1 protein_id gnl|my_center|LOCUS_06910 723179 724441 gene locus_tag LOCUS_06920 723179 724441 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_06920 724926 726977 gene locus_tag LOCUS_06930 724926 726977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 726974 727615 gene locus_tag LOCUS_06940 726974 727615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 727605 728189 gene locus_tag LOCUS_06950 727605 728189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 728186 729094 gene locus_tag LOCUS_06960 728186 729094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 729075 729317 gene locus_tag LOCUS_06970 729075 729317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 729318 730730 gene locus_tag LOCUS_06980 729318 730730 CDS product DNA methyltransferase C1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545124.1 protein_id gnl|my_center|LOCUS_06980 730740 731711 gene locus_tag LOCUS_06990 730740 731711 CDS product CfrBI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546529.1 protein_id gnl|my_center|LOCUS_06990 731869 732465 gene locus_tag LOCUS_07000 731869 732465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 732533 733789 gene locus_tag LOCUS_07010 732533 733789 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_07010 734498 733914 gene locus_tag LOCUS_07020 gene pyrE 734498 733914 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547500.1 protein_id gnl|my_center|LOCUS_07020 735683 734529 gene locus_tag LOCUS_07030 gene purC 735683 734529 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582681.1 protein_id gnl|my_center|LOCUS_07030 735824 737317 gene locus_tag LOCUS_07040 735824 737317 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 protein_id gnl|my_center|LOCUS_07040 737420 737346 gene locus_tag LOCUS_t00130 737420 737346 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 738986 737589 gene locus_tag LOCUS_07050 738986 737589 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_07050 739221 738976 gene locus_tag LOCUS_07060 gene purS 739221 738976 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879434.1 protein_id gnl|my_center|LOCUS_07060 739640 739410 gene locus_tag LOCUS_07070 739640 739410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 740816 739683 gene locus_tag LOCUS_07080 gene ftsZ 740816 739683 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_07080 741681 741025 gene locus_tag LOCUS_07090 gene rpsB 741681 741025 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250447.1 protein_id gnl|my_center|LOCUS_07090 742154 742636 gene locus_tag LOCUS_07100 742154 742636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 742633 743205 gene locus_tag LOCUS_07110 742633 743205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 743889 743251 gene locus_tag LOCUS_07120 743889 743251 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020734.1 protein_id gnl|my_center|LOCUS_07120 745535 744087 gene locus_tag LOCUS_07130 745535 744087 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 protein_id gnl|my_center|LOCUS_07130 745601 746152 gene locus_tag LOCUS_07140 gene afpA 745601 746152 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064401.1 protein_id gnl|my_center|LOCUS_07140 747180 746197 gene locus_tag LOCUS_07150 gene ilvC 747180 746197 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061053.1 protein_id gnl|my_center|LOCUS_07150 747454 747957 gene locus_tag LOCUS_07160 747454 747957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 748139 749719 gene locus_tag LOCUS_07170 748139 749719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 749746 751002 gene locus_tag LOCUS_07180 749746 751002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 751764 751282 gene locus_tag LOCUS_07190 gene ilvN 751764 751282 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879215.1 protein_id gnl|my_center|LOCUS_07190 753476 751749 gene locus_tag LOCUS_07200 753476 751749 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_07200 755507 753693 gene locus_tag LOCUS_07210 755507 753693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 756364 755504 gene locus_tag LOCUS_07220 756364 755504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 756873 756385 gene locus_tag LOCUS_07230 756873 756385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 758782 757079 gene locus_tag LOCUS_07240 gene ilvD 758782 757079 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546643.1 protein_id gnl|my_center|LOCUS_07240 759745 758876 gene locus_tag LOCUS_07250 759745 758876 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_07250 760808 760005 gene locus_tag LOCUS_07260 760808 760005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_07260 762044 760956 gene locus_tag LOCUS_07270 762044 760956 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_07270 762228 762788 gene locus_tag LOCUS_07280 762228 762788 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_07280 766361 762840 gene locus_tag LOCUS_07290 766361 762840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 768476 766440 gene locus_tag LOCUS_07300 gene hdrA 768476 766440 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_07300 769191 768529 gene locus_tag LOCUS_07310 769191 768529 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879028.1 protein_id gnl|my_center|LOCUS_07310 769638 769306 gene locus_tag LOCUS_07320 769638 769306 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 protein_id gnl|my_center|LOCUS_07320 769831 771102 gene locus_tag LOCUS_07330 gene ahcY 769831 771102 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_07330 771188 772279 gene locus_tag LOCUS_07340 771188 772279 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846769.1 protein_id gnl|my_center|LOCUS_07340 772329 772709 gene locus_tag LOCUS_07350 772329 772709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 772972 773193 gene locus_tag LOCUS_07360 772972 773193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 774013 773183 gene locus_tag LOCUS_07370 774013 773183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 775039 774035 gene locus_tag LOCUS_07380 775039 774035 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022219.1 protein_id gnl|my_center|LOCUS_07380 774957 776165 gene locus_tag LOCUS_07390 774957 776165 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878822.1 protein_id gnl|my_center|LOCUS_07390 776421 776630 gene locus_tag LOCUS_07400 776421 776630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 777585 776815 gene locus_tag LOCUS_07410 gene dph5 777585 776815 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_07410 777671 779443 gene locus_tag LOCUS_07420 gene argS 777671 779443 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_07420 780035 779715 gene locus_tag LOCUS_07430 780035 779715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 780549 780205 gene locus_tag LOCUS_07440 780549 780205 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_07440 780842 780546 gene locus_tag LOCUS_07450 780842 780546 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020159.1 protein_id gnl|my_center|LOCUS_07450 782271 781081 gene locus_tag LOCUS_07460 782271 781081 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 protein_id gnl|my_center|LOCUS_07460 782762 782379 gene locus_tag LOCUS_07470 782762 782379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 782918 782845 gene locus_tag LOCUS_t00140 782918 782845 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 782982 783266 gene locus_tag LOCUS_07480 782982 783266 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868107.1 protein_id gnl|my_center|LOCUS_07480 783301 783996 gene locus_tag LOCUS_07490 783301 783996 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_07490 784099 784503 gene locus_tag LOCUS_07500 784099 784503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 785412 784615 gene locus_tag LOCUS_07510 785412 784615 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870188.1 protein_id gnl|my_center|LOCUS_07510 786916 785495 gene locus_tag LOCUS_07520 786916 785495 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876966.1 protein_id gnl|my_center|LOCUS_07520 788607 786994 gene locus_tag LOCUS_07530 gene secY 788607 786994 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319363.1 protein_id gnl|my_center|LOCUS_07530 789124 788687 gene locus_tag LOCUS_07540 789124 788687 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_07540 789151 789612 gene locus_tag LOCUS_07550 789151 789612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 789612 789803 gene locus_tag LOCUS_07560 789612 789803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 789806 790744 gene locus_tag LOCUS_07570 789806 790744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 790731 790895 gene locus_tag LOCUS_07580 790731 790895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 790895 791182 gene locus_tag LOCUS_07590 790895 791182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 791401 791868 gene locus_tag LOCUS_07600 791401 791868 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879874.1 protein_id gnl|my_center|LOCUS_07600 792134 795247 gene locus_tag LOCUS_07610 gene leuS 792134 795247 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867994.1 protein_id gnl|my_center|LOCUS_07610 795633 795340 gene locus_tag LOCUS_07620 795633 795340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 796023 796769 gene locus_tag LOCUS_07630 796023 796769 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064299.1 protein_id gnl|my_center|LOCUS_07630 798373 796862 gene locus_tag LOCUS_07640 798373 796862 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877864.1 protein_id gnl|my_center|LOCUS_07640 799777 798413 gene locus_tag LOCUS_07650 799777 798413 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064221.1 protein_id gnl|my_center|LOCUS_07650 799961 801895 gene locus_tag LOCUS_07660 799961 801895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 802411 801929 gene locus_tag LOCUS_07670 802411 801929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 803259 802429 gene locus_tag LOCUS_07680 803259 802429 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_07680 803712 803362 gene locus_tag LOCUS_07690 803712 803362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 804262 803732 gene locus_tag LOCUS_07700 804262 803732 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870197.1 protein_id gnl|my_center|LOCUS_07700 804376 805827 gene locus_tag LOCUS_07710 gene gatB 804376 805827 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064531.1 protein_id gnl|my_center|LOCUS_07710 805927 806343 gene locus_tag LOCUS_07720 805927 806343 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_07720 806340 807404 gene locus_tag LOCUS_07730 806340 807404 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_07730 807430 808044 gene locus_tag LOCUS_07740 807430 808044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 808069 808929 gene locus_tag LOCUS_07750 808069 808929 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_07750 808959 811643 gene locus_tag LOCUS_07760 808959 811643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 811894 813114 gene locus_tag LOCUS_07770 811894 813114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 813086 813520 gene locus_tag LOCUS_07780 813086 813520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 813584 813718 gene locus_tag LOCUS_07790 813584 813718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 814024 815250 gene locus_tag LOCUS_07800 814024 815250 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023766.1 protein_id gnl|my_center|LOCUS_07800 815254 815610 gene locus_tag LOCUS_07810 815254 815610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 815600 816463 gene locus_tag LOCUS_07820 815600 816463 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022865.1 protein_id gnl|my_center|LOCUS_07820 816496 817062 gene locus_tag LOCUS_07830 816496 817062 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871101.1 protein_id gnl|my_center|LOCUS_07830 817172 819079 gene locus_tag LOCUS_07840 817172 819079 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871102.1 protein_id gnl|my_center|LOCUS_07840 820330 819386 gene locus_tag LOCUS_07850 820330 819386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 821034 820357 gene locus_tag LOCUS_07860 821034 820357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 821452 823023 gene locus_tag LOCUS_07870 821452 823023 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061161.1 protein_id gnl|my_center|LOCUS_07870 824195 823044 gene locus_tag LOCUS_07880 gene mfnA 824195 823044 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020065.1 protein_id gnl|my_center|LOCUS_07880 824326 825144 gene locus_tag LOCUS_07890 824326 825144 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_07890 825915 825148 gene locus_tag LOCUS_07900 gene cobS 825915 825148 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867168.1 protein_id gnl|my_center|LOCUS_07900 826485 825976 gene locus_tag LOCUS_07910 826485 825976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 827321 826485 gene locus_tag LOCUS_07920 827321 826485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 828202 827318 gene locus_tag LOCUS_07930 828202 827318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 829344 828265 gene locus_tag LOCUS_07940 829344 828265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 830351 829374 gene locus_tag LOCUS_07950 830351 829374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021970.1 protein_id gnl|my_center|LOCUS_07950 830389 831063 gene locus_tag LOCUS_07960 830389 831063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 832229 831060 gene locus_tag LOCUS_07970 gene dnaJ 832229 831060 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582445.1 protein_id gnl|my_center|LOCUS_07970 832497 832958 gene locus_tag LOCUS_07980 832497 832958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 833030 833539 gene locus_tag LOCUS_07990 833030 833539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 834174 833563 gene locus_tag LOCUS_08000 834174 833563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 834593 834147 gene locus_tag LOCUS_08010 834593 834147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 835065 834679 gene locus_tag LOCUS_08020 835065 834679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 836171 835107 gene locus_tag LOCUS_08030 836171 835107 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_08030 837083 839998 gene locus_tag LOCUS_08040 gene alaS 837083 839998 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_08040 840088 840738 gene locus_tag LOCUS_08050 840088 840738 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902085.1 protein_id gnl|my_center|LOCUS_08050 840865 842325 gene locus_tag LOCUS_08060 840865 842325 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902931.1 protein_id gnl|my_center|LOCUS_08060 842925 842410 gene locus_tag LOCUS_08070 gene rplJ 842925 842410 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_08070 843717 843148 gene locus_tag LOCUS_08080 843717 843148 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_08080 844260 843736 gene locus_tag LOCUS_08090 844260 843736 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869779.1 protein_id gnl|my_center|LOCUS_08090 845304 844267 gene locus_tag LOCUS_08100 845304 844267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 846128 845547 gene locus_tag LOCUS_08110 846128 845547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 846274 847566 gene locus_tag LOCUS_08120 846274 847566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 848199 847615 gene locus_tag LOCUS_08130 848199 847615 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531832.1 protein_id gnl|my_center|LOCUS_08130 848287 849909 gene locus_tag LOCUS_08140 848287 849909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 850322 850855 gene locus_tag LOCUS_08150 850322 850855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 851405 850857 gene locus_tag LOCUS_08160 851405 850857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 protein_id gnl|my_center|LOCUS_08160 851639 851487 gene locus_tag LOCUS_08170 851639 851487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 853518 851785 gene locus_tag LOCUS_08180 853518 851785 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930711.1 protein_id gnl|my_center|LOCUS_08180 853691 856429 gene locus_tag LOCUS_08190 853691 856429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 857280 856633 gene locus_tag LOCUS_08200 857280 856633 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_08200 858125 857367 gene locus_tag LOCUS_08210 858125 857367 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761990.1 protein_id gnl|my_center|LOCUS_08210 858453 858112 gene locus_tag LOCUS_08220 858453 858112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 858719 859003 gene locus_tag LOCUS_08230 858719 859003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 860159 859110 gene locus_tag LOCUS_08240 860159 859110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 861169 860156 gene locus_tag LOCUS_08250 861169 860156 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007784895.1 protein_id gnl|my_center|LOCUS_08250 861990 862790 gene locus_tag LOCUS_08260 861990 862790 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875872.1 protein_id gnl|my_center|LOCUS_08260 862911 862839 gene locus_tag LOCUS_t00150 862911 862839 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 864089 863055 gene locus_tag LOCUS_08270 gene fhcD 864089 863055 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869816.1 protein_id gnl|my_center|LOCUS_08270 865082 864108 gene locus_tag LOCUS_08280 gene nadA 865082 864108 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877429.1 protein_id gnl|my_center|LOCUS_08280 866136 865090 gene locus_tag LOCUS_08290 gene priL 866136 865090 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_08290 866418 867014 gene locus_tag LOCUS_08300 866418 867014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 868034 866931 gene locus_tag LOCUS_08310 868034 866931 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_08310 869080 868034 gene locus_tag LOCUS_08320 869080 868034 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250659.1 protein_id gnl|my_center|LOCUS_08320 870768 869341 gene locus_tag LOCUS_08330 870768 869341 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023126.1 protein_id gnl|my_center|LOCUS_08330 871582 871010 gene locus_tag LOCUS_08340 gene nudF 871582 871010 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_08340 873497 871575 gene locus_tag LOCUS_08350 gene gatE 873497 871575 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_08350 873650 874807 gene locus_tag LOCUS_08360 873650 874807 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877728.1 protein_id gnl|my_center|LOCUS_08360 874804 874980 gene locus_tag LOCUS_08370 874804 874980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 876270 875059 gene locus_tag LOCUS_08380 876270 875059 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_08380 877254 877024 gene locus_tag LOCUS_08390 877254 877024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 877888 877301 gene locus_tag LOCUS_08400 877888 877301 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941409.1 protein_id gnl|my_center|LOCUS_08400 879081 878068 gene locus_tag LOCUS_08410 879081 878068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485789.1 protein_id gnl|my_center|LOCUS_08410 879225 879842 gene locus_tag LOCUS_08420 879225 879842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 879912 881282 gene locus_tag LOCUS_08430 879912 881282 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_08430 881674 881309 gene locus_tag LOCUS_08440 881674 881309 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878679.1 protein_id gnl|my_center|LOCUS_08440 882713 881754 gene locus_tag LOCUS_08450 882713 881754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 882767 883777 gene locus_tag LOCUS_08460 882767 883777 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_08460 883796 884443 gene locus_tag LOCUS_08470 gene coaE 883796 884443 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_08470 885440 884430 gene locus_tag LOCUS_08480 gene trpD 885440 884430 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_08480 886071 885502 gene locus_tag LOCUS_08490 886071 885502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08490 887705 886086 gene locus_tag LOCUS_08500 gene trpE 887705 886086 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 protein_id gnl|my_center|LOCUS_08500 889977 887758 gene locus_tag LOCUS_08510 gene rqcH 889977 887758 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020698.1 protein_id gnl|my_center|LOCUS_08510 890175 889984 gene locus_tag LOCUS_08520 890175 889984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 890548 890258 gene locus_tag LOCUS_08530 890548 890258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 890720 890550 gene locus_tag LOCUS_08540 890720 890550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 891182 890811 gene locus_tag LOCUS_08550 891182 890811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 892536 891262 gene locus_tag LOCUS_08560 gene secY 892536 891262 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319363.1 protein_id gnl|my_center|LOCUS_08560 892910 895033 gene locus_tag LOCUS_08570 892910 895033 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_08570 895107 897851 gene locus_tag LOCUS_08580 895107 897851 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878004.1 protein_id gnl|my_center|LOCUS_08580 897923 898129 gene locus_tag LOCUS_08590 897923 898129 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_08590 898126 898707 gene locus_tag LOCUS_08600 898126 898707 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 protein_id gnl|my_center|LOCUS_08600 898688 899503 gene locus_tag LOCUS_08610 898688 899503 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060998.1 protein_id gnl|my_center|LOCUS_08610 900588 899500 gene locus_tag LOCUS_08620 900588 899500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 900711 901475 gene locus_tag LOCUS_08630 900711 901475 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_08630 901472 903064 gene locus_tag LOCUS_08640 gene serS 901472 903064 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870589.1 protein_id gnl|my_center|LOCUS_08640 903105 903608 gene locus_tag LOCUS_08650 903105 903608 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_08650 903695 904891 gene locus_tag LOCUS_08660 903695 904891 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_08660 905463 904942 gene locus_tag LOCUS_08670 905463 904942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 906149 905631 gene locus_tag LOCUS_08680 906149 905631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 906517 907383 gene locus_tag LOCUS_08690 906517 907383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 907462 908040 gene locus_tag LOCUS_08700 907462 908040 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868022.1 protein_id gnl|my_center|LOCUS_08700 908109 909752 gene locus_tag LOCUS_08710 908109 909752 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020198.1 protein_id gnl|my_center|LOCUS_08710 909798 910376 gene locus_tag LOCUS_08720 gene hisB 909798 910376 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 protein_id gnl|my_center|LOCUS_08720 910382 910927 gene locus_tag LOCUS_08730 910382 910927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 911181 911801 gene locus_tag LOCUS_08740 911181 911801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545105.1 protein_id gnl|my_center|LOCUS_08740 912886 911765 gene locus_tag LOCUS_08750 912886 911765 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_08750 914111 912903 gene locus_tag LOCUS_08760 914111 912903 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860356.1 protein_id gnl|my_center|LOCUS_08760 915297 914116 gene locus_tag LOCUS_08770 915297 914116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 915916 915305 gene locus_tag LOCUS_08780 915916 915305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 917462 916080 gene locus_tag LOCUS_08790 gene thiD 917462 916080 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023132.1 protein_id gnl|my_center|LOCUS_08790 918005 917484 gene locus_tag LOCUS_08800 918005 917484 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146480.1 protein_id gnl|my_center|LOCUS_08800 918064 918474 gene locus_tag LOCUS_08810 918064 918474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 919241 918492 gene locus_tag LOCUS_08820 gene aroD 919241 918492 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_08820 919506 920594 gene locus_tag LOCUS_08830 919506 920594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 920622 921011 gene locus_tag LOCUS_08840 920622 921011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 921111 922646 gene locus_tag LOCUS_08850 921111 922646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 923653 922700 gene locus_tag LOCUS_08860 923653 922700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 923681 924664 gene locus_tag LOCUS_08870 gene cofG 923681 924664 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878300.1 protein_id gnl|my_center|LOCUS_08870 925568 924708 gene locus_tag LOCUS_08880 925568 924708 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925142.1 protein_id gnl|my_center|LOCUS_08880 926973 925726 gene locus_tag LOCUS_08890 926973 925726 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250137.1 protein_id gnl|my_center|LOCUS_08890 927453 927043 gene locus_tag LOCUS_08900 927453 927043 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_08900 927603 928418 gene locus_tag LOCUS_08910 927603 928418 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477179.1 protein_id gnl|my_center|LOCUS_08910 928494 929840 gene locus_tag LOCUS_08920 928494 929840 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_08920 931345 929936 gene locus_tag LOCUS_08930 931345 929936 CDS product lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679156.1 protein_id gnl|my_center|LOCUS_08930 932320 931349 gene locus_tag LOCUS_08940 932320 931349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 933534 932317 gene locus_tag LOCUS_08950 gene trpB 933534 932317 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496708.1 protein_id gnl|my_center|LOCUS_08950 934383 933634 gene locus_tag LOCUS_08960 934383 933634 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_08960 934436 935758 gene locus_tag LOCUS_08970 934436 935758 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870834.1 protein_id gnl|my_center|LOCUS_08970 935940 936737 gene locus_tag LOCUS_08980 935940 936737 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_08980 936794 937903 gene locus_tag LOCUS_08990 936794 937903 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_08990 938124 938609 gene locus_tag LOCUS_09000 938124 938609 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_09000 938900 938733 gene locus_tag LOCUS_09010 938900 938733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 939255 938836 gene locus_tag LOCUS_09020 939255 938836 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878018.1 protein_id gnl|my_center|LOCUS_09020 941159 939288 gene locus_tag LOCUS_09030 gene infB 941159 939288 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878271.1 protein_id gnl|my_center|LOCUS_09030 941246 941704 gene locus_tag LOCUS_09040 941246 941704 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879882.1 protein_id gnl|my_center|LOCUS_09040 941784 941954 gene locus_tag LOCUS_09050 941784 941954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 942133 942339 gene locus_tag LOCUS_09060 942133 942339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 942324 942650 gene locus_tag LOCUS_09070 942324 942650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 942647 943150 gene locus_tag LOCUS_09080 942647 943150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 943189 943923 gene locus_tag LOCUS_09090 943189 943923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 943973 945343 gene locus_tag LOCUS_09100 943973 945343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 945433 945858 gene locus_tag LOCUS_09110 945433 945858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 945902 947134 gene locus_tag LOCUS_09120 945902 947134 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064535.1 protein_id gnl|my_center|LOCUS_09120 947262 947573 gene locus_tag LOCUS_09130 947262 947573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 947618 947857 gene locus_tag LOCUS_09140 947618 947857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 947877 949727 gene locus_tag LOCUS_09150 947877 949727 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967805.1 protein_id gnl|my_center|LOCUS_09150 950169 951353 gene locus_tag LOCUS_09160 950169 951353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 951367 951801 gene locus_tag LOCUS_09170 951367 951801 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_09170 951798 952247 gene locus_tag LOCUS_09180 951798 952247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 952426 952617 gene locus_tag LOCUS_09190 952426 952617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 952610 954448 gene locus_tag LOCUS_09200 952610 954448 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396787.1 protein_id gnl|my_center|LOCUS_09200 954746 956371 gene locus_tag LOCUS_09210 954746 956371 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_09210 956372 957997 gene locus_tag LOCUS_09220 956372 957997 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969265.1 protein_id gnl|my_center|LOCUS_09220 958098 958592 gene locus_tag LOCUS_09230 958098 958592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 959181 958630 gene locus_tag LOCUS_09240 959181 958630 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_09240 959308 960441 gene locus_tag LOCUS_09250 959308 960441 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870394.1 protein_id gnl|my_center|LOCUS_09250 963867 960442 gene locus_tag LOCUS_09260 963867 960442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 963939 964751 gene locus_tag LOCUS_09270 963939 964751 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_09270 964934 965323 gene locus_tag LOCUS_09280 964934 965323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 966375 965665 gene locus_tag LOCUS_09290 966375 965665 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877867.1 protein_id gnl|my_center|LOCUS_09290 966545 966676 gene locus_tag LOCUS_09300 966545 966676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 966673 967536 gene locus_tag LOCUS_09310 gene ahbD 966673 967536 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_09310 967689 968210 gene locus_tag LOCUS_09320 967689 968210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 968207 968836 gene locus_tag LOCUS_09330 968207 968836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 969515 968859 gene locus_tag LOCUS_09340 gene pdxT 969515 968859 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878016.1 protein_id gnl|my_center|LOCUS_09340 970540 969512 gene locus_tag LOCUS_09350 gene pdxS 970540 969512 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878015.1 protein_id gnl|my_center|LOCUS_09350 972265 970610 gene locus_tag LOCUS_09360 gene guaA 972265 970610 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880099.1 protein_id gnl|my_center|LOCUS_09360 972442 973212 gene locus_tag LOCUS_09370 972442 973212 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061072.1 protein_id gnl|my_center|LOCUS_09370 973441 974934 gene locus_tag LOCUS_09380 gene glnA 973441 974934 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318802.1 protein_id gnl|my_center|LOCUS_09380 975006 975323 gene locus_tag LOCUS_09390 975006 975323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878292.1 protein_id gnl|my_center|LOCUS_09390 975359 976462 gene locus_tag LOCUS_09400 gene hisC 975359 976462 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879516.1 protein_id gnl|my_center|LOCUS_09400 976480 977703 gene locus_tag LOCUS_09410 gene hmgA 976480 977703 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146539.1 protein_id gnl|my_center|LOCUS_09410 977855 980041 gene locus_tag LOCUS_09420 977855 980041 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879387.1 protein_id gnl|my_center|LOCUS_09420 981541 980159 gene locus_tag LOCUS_09430 gene gatD 981541 980159 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_09430 982776 981655 gene locus_tag LOCUS_09440 gene rtcA 982776 981655 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_09440 984258 983044 gene locus_tag LOCUS_09450 984258 983044 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082727.1 protein_id gnl|my_center|LOCUS_09450 984727 984338 gene locus_tag LOCUS_09460 984727 984338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 984908 984834 gene locus_tag LOCUS_t00160 984908 984834 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 986136 984946 gene locus_tag LOCUS_09470 986136 984946 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020340.1 protein_id gnl|my_center|LOCUS_09470 986976 986161 gene locus_tag LOCUS_09480 986976 986161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020339.1 protein_id gnl|my_center|LOCUS_09480 988112 987066 gene locus_tag LOCUS_09490 gene wtpA 988112 987066 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020338.1 protein_id gnl|my_center|LOCUS_09490 988277 989107 gene locus_tag LOCUS_09500 988277 989107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 989285 989659 gene locus_tag LOCUS_09510 989285 989659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 989799 990197 gene locus_tag LOCUS_09520 gene rpl14p 989799 990197 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879408.1 protein_id gnl|my_center|LOCUS_09520 990200 990439 gene locus_tag LOCUS_09530 990200 990439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 990491 990576 gene locus_tag LOCUS_t00170 990491 990576 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 990660 991262 gene locus_tag LOCUS_09540 990660 991262 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_09540 991293 992012 gene locus_tag LOCUS_09550 991293 992012 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_09550 992284 992009 gene locus_tag LOCUS_09560 992284 992009 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_09560 992340 992573 gene locus_tag LOCUS_09570 992340 992573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 993516 992617 gene locus_tag LOCUS_09580 993516 992617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 999124 993530 gene locus_tag LOCUS_09590 999124 993530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1001415 999361 gene locus_tag LOCUS_09600 1001415 999361 CDS product IGHMBP2 family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838098.1 protein_id gnl|my_center|LOCUS_09600 1001459 1002508 gene locus_tag LOCUS_09610 1001459 1002508 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020113.1 protein_id gnl|my_center|LOCUS_09610 1002634 1003173 gene locus_tag LOCUS_09620 1002634 1003173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1003204 1004829 gene locus_tag LOCUS_09630 1003204 1004829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1004829 1005062 gene locus_tag LOCUS_09640 1004829 1005062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1005064 1005882 gene locus_tag LOCUS_09650 1005064 1005882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1006058 1006186 gene locus_tag LOCUS_09660 1006058 1006186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1006299 1007879 gene locus_tag LOCUS_09670 1006299 1007879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1007876 1010101 gene locus_tag LOCUS_09680 1007876 1010101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1010250 1010486 gene locus_tag LOCUS_09690 1010250 1010486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1010483 1010899 gene locus_tag LOCUS_09700 1010483 1010899 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248971.1 protein_id gnl|my_center|LOCUS_09700 1010919 1011137 gene locus_tag LOCUS_09710 1010919 1011137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1011190 1011432 gene locus_tag LOCUS_09720 1011190 1011432 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250027.1 protein_id gnl|my_center|LOCUS_09720 1011429 1011836 gene locus_tag LOCUS_09730 1011429 1011836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1011946 1012275 gene locus_tag LOCUS_09740 1011946 1012275 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582723.1 protein_id gnl|my_center|LOCUS_09740 1012347 1012658 gene locus_tag LOCUS_09750 1012347 1012658 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066199.1 protein_id gnl|my_center|LOCUS_09750 1012645 1012797 gene locus_tag LOCUS_09760 1012645 1012797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09760 1012855 1012983 gene locus_tag LOCUS_09770 1012855 1012983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1013026 1013172 gene locus_tag LOCUS_09780 1013026 1013172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1013215 1014225 gene locus_tag LOCUS_09790 1013215 1014225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1014376 1015527 gene locus_tag LOCUS_09800 1014376 1015527 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867980.1 protein_id gnl|my_center|LOCUS_09800 1015609 1017330 gene locus_tag LOCUS_09810 1015609 1017330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1018416 1017355 gene locus_tag LOCUS_09820 gene thiL 1018416 1017355 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_09820 1019829 1018492 gene locus_tag LOCUS_09830 1019829 1018492 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878861.1 protein_id gnl|my_center|LOCUS_09830 1020156 1019884 gene locus_tag LOCUS_09840 1020156 1019884 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_09840 1020278 1021198 gene locus_tag LOCUS_09850 1020278 1021198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1022222 1021149 gene locus_tag LOCUS_09860 1022222 1021149 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064863.1 protein_id gnl|my_center|LOCUS_09860 1022466 1022164 gene locus_tag LOCUS_09870 1022466 1022164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1022753 1022448 gene locus_tag LOCUS_09880 1022753 1022448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1023244 1022915 gene locus_tag LOCUS_09890 1023244 1022915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1023316 1023906 gene locus_tag LOCUS_09900 gene yjjX 1023316 1023906 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250698.1 protein_id gnl|my_center|LOCUS_09900 1025030 1024119 gene locus_tag LOCUS_09910 1025030 1024119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1026052 1025180 gene locus_tag LOCUS_09920 gene pheA 1026052 1025180 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066451.1 protein_id gnl|my_center|LOCUS_09920 1026587 1026090 gene locus_tag LOCUS_09930 1026587 1026090 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_09930 1026675 1026602 gene locus_tag LOCUS_t00180 1026675 1026602 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1026824 1028302 gene locus_tag LOCUS_09940 1026824 1028302 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870510.1 protein_id gnl|my_center|LOCUS_09940 1028397 1029008 gene locus_tag LOCUS_09950 1028397 1029008 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_09950 1029043 1029113 gene locus_tag LOCUS_t00190 1029043 1029113 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1029741 1030553 gene locus_tag LOCUS_09960 1029741 1030553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1031862 1030591 gene locus_tag LOCUS_09970 1031862 1030591 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879688.1 protein_id gnl|my_center|LOCUS_09970 1033126 1031888 gene locus_tag LOCUS_09980 1033126 1031888 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_09980 1033264 1033818 gene locus_tag LOCUS_09990 1033264 1033818 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066543.1 protein_id gnl|my_center|LOCUS_09990 1033791 1034417 gene locus_tag LOCUS_10000 1033791 1034417 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870283.1 protein_id gnl|my_center|LOCUS_10000 1034800 1034435 gene locus_tag LOCUS_10010 gene rplX 1034800 1034435 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869967.1 protein_id gnl|my_center|LOCUS_10010 1034955 1036268 gene locus_tag LOCUS_10020 1034955 1036268 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_10020 1036473 1037006 gene locus_tag LOCUS_10030 1036473 1037006 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393700.1 protein_id gnl|my_center|LOCUS_10030 1037398 1037856 gene locus_tag LOCUS_10040 1037398 1037856 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869527.1 protein_id gnl|my_center|LOCUS_10040 1037971 1038201 gene locus_tag LOCUS_10050 1037971 1038201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1038231 1038464 gene locus_tag LOCUS_10060 1038231 1038464 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878411.1 protein_id gnl|my_center|LOCUS_10060 1038562 1039455 gene locus_tag LOCUS_10070 gene dapA 1038562 1039455 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_10070 1040279 1039464 gene locus_tag LOCUS_10080 gene truA 1040279 1039464 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064445.1 protein_id gnl|my_center|LOCUS_10080 1043240 1040316 gene locus_tag LOCUS_10090 1043240 1040316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1044017 1043433 gene locus_tag LOCUS_10100 1044017 1043433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1044112 1045599 gene locus_tag LOCUS_10110 1044112 1045599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1046455 1045589 gene locus_tag LOCUS_10120 gene purQ 1046455 1045589 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_10120 1046566 1047507 gene locus_tag LOCUS_10130 gene ilvE 1046566 1047507 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_10130 1047571 1047783 gene locus_tag LOCUS_10140 1047571 1047783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1048751 1047855 gene locus_tag LOCUS_10150 1048751 1047855 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 protein_id gnl|my_center|LOCUS_10150 1049804 1048800 gene locus_tag LOCUS_10160 1049804 1048800 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_10160 1049854 1051140 gene locus_tag LOCUS_10170 1049854 1051140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1051195 1052838 gene locus_tag LOCUS_10180 1051195 1052838 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583972.1 protein_id gnl|my_center|LOCUS_10180 1052951 1054195 gene locus_tag LOCUS_10190 1052951 1054195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1054171 1056984 gene locus_tag LOCUS_10200 gene rad50 1054171 1056984 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251161.1 protein_id gnl|my_center|LOCUS_10200 1057120 1057692 gene locus_tag LOCUS_10210 1057120 1057692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10210 1057716 1058096 gene locus_tag LOCUS_10220 1057716 1058096 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249913.1 protein_id gnl|my_center|LOCUS_10220 1058093 1058497 gene locus_tag LOCUS_10230 1058093 1058497 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229002.1 protein_id gnl|my_center|LOCUS_10230 1058757 1064087 gene locus_tag LOCUS_10240 1058757 1064087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1064803 1064210 gene locus_tag LOCUS_10250 1064803 1064210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249130.1 protein_id gnl|my_center|LOCUS_10250 1064982 1065260 gene locus_tag LOCUS_10260 1064982 1065260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1065257 1065586 gene locus_tag LOCUS_10270 gene mnhG 1065257 1065586 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249571.1 protein_id gnl|my_center|LOCUS_10270 1065672 1066190 gene locus_tag LOCUS_10280 1065672 1066190 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_10280 1066291 1066536 gene locus_tag LOCUS_10290 1066291 1066536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1066533 1067066 gene locus_tag LOCUS_10300 1066533 1067066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10300 1067063 1067632 gene locus_tag LOCUS_10310 1067063 1067632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1067731 1068171 gene locus_tag LOCUS_10320 1067731 1068171 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_10320 1068540 1070180 gene locus_tag LOCUS_10330 gene thsB 1068540 1070180 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_10330 1070241 1071620 gene locus_tag LOCUS_10340 1070241 1071620 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_10340 1072337 1071762 gene locus_tag LOCUS_10350 1072337 1071762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1072734 1072450 gene locus_tag LOCUS_10360 1072734 1072450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1074762 1072885 gene locus_tag LOCUS_10370 1074762 1072885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1074882 1075958 gene locus_tag LOCUS_10380 1074882 1075958 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_10380 1075955 1076866 gene locus_tag LOCUS_10390 gene cofD 1075955 1076866 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878417.1 protein_id gnl|my_center|LOCUS_10390 1076945 1077931 gene locus_tag LOCUS_10400 1076945 1077931 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_10400 1078267 1077980 gene locus_tag LOCUS_10410 1078267 1077980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1078747 1078277 gene locus_tag LOCUS_10420 1078747 1078277 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_10420 1079270 1078719 gene locus_tag LOCUS_10430 1079270 1078719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1080355 1079267 gene locus_tag LOCUS_10440 1080355 1079267 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_10440 1080411 1081487 gene locus_tag LOCUS_10450 1080411 1081487 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877877.1 protein_id gnl|my_center|LOCUS_10450 1082098 1081463 gene locus_tag LOCUS_10460 1082098 1081463 CDS product DUF2119 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870002.1 protein_id gnl|my_center|LOCUS_10460 1082268 1085759 gene locus_tag LOCUS_10470 1082268 1085759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1086680 1085769 gene locus_tag LOCUS_10480 1086680 1085769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875877.1 protein_id gnl|my_center|LOCUS_10480 1086756 1087151 gene locus_tag LOCUS_10490 1086756 1087151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1088278 1087133 gene locus_tag LOCUS_10500 1088278 1087133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1089656 1088292 gene locus_tag LOCUS_10510 gene pscS 1089656 1088292 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966499.1 protein_id gnl|my_center|LOCUS_10510 1089763 1090107 gene locus_tag LOCUS_10520 1089763 1090107 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_10520 1090159 1090710 gene locus_tag LOCUS_10530 1090159 1090710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1090695 1090928 gene locus_tag LOCUS_10540 1090695 1090928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1091036 1092256 gene locus_tag LOCUS_10550 1091036 1092256 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_10550 1092361 1094025 gene locus_tag LOCUS_10560 1092361 1094025 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869499.1 protein_id gnl|my_center|LOCUS_10560 1094022 1094255 gene locus_tag LOCUS_10570 1094022 1094255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1094275 1095027 gene locus_tag LOCUS_10580 1094275 1095027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1095662 1095081 gene locus_tag LOCUS_10590 1095662 1095081 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020740.1 protein_id gnl|my_center|LOCUS_10590 1096926 1095724 gene locus_tag LOCUS_10600 gene ftsY 1096926 1095724 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024000.1 protein_id gnl|my_center|LOCUS_10600 1097522 1096971 gene locus_tag LOCUS_10610 1097522 1096971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1097728 1097910 gene locus_tag LOCUS_10620 1097728 1097910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1099563 1097962 gene locus_tag LOCUS_10630 1099563 1097962 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546886.1 protein_id gnl|my_center|LOCUS_10630 1100365 1099565 gene locus_tag LOCUS_10640 gene frhB 1100365 1099565 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496371.1 protein_id gnl|my_center|LOCUS_10640 1101080 1100751 gene locus_tag LOCUS_10650 1101080 1100751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1101947 1101420 gene locus_tag LOCUS_10660 1101947 1101420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1103215 1101950 gene locus_tag LOCUS_10670 1103215 1101950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1104967 1103456 gene locus_tag LOCUS_10680 1104967 1103456 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_10680 1105845 1105462 gene locus_tag LOCUS_10690 1105845 1105462 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878647.1 protein_id gnl|my_center|LOCUS_10690 1105929 1107350 gene locus_tag LOCUS_10700 1105929 1107350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1107380 1108066 gene locus_tag LOCUS_10710 1107380 1108066 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_10710 1108203 1108565 gene locus_tag LOCUS_10720 1108203 1108565 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_10720 1108585 1109226 gene locus_tag LOCUS_10730 1108585 1109226 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878334.1 protein_id gnl|my_center|LOCUS_10730 1109359 1109946 gene locus_tag LOCUS_10740 1109359 1109946 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879016.1 protein_id gnl|my_center|LOCUS_10740 1110799 1109990 gene locus_tag LOCUS_10750 1110799 1109990 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_10750 1111068 1110892 gene locus_tag LOCUS_10760 1111068 1110892 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250050.1 protein_id gnl|my_center|LOCUS_10760 1111400 1111191 gene locus_tag LOCUS_10770 1111400 1111191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1112381 1111497 gene locus_tag LOCUS_10780 1112381 1111497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1113556 1112678 gene locus_tag LOCUS_10790 1113556 1112678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10790 1115083 1113884 gene locus_tag LOCUS_10800 gene priS 1115083 1113884 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_10800 1115196 1116065 gene locus_tag LOCUS_10810 gene hisG 1115196 1116065 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_10810 1116185 1116904 gene locus_tag LOCUS_10820 1116185 1116904 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879510.1 protein_id gnl|my_center|LOCUS_10820 1117540 1116896 gene locus_tag LOCUS_10830 1117540 1116896 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060730.1 protein_id gnl|my_center|LOCUS_10830 1117657 1117839 gene locus_tag LOCUS_10840 1117657 1117839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1118121 1118279 gene locus_tag LOCUS_10850 1118121 1118279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1118426 1118761 gene locus_tag LOCUS_10860 1118426 1118761 CDS product DUF5320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879879.1 protein_id gnl|my_center|LOCUS_10860 1118846 1119220 gene locus_tag LOCUS_10870 1118846 1119220 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392925.1 protein_id gnl|my_center|LOCUS_10870 1119217 1119690 gene locus_tag LOCUS_10880 1119217 1119690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1119707 1120138 gene locus_tag LOCUS_10890 1119707 1120138 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064575.1 protein_id gnl|my_center|LOCUS_10890 1120221 1121159 gene locus_tag LOCUS_10900 1120221 1121159 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_10900 1121214 1122218 gene locus_tag LOCUS_10910 1121214 1122218 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024123.1 protein_id gnl|my_center|LOCUS_10910 1122272 1123765 gene locus_tag LOCUS_10920 gene lysS 1122272 1123765 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066108.1 protein_id gnl|my_center|LOCUS_10920 1124708 1123926 gene locus_tag LOCUS_10930 1124708 1123926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1125935 1124787 gene locus_tag LOCUS_10940 1125935 1124787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1126979 1125942 gene locus_tag LOCUS_10950 1126979 1125942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1127302 1127229 gene locus_tag LOCUS_t00200 1127302 1127229 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1127369 1128754 gene locus_tag LOCUS_10960 1127369 1128754 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598734.1 protein_id gnl|my_center|LOCUS_10960 1128814 1129143 gene locus_tag LOCUS_10970 1128814 1129143 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064407.1 protein_id gnl|my_center|LOCUS_10970 1130250 1129177 gene locus_tag LOCUS_10980 gene twy1 1130250 1129177 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020099.1 protein_id gnl|my_center|LOCUS_10980 1130581 1130216 gene locus_tag LOCUS_10990 1130581 1130216 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 protein_id gnl|my_center|LOCUS_10990 1130933 1130730 gene locus_tag LOCUS_11000 1130933 1130730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1131537 1130926 gene locus_tag LOCUS_11010 1131537 1130926 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_11010 1132488 1131634 gene locus_tag LOCUS_11020 1132488 1131634 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878217.1 protein_id gnl|my_center|LOCUS_11020 1133511 1132636 gene locus_tag LOCUS_11030 1133511 1132636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1133589 1134398 gene locus_tag LOCUS_11040 1133589 1134398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1134565 1134948 gene locus_tag LOCUS_11050 1134565 1134948 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868249.1 protein_id gnl|my_center|LOCUS_11050 1135080 1136525 gene locus_tag LOCUS_11060 gene aspS 1135080 1136525 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_11060 1136727 1138397 gene locus_tag LOCUS_11070 1136727 1138397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1138423 1140543 gene locus_tag LOCUS_11080 gene hdrA 1138423 1140543 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_11080 1140696 1141097 gene locus_tag LOCUS_11090 1140696 1141097 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021394.1 protein_id gnl|my_center|LOCUS_11090 1141145 1141303 gene locus_tag LOCUS_11100 1141145 1141303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1141410 1142606 gene locus_tag LOCUS_11110 1141410 1142606 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878787.1 protein_id gnl|my_center|LOCUS_11110 1142739 1143158 gene locus_tag LOCUS_11120 1142739 1143158 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878788.1 protein_id gnl|my_center|LOCUS_11120 1143212 1144069 gene locus_tag LOCUS_11130 1143212 1144069 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_11130 1144066 1144887 gene locus_tag LOCUS_11140 1144066 1144887 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_11140 1144906 1145622 gene locus_tag LOCUS_11150 1144906 1145622 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_11150 1147624 1145633 gene locus_tag LOCUS_11160 gene hdrA 1147624 1145633 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_11160 1148967 1147621 gene locus_tag LOCUS_11170 1148967 1147621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1150168 1148978 gene locus_tag LOCUS_11180 1150168 1148978 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020662.1 protein_id gnl|my_center|LOCUS_11180 1150530 1151117 gene locus_tag LOCUS_11190 1150530 1151117 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_11190 1151186 1152472 gene locus_tag LOCUS_11200 1151186 1152472 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318432.1 protein_id gnl|my_center|LOCUS_11200 1152699 1153976 gene locus_tag LOCUS_11210 1152699 1153976 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021469.1 protein_id gnl|my_center|LOCUS_11210 1155161 1155311 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1155965 1155312 gene locus_tag LOCUS_11220 1155965 1155312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1155939 1160642 gene locus_tag LOCUS_11230 1155939 1160642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1157827 1157836 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1161457 1160702 gene locus_tag LOCUS_11240 gene pstB 1161457 1160702 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986851.1 protein_id gnl|my_center|LOCUS_11240 1162367 1161480 gene locus_tag LOCUS_11250 gene pstA 1162367 1161480 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990843.1 protein_id gnl|my_center|LOCUS_11250 1163275 1162364 gene locus_tag LOCUS_11260 gene pstC 1163275 1162364 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_11260 1164367 1163348 gene locus_tag LOCUS_11270 1164367 1163348 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_11270 1165599 1164955 gene locus_tag LOCUS_11280 1165599 1164955 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 protein_id gnl|my_center|LOCUS_11280 1165730 1166746 gene locus_tag LOCUS_11290 1165730 1166746 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871181.1 protein_id gnl|my_center|LOCUS_11290 1166805 1167278 gene locus_tag LOCUS_11300 1166805 1167278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1167312 1168037 gene locus_tag LOCUS_11310 1167312 1168037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1168641 1172132 gene locus_tag LOCUS_11320 1168641 1172132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1172833 1172129 gene locus_tag LOCUS_11330 1172833 1172129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1172899 1173576 gene locus_tag LOCUS_11340 1172899 1173576 CDS product amino acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021487.1 protein_id gnl|my_center|LOCUS_11340 1174033 1173614 gene locus_tag LOCUS_11350 1174033 1173614 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868448.1 protein_id gnl|my_center|LOCUS_11350 1174170 1175057 gene locus_tag LOCUS_11360 1174170 1175057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064248.1 protein_id gnl|my_center|LOCUS_11360 1175101 1175691 gene locus_tag LOCUS_11370 1175101 1175691 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878168.1 protein_id gnl|my_center|LOCUS_11370 1176423 1175848 gene locus_tag LOCUS_11380 1176423 1175848 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_11380 1177571 1176573 gene locus_tag LOCUS_11390 1177571 1176573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1178781 1177576 gene locus_tag LOCUS_11400 gene ahbD 1178781 1177576 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_11400 1179770 1178763 gene locus_tag LOCUS_11410 1179770 1178763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1179904 1181004 gene locus_tag LOCUS_11420 1179904 1181004 CDS product CofH family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064223.1 protein_id gnl|my_center|LOCUS_11420 1181006 1181854 gene locus_tag LOCUS_11430 1181006 1181854 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064224.1 protein_id gnl|my_center|LOCUS_11430 1181878 1182996 gene locus_tag LOCUS_11440 gene mqnC 1181878 1182996 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877897.1 protein_id gnl|my_center|LOCUS_11440 1183558 1183223 gene locus_tag LOCUS_11450 1183558 1183223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1184245 1183706 gene locus_tag LOCUS_11460 1184245 1183706 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061181.1 protein_id gnl|my_center|LOCUS_11460 1184373 1185233 gene locus_tag LOCUS_11470 1184373 1185233 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879200.1 protein_id gnl|my_center|LOCUS_11470 1185335 1185931 gene locus_tag LOCUS_11480 1185335 1185931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1185924 1187675 gene locus_tag LOCUS_11490 1185924 1187675 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545652.1 protein_id gnl|my_center|LOCUS_11490 1187704 1188672 gene locus_tag LOCUS_11500 1187704 1188672 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867916.1 protein_id gnl|my_center|LOCUS_11500 1188677 1189150 gene locus_tag LOCUS_11510 1188677 1189150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867917.1 protein_id gnl|my_center|LOCUS_11510 1189359 1189288 gene locus_tag LOCUS_t00210 1189359 1189288 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1193103 1189462 gene locus_tag LOCUS_r00010 1193103 1189462 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1193312 1193241 gene locus_tag LOCUS_t00220 1193312 1193241 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1194845 1193374 gene locus_tag LOCUS_r00020 1194845 1193374 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1196450 1195170 gene locus_tag LOCUS_11520 1196450 1195170 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_11520 1196535 1200167 gene locus_tag LOCUS_11530 1196535 1200167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1200277 1200912 gene locus_tag LOCUS_11540 1200277 1200912 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_11540 1202170 1200896 gene locus_tag LOCUS_11550 gene argJ 1202170 1200896 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023478.1 protein_id gnl|my_center|LOCUS_11550 1202232 1202304 gene locus_tag LOCUS_t00230 1202232 1202304 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1202978 1202304 gene locus_tag LOCUS_11560 gene rnhB 1202978 1202304 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876654.1 protein_id gnl|my_center|LOCUS_11560 1204338 1203064 gene locus_tag LOCUS_11570 1204338 1203064 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_11570 1204428 1205687 gene locus_tag LOCUS_11580 1204428 1205687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1206408 1205692 gene locus_tag LOCUS_11590 1206408 1205692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1206528 1207388 gene locus_tag LOCUS_11600 1206528 1207388 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 protein_id gnl|my_center|LOCUS_11600 1208861 1207419 gene locus_tag LOCUS_11610 gene glmM 1208861 1207419 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250059.1 protein_id gnl|my_center|LOCUS_11610 1210051 1208915 gene locus_tag LOCUS_11620 1210051 1208915 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_11620 1211629 1210172 gene locus_tag LOCUS_11630 1211629 1210172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1212831 1211644 gene locus_tag LOCUS_11640 gene porA 1212831 1211644 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250933.1 protein_id gnl|my_center|LOCUS_11640 1212960 1213679 gene locus_tag LOCUS_11650 gene hisH 1212960 1213679 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903536.1 protein_id gnl|my_center|LOCUS_11650 1215111 1213975 gene locus_tag LOCUS_11660 1215111 1213975 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249158.1 protein_id gnl|my_center|LOCUS_11660 1215235 1215318 gene locus_tag LOCUS_t00240 1215235 1215318 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1216131 1215346 gene locus_tag LOCUS_11670 1216131 1215346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1216195 1216656 gene locus_tag LOCUS_11680 1216195 1216656 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022827.1 protein_id gnl|my_center|LOCUS_11680 1217779 1216724 gene locus_tag LOCUS_11690 gene dph2 1217779 1216724 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868245.1 protein_id gnl|my_center|LOCUS_11690 1219058 1217844 gene locus_tag LOCUS_11700 1219058 1217844 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024465.1 protein_id gnl|my_center|LOCUS_11700 1219882 1219055 gene locus_tag LOCUS_11710 1219882 1219055 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_11710 1222057 1220171 gene locus_tag LOCUS_11720 1222057 1220171 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546184.1 protein_id gnl|my_center|LOCUS_11720 1222974 1222300 gene locus_tag LOCUS_11730 gene psmB 1222974 1222300 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 protein_id gnl|my_center|LOCUS_11730 1223534 1223058 gene locus_tag LOCUS_11740 gene nikR 1223534 1223058 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 protein_id gnl|my_center|LOCUS_11740 1224062 1223547 gene locus_tag LOCUS_11750 1224062 1223547 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021822.1 protein_id gnl|my_center|LOCUS_11750 1224509 1224120 gene locus_tag LOCUS_11760 1224509 1224120 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066255.1 protein_id gnl|my_center|LOCUS_11760 1225468 1224557 gene locus_tag LOCUS_11770 1225468 1224557 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 protein_id gnl|my_center|LOCUS_11770 1226488 1225574 gene locus_tag LOCUS_11780 1226488 1225574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1227313 1226582 gene locus_tag LOCUS_11790 gene cofC 1227313 1226582 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879553.1 protein_id gnl|my_center|LOCUS_11790 1227536 1229185 gene locus_tag LOCUS_11800 1227536 1229185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1229506 1230780 gene locus_tag LOCUS_11810 1229506 1230780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1231802 1230774 gene locus_tag LOCUS_11820 1231802 1230774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1232317 1231769 gene locus_tag LOCUS_11830 1232317 1231769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1232471 1234210 gene locus_tag LOCUS_11840 1232471 1234210 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048165814.1 protein_id gnl|my_center|LOCUS_11840 1235716 1234211 gene locus_tag LOCUS_11850 1235716 1234211 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_11850 1237839 1235719 gene locus_tag LOCUS_11860 1237839 1235719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1239335 1237836 gene locus_tag LOCUS_11870 1239335 1237836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1240581 1239436 gene locus_tag LOCUS_11880 1240581 1239436 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_11880 1241622 1240930 gene locus_tag LOCUS_11890 1241622 1240930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1243831 1242836 gene locus_tag LOCUS_11900 1243831 1242836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1243932 1245134 gene locus_tag LOCUS_11910 1243932 1245134 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875977.1 protein_id gnl|my_center|LOCUS_11910 1245109 1246083 gene locus_tag LOCUS_11920 1245109 1246083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1246085 1247266 gene locus_tag LOCUS_11930 1246085 1247266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1247660 1247466 gene locus_tag LOCUS_11940 1247660 1247466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1248974 1247715 gene locus_tag LOCUS_11950 1248974 1247715 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790938.1 protein_id gnl|my_center|LOCUS_11950 1249858 1249082 gene locus_tag LOCUS_11960 1249858 1249082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1251069 1249855 gene locus_tag LOCUS_11970 1251069 1249855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1251285 1251509 gene locus_tag LOCUS_11980 1251285 1251509 CDS product Sm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021429.1 protein_id gnl|my_center|LOCUS_11980 1251671 1252561 gene locus_tag LOCUS_11990 gene proC 1251671 1252561 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_11990 1252558 1253607 gene locus_tag LOCUS_12000 1252558 1253607 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879283.1 protein_id gnl|my_center|LOCUS_12000 1255410 1253674 gene locus_tag LOCUS_12010 gene ade 1255410 1253674 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877751.1 protein_id gnl|my_center|LOCUS_12010 1256229 1255432 gene locus_tag LOCUS_12020 1256229 1255432 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392339.1 protein_id gnl|my_center|LOCUS_12020 1256378 1256451 gene locus_tag LOCUS_t00250 1256378 1256451 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1256554 1257294 gene locus_tag LOCUS_12030 gene psmA 1256554 1257294 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_12030 1257324 1258037 gene locus_tag LOCUS_12040 1257324 1258037 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877998.1 protein_id gnl|my_center|LOCUS_12040 1258100 1258966 gene locus_tag LOCUS_12050 gene rrp4 1258100 1258966 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_12050 1258963 1259733 gene locus_tag LOCUS_12060 gene rrp41 1258963 1259733 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878000.1 protein_id gnl|my_center|LOCUS_12060 1259773 1260564 gene locus_tag LOCUS_12070 gene rrp42 1259773 1260564 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021779.1 protein_id gnl|my_center|LOCUS_12070 1262063 1260621 gene locus_tag LOCUS_12080 gene purF 1262063 1260621 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_12080 1263403 1262060 gene locus_tag LOCUS_12090 gene hisS 1263403 1262060 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879138.1 protein_id gnl|my_center|LOCUS_12090 1265127 1263550 gene locus_tag LOCUS_12100 1265127 1263550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1266427 1265129 gene locus_tag LOCUS_12110 1266427 1265129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1267688 1266441 gene locus_tag LOCUS_12120 1267688 1266441 CDS product DUF2791 family P-loop domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875950.1 protein_id gnl|my_center|LOCUS_12120 1268515 1267685 gene locus_tag LOCUS_12130 1268515 1267685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1268747 1268562 gene locus_tag LOCUS_12140 1268747 1268562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1268859 1269311 gene locus_tag LOCUS_12150 1268859 1269311 CDS product paREP15, coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546267.1 protein_id gnl|my_center|LOCUS_12150 1269410 1271992 gene locus_tag LOCUS_12160 1269410 1271992 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879019.1 protein_id gnl|my_center|LOCUS_12160 1271934 1272134 gene locus_tag LOCUS_12170 1271934 1272134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1272135 1273382 gene locus_tag LOCUS_12180 1272135 1273382 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064633.1 protein_id gnl|my_center|LOCUS_12180 1274002 1273532 gene locus_tag LOCUS_12190 1274002 1273532 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879695.1 protein_id gnl|my_center|LOCUS_12190 1274941 1274015 gene locus_tag LOCUS_12200 1274941 1274015 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274369.1 protein_id gnl|my_center|LOCUS_12200 1276041 1275289 gene locus_tag LOCUS_12210 1276041 1275289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095282.1 protein_id gnl|my_center|LOCUS_12210 1276512 1276057 gene locus_tag LOCUS_12220 1276512 1276057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1276913 1276521 gene locus_tag LOCUS_12230 1276913 1276521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1277005 1278624 gene locus_tag LOCUS_12240 1277005 1278624 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877754.1 protein_id gnl|my_center|LOCUS_12240 1278722 1279081 gene locus_tag LOCUS_12250 1278722 1279081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1279459 1279112 gene locus_tag LOCUS_12260 1279459 1279112 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011696863.1 protein_id gnl|my_center|LOCUS_12260 1279843 1279520 gene locus_tag LOCUS_12270 1279843 1279520 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021109.1 protein_id gnl|my_center|LOCUS_12270 1280260 1279943 gene locus_tag LOCUS_12280 gene yciH 1280260 1279943 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875652.1 protein_id gnl|my_center|LOCUS_12280 1280701 1280477 gene locus_tag LOCUS_12290 gene rpmC 1280701 1280477 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021108.1 protein_id gnl|my_center|LOCUS_12290 1281495 1280734 gene locus_tag LOCUS_12300 1281495 1280734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1281626 1282603 gene locus_tag LOCUS_12310 gene idsA 1281626 1282603 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_12310 1282694 1282849 gene locus_tag LOCUS_12320 1282694 1282849 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879404.1 protein_id gnl|my_center|LOCUS_12320 1282876 1283268 gene locus_tag LOCUS_12330 1282876 1283268 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_12330 1283290 1284090 gene locus_tag LOCUS_12340 1283290 1284090 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546052.1 protein_id gnl|my_center|LOCUS_12340 1284540 1284094 gene locus_tag LOCUS_12350 1284540 1284094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1285058 1284588 gene locus_tag LOCUS_12360 1285058 1284588 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_12360 1285157 1285984 gene locus_tag LOCUS_12370 1285157 1285984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1286851 1286072 gene locus_tag LOCUS_12380 1286851 1286072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1287743 1286955 gene locus_tag LOCUS_12390 1287743 1286955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1289234 1288113 gene locus_tag LOCUS_12400 gene fbp 1289234 1288113 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878939.1 protein_id gnl|my_center|LOCUS_12400 1289856 1289344 gene locus_tag LOCUS_12410 1289856 1289344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1290992 1289853 gene locus_tag LOCUS_12420 1290992 1289853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1292280 1291249 gene locus_tag LOCUS_12430 gene aglJ 1292280 1291249 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877894.1 protein_id gnl|my_center|LOCUS_12430 1293369 1292353 gene locus_tag LOCUS_12440 gene gap 1293369 1292353 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_12440 1295430 1293457 gene locus_tag LOCUS_12450 1295430 1293457 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_12450 1295672 1296625 gene locus_tag LOCUS_12460 1295672 1296625 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_12460 1296904 1297716 gene locus_tag LOCUS_12470 1296904 1297716 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_12470 1298311 1297673 gene locus_tag LOCUS_12480 1298311 1297673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083091.1 protein_id gnl|my_center|LOCUS_12480 1299298 1298438 gene locus_tag LOCUS_12490 gene artA 1299298 1298438 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879538.1 protein_id gnl|my_center|LOCUS_12490 1300627 1299308 gene locus_tag LOCUS_12500 1300627 1299308 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879532.1 protein_id gnl|my_center|LOCUS_12500 1300666 1301451 gene locus_tag LOCUS_12510 1300666 1301451 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065795.1 protein_id gnl|my_center|LOCUS_12510 1301470 1302237 gene locus_tag LOCUS_12520 1301470 1302237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1302467 1304995 gene locus_tag LOCUS_12530 1302467 1304995 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020155.1 protein_id gnl|my_center|LOCUS_12530 1305130 1306149 gene locus_tag LOCUS_12540 1305130 1306149 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878344.1 protein_id gnl|my_center|LOCUS_12540 1307162 1306218 gene locus_tag LOCUS_12550 gene speE 1307162 1306218 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249102.1 protein_id gnl|my_center|LOCUS_12550 1307579 1307184 gene locus_tag LOCUS_12560 gene speD 1307579 1307184 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545906.1 protein_id gnl|my_center|LOCUS_12560 1309071 1307818 gene locus_tag LOCUS_12570 gene coaBC 1309071 1307818 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065075.1 protein_id gnl|my_center|LOCUS_12570 1309148 1309076 gene locus_tag LOCUS_t00260 1309148 1309076 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1309287 1310405 gene locus_tag LOCUS_12580 1309287 1310405 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_12580 1310474 1312861 gene locus_tag LOCUS_12590 gene cdhA 1310474 1312861 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879884.1 protein_id gnl|my_center|LOCUS_12590 1313037 1313570 gene locus_tag LOCUS_12600 gene cdhB 1313037 1313570 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879885.1 protein_id gnl|my_center|LOCUS_12600 1313845 1315191 gene locus_tag LOCUS_12610 1313845 1315191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1315288 1315452 gene locus_tag LOCUS_12620 1315288 1315452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1315511 1316338 gene locus_tag LOCUS_12630 1315511 1316338 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546361.1 protein_id gnl|my_center|LOCUS_12630 1316410 1316976 gene locus_tag LOCUS_12640 1316410 1316976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1317720 1317133 gene locus_tag LOCUS_12650 1317720 1317133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1318297 1317887 gene locus_tag LOCUS_12660 gene rpsS 1318297 1317887 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879414.1 protein_id gnl|my_center|LOCUS_12660 1319152 1318373 gene locus_tag LOCUS_12670 1319152 1318373 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879415.1 protein_id gnl|my_center|LOCUS_12670 1319378 1319184 gene locus_tag LOCUS_12680 1319378 1319184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1319469 1320446 gene locus_tag LOCUS_12690 1319469 1320446 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_12690 1320521 1321276 gene locus_tag LOCUS_12700 1320521 1321276 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_12700 1321304 1321993 gene locus_tag LOCUS_12710 1321304 1321993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1322053 1322817 gene locus_tag LOCUS_12720 1322053 1322817 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088944.1 protein_id gnl|my_center|LOCUS_12720 1323508 1322834 gene locus_tag LOCUS_12730 1323508 1322834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1324159 1323527 gene locus_tag LOCUS_12740 1324159 1323527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1325017 1324163 gene locus_tag LOCUS_12750 gene larE 1325017 1324163 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080596.1 protein_id gnl|my_center|LOCUS_12750 1325213 1326307 gene locus_tag LOCUS_12760 1325213 1326307 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_12760 1326244 1326648 gene locus_tag LOCUS_12770 1326244 1326648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1326663 1327631 gene locus_tag LOCUS_12780 1326663 1327631 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_12780 1327697 1328386 gene locus_tag LOCUS_12790 1327697 1328386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1328524 1329255 gene locus_tag LOCUS_12800 1328524 1329255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1329257 1330066 gene locus_tag LOCUS_12810 1329257 1330066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1330066 1331358 gene locus_tag LOCUS_12820 1330066 1331358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1331482 1334580 gene locus_tag LOCUS_12830 gene ileS 1331482 1334580 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_12830 1334603 1335010 gene locus_tag LOCUS_12840 1334603 1335010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1335192 1335404 gene locus_tag LOCUS_12850 1335192 1335404 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020514.1 protein_id gnl|my_center|LOCUS_12850 1337661 1335586 gene locus_tag LOCUS_12860 gene lonB 1337661 1335586 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023222.1 protein_id gnl|my_center|LOCUS_12860 1339212 1337746 gene locus_tag LOCUS_12870 1339212 1337746 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_12870 1339420 1340328 gene locus_tag LOCUS_12880 1339420 1340328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1340507 1354090 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttaaacacggactaaggtaggattgaaag 1356107 1354545 gene locus_tag LOCUS_12890 1356107 1354545 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_12890 1357096 1356329 gene locus_tag LOCUS_12900 1357096 1356329 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990915.1 protein_id gnl|my_center|LOCUS_12900 1358158 1357145 gene locus_tag LOCUS_12910 1358158 1357145 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392751.1 protein_id gnl|my_center|LOCUS_12910 1359009 1358332 gene locus_tag LOCUS_12920 1359009 1358332 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 protein_id gnl|my_center|LOCUS_12920 1360365 1359235 gene locus_tag LOCUS_12930 gene trm14 1360365 1359235 CDS product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064539.1 protein_id gnl|my_center|LOCUS_12930 1361851 1360358 gene locus_tag LOCUS_12940 gene cca 1361851 1360358 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 protein_id gnl|my_center|LOCUS_12940 1362196 1361876 gene locus_tag LOCUS_12950 gene gatC 1362196 1361876 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024398.1 protein_id gnl|my_center|LOCUS_12950 1363134 1362235 gene locus_tag LOCUS_12960 1363134 1362235 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879771.1 protein_id gnl|my_center|LOCUS_12960 1363555 1363169 gene locus_tag LOCUS_12970 1363555 1363169 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 protein_id gnl|my_center|LOCUS_12970 1364176 1363592 gene locus_tag LOCUS_12980 gene rpsD 1364176 1363592 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875676.1 protein_id gnl|my_center|LOCUS_12980 1364777 1364250 gene locus_tag LOCUS_12990 1364777 1364250 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_12990 1366028 1365006 gene locus_tag LOCUS_13000 1366028 1365006 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021133.1 protein_id gnl|my_center|LOCUS_13000 1368747 1366021 gene locus_tag LOCUS_13010 1368747 1366021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1370061 1368808 gene locus_tag LOCUS_13020 gene pan 1370061 1368808 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_13020 1370200 1370649 gene locus_tag LOCUS_13030 1370200 1370649 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065943.1 protein_id gnl|my_center|LOCUS_13030 1371406 1370735 gene locus_tag LOCUS_13040 1371406 1370735 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_13040 1371503 1371850 gene locus_tag LOCUS_13050 1371503 1371850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1371985 1371914 gene locus_tag LOCUS_t00270 1371985 1371914 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1372454 1372179 gene locus_tag LOCUS_13060 1372454 1372179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1372573 1374060 gene locus_tag LOCUS_13070 1372573 1374060 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902126.1 protein_id gnl|my_center|LOCUS_13070 1375605 1374088 gene locus_tag LOCUS_13080 1375605 1374088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1375757 1376668 gene locus_tag LOCUS_13090 gene trxB 1375757 1376668 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060886.1 protein_id gnl|my_center|LOCUS_13090 1376723 1377421 gene locus_tag LOCUS_13100 1376723 1377421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1377434 1377910 gene locus_tag LOCUS_13110 1377434 1377910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1379162 1377999 gene locus_tag LOCUS_13120 1379162 1377999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1381969 1379300 gene locus_tag LOCUS_13130 1381969 1379300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1382358 1381978 gene locus_tag LOCUS_13140 1382358 1381978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1384303 1382555 gene locus_tag LOCUS_13150 1384303 1382555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1384362 1384700 gene locus_tag LOCUS_13160 1384362 1384700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1386825 1385848 gene locus_tag LOCUS_13170 1386825 1385848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1387944 1386829 gene locus_tag LOCUS_13180 1387944 1386829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1391843 1388208 gene locus_tag LOCUS_13190 1391843 1388208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1393373 1392357 gene locus_tag LOCUS_13200 1393373 1392357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1395682 1393397 gene locus_tag LOCUS_13210 1395682 1393397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1396637 1407067 gene locus_tag LOCUS_13220 1396637 1407067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1407074 1407754 gene locus_tag LOCUS_13230 1407074 1407754 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020402.1 protein_id gnl|my_center|LOCUS_13230 1407847 1408242 gene locus_tag LOCUS_13240 1407847 1408242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1409205 1408501 gene locus_tag LOCUS_13250 1409205 1408501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1409313 1409798 gene locus_tag LOCUS_13260 1409313 1409798 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877206.1 protein_id gnl|my_center|LOCUS_13260 1409827 1410612 gene locus_tag LOCUS_13270 1409827 1410612 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867960.1 protein_id gnl|my_center|LOCUS_13270 1410699 1411031 gene locus_tag LOCUS_13280 1410699 1411031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1412002 1411037 gene locus_tag LOCUS_13290 1412002 1411037 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020718.1 protein_id gnl|my_center|LOCUS_13290 1412108 1415287 gene locus_tag LOCUS_13300 1412108 1415287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1416350 1415301 gene locus_tag LOCUS_13310 1416350 1415301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1416450 1417211 gene locus_tag LOCUS_13320 1416450 1417211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1417337 1417636 gene locus_tag LOCUS_13330 1417337 1417636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1417630 1418529 gene locus_tag LOCUS_13340 1417630 1418529 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870811.1 protein_id gnl|my_center|LOCUS_13340 1418559 1419746 gene locus_tag LOCUS_13350 1418559 1419746 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933725.1 protein_id gnl|my_center|LOCUS_13350 1419727 1420008 gene locus_tag LOCUS_13360 1419727 1420008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1420418 1420068 gene locus_tag LOCUS_13370 1420418 1420068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1420638 1420399 gene locus_tag LOCUS_13380 1420638 1420399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1421595 1420639 gene locus_tag LOCUS_13390 1421595 1420639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1422949 1421588 gene locus_tag LOCUS_13400 1422949 1421588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1424832 1422946 gene locus_tag LOCUS_13410 1424832 1422946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1425023 1426312 gene locus_tag LOCUS_13420 1425023 1426312 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878898.1 protein_id gnl|my_center|LOCUS_13420 1426746 1426309 gene locus_tag LOCUS_13430 gene rimI 1426746 1426309 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868792.1 protein_id gnl|my_center|LOCUS_13430 1427643 1426759 gene locus_tag LOCUS_13440 1427643 1426759 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871156.1 protein_id gnl|my_center|LOCUS_13440 1428858 1427674 gene locus_tag LOCUS_13450 1428858 1427674 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_13450 1429898 1429125 gene locus_tag LOCUS_13460 1429898 1429125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1431310 1429901 gene locus_tag LOCUS_13470 1431310 1429901 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869712.1 protein_id gnl|my_center|LOCUS_13470 1433281 1431416 gene locus_tag LOCUS_13480 1433281 1431416 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496424.1 protein_id gnl|my_center|LOCUS_13480 1433326 1434243 gene locus_tag LOCUS_13490 gene mptN 1433326 1434243 CDS product tetrahydromethanopterin:alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023202.1 protein_id gnl|my_center|LOCUS_13490 1434917 1434240 gene locus_tag LOCUS_13500 1434917 1434240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1435202 1434978 gene locus_tag LOCUS_13510 1435202 1434978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1436109 1435207 gene locus_tag LOCUS_13520 1436109 1435207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1436670 1436239 gene locus_tag LOCUS_13530 1436670 1436239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1437050 1436667 gene locus_tag LOCUS_13540 1437050 1436667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1438424 1437099 gene locus_tag LOCUS_13550 1438424 1437099 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591983.1 protein_id gnl|my_center|LOCUS_13550 1439180 1438452 gene locus_tag LOCUS_13560 1439180 1438452 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846775.1 protein_id gnl|my_center|LOCUS_13560 1439377 1439967 gene locus_tag LOCUS_13570 1439377 1439967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1442095 1440035 gene locus_tag LOCUS_13580 1442095 1440035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1442596 1442120 gene locus_tag LOCUS_13590 1442596 1442120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1443250 1442621 gene locus_tag LOCUS_13600 1443250 1442621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1443495 1444622 gene locus_tag LOCUS_13610 1443495 1444622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1444988 1444692 gene locus_tag LOCUS_13620 1444988 1444692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1445196 1445047 gene locus_tag LOCUS_13630 1445196 1445047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1446143 1445313 gene locus_tag LOCUS_13640 1446143 1445313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1446373 1447251 gene locus_tag LOCUS_13650 1446373 1447251 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024467.1 protein_id gnl|my_center|LOCUS_13650 1448459 1447269 gene locus_tag LOCUS_13660 gene endA 1448459 1447269 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_13660 1449873 1448461 gene locus_tag LOCUS_13670 1449873 1448461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1450737 1449904 gene locus_tag LOCUS_13680 1450737 1449904 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878917.1 protein_id gnl|my_center|LOCUS_13680 1451764 1450814 gene locus_tag LOCUS_13690 gene radA 1451764 1450814 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_13690 1452794 1451826 gene locus_tag LOCUS_13700 1452794 1451826 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970641.1 protein_id gnl|my_center|LOCUS_13700 1453825 1452860 gene locus_tag LOCUS_13710 gene pyrB 1453825 1452860 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024378.1 protein_id gnl|my_center|LOCUS_13710 1454292 1454029 gene locus_tag LOCUS_13720 gene albA 1454292 1454029 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_13720 1456076 1454568 gene locus_tag LOCUS_13730 gene srp54 1456076 1454568 CDS product signal recognition particle protein SRP54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878126.1 protein_id gnl|my_center|LOCUS_13730 1456616 1457437 gene locus_tag LOCUS_13740 1456616 1457437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1457498 1458211 gene locus_tag LOCUS_13750 1457498 1458211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1458991 1458233 gene locus_tag LOCUS_13760 1458991 1458233 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350721.1 protein_id gnl|my_center|LOCUS_13760 1459340 1460257 gene locus_tag LOCUS_13770 1459340 1460257 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879565.1 protein_id gnl|my_center|LOCUS_13770 1460390 1460767 gene locus_tag LOCUS_13780 1460390 1460767 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_13780 1460786 1461268 gene locus_tag LOCUS_13790 1460786 1461268 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_13790 1461265 1461663 gene locus_tag LOCUS_13800 1461265 1461663 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250451.1 protein_id gnl|my_center|LOCUS_13800 1461733 1461912 gene locus_tag LOCUS_13810 1461733 1461912 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_13810 1462019 1462095 gene locus_tag LOCUS_t00280 1462019 1462095 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1462197 1462517 gene locus_tag LOCUS_13820 1462197 1462517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1463245 1462619 gene locus_tag LOCUS_13830 1463245 1462619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1463813 1463259 gene locus_tag LOCUS_13840 1463813 1463259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 protein_id gnl|my_center|LOCUS_13840 1464519 1463893 gene locus_tag LOCUS_13850 gene mcrC 1464519 1463893 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870358.1 protein_id gnl|my_center|LOCUS_13850 1466237 1464630 gene locus_tag LOCUS_13860 gene atwA 1466237 1464630 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060951.1 protein_id gnl|my_center|LOCUS_13860 1466721 1466344 gene locus_tag LOCUS_13870 1466721 1466344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1466875 1466738 gene locus_tag LOCUS_13880 1466875 1466738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1467828 1466872 gene locus_tag LOCUS_13890 1467828 1466872 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871181.1 protein_id gnl|my_center|LOCUS_13890 1469007 1468018 gene locus_tag LOCUS_13900 gene mtrH 1469007 1468018 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_13900 1469342 1469091 gene locus_tag LOCUS_13910 1469342 1469091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1469647 1469441 gene locus_tag LOCUS_13920 1469647 1469441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1470446 1469721 gene locus_tag LOCUS_13930 gene mtrA 1470446 1469721 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876783.1 protein_id gnl|my_center|LOCUS_13930 1470790 1470446 gene locus_tag LOCUS_13940 1470790 1470446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1471721 1470834 gene locus_tag LOCUS_13950 gene mtrC 1471721 1470834 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020332.1 protein_id gnl|my_center|LOCUS_13950 1472486 1471722 gene locus_tag LOCUS_13960 gene mtrD 1472486 1471722 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870362.1 protein_id gnl|my_center|LOCUS_13960 1473225 1472506 gene locus_tag LOCUS_13970 1473225 1472506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1473328 1473504 gene locus_tag LOCUS_13980 1473328 1473504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1473594 1475063 gene locus_tag LOCUS_13990 1473594 1475063 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024395.1 protein_id gnl|my_center|LOCUS_13990 1475139 1475699 gene locus_tag LOCUS_14000 1475139 1475699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1476521 1475742 gene locus_tag LOCUS_14010 1476521 1475742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1476593 1477810 gene locus_tag LOCUS_14020 1476593 1477810 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870021.1 protein_id gnl|my_center|LOCUS_14020 1477915 1478760 gene locus_tag LOCUS_14030 gene sppA 1477915 1478760 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_14030 1479278 1479048 gene locus_tag LOCUS_14040 1479278 1479048 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_14040 1479456 1479265 gene locus_tag LOCUS_14050 1479456 1479265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1481594 1479909 gene locus_tag LOCUS_14060 gene mcrA 1481594 1479909 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870360.1 protein_id gnl|my_center|LOCUS_14060 1481725 1481561 gene locus_tag LOCUS_14070 1481725 1481561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1482565 1481726 gene locus_tag LOCUS_14080 gene mcrG 1482565 1481726 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876754.1 protein_id gnl|my_center|LOCUS_14080 1482916 1482572 gene locus_tag LOCUS_14090 1482916 1482572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1484362 1483040 gene locus_tag LOCUS_14100 gene mcrB 1484362 1483040 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869573.1 protein_id gnl|my_center|LOCUS_14100 1484686 1484614 gene locus_tag LOCUS_t00290 1484686 1484614 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1484776 1485051 gene locus_tag LOCUS_14110 1484776 1485051 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023444.1 protein_id gnl|my_center|LOCUS_14110 1485179 1485104 gene locus_tag LOCUS_t00300 1485179 1485104 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1485292 1486947 gene locus_tag LOCUS_14120 1485292 1486947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1487531 1486944 gene locus_tag LOCUS_14130 1487531 1486944 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 protein_id gnl|my_center|LOCUS_14130 1488348 1487605 gene locus_tag LOCUS_14140 1488348 1487605 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_14140 1489553 1488387 gene locus_tag LOCUS_14150 1489553 1488387 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_14150 1489738 1491369 gene locus_tag LOCUS_14160 1489738 1491369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1491546 1492793 gene locus_tag LOCUS_14170 1491546 1492793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1492889 1494919 gene locus_tag LOCUS_14180 1492889 1494919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1494979 1496718 gene locus_tag LOCUS_14190 1494979 1496718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1496722 1497057 gene locus_tag LOCUS_14200 1496722 1497057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1497228 1498472 gene locus_tag LOCUS_14210 1497228 1498472 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879247.1 protein_id gnl|my_center|LOCUS_14210 1498629 1499741 gene locus_tag LOCUS_14220 gene cfbD 1498629 1499741 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023536.1 protein_id gnl|my_center|LOCUS_14220 1499833 1500621 gene locus_tag LOCUS_14230 gene cfbC 1499833 1500621 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023535.1 protein_id gnl|my_center|LOCUS_14230 1500836 1502278 gene locus_tag LOCUS_14240 1500836 1502278 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_14240 1502386 1502532 gene locus_tag LOCUS_14250 1502386 1502532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1502624 1502800 gene locus_tag LOCUS_14260 1502624 1502800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1502829 1504370 gene locus_tag LOCUS_14270 1502829 1504370 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392614.1 protein_id gnl|my_center|LOCUS_14270 1504389 1505438 gene locus_tag LOCUS_14280 1504389 1505438 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_14280 1506119 1505430 gene locus_tag LOCUS_14290 1506119 1505430 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903531.1 protein_id gnl|my_center|LOCUS_14290 1506218 1507507 gene locus_tag LOCUS_14300 1506218 1507507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1507538 1507954 gene locus_tag LOCUS_14310 1507538 1507954 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_14310 1510085 1508496 gene locus_tag LOCUS_14320 1510085 1508496 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980485.1 protein_id gnl|my_center|LOCUS_14320 1511467 1510094 gene locus_tag LOCUS_14330 1511467 1510094 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_14330 1511917 1511516 gene locus_tag LOCUS_14340 1511917 1511516 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250475.1 protein_id gnl|my_center|LOCUS_14340 1513246 1511969 gene locus_tag LOCUS_14350 1513246 1511969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1514991 1513399 gene locus_tag LOCUS_14360 gene serA 1514991 1513399 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_14360 1515089 1516363 gene locus_tag LOCUS_14370 gene eno 1515089 1516363 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496902.1 protein_id gnl|my_center|LOCUS_14370 1516470 1517789 gene locus_tag LOCUS_14380 gene fni 1516470 1517789 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064552.1 protein_id gnl|my_center|LOCUS_14380 1517783 1518745 gene locus_tag LOCUS_14390 gene mch 1517783 1518745 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021714.1 protein_id gnl|my_center|LOCUS_14390 1520906 1518828 gene locus_tag LOCUS_14400 1520906 1518828 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867777.1 protein_id gnl|my_center|LOCUS_14400 1521735 1520896 gene locus_tag LOCUS_14410 1521735 1520896 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022973.1 protein_id gnl|my_center|LOCUS_14410 1522551 1521814 gene locus_tag LOCUS_14420 gene cobA 1522551 1521814 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878738.1 protein_id gnl|my_center|LOCUS_14420 1524079 1522631 gene locus_tag LOCUS_14430 1524079 1522631 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060907.1 protein_id gnl|my_center|LOCUS_14430 1525951 1524128 gene locus_tag LOCUS_14440 1525951 1524128 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_14440 1526789 1525932 gene locus_tag LOCUS_14450 1526789 1525932 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_14450 1527137 1526892 gene locus_tag LOCUS_14460 1527137 1526892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1527415 1529646 gene locus_tag LOCUS_14470 1527415 1529646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1529717 1530361 gene locus_tag LOCUS_14480 1529717 1530361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1530431 1531366 gene locus_tag LOCUS_14490 gene map 1530431 1531366 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 protein_id gnl|my_center|LOCUS_14490 1531400 1532128 gene locus_tag LOCUS_14500 1531400 1532128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1532112 1533419 gene locus_tag LOCUS_14510 gene thrC 1532112 1533419 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021620.1 protein_id gnl|my_center|LOCUS_14510 1534358 1533462 gene locus_tag LOCUS_14520 gene yhdJ 1534358 1533462 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642611.1 protein_id gnl|my_center|LOCUS_14520 1535564 1534401 gene locus_tag LOCUS_14530 1535564 1534401 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065191.1 protein_id gnl|my_center|LOCUS_14530 1535634 1536041 gene locus_tag LOCUS_14540 1535634 1536041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1536385 1536618 gene locus_tag LOCUS_14550 1536385 1536618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1537026 1536514 gene locus_tag LOCUS_14560 1537026 1536514 CDS product PaREP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846703.1 protein_id gnl|my_center|LOCUS_14560 1537390 1536986 gene locus_tag LOCUS_14570 1537390 1536986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1538963 1537788 gene locus_tag LOCUS_14580 1538963 1537788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1539113 1540018 gene locus_tag LOCUS_14590 1539113 1540018 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878818.1 protein_id gnl|my_center|LOCUS_14590 1540913 1540059 gene locus_tag LOCUS_14600 gene cofE 1540913 1540059 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_14600 1541983 1541048 gene locus_tag LOCUS_14610 gene rnz 1541983 1541048 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_14610 1542054 1542860 gene locus_tag LOCUS_14620 1542054 1542860 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_14620 1543645 1542857 gene locus_tag LOCUS_14630 1543645 1542857 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_14630 1543655 1544557 gene locus_tag LOCUS_14640 1543655 1544557 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_14640 1544678 1545622 gene locus_tag LOCUS_14650 gene hemB 1544678 1545622 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020627.1 protein_id gnl|my_center|LOCUS_14650 1546015 1545797 gene locus_tag LOCUS_14660 1546015 1545797 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545314.1 protein_id gnl|my_center|LOCUS_14660 1546287 1545997 gene locus_tag LOCUS_14670 1546287 1545997 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545735.1 protein_id gnl|my_center|LOCUS_14670 1546593 1547579 gene locus_tag LOCUS_14680 1546593 1547579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1547576 1548304 gene locus_tag LOCUS_14690 1547576 1548304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1548301 1549608 gene locus_tag LOCUS_14700 gene hemL 1548301 1549608 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878736.1 protein_id gnl|my_center|LOCUS_14700 1549648 1550553 gene locus_tag LOCUS_14710 gene hemC 1549648 1550553 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878737.1 protein_id gnl|my_center|LOCUS_14710 1551296 1550550 gene locus_tag LOCUS_14720 1551296 1550550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1551975 1551319 gene locus_tag LOCUS_14730 1551975 1551319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1552709 1552089 gene locus_tag LOCUS_14740 1552709 1552089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1552941 1554617 gene locus_tag LOCUS_14750 gene pheT 1552941 1554617 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021951.1 protein_id gnl|my_center|LOCUS_14750 1556620 1554692 gene locus_tag LOCUS_14760 gene hdrA 1556620 1554692 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_14760 1556921 1556622 gene locus_tag LOCUS_14770 1556921 1556622 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249651.1 protein_id gnl|my_center|LOCUS_14770 1557346 1556921 gene locus_tag LOCUS_14780 1557346 1556921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940349.1 protein_id gnl|my_center|LOCUS_14780 1558353 1557352 gene locus_tag LOCUS_14790 1558353 1557352 CDS product NOL1/NOP2/sun family putative RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878356.1 protein_id gnl|my_center|LOCUS_14790 1558451 1559872 gene locus_tag LOCUS_14800 gene argH 1558451 1559872 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_14800 1559860 1560336 gene locus_tag LOCUS_14810 1559860 1560336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1560285 1561310 gene locus_tag LOCUS_14820 1560285 1561310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1561360 1562463 gene locus_tag LOCUS_14830 1561360 1562463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1562456 1563277 gene locus_tag LOCUS_14840 1562456 1563277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1564577 1563432 gene locus_tag LOCUS_14850 1564577 1563432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1564975 1564592 gene locus_tag LOCUS_14860 1564975 1564592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1565108 1566004 gene locus_tag LOCUS_14870 1565108 1566004 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 protein_id gnl|my_center|LOCUS_14870 1565994 1566743 gene locus_tag LOCUS_14880 1565994 1566743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_14880 1566759 1567598 gene locus_tag LOCUS_14890 1566759 1567598 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485751.1 protein_id gnl|my_center|LOCUS_14890 1571426 1567557 gene locus_tag LOCUS_14900 1571426 1567557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1572500 1571448 gene locus_tag LOCUS_14910 1572500 1571448 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880716.1 protein_id gnl|my_center|LOCUS_14910 1572625 1575912 gene locus_tag LOCUS_14920 gene carB 1572625 1575912 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022129.1 protein_id gnl|my_center|LOCUS_14920 1576437 1575922 gene locus_tag LOCUS_14930 gene ribH 1576437 1575922 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879619.1 protein_id gnl|my_center|LOCUS_14930 1576946 1576491 gene locus_tag LOCUS_14940 gene ribC 1576946 1576491 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021819.1 protein_id gnl|my_center|LOCUS_14940 1578228 1577161 gene locus_tag LOCUS_14950 1578228 1577161 CDS product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 protein_id gnl|my_center|LOCUS_14950 1579730 1578207 gene locus_tag LOCUS_14960 1579730 1578207 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878682.1 protein_id gnl|my_center|LOCUS_14960 1579851 1580765 gene locus_tag LOCUS_14970 1579851 1580765 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_14970 1580831 1581811 gene locus_tag LOCUS_14980 1580831 1581811 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066146.1 protein_id gnl|my_center|LOCUS_14980 1582104 1583375 gene locus_tag LOCUS_14990 1582104 1583375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1583576 1584325 gene locus_tag LOCUS_15000 1583576 1584325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1586009 1585023 gene locus_tag LOCUS_15010 1586009 1585023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1587077 1586088 gene locus_tag LOCUS_15020 1587077 1586088 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249815.1 protein_id gnl|my_center|LOCUS_15020 1587114 1587887 gene locus_tag LOCUS_15030 1587114 1587887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1588062 1589321 gene locus_tag LOCUS_15040 gene leuC 1588062 1589321 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880579.1 protein_id gnl|my_center|LOCUS_15040 1589429 1589917 gene locus_tag LOCUS_15050 1589429 1589917 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878133.1 protein_id gnl|my_center|LOCUS_15050 1589994 1591133 gene locus_tag LOCUS_15060 gene argC 1589994 1591133 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 protein_id gnl|my_center|LOCUS_15060 1591273 1591201 gene locus_tag LOCUS_t00310 1591273 1591201 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1591961 1591503 gene locus_tag LOCUS_15070 1591961 1591503 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878028.1 protein_id gnl|my_center|LOCUS_15070 1592000 1592983 gene locus_tag LOCUS_15080 1592000 1592983 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878029.1 protein_id gnl|my_center|LOCUS_15080 1593341 1593105 gene locus_tag LOCUS_15090 1593341 1593105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1596069 1593418 gene locus_tag LOCUS_15100 1596069 1593418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1596136 1596387 gene locus_tag LOCUS_15110 1596136 1596387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1596563 1597789 gene locus_tag LOCUS_15120 1596563 1597789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1597818 1599053 gene locus_tag LOCUS_15130 1597818 1599053 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113721.1 protein_id gnl|my_center|LOCUS_15130 1600037 1599069 gene locus_tag LOCUS_15140 1600037 1599069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811766.1 protein_id gnl|my_center|LOCUS_15140 1601719 1600148 gene locus_tag LOCUS_15150 1601719 1600148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1601873 1603489 gene locus_tag LOCUS_15160 gene tgtA 1601873 1603489 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024298.1 protein_id gnl|my_center|LOCUS_15160 1603464 1603874 gene locus_tag LOCUS_15170 1603464 1603874 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 protein_id gnl|my_center|LOCUS_15170 1605466 1603925 gene locus_tag LOCUS_15180 1605466 1603925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1605754 1606527 gene locus_tag LOCUS_15190 gene rpiA 1605754 1606527 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_15190 1606524 1607234 gene locus_tag LOCUS_15200 1606524 1607234 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_15200 1607468 1607812 gene locus_tag LOCUS_15210 1607468 1607812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1607833 1608060 gene locus_tag LOCUS_15220 1607833 1608060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1608148 1608903 gene locus_tag LOCUS_15230 1608148 1608903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1608915 1610012 gene locus_tag LOCUS_15240 gene carA 1608915 1610012 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022130.1 protein_id gnl|my_center|LOCUS_15240 1610144 1610261 gene locus_tag LOCUS_r00030 1610144 1610261 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1610312 1611469 gene locus_tag LOCUS_15250 1610312 1611469 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250179.1 protein_id gnl|my_center|LOCUS_15250 1611466 1612287 gene locus_tag LOCUS_15260 1611466 1612287 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879673.1 protein_id gnl|my_center|LOCUS_15260 1612953 1612288 gene locus_tag LOCUS_15270 1612953 1612288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1614175 1612931 gene locus_tag LOCUS_15280 1614175 1612931 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546645.1 protein_id gnl|my_center|LOCUS_15280 1614305 1616044 gene locus_tag LOCUS_15290 1614305 1616044 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582491.1 protein_id gnl|my_center|LOCUS_15290 1616323 1616111 gene locus_tag LOCUS_15300 1616323 1616111 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146864.1 protein_id gnl|my_center|LOCUS_15300 1617130 1616492 gene locus_tag LOCUS_15310 gene rpsG 1617130 1616492 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879386.1 protein_id gnl|my_center|LOCUS_15310 1618325 1617258 gene locus_tag LOCUS_15320 1618325 1617258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1617561 1617570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1618708 1618358 gene locus_tag LOCUS_15330 1618708 1618358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1621338 1618792 gene locus_tag LOCUS_15340 1621338 1618792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1623750 1621348 gene locus_tag LOCUS_15350 1623750 1621348 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879381.1 protein_id gnl|my_center|LOCUS_15350 1623788 1623797 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1623844 1624194 gene locus_tag LOCUS_15360 1623844 1624194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1624824 1624974 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1625591 1625740 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends