>Feature sequence1 <1 977 gene locus_tag LOCUS_00010 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877216.1:signal recognition particle-docking protein FtsY 967 2052 gene locus_tag LOCUS_00020 967 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2042 3364 gene locus_tag LOCUS_00030 2042 3364 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986561.1 protein_id gnl|my_center|LOCUS_00030 3343 3492 gene locus_tag LOCUS_00040 3343 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4011 3634 gene locus_tag LOCUS_00050 4011 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4157 4585 gene locus_tag LOCUS_00060 4157 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4629 5063 gene locus_tag LOCUS_00070 4629 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5285 6223 gene locus_tag LOCUS_00080 5285 6223 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_00080 6266 7117 gene locus_tag LOCUS_00090 6266 7117 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 protein_id gnl|my_center|LOCUS_00090 7279 7665 gene locus_tag LOCUS_00100 gene mutT 7279 7665 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_00100 7671 10541 gene locus_tag LOCUS_00110 7671 10541 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948376.1 protein_id gnl|my_center|LOCUS_00110 10551 10697 gene locus_tag LOCUS_00120 10551 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10731 10865 gene locus_tag LOCUS_00130 10731 10865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11068 10880 gene locus_tag LOCUS_00140 11068 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 11136 11591 gene locus_tag LOCUS_00150 11136 11591 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061315.1 protein_id gnl|my_center|LOCUS_00150 11595 13133 gene locus_tag LOCUS_00160 11595 13133 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877210.1 protein_id gnl|my_center|LOCUS_00160 13416 13126 gene locus_tag LOCUS_00170 13416 13126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 13984 13406 gene locus_tag LOCUS_00180 13984 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 14413 14003 gene locus_tag LOCUS_00190 14413 14003 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876265.1 protein_id gnl|my_center|LOCUS_00190 14734 14543 gene locus_tag LOCUS_00200 14734 14543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 15553 14771 gene locus_tag LOCUS_00210 15553 14771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 15875 17089 gene locus_tag LOCUS_00220 15875 17089 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_00220 18408 17266 gene locus_tag LOCUS_00230 18408 17266 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 protein_id gnl|my_center|LOCUS_00230 18521 19195 gene locus_tag LOCUS_00240 18521 19195 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_00240 19205 19858 gene locus_tag LOCUS_00250 19205 19858 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_00250 19967 20536 gene locus_tag LOCUS_00260 19967 20536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 20585 21304 gene locus_tag LOCUS_00270 20585 21304 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877208.1 protein_id gnl|my_center|LOCUS_00270 21342 22451 gene locus_tag LOCUS_00280 gene cdc6-2 21342 22451 CDS product ORC1-type DNA replication protein Cdc6-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877207.1 protein_id gnl|my_center|LOCUS_00280 22718 22455 gene locus_tag LOCUS_00290 22718 22455 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418727.1 protein_id gnl|my_center|LOCUS_00290 23002 22823 gene locus_tag LOCUS_00300 23002 22823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 23096 23518 gene locus_tag LOCUS_00310 23096 23518 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877206.1 protein_id gnl|my_center|LOCUS_00310 23555 23875 gene locus_tag LOCUS_00320 23555 23875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 24114 25562 gene locus_tag LOCUS_00330 24114 25562 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061099.1 protein_id gnl|my_center|LOCUS_00330 25569 26327 gene locus_tag LOCUS_00340 gene mtnP 25569 26327 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877204.1 protein_id gnl|my_center|LOCUS_00340 26386 26955 gene locus_tag LOCUS_00350 26386 26955 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197538709.1 protein_id gnl|my_center|LOCUS_00350 26957 27280 gene locus_tag LOCUS_00360 26957 27280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 27408 27761 gene locus_tag LOCUS_00370 27408 27761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 27751 27825 gene locus_tag LOCUS_t00010 27751 27825 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27854 28216 gene locus_tag LOCUS_00380 27854 28216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 28668 29249 gene locus_tag LOCUS_00390 28668 29249 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877201.1 protein_id gnl|my_center|LOCUS_00390 29957 29319 gene locus_tag LOCUS_00400 29957 29319 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985956.1 protein_id gnl|my_center|LOCUS_00400 30051 30749 gene locus_tag LOCUS_00410 30051 30749 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877200.1 protein_id gnl|my_center|LOCUS_00410 30786 30974 gene locus_tag LOCUS_00420 30786 30974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 31046 32284 gene locus_tag LOCUS_00430 31046 32284 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877199.1 protein_id gnl|my_center|LOCUS_00430 32298 33635 gene locus_tag LOCUS_00440 gene glmM 32298 33635 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877198.1 protein_id gnl|my_center|LOCUS_00440 33767 35047 gene locus_tag LOCUS_00450 33767 35047 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 protein_id gnl|my_center|LOCUS_00450 35063 35539 gene locus_tag LOCUS_00460 35063 35539 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869802.1 protein_id gnl|my_center|LOCUS_00460 35549 36649 gene locus_tag LOCUS_00470 gene hisC 35549 36649 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877195.1 protein_id gnl|my_center|LOCUS_00470 36649 37353 gene locus_tag LOCUS_00480 36649 37353 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061096.1 protein_id gnl|my_center|LOCUS_00480 37375 38511 gene locus_tag LOCUS_00490 37375 38511 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892639.1 protein_id gnl|my_center|LOCUS_00490 38651 39274 gene locus_tag LOCUS_00500 38651 39274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 39267 40133 gene locus_tag LOCUS_00510 39267 40133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 41509 40145 gene locus_tag LOCUS_00520 gene glmM 41509 40145 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877192.1 protein_id gnl|my_center|LOCUS_00520 42049 41654 gene locus_tag LOCUS_00530 42049 41654 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877189.1 protein_id gnl|my_center|LOCUS_00530 42152 42790 gene locus_tag LOCUS_00540 42152 42790 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 protein_id gnl|my_center|LOCUS_00540 44439 42784 gene locus_tag LOCUS_00550 44439 42784 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061094.1 protein_id gnl|my_center|LOCUS_00550 45714 44440 gene locus_tag LOCUS_00560 gene thiC 45714 44440 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877184.1 protein_id gnl|my_center|LOCUS_00560 46569 45736 gene locus_tag LOCUS_00570 46569 45736 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061092.1 protein_id gnl|my_center|LOCUS_00570 47203 47826 gene locus_tag LOCUS_00580 47203 47826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00580 47867 48082 gene locus_tag LOCUS_00590 47867 48082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00590 50353 48161 gene locus_tag LOCUS_00600 50353 48161 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061106.1 protein_id gnl|my_center|LOCUS_00600 52036 50735 gene locus_tag LOCUS_00610 52036 50735 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877248.1 protein_id gnl|my_center|LOCUS_00610 52092 53153 gene locus_tag LOCUS_00620 52092 53153 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061107.1 protein_id gnl|my_center|LOCUS_00620 53258 54220 gene locus_tag LOCUS_00630 53258 54220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877252.1 protein_id gnl|my_center|LOCUS_00630 54227 55273 gene locus_tag LOCUS_00640 54227 55273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 56577 55276 gene locus_tag LOCUS_00650 56577 55276 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892604.1 protein_id gnl|my_center|LOCUS_00650 56671 56946 gene locus_tag LOCUS_00660 56671 56946 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877257.1 protein_id gnl|my_center|LOCUS_00660 57443 56940 gene locus_tag LOCUS_00670 57443 56940 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061113.1 protein_id gnl|my_center|LOCUS_00670 57633 57558 gene locus_tag LOCUS_t00020 57633 57558 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 58008 57724 gene locus_tag LOCUS_00680 58008 57724 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061319.1 protein_id gnl|my_center|LOCUS_00680 59126 58212 gene locus_tag LOCUS_00690 59126 58212 CDS product DUF5591 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061115.1 protein_id gnl|my_center|LOCUS_00690 59623 59129 gene locus_tag LOCUS_00700 59623 59129 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877275.1 protein_id gnl|my_center|LOCUS_00700 60151 59630 gene locus_tag LOCUS_00710 gene tfe 60151 59630 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877276.1 protein_id gnl|my_center|LOCUS_00710 61094 60237 gene locus_tag LOCUS_00720 61094 60237 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877277.1 protein_id gnl|my_center|LOCUS_00720 61159 61728 gene locus_tag LOCUS_00730 61159 61728 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877282.1 protein_id gnl|my_center|LOCUS_00730 62742 61801 gene locus_tag LOCUS_00740 gene mtrH 62742 61801 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_00740 63564 64697 gene locus_tag LOCUS_00750 gene ftsZ 63564 64697 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877283.1 protein_id gnl|my_center|LOCUS_00750 64852 64992 gene locus_tag LOCUS_00760 64852 64992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 65217 65369 gene locus_tag LOCUS_00770 65217 65369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 65950 68211 gene locus_tag LOCUS_00780 65950 68211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 68263 68859 gene locus_tag LOCUS_00790 68263 68859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 69329 69508 gene locus_tag LOCUS_00800 69329 69508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 69742 70212 gene locus_tag LOCUS_00810 69742 70212 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061118.1 protein_id gnl|my_center|LOCUS_00810 70212 70694 gene locus_tag LOCUS_00820 70212 70694 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877286.1 protein_id gnl|my_center|LOCUS_00820 70881 71519 gene locus_tag LOCUS_00830 70881 71519 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061119.1 protein_id gnl|my_center|LOCUS_00830 71519 72526 gene locus_tag LOCUS_00840 71519 72526 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877288.1 protein_id gnl|my_center|LOCUS_00840 72595 72900 gene locus_tag LOCUS_00850 72595 72900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 73079 75772 gene locus_tag LOCUS_00860 gene alaS 73079 75772 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877290.1 protein_id gnl|my_center|LOCUS_00860 75892 77079 gene locus_tag LOCUS_00870 75892 77079 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256452.1 protein_id gnl|my_center|LOCUS_00870 77081 78226 gene locus_tag LOCUS_00880 gene thiI 77081 78226 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 protein_id gnl|my_center|LOCUS_00880 78505 89202 gene locus_tag LOCUS_00890 78505 89202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 89376 90470 gene locus_tag LOCUS_00900 gene fbp 89376 90470 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877293.1 protein_id gnl|my_center|LOCUS_00900 90854 90609 gene locus_tag LOCUS_00910 90854 90609 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877297.1 protein_id gnl|my_center|LOCUS_00910 91417 90851 gene locus_tag LOCUS_00920 gene pgsA 91417 90851 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061121.1 protein_id gnl|my_center|LOCUS_00920 91477 92058 gene locus_tag LOCUS_00930 91477 92058 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877299.1 protein_id gnl|my_center|LOCUS_00930 92098 92802 gene locus_tag LOCUS_00940 gene radB 92098 92802 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877300.1 protein_id gnl|my_center|LOCUS_00940 92868 94055 gene locus_tag LOCUS_00950 92868 94055 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877301.1 protein_id gnl|my_center|LOCUS_00950 94058 94813 gene locus_tag LOCUS_00960 94058 94813 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875860.1 protein_id gnl|my_center|LOCUS_00960 94818 95195 gene locus_tag LOCUS_00970 94818 95195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 96970 95192 gene locus_tag LOCUS_00980 96970 95192 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061122.1 protein_id gnl|my_center|LOCUS_00980 97481 97119 gene locus_tag LOCUS_00990 97481 97119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 97643 97945 gene locus_tag LOCUS_01000 gene pth2 97643 97945 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877304.1 protein_id gnl|my_center|LOCUS_01000 98097 98669 gene locus_tag LOCUS_01010 98097 98669 CDS product delta 1-pyrroline-5-carboxylate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061123.1 protein_id gnl|my_center|LOCUS_01010 98670 98831 gene locus_tag LOCUS_01020 98670 98831 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877306.1 protein_id gnl|my_center|LOCUS_01020 98856 99125 gene locus_tag LOCUS_01030 98856 99125 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_01030 99283 99756 gene locus_tag LOCUS_01040 99283 99756 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022043.1 protein_id gnl|my_center|LOCUS_01040 99872 101125 gene locus_tag LOCUS_01050 99872 101125 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892580.1 protein_id gnl|my_center|LOCUS_01050 102075 101122 gene locus_tag LOCUS_01060 102075 101122 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024418.1 protein_id gnl|my_center|LOCUS_01060 102188 103654 gene locus_tag LOCUS_01070 102188 103654 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750460.1 protein_id gnl|my_center|LOCUS_01070 103662 104579 gene locus_tag LOCUS_01080 103662 104579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 105310 104588 gene locus_tag LOCUS_01090 105310 104588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 106057 105335 gene locus_tag LOCUS_01100 106057 105335 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899767.1 protein_id gnl|my_center|LOCUS_01100 107011 106067 gene locus_tag LOCUS_01110 107011 106067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861095.1 protein_id gnl|my_center|LOCUS_01110 108008 107292 gene locus_tag LOCUS_01120 108008 107292 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875869.1 protein_id gnl|my_center|LOCUS_01120 109545 111560 gene locus_tag LOCUS_01130 gene feoB 109545 111560 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964349.1 protein_id gnl|my_center|LOCUS_01130 111794 112024 gene locus_tag LOCUS_01140 111794 112024 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_01140 112060 112260 gene locus_tag LOCUS_01150 112060 112260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 113095 112250 gene locus_tag LOCUS_01160 113095 112250 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877312.1 protein_id gnl|my_center|LOCUS_01160 113941 113111 gene locus_tag LOCUS_01170 gene cbiQ 113941 113111 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877313.1 protein_id gnl|my_center|LOCUS_01170 114310 114005 gene locus_tag LOCUS_01180 114310 114005 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877314.1 protein_id gnl|my_center|LOCUS_01180 114952 114311 gene locus_tag LOCUS_01190 gene cbiM 114952 114311 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877315.1 protein_id gnl|my_center|LOCUS_01190 116183 115200 gene locus_tag LOCUS_01200 gene msrB 116183 115200 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203359.1 protein_id gnl|my_center|LOCUS_01200 117566 116280 gene locus_tag LOCUS_01210 117566 116280 CDS product oligosaccharide repeat unit polymerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876293.1 protein_id gnl|my_center|LOCUS_01210 118367 117579 gene locus_tag LOCUS_01220 118367 117579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876292.1 protein_id gnl|my_center|LOCUS_01220 118553 118386 gene locus_tag LOCUS_01230 118553 118386 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020514.1 protein_id gnl|my_center|LOCUS_01230 118729 118812 gene locus_tag LOCUS_t00030 118729 118812 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 118847 118919 gene locus_tag LOCUS_t00040 118847 118919 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 119531 118971 gene locus_tag LOCUS_01240 119531 118971 CDS product FeGP cofactor biosynthesis protein HcgF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876772.1 protein_id gnl|my_center|LOCUS_01240 120162 119524 gene locus_tag LOCUS_01250 120162 119524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876771.1 protein_id gnl|my_center|LOCUS_01250 120906 120211 gene locus_tag LOCUS_01260 120906 120211 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876770.1 protein_id gnl|my_center|LOCUS_01260 121692 120907 gene locus_tag LOCUS_01270 121692 120907 CDS product SAM-dependent methyltransferase HcgC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876769.1 protein_id gnl|my_center|LOCUS_01270 122176 121697 gene locus_tag LOCUS_01280 122176 121697 CDS product DUF3236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876768.1 protein_id gnl|my_center|LOCUS_01280 123184 122186 gene locus_tag LOCUS_01290 gene hmdB 123184 122186 CDS product 5,10-methenyltetrahydromethanopterin hydrogenase cofactor biosynthesis protein HmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876767.1 protein_id gnl|my_center|LOCUS_01290 124348 123335 gene locus_tag LOCUS_01300 gene hmd 124348 123335 CDS product 5,10-methenyltetrahydromethanopterin hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060977.1 protein_id gnl|my_center|LOCUS_01300 124858 126360 gene locus_tag LOCUS_01310 gene hmdC 124858 126360 CDS product 5,10-methenyltetrahydromethanopterin hydrogenase cofactor biosynthesis protein HmdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876761.1 protein_id gnl|my_center|LOCUS_01310 126459 127262 gene locus_tag LOCUS_01320 126459 127262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 127268 128149 gene locus_tag LOCUS_01330 127268 128149 CDS product PhoU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877330.1 protein_id gnl|my_center|LOCUS_01330 128313 129122 gene locus_tag LOCUS_01340 128313 129122 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_01340 129138 130013 gene locus_tag LOCUS_01350 gene pstC 129138 130013 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_01350 130010 130858 gene locus_tag LOCUS_01360 gene pstA 130010 130858 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877336.1 protein_id gnl|my_center|LOCUS_01360 130862 131611 gene locus_tag LOCUS_01370 gene pstB 130862 131611 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061132.1 protein_id gnl|my_center|LOCUS_01370 131621 132313 gene locus_tag LOCUS_01380 gene phoU 131621 132313 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877340.1 protein_id gnl|my_center|LOCUS_01380 133190 132345 gene locus_tag LOCUS_01390 133190 132345 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877341.1 protein_id gnl|my_center|LOCUS_01390 133525 133280 gene locus_tag LOCUS_01400 133525 133280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 134042 133539 gene locus_tag LOCUS_01410 134042 133539 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061134.1 protein_id gnl|my_center|LOCUS_01410 134922 134056 gene locus_tag LOCUS_01420 gene porB 134922 134056 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 protein_id gnl|my_center|LOCUS_01420 136070 134925 gene locus_tag LOCUS_01430 gene porA 136070 134925 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_01430 136324 136082 gene locus_tag LOCUS_01440 gene porD 136324 136082 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869765.1 protein_id gnl|my_center|LOCUS_01440 136874 136350 gene locus_tag LOCUS_01450 gene porC 136874 136350 CDS product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892553.1 protein_id gnl|my_center|LOCUS_01450 137090 138694 gene locus_tag LOCUS_01460 137090 138694 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877347.1 protein_id gnl|my_center|LOCUS_01460 138768 139625 gene locus_tag LOCUS_01470 138768 139625 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877416.1 protein_id gnl|my_center|LOCUS_01470 139639 140796 gene locus_tag LOCUS_01480 139639 140796 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061331.1 protein_id gnl|my_center|LOCUS_01480 140805 141722 gene locus_tag LOCUS_01490 140805 141722 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877348.1 protein_id gnl|my_center|LOCUS_01490 141727 141930 gene locus_tag LOCUS_01500 141727 141930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 141931 142797 gene locus_tag LOCUS_01510 141931 142797 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 protein_id gnl|my_center|LOCUS_01510 142806 143267 gene locus_tag LOCUS_01520 142806 143267 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358940.1 protein_id gnl|my_center|LOCUS_01520 143277 143888 gene locus_tag LOCUS_01530 143277 143888 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877352.1 protein_id gnl|my_center|LOCUS_01530 143885 144619 gene locus_tag LOCUS_01540 143885 144619 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877353.1 protein_id gnl|my_center|LOCUS_01540 145880 144609 gene locus_tag LOCUS_01550 145880 144609 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892544.1 protein_id gnl|my_center|LOCUS_01550 146396 145914 gene locus_tag LOCUS_01560 146396 145914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 146535 147827 gene locus_tag LOCUS_01570 146535 147827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 148946 147864 gene locus_tag LOCUS_01580 148946 147864 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870054.1 protein_id gnl|my_center|LOCUS_01580 149138 149929 gene locus_tag LOCUS_01590 149138 149929 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079210.1 protein_id gnl|my_center|LOCUS_01590 150924 149959 gene locus_tag LOCUS_01600 gene mer 150924 149959 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877358.1 protein_id gnl|my_center|LOCUS_01600 151594 153065 gene locus_tag LOCUS_r00010 151594 153065 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 153551 156527 gene locus_tag LOCUS_r00020 153551 156527 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 157543 158997 gene locus_tag LOCUS_01610 157543 158997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 160271 159222 gene locus_tag LOCUS_01620 160271 159222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 160518 160276 gene locus_tag LOCUS_01630 160518 160276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01630 160750 160511 gene locus_tag LOCUS_01640 160750 160511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 160835 161158 gene locus_tag LOCUS_01650 160835 161158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 161304 162377 gene locus_tag LOCUS_01660 161304 162377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 162436 162963 gene locus_tag LOCUS_01670 162436 162963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 163357 162920 gene locus_tag LOCUS_01680 163357 162920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 163952 165739 gene locus_tag LOCUS_01690 163952 165739 CDS product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203121.1 protein_id gnl|my_center|LOCUS_01690 165771 166136 gene locus_tag LOCUS_01700 165771 166136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 166951 166421 gene locus_tag LOCUS_01710 166951 166421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 167103 167621 gene locus_tag LOCUS_01720 167103 167621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 169699 168398 gene locus_tag LOCUS_01730 169699 168398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 170197 169862 gene locus_tag LOCUS_01740 170197 169862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 172921 170207 gene locus_tag LOCUS_01750 172921 170207 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_01750 173442 173600 gene locus_tag LOCUS_01760 173442 173600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 173625 174035 gene locus_tag LOCUS_01770 173625 174035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01770 174064 174891 gene locus_tag LOCUS_01780 174064 174891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 176656 175004 gene locus_tag LOCUS_01790 176656 175004 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061109.1 protein_id gnl|my_center|LOCUS_01790 178599 176695 gene locus_tag LOCUS_01800 178599 176695 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061138.1 protein_id gnl|my_center|LOCUS_01800 181077 178702 gene locus_tag LOCUS_01810 181077 178702 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_01810 183577 181064 gene locus_tag LOCUS_01820 183577 181064 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877365.1 protein_id gnl|my_center|LOCUS_01820 185287 183809 gene locus_tag LOCUS_01830 185287 183809 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990274.1 protein_id gnl|my_center|LOCUS_01830 185466 186044 gene locus_tag LOCUS_01840 gene tmk 185466 186044 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877367.1 protein_id gnl|my_center|LOCUS_01840 186049 186600 gene locus_tag LOCUS_01850 186049 186600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 187601 186597 gene locus_tag LOCUS_01860 gene mtaA 187601 186597 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589539.1 protein_id gnl|my_center|LOCUS_01860 189214 187610 gene locus_tag LOCUS_01870 189214 187610 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020208.1 protein_id gnl|my_center|LOCUS_01870 190048 189221 gene locus_tag LOCUS_01880 gene mtaC 190048 189221 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021627.1 protein_id gnl|my_center|LOCUS_01880 191452 190067 gene locus_tag LOCUS_01890 gene mtaB 191452 190067 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024271.1 protein_id gnl|my_center|LOCUS_01890 191955 191746 gene locus_tag LOCUS_01900 191955 191746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 192918 191959 gene locus_tag LOCUS_01910 192918 191959 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877369.1 protein_id gnl|my_center|LOCUS_01910 193967 192924 gene locus_tag LOCUS_01920 193967 192924 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877370.1 protein_id gnl|my_center|LOCUS_01920 194405 193998 gene locus_tag LOCUS_01930 194405 193998 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877371.1 protein_id gnl|my_center|LOCUS_01930 196511 194511 gene locus_tag LOCUS_01940 196511 194511 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877372.1 protein_id gnl|my_center|LOCUS_01940 196648 197070 gene locus_tag LOCUS_01950 196648 197070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061140.1 protein_id gnl|my_center|LOCUS_01950 197699 197067 gene locus_tag LOCUS_01960 gene rrmJ 197699 197067 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877375.1 protein_id gnl|my_center|LOCUS_01960 198233 197703 gene locus_tag LOCUS_01970 198233 197703 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877376.1 protein_id gnl|my_center|LOCUS_01970 198441 199532 gene locus_tag LOCUS_01980 198441 199532 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060989.1 protein_id gnl|my_center|LOCUS_01980 199942 199535 gene locus_tag LOCUS_01990 199942 199535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 200323 199955 gene locus_tag LOCUS_02000 200323 199955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 200796 200329 gene locus_tag LOCUS_02010 200796 200329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 203409 200809 gene locus_tag LOCUS_02020 203409 200809 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877404.1 protein_id gnl|my_center|LOCUS_02020 203498 204349 gene locus_tag LOCUS_02030 203498 204349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 205160 204336 gene locus_tag LOCUS_02040 205160 204336 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359074.1 protein_id gnl|my_center|LOCUS_02040 205904 205206 gene locus_tag LOCUS_02050 205904 205206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 206002 206481 gene locus_tag LOCUS_02060 206002 206481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 207260 206478 gene locus_tag LOCUS_02070 gene nucS 207260 206478 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061145.1 protein_id gnl|my_center|LOCUS_02070 207315 208304 gene locus_tag LOCUS_02080 207315 208304 CDS product alpha/beta fold hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877422.1 protein_id gnl|my_center|LOCUS_02080 208309 208587 gene locus_tag LOCUS_02090 208309 208587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892859.1 protein_id gnl|my_center|LOCUS_02090 209537 208620 gene locus_tag LOCUS_02100 gene nadA 209537 208620 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877429.1 protein_id gnl|my_center|LOCUS_02100 210285 209542 gene locus_tag LOCUS_02110 210285 209542 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877432.1 protein_id gnl|my_center|LOCUS_02110 211189 210287 gene locus_tag LOCUS_02120 gene rnz 211189 210287 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061333.1 protein_id gnl|my_center|LOCUS_02120 211256 212086 gene locus_tag LOCUS_02130 gene nadC 211256 212086 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249173.1 protein_id gnl|my_center|LOCUS_02130 212090 212752 gene locus_tag LOCUS_02140 212090 212752 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_02140 212826 213908 gene locus_tag LOCUS_02150 gene carA 212826 213908 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060942.1 protein_id gnl|my_center|LOCUS_02150 213948 217124 gene locus_tag LOCUS_02160 gene carB 213948 217124 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_02160 217885 217127 gene locus_tag LOCUS_02170 217885 217127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 217928 219085 gene locus_tag LOCUS_02180 217928 219085 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876625.1 protein_id gnl|my_center|LOCUS_02180 219128 219553 gene locus_tag LOCUS_02190 219128 219553 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876624.1 protein_id gnl|my_center|LOCUS_02190 219610 220449 gene locus_tag LOCUS_02200 219610 220449 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060939.1 protein_id gnl|my_center|LOCUS_02200 220461 220925 gene locus_tag LOCUS_02210 220461 220925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 221938 220928 gene locus_tag LOCUS_02220 gene larE 221938 220928 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876621.1 protein_id gnl|my_center|LOCUS_02220 222588 221935 gene locus_tag LOCUS_02230 222588 221935 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_02230 223794 222595 gene locus_tag LOCUS_02240 223794 222595 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_02240 224439 223801 gene locus_tag LOCUS_02250 224439 223801 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_02250 224719 224492 gene locus_tag LOCUS_02260 224719 224492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 225491 224733 gene locus_tag LOCUS_02270 225491 224733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 226350 225598 gene locus_tag LOCUS_02280 226350 225598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 226694 227722 gene locus_tag LOCUS_02290 226694 227722 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485766.1 protein_id gnl|my_center|LOCUS_02290 227787 228707 gene locus_tag LOCUS_02300 227787 228707 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876611.1 protein_id gnl|my_center|LOCUS_02300 228716 228901 gene locus_tag LOCUS_02310 228716 228901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 229457 228894 gene locus_tag LOCUS_02320 229457 228894 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382268.1 protein_id gnl|my_center|LOCUS_02320 230032 229430 gene locus_tag LOCUS_02330 230032 229430 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168922.1 protein_id gnl|my_center|LOCUS_02330 230103 231515 gene locus_tag LOCUS_02340 230103 231515 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_02340 232239 231517 gene locus_tag LOCUS_02350 232239 231517 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868627.1 protein_id gnl|my_center|LOCUS_02350 232443 232850 gene locus_tag LOCUS_02360 232443 232850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 232931 233695 gene locus_tag LOCUS_02370 232931 233695 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_02370 233699 234418 gene locus_tag LOCUS_02380 233699 234418 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_02380 234429 235139 gene locus_tag LOCUS_02390 234429 235139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 235565 235221 gene locus_tag LOCUS_02400 235565 235221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 235800 235928 gene locus_tag LOCUS_02410 235800 235928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 237701 236127 gene locus_tag LOCUS_02420 gene serA 237701 236127 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061266.1 protein_id gnl|my_center|LOCUS_02420 237844 238185 gene locus_tag LOCUS_02430 237844 238185 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061225.1 protein_id gnl|my_center|LOCUS_02430 238245 238994 gene locus_tag LOCUS_02440 238245 238994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061265.1 protein_id gnl|my_center|LOCUS_02440 239389 238991 gene locus_tag LOCUS_02450 239389 238991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 240335 239394 gene locus_tag LOCUS_02460 240335 239394 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876598.1 protein_id gnl|my_center|LOCUS_02460 240397 241662 gene locus_tag LOCUS_02470 240397 241662 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 protein_id gnl|my_center|LOCUS_02470 241871 242782 gene locus_tag LOCUS_02480 241871 242782 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 protein_id gnl|my_center|LOCUS_02480 242782 243273 gene locus_tag LOCUS_02490 242782 243273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 protein_id gnl|my_center|LOCUS_02490 243338 244735 gene locus_tag LOCUS_02500 243338 244735 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876596.1 protein_id gnl|my_center|LOCUS_02500 244741 245643 gene locus_tag LOCUS_02510 244741 245643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 protein_id gnl|my_center|LOCUS_02510 245648 246520 gene locus_tag LOCUS_02520 245648 246520 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876594.1 protein_id gnl|my_center|LOCUS_02520 246567 247373 gene locus_tag LOCUS_02530 246567 247373 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876593.1 protein_id gnl|my_center|LOCUS_02530 247379 247885 gene locus_tag LOCUS_02540 247379 247885 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_02540 247892 248230 gene locus_tag LOCUS_02550 247892 248230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 248568 248233 gene locus_tag LOCUS_02560 248568 248233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 248638 248985 gene locus_tag LOCUS_02570 248638 248985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 249262 249576 gene locus_tag LOCUS_02580 gene ahaH 249262 249576 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060933.1 protein_id gnl|my_center|LOCUS_02580 249587 251590 gene locus_tag LOCUS_02590 249587 251590 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060932.1 protein_id gnl|my_center|LOCUS_02590 251644 252129 gene locus_tag LOCUS_02600 251644 252129 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876590.1 protein_id gnl|my_center|LOCUS_02600 252143 252769 gene locus_tag LOCUS_02610 252143 252769 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876589.1 protein_id gnl|my_center|LOCUS_02610 252781 253935 gene locus_tag LOCUS_02620 252781 253935 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876588.1 protein_id gnl|my_center|LOCUS_02620 253932 254249 gene locus_tag LOCUS_02630 253932 254249 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876587.1 protein_id gnl|my_center|LOCUS_02630 254246 256000 gene locus_tag LOCUS_02640 254246 256000 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_02640 256003 257391 gene locus_tag LOCUS_02650 256003 257391 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296141.1 protein_id gnl|my_center|LOCUS_02650 257417 258112 gene locus_tag LOCUS_02660 257417 258112 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876584.1 protein_id gnl|my_center|LOCUS_02660 258263 258415 gene locus_tag LOCUS_02670 258263 258415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 259570 258395 gene locus_tag LOCUS_02680 259570 258395 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296134.1 protein_id gnl|my_center|LOCUS_02680 259676 259603 gene locus_tag LOCUS_t00050 259676 259603 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 260134 259745 gene locus_tag LOCUS_02690 260134 259745 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024120.1 protein_id gnl|my_center|LOCUS_02690 260781 260176 gene locus_tag LOCUS_02700 260781 260176 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_02700 261782 260874 gene locus_tag LOCUS_02710 261782 260874 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_02710 263054 261795 gene locus_tag LOCUS_02720 gene dnaG 263054 261795 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876524.1 protein_id gnl|my_center|LOCUS_02720 263503 264240 gene locus_tag LOCUS_02730 263503 264240 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876521.1 protein_id gnl|my_center|LOCUS_02730 264370 264657 gene locus_tag LOCUS_02740 264370 264657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 264705 265637 gene locus_tag LOCUS_02750 264705 265637 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 protein_id gnl|my_center|LOCUS_02750 267553 265649 gene locus_tag LOCUS_02760 267553 265649 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876517.1 protein_id gnl|my_center|LOCUS_02760 268558 267590 gene locus_tag LOCUS_02770 268558 267590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876516.1 protein_id gnl|my_center|LOCUS_02770 268727 269539 gene locus_tag LOCUS_02780 268727 269539 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060918.1 protein_id gnl|my_center|LOCUS_02780 270390 269536 gene locus_tag LOCUS_02790 270390 269536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 270715 270392 gene locus_tag LOCUS_02800 270715 270392 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943418.1 protein_id gnl|my_center|LOCUS_02800 270916 270725 gene locus_tag LOCUS_02810 270916 270725 CDS product DUF2116 family Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876513.1 protein_id gnl|my_center|LOCUS_02810 271723 270932 gene locus_tag LOCUS_02820 271723 270932 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_02820 272413 271736 gene locus_tag LOCUS_02830 gene pyrH 272413 271736 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876512.1 protein_id gnl|my_center|LOCUS_02830 272659 273027 gene locus_tag LOCUS_02840 272659 273027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 275035 273650 gene locus_tag LOCUS_02850 275035 273650 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_02850 275507 275028 gene locus_tag LOCUS_02860 275507 275028 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948763.1 protein_id gnl|my_center|LOCUS_02860 276800 275670 gene locus_tag LOCUS_02870 276800 275670 CDS product pseudomurein-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875756.1 protein_id gnl|my_center|LOCUS_02870 277248 277655 gene locus_tag LOCUS_02880 277248 277655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 277696 281493 gene locus_tag LOCUS_02890 277696 281493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 281756 282199 gene locus_tag LOCUS_02900 281756 282199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061151.1 protein_id gnl|my_center|LOCUS_02900 282792 282211 gene locus_tag LOCUS_02910 282792 282211 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877436.1 protein_id gnl|my_center|LOCUS_02910 283729 282785 gene locus_tag LOCUS_02920 283729 282785 CDS product 3H domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877437.1 protein_id gnl|my_center|LOCUS_02920 283939 284988 gene locus_tag LOCUS_02930 283939 284988 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877439.1 protein_id gnl|my_center|LOCUS_02930 284994 285443 gene locus_tag LOCUS_02940 284994 285443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 286207 285452 gene locus_tag LOCUS_02950 286207 285452 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061154.1 protein_id gnl|my_center|LOCUS_02950 286402 287193 gene locus_tag LOCUS_02960 286402 287193 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020249.1 protein_id gnl|my_center|LOCUS_02960 288899 287205 gene locus_tag LOCUS_02970 gene glyS 288899 287205 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061155.1 protein_id gnl|my_center|LOCUS_02970 289498 288905 gene locus_tag LOCUS_02980 gene dcd 289498 288905 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061156.1 protein_id gnl|my_center|LOCUS_02980 289664 289822 gene locus_tag LOCUS_02990 289664 289822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 289779 291035 gene locus_tag LOCUS_03000 289779 291035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 291057 291845 gene locus_tag LOCUS_03010 291057 291845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 292538 291912 gene locus_tag LOCUS_03020 gene upp 292538 291912 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_03020 293817 292531 gene locus_tag LOCUS_03030 293817 292531 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775347.1 protein_id gnl|my_center|LOCUS_03030 294923 294102 gene locus_tag LOCUS_03040 294923 294102 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876384.1 protein_id gnl|my_center|LOCUS_03040 295825 294920 gene locus_tag LOCUS_03050 295825 294920 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877451.1 protein_id gnl|my_center|LOCUS_03050 297318 295837 gene locus_tag LOCUS_03060 297318 295837 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061157.1 protein_id gnl|my_center|LOCUS_03060 297434 299332 gene locus_tag LOCUS_03070 gene iorA 297434 299332 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877454.1 protein_id gnl|my_center|LOCUS_03070 299335 299919 gene locus_tag LOCUS_03080 gene iorB 299335 299919 CDS product indolepyruvate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877455.1 protein_id gnl|my_center|LOCUS_03080 299977 300255 gene locus_tag LOCUS_03090 299977 300255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 300282 300605 gene locus_tag LOCUS_03100 300282 300605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 301055 300624 gene locus_tag LOCUS_03110 301055 300624 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_03110 302367 301066 gene locus_tag LOCUS_03120 302367 301066 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877457.1 protein_id gnl|my_center|LOCUS_03120 302485 304098 gene locus_tag LOCUS_03130 302485 304098 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_03130 306161 304737 gene locus_tag LOCUS_03140 306161 304737 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_03140 306319 306669 gene locus_tag LOCUS_03150 306319 306669 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875816.1 protein_id gnl|my_center|LOCUS_03150 306679 307422 gene locus_tag LOCUS_03160 306679 307422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 307497 308522 gene locus_tag LOCUS_03170 307497 308522 CDS product Zc3h12a-like ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060764.1 protein_id gnl|my_center|LOCUS_03170 308515 309717 gene locus_tag LOCUS_03180 308515 309717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060765.1 protein_id gnl|my_center|LOCUS_03180 309769 310038 gene locus_tag LOCUS_03190 309769 310038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 310062 311282 gene locus_tag LOCUS_03200 gene argJ 310062 311282 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330363.1 protein_id gnl|my_center|LOCUS_03200 311652 312269 gene locus_tag LOCUS_03210 311652 312269 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877478.1 protein_id gnl|my_center|LOCUS_03210 312276 312986 gene locus_tag LOCUS_03220 312276 312986 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 protein_id gnl|my_center|LOCUS_03220 312979 313998 gene locus_tag LOCUS_03230 312979 313998 CDS product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610204.1 protein_id gnl|my_center|LOCUS_03230 314260 315138 gene locus_tag LOCUS_03240 gene argB 314260 315138 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875822.1 protein_id gnl|my_center|LOCUS_03240 316649 315171 gene locus_tag LOCUS_03250 316649 315171 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_03250 317651 316650 gene locus_tag LOCUS_03260 gene aksF 317651 316650 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875823.1 protein_id gnl|my_center|LOCUS_03260 317757 318221 gene locus_tag LOCUS_03270 317757 318221 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877408.1 protein_id gnl|my_center|LOCUS_03270 318474 319061 gene locus_tag LOCUS_03280 gene pdxT 318474 319061 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875829.1 protein_id gnl|my_center|LOCUS_03280 319049 319966 gene locus_tag LOCUS_03290 319049 319966 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_03290 319979 320653 gene locus_tag LOCUS_03300 319979 320653 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875831.1 protein_id gnl|my_center|LOCUS_03300 320673 322169 gene locus_tag LOCUS_03310 320673 322169 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875833.1 protein_id gnl|my_center|LOCUS_03310 322597 322166 gene locus_tag LOCUS_03320 322597 322166 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876447.1 protein_id gnl|my_center|LOCUS_03320 322620 322784 gene locus_tag LOCUS_03330 322620 322784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 323010 323237 gene locus_tag LOCUS_03340 323010 323237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 323628 324095 gene locus_tag LOCUS_03350 323628 324095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457324.1 protein_id gnl|my_center|LOCUS_03350 324193 324636 gene locus_tag LOCUS_03360 gene nikR 324193 324636 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876378.1 protein_id gnl|my_center|LOCUS_03360 324651 325418 gene locus_tag LOCUS_03370 324651 325418 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876377.1 protein_id gnl|my_center|LOCUS_03370 325475 325900 gene locus_tag LOCUS_03380 gene hycI 325475 325900 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485809.1 protein_id gnl|my_center|LOCUS_03380 325897 327000 gene locus_tag LOCUS_03390 325897 327000 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485757.1 protein_id gnl|my_center|LOCUS_03390 327082 328152 gene locus_tag LOCUS_03400 327082 328152 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876374.1 protein_id gnl|my_center|LOCUS_03400 328185 329621 gene locus_tag LOCUS_03410 328185 329621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 329705 330145 gene locus_tag LOCUS_03420 329705 330145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876372.1 protein_id gnl|my_center|LOCUS_03420 330158 331423 gene locus_tag LOCUS_03430 330158 331423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 331465 331899 gene locus_tag LOCUS_03440 331465 331899 CDS product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876369.1 protein_id gnl|my_center|LOCUS_03440 332382 331900 gene locus_tag LOCUS_03450 332382 331900 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 protein_id gnl|my_center|LOCUS_03450 332587 333840 gene locus_tag LOCUS_03460 332587 333840 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876367.1 protein_id gnl|my_center|LOCUS_03460 333969 335018 gene locus_tag LOCUS_03470 333969 335018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 335048 336085 gene locus_tag LOCUS_03480 335048 336085 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876363.1 protein_id gnl|my_center|LOCUS_03480 336653 338124 gene locus_tag LOCUS_r00030 336653 338124 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 338208 338283 gene locus_tag LOCUS_t00060 338208 338283 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 338610 341586 gene locus_tag LOCUS_r00040 338610 341586 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 341950 343422 gene locus_tag LOCUS_03490 341950 343422 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876362.1 protein_id gnl|my_center|LOCUS_03490 343432 343920 gene locus_tag LOCUS_03500 343432 343920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 344878 343904 gene locus_tag LOCUS_03510 344878 343904 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876360.1 protein_id gnl|my_center|LOCUS_03510 346061 344886 gene locus_tag LOCUS_03520 346061 344886 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061240.1 protein_id gnl|my_center|LOCUS_03520 347075 346149 gene locus_tag LOCUS_03530 gene guaA 347075 346149 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060888.1 protein_id gnl|my_center|LOCUS_03530 347360 347094 gene locus_tag LOCUS_03540 347360 347094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 347925 347353 gene locus_tag LOCUS_03550 347925 347353 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060887.1 protein_id gnl|my_center|LOCUS_03550 348750 348262 gene locus_tag LOCUS_03560 348750 348262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 349863 348949 gene locus_tag LOCUS_03570 gene trxB 349863 348949 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060886.1 protein_id gnl|my_center|LOCUS_03570 350660 349974 gene locus_tag LOCUS_03580 350660 349974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 350996 351199 gene locus_tag LOCUS_03590 350996 351199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 353229 351364 gene locus_tag LOCUS_03600 gene gatE 353229 351364 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876346.1 protein_id gnl|my_center|LOCUS_03600 354552 353242 gene locus_tag LOCUS_03610 gene gatD 354552 353242 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876345.1 protein_id gnl|my_center|LOCUS_03610 356028 354568 gene locus_tag LOCUS_03620 356028 354568 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_03620 357153 356041 gene locus_tag LOCUS_03630 gene vorB 357153 356041 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060884.1 protein_id gnl|my_center|LOCUS_03630 357385 357146 gene locus_tag LOCUS_03640 357385 357146 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022860.1 protein_id gnl|my_center|LOCUS_03640 359064 357394 gene locus_tag LOCUS_03650 359064 357394 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_03650 359635 359084 gene locus_tag LOCUS_03660 359635 359084 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 protein_id gnl|my_center|LOCUS_03660 359869 360243 gene locus_tag LOCUS_03670 359869 360243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 361184 360255 gene locus_tag LOCUS_03680 361184 360255 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_03680 361289 361666 gene locus_tag LOCUS_03690 361289 361666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 361666 362163 gene locus_tag LOCUS_03700 361666 362163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061212.1 protein_id gnl|my_center|LOCUS_03700 362168 362419 gene locus_tag LOCUS_03710 362168 362419 CDS product DUF2109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496532.1 protein_id gnl|my_center|LOCUS_03710 362429 362698 gene locus_tag LOCUS_03720 362429 362698 CDS product DUF2108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892391.1 protein_id gnl|my_center|LOCUS_03720 362691 362951 gene locus_tag LOCUS_03730 362691 362951 CDS product EhaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060805.1 protein_id gnl|my_center|LOCUS_03730 362948 363541 gene locus_tag LOCUS_03740 362948 363541 CDS product DUF2106 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261153.1 protein_id gnl|my_center|LOCUS_03740 363541 364236 gene locus_tag LOCUS_03750 363541 364236 CDS product EhaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060806.1 protein_id gnl|my_center|LOCUS_03750 364243 364914 gene locus_tag LOCUS_03760 364243 364914 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060807.1 protein_id gnl|my_center|LOCUS_03760 364922 365137 gene locus_tag LOCUS_03770 364922 365137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 365145 366005 gene locus_tag LOCUS_03780 365145 366005 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876032.1 protein_id gnl|my_center|LOCUS_03780 366016 366270 gene locus_tag LOCUS_03790 366016 366270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 366281 366580 gene locus_tag LOCUS_03800 366281 366580 CDS product DUF2104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876034.1 protein_id gnl|my_center|LOCUS_03800 366591 366983 gene locus_tag LOCUS_03810 366591 366983 CDS product DUF1959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876035.1 protein_id gnl|my_center|LOCUS_03810 367022 367471 gene locus_tag LOCUS_03820 367022 367471 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876036.1 protein_id gnl|my_center|LOCUS_03820 367468 368592 gene locus_tag LOCUS_03830 367468 368592 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876037.1 protein_id gnl|my_center|LOCUS_03830 368594 369637 gene locus_tag LOCUS_03840 368594 369637 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876038.1 protein_id gnl|my_center|LOCUS_03840 369634 371004 gene locus_tag LOCUS_03850 369634 371004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 371009 372055 gene locus_tag LOCUS_03860 371009 372055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876041.1 protein_id gnl|my_center|LOCUS_03860 372078 372968 gene locus_tag LOCUS_03870 372078 372968 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876042.1 protein_id gnl|my_center|LOCUS_03870 372978 373937 gene locus_tag LOCUS_03880 372978 373937 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876043.1 protein_id gnl|my_center|LOCUS_03880 374005 374829 gene locus_tag LOCUS_03890 374005 374829 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060810.1 protein_id gnl|my_center|LOCUS_03890 374842 375477 gene locus_tag LOCUS_03900 374842 375477 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876045.1 protein_id gnl|my_center|LOCUS_03900 376104 375490 gene locus_tag LOCUS_03910 376104 375490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 protein_id gnl|my_center|LOCUS_03910 377038 376106 gene locus_tag LOCUS_03920 377038 376106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021908.1 protein_id gnl|my_center|LOCUS_03920 377898 377050 gene locus_tag LOCUS_03930 377898 377050 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021909.1 protein_id gnl|my_center|LOCUS_03930 378790 377888 gene locus_tag LOCUS_03940 378790 377888 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_03940 380560 378941 gene locus_tag LOCUS_03950 380560 378941 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021912.1 protein_id gnl|my_center|LOCUS_03950 381237 380839 gene locus_tag LOCUS_03960 381237 380839 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438867.1 protein_id gnl|my_center|LOCUS_03960 381450 382004 gene locus_tag LOCUS_03970 381450 382004 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750468.1 protein_id gnl|my_center|LOCUS_03970 382035 382460 gene locus_tag LOCUS_03980 382035 382460 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061237.1 protein_id gnl|my_center|LOCUS_03980 382520 382846 gene locus_tag LOCUS_03990 382520 382846 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870247.1 protein_id gnl|my_center|LOCUS_03990 383679 382849 gene locus_tag LOCUS_04000 gene fdhD 383679 382849 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877156.1 protein_id gnl|my_center|LOCUS_04000 383853 384113 gene locus_tag LOCUS_04010 383853 384113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 384124 386247 gene locus_tag LOCUS_04020 384124 386247 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808998.1 protein_id gnl|my_center|LOCUS_04020 387200 386265 gene locus_tag LOCUS_04030 387200 386265 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993974.1 protein_id gnl|my_center|LOCUS_04030 387370 388110 gene locus_tag LOCUS_04040 387370 388110 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_04040 388121 388879 gene locus_tag LOCUS_04050 388121 388879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_04050 389623 388883 gene locus_tag LOCUS_04060 gene thiD 389623 388883 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876253.1 protein_id gnl|my_center|LOCUS_04060 390298 389624 gene locus_tag LOCUS_04070 gene cofC 390298 389624 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876252.1 protein_id gnl|my_center|LOCUS_04070 391715 390309 gene locus_tag LOCUS_04080 gene proS 391715 390309 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060857.1 protein_id gnl|my_center|LOCUS_04080 391870 392916 gene locus_tag LOCUS_04090 391870 392916 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876249.1 protein_id gnl|my_center|LOCUS_04090 392913 393350 gene locus_tag LOCUS_04100 392913 393350 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876248.1 protein_id gnl|my_center|LOCUS_04100 393371 394036 gene locus_tag LOCUS_04110 gene rpiA 393371 394036 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060856.1 protein_id gnl|my_center|LOCUS_04110 394047 394265 gene locus_tag LOCUS_04120 394047 394265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 397468 394319 gene locus_tag LOCUS_04130 397468 394319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 397722 399500 gene locus_tag LOCUS_04140 397722 399500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 399746 401200 gene locus_tag LOCUS_04150 399746 401200 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871161.1 protein_id gnl|my_center|LOCUS_04150 401321 401734 gene locus_tag LOCUS_04160 401321 401734 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876409.1 protein_id gnl|my_center|LOCUS_04160 401737 401919 gene locus_tag LOCUS_04170 401737 401919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 403690 402029 gene locus_tag LOCUS_04180 gene pheT 403690 402029 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876408.1 protein_id gnl|my_center|LOCUS_04180 404075 403716 gene locus_tag LOCUS_04190 404075 403716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 404700 405677 gene locus_tag LOCUS_04200 404700 405677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 405868 406044 gene locus_tag LOCUS_04210 405868 406044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 406155 408872 gene locus_tag LOCUS_04220 gene valS 406155 408872 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 protein_id gnl|my_center|LOCUS_04220 408979 410295 gene locus_tag LOCUS_04230 gene aroA 408979 410295 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 protein_id gnl|my_center|LOCUS_04230 410308 410931 gene locus_tag LOCUS_04240 410308 410931 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485759.1 protein_id gnl|my_center|LOCUS_04240 411080 412027 gene locus_tag LOCUS_04250 gene cysK 411080 412027 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_04250 412117 412830 gene locus_tag LOCUS_04260 412117 412830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 412840 413223 gene locus_tag LOCUS_04270 412840 413223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 413277 413348 gene locus_tag LOCUS_t00070 413277 413348 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 413384 414730 gene locus_tag LOCUS_04280 gene cysS 413384 414730 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868520.1 protein_id gnl|my_center|LOCUS_04280 415263 414739 gene locus_tag LOCUS_04290 415263 414739 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 protein_id gnl|my_center|LOCUS_04290 415478 421672 gene locus_tag LOCUS_04300 415478 421672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 421850 421659 gene locus_tag LOCUS_04310 421850 421659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 421990 423288 gene locus_tag LOCUS_04320 421990 423288 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022675.1 protein_id gnl|my_center|LOCUS_04320 423321 424508 gene locus_tag LOCUS_04330 gene nifS 423321 424508 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_04330 424524 424892 gene locus_tag LOCUS_04340 gene nifU 424524 424892 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_04340 425089 425481 gene locus_tag LOCUS_04350 425089 425481 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_04350 425813 426208 gene locus_tag LOCUS_04360 425813 426208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 426238 428496 gene locus_tag LOCUS_04370 426238 428496 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060894.1 protein_id gnl|my_center|LOCUS_04370 428498 429007 gene locus_tag LOCUS_04380 428498 429007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 429016 429909 gene locus_tag LOCUS_04390 429016 429909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 429919 430893 gene locus_tag LOCUS_04400 429919 430893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 431250 430963 gene locus_tag LOCUS_04410 431250 430963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 431776 431961 gene locus_tag LOCUS_04420 431776 431961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 431958 432221 gene locus_tag LOCUS_04430 431958 432221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 432232 432525 gene locus_tag LOCUS_04440 432232 432525 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438991.1 protein_id gnl|my_center|LOCUS_04440 432533 433897 gene locus_tag LOCUS_04450 432533 433897 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_04450 434081 434614 gene locus_tag LOCUS_04460 434081 434614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 434692 434925 gene locus_tag LOCUS_04470 434692 434925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 435082 435300 gene locus_tag LOCUS_04480 435082 435300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 435310 436029 gene locus_tag LOCUS_04490 435310 436029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 436252 436527 gene locus_tag LOCUS_04500 436252 436527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 436642 437346 gene locus_tag LOCUS_04510 436642 437346 CDS product ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876327.1 protein_id gnl|my_center|LOCUS_04510 437336 437698 gene locus_tag LOCUS_04520 437336 437698 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876326.1 protein_id gnl|my_center|LOCUS_04520 438393 439145 gene locus_tag LOCUS_04530 gene psmA 438393 439145 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876325.1 protein_id gnl|my_center|LOCUS_04530 439173 439874 gene locus_tag LOCUS_04540 439173 439874 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876324.1 protein_id gnl|my_center|LOCUS_04540 439905 440801 gene locus_tag LOCUS_04550 gene rrp4 439905 440801 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876323.1 protein_id gnl|my_center|LOCUS_04550 440829 441530 gene locus_tag LOCUS_04560 gene rrp41 440829 441530 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876322.1 protein_id gnl|my_center|LOCUS_04560 441532 442320 gene locus_tag LOCUS_04570 gene rrp42 441532 442320 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876321.1 protein_id gnl|my_center|LOCUS_04570 442931 442317 gene locus_tag LOCUS_04580 442931 442317 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892791.1 protein_id gnl|my_center|LOCUS_04580 443698 442943 gene locus_tag LOCUS_04590 443698 442943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 444283 443720 gene locus_tag LOCUS_04600 gene cbiT 444283 443720 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875785.1 protein_id gnl|my_center|LOCUS_04600 444832 444284 gene locus_tag LOCUS_04610 444832 444284 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060752.1 protein_id gnl|my_center|LOCUS_04610 446068 444842 gene locus_tag LOCUS_04620 446068 444842 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875787.1 protein_id gnl|my_center|LOCUS_04620 446388 446074 gene locus_tag LOCUS_04630 446388 446074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 446691 447908 gene locus_tag LOCUS_04640 446691 447908 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060874.1 protein_id gnl|my_center|LOCUS_04640 447920 448258 gene locus_tag LOCUS_04650 447920 448258 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_04650 448903 448289 gene locus_tag LOCUS_04660 448903 448289 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060845.1 protein_id gnl|my_center|LOCUS_04660 449587 448913 gene locus_tag LOCUS_04670 gene aroD 449587 448913 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876205.1 protein_id gnl|my_center|LOCUS_04670 452835 449668 gene locus_tag LOCUS_04680 452835 449668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 453128 454627 gene locus_tag LOCUS_04690 453128 454627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 454684 457221 gene locus_tag LOCUS_04700 454684 457221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 457603 458328 gene locus_tag LOCUS_04710 457603 458328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060844.1 protein_id gnl|my_center|LOCUS_04710 458344 459204 gene locus_tag LOCUS_04720 gene sucD 458344 459204 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750467.1 protein_id gnl|my_center|LOCUS_04720 459205 460407 gene locus_tag LOCUS_04730 gene hmgA 459205 460407 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876201.1 protein_id gnl|my_center|LOCUS_04730 460409 460609 gene locus_tag LOCUS_04740 460409 460609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 461247 460606 gene locus_tag LOCUS_04750 461247 460606 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892283.1 protein_id gnl|my_center|LOCUS_04750 461706 461254 gene locus_tag LOCUS_04760 461706 461254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876197.1 protein_id gnl|my_center|LOCUS_04760 461905 461750 gene locus_tag LOCUS_04770 461905 461750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 462113 463336 gene locus_tag LOCUS_04780 462113 463336 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870253.1 protein_id gnl|my_center|LOCUS_04780 464434 463424 gene locus_tag LOCUS_04790 464434 463424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 464626 466278 gene locus_tag LOCUS_04800 gene thsA 464626 466278 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060772.1 protein_id gnl|my_center|LOCUS_04800 466693 471198 gene locus_tag LOCUS_04810 466693 471198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 471327 472037 gene locus_tag LOCUS_04820 471327 472037 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330364.1 protein_id gnl|my_center|LOCUS_04820 472129 472644 gene locus_tag LOCUS_04830 gene endA 472129 472644 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060780.1 protein_id gnl|my_center|LOCUS_04830 472753 473841 gene locus_tag LOCUS_04840 472753 473841 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875890.1 protein_id gnl|my_center|LOCUS_04840 473841 474500 gene locus_tag LOCUS_04850 473841 474500 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892541.1 protein_id gnl|my_center|LOCUS_04850 474545 475741 gene locus_tag LOCUS_04860 gene thrC 474545 475741 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061193.1 protein_id gnl|my_center|LOCUS_04860 476000 476197 gene locus_tag LOCUS_04870 476000 476197 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876456.1 protein_id gnl|my_center|LOCUS_04870 476550 477464 gene locus_tag LOCUS_04880 476550 477464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 478038 477688 gene locus_tag LOCUS_04890 478038 477688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 478352 478173 gene locus_tag LOCUS_04900 478352 478173 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061279.1 protein_id gnl|my_center|LOCUS_04900 478672 478385 gene locus_tag LOCUS_04910 478672 478385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 479210 478686 gene locus_tag LOCUS_04920 479210 478686 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876802.1 protein_id gnl|my_center|LOCUS_04920 479776 480147 gene locus_tag LOCUS_04930 gene rpl7ae 479776 480147 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061194.1 protein_id gnl|my_center|LOCUS_04930 480180 480386 gene locus_tag LOCUS_04940 480180 480386 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875895.1 protein_id gnl|my_center|LOCUS_04940 480401 480562 gene locus_tag LOCUS_04950 480401 480562 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875896.1 protein_id gnl|my_center|LOCUS_04950 480559 481011 gene locus_tag LOCUS_04960 gene ndk 480559 481011 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875897.1 protein_id gnl|my_center|LOCUS_04960 481029 482819 gene locus_tag LOCUS_04970 gene infB 481029 482819 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875898.1 protein_id gnl|my_center|LOCUS_04970 482861 483247 gene locus_tag LOCUS_04980 482861 483247 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_04980 483314 484528 gene locus_tag LOCUS_04990 gene eif2g 483314 484528 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875900.1 protein_id gnl|my_center|LOCUS_04990 484538 484930 gene locus_tag LOCUS_05000 484538 484930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875901.1 protein_id gnl|my_center|LOCUS_05000 484978 485505 gene locus_tag LOCUS_05010 484978 485505 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_05010 485516 486082 gene locus_tag LOCUS_05020 gene rpoE 485516 486082 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875903.1 protein_id gnl|my_center|LOCUS_05020 486079 486255 gene locus_tag LOCUS_05030 486079 486255 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875904.1 protein_id gnl|my_center|LOCUS_05030 486267 486776 gene locus_tag LOCUS_05040 486267 486776 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875905.1 protein_id gnl|my_center|LOCUS_05040 486790 487098 gene locus_tag LOCUS_05050 486790 487098 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875906.1 protein_id gnl|my_center|LOCUS_05050 487109 487264 gene locus_tag LOCUS_05060 487109 487264 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875907.1 protein_id gnl|my_center|LOCUS_05060 487322 488740 gene locus_tag LOCUS_05070 gene argH 487322 488740 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875908.1 protein_id gnl|my_center|LOCUS_05070 488958 488737 gene locus_tag LOCUS_05080 488958 488737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 490001 488979 gene locus_tag LOCUS_05090 490001 488979 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892473.1 protein_id gnl|my_center|LOCUS_05090 490120 490734 gene locus_tag LOCUS_05100 490120 490734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 490846 491004 gene locus_tag LOCUS_05110 490846 491004 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249479.1 protein_id gnl|my_center|LOCUS_05110 491052 491171 gene locus_tag LOCUS_05120 491052 491171 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_05120 491785 491183 gene locus_tag LOCUS_05130 491785 491183 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_05130 491859 492227 gene locus_tag LOCUS_05140 491859 492227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 492934 492242 gene locus_tag LOCUS_05150 gene arfB 492934 492242 CDS product 2-amino-5-formylamino-6-ribosylaminopyrimidin-4(3H)-one 5'-monophosphate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876289.1 protein_id gnl|my_center|LOCUS_05150 493431 492949 gene locus_tag LOCUS_05160 493431 492949 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 protein_id gnl|my_center|LOCUS_05160 493958 494188 gene locus_tag LOCUS_05170 493958 494188 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_05170 494247 494435 gene locus_tag LOCUS_05180 494247 494435 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876286.1 protein_id gnl|my_center|LOCUS_05180 494681 495091 gene locus_tag LOCUS_05190 494681 495091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 495105 495497 gene locus_tag LOCUS_05200 495105 495497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 495499 496257 gene locus_tag LOCUS_05210 495499 496257 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_05210 496613 496263 gene locus_tag LOCUS_05220 496613 496263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 496795 497466 gene locus_tag LOCUS_05230 gene rnc 496795 497466 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640377.1 protein_id gnl|my_center|LOCUS_05230 497476 498951 gene locus_tag LOCUS_05240 497476 498951 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990604.1 protein_id gnl|my_center|LOCUS_05240 500255 498969 gene locus_tag LOCUS_05250 500255 498969 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022675.1 protein_id gnl|my_center|LOCUS_05250 500691 506039 gene locus_tag LOCUS_05260 500691 506039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05260 506278 506009 gene locus_tag LOCUS_05270 506278 506009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 506220 510584 gene locus_tag LOCUS_05280 506220 510584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05280 511141 510827 gene locus_tag LOCUS_05290 511141 510827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 511388 513700 gene locus_tag LOCUS_05300 511388 513700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 514468 513740 gene locus_tag LOCUS_05310 gene cas6 514468 513740 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750454.1 protein_id gnl|my_center|LOCUS_05310 514803 516161 gene locus_tag LOCUS_05320 gene cas8a1 514803 516161 CDS product type I-B CRISPR-associated protein Cas8b1/Cst1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023575.1 protein_id gnl|my_center|LOCUS_05320 516164 517150 gene locus_tag LOCUS_05330 gene cas7i 516164 517150 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023574.1 protein_id gnl|my_center|LOCUS_05330 517151 517771 gene locus_tag LOCUS_05340 gene cas5b 517151 517771 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023573.1 protein_id gnl|my_center|LOCUS_05340 517780 519984 gene locus_tag LOCUS_05350 517780 519984 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065767.1 protein_id gnl|my_center|LOCUS_05350 519985 520491 gene locus_tag LOCUS_05360 gene cas4 519985 520491 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876709.1 protein_id gnl|my_center|LOCUS_05360 520506 521474 gene locus_tag LOCUS_05370 gene cas1b 520506 521474 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060964.1 protein_id gnl|my_center|LOCUS_05370 521479 521742 gene locus_tag LOCUS_05380 gene cas2 521479 521742 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496911.1 protein_id gnl|my_center|LOCUS_05380 522085 523910 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttaaaaataagactataataggattgaaat 524031 525458 gene locus_tag LOCUS_05390 gene asnB 524031 525458 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060813.1 protein_id gnl|my_center|LOCUS_05390 525855 527105 gene locus_tag LOCUS_05400 525855 527105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 527123 527338 gene locus_tag LOCUS_05410 527123 527338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 527350 527835 gene locus_tag LOCUS_05420 527350 527835 CDS product allosteric regulator of homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060814.1 protein_id gnl|my_center|LOCUS_05420 527843 528862 gene locus_tag LOCUS_05430 527843 528862 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876056.1 protein_id gnl|my_center|LOCUS_05430 528890 530122 gene locus_tag LOCUS_05440 528890 530122 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060815.1 protein_id gnl|my_center|LOCUS_05440 530246 531610 gene locus_tag LOCUS_05450 530246 531610 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_05450 531689 533080 gene locus_tag LOCUS_05460 531689 533080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 533151 536912 gene locus_tag LOCUS_05470 533151 536912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 536913 537113 gene locus_tag LOCUS_05480 536913 537113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 537482 538273 gene locus_tag LOCUS_05490 537482 538273 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101871.1 protein_id gnl|my_center|LOCUS_05490 538289 539419 gene locus_tag LOCUS_05500 538289 539419 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_05500 539689 541305 gene locus_tag LOCUS_05510 gene pyrG 539689 541305 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876058.1 protein_id gnl|my_center|LOCUS_05510 541695 541417 gene locus_tag LOCUS_05520 541695 541417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 541953 541735 gene locus_tag LOCUS_05530 541953 541735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 541943 542260 gene locus_tag LOCUS_05540 541943 542260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 542262 542690 gene locus_tag LOCUS_05550 542262 542690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 542719 543468 gene locus_tag LOCUS_05560 542719 543468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 543585 544391 gene locus_tag LOCUS_05570 543585 544391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 544398 545078 gene locus_tag LOCUS_05580 544398 545078 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_05580 545623 545081 gene locus_tag LOCUS_05590 545623 545081 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060819.1 protein_id gnl|my_center|LOCUS_05590 546373 545639 gene locus_tag LOCUS_05600 546373 545639 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876074.1 protein_id gnl|my_center|LOCUS_05600 546769 546386 gene locus_tag LOCUS_05610 546769 546386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 547120 548175 gene locus_tag LOCUS_05620 547120 548175 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876130.1 protein_id gnl|my_center|LOCUS_05620 548252 549775 gene locus_tag LOCUS_05630 548252 549775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 550576 549800 gene locus_tag LOCUS_05640 550576 549800 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942064.1 protein_id gnl|my_center|LOCUS_05640 550824 551903 gene locus_tag LOCUS_05650 550824 551903 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875832.1 protein_id gnl|my_center|LOCUS_05650 551974 553002 gene locus_tag LOCUS_05660 551974 553002 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060820.1 protein_id gnl|my_center|LOCUS_05660 553037 553456 gene locus_tag LOCUS_05670 553037 553456 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_05670 553942 553457 gene locus_tag LOCUS_05680 gene tsaA 553942 553457 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 protein_id gnl|my_center|LOCUS_05680 554287 554078 gene locus_tag LOCUS_05690 554287 554078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 555075 554638 gene locus_tag LOCUS_05700 555075 554638 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875788.1 protein_id gnl|my_center|LOCUS_05700 555618 555079 gene locus_tag LOCUS_05710 555618 555079 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060754.1 protein_id gnl|my_center|LOCUS_05710 556340 555624 gene locus_tag LOCUS_05720 556340 555624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 556472 557146 gene locus_tag LOCUS_05730 556472 557146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 557147 557662 gene locus_tag LOCUS_05740 557147 557662 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060842.1 protein_id gnl|my_center|LOCUS_05740 557947 558093 gene locus_tag LOCUS_05750 557947 558093 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876192.1 protein_id gnl|my_center|LOCUS_05750 558291 559043 gene locus_tag LOCUS_05760 558291 559043 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060841.1 protein_id gnl|my_center|LOCUS_05760 559105 560163 gene locus_tag LOCUS_05770 559105 560163 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496958.1 protein_id gnl|my_center|LOCUS_05770 560182 561693 gene locus_tag LOCUS_05780 560182 561693 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875946.1 protein_id gnl|my_center|LOCUS_05780 561823 563046 gene locus_tag LOCUS_05790 561823 563046 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870840.1 protein_id gnl|my_center|LOCUS_05790 563043 565796 gene locus_tag LOCUS_05800 gene rad50 563043 565796 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846723.1 protein_id gnl|my_center|LOCUS_05800 566235 565834 gene locus_tag LOCUS_05810 566235 565834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 566328 567608 gene locus_tag LOCUS_05820 566328 567608 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876171.1 protein_id gnl|my_center|LOCUS_05820 567694 568878 gene locus_tag LOCUS_05830 567694 568878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296325.1 protein_id gnl|my_center|LOCUS_05830 568924 569583 gene locus_tag LOCUS_05840 568924 569583 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060837.1 protein_id gnl|my_center|LOCUS_05840 570243 569569 gene locus_tag LOCUS_05850 570243 569569 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876165.1 protein_id gnl|my_center|LOCUS_05850 571494 570268 gene locus_tag LOCUS_05860 571494 570268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 573971 571512 gene locus_tag LOCUS_05870 573971 571512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 574128 576728 gene locus_tag LOCUS_05880 574128 576728 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876131.1 protein_id gnl|my_center|LOCUS_05880 576879 577088 gene locus_tag LOCUS_05890 576879 577088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 577238 577615 gene locus_tag LOCUS_05900 gene hypA 577238 577615 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060898.1 protein_id gnl|my_center|LOCUS_05900 577632 578285 gene locus_tag LOCUS_05910 gene hypB 577632 578285 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_05910 578296 579327 gene locus_tag LOCUS_05920 578296 579327 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485760.1 protein_id gnl|my_center|LOCUS_05920 579381 579455 gene locus_tag LOCUS_t00080 579381 579455 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 579500 580594 gene locus_tag LOCUS_05930 579500 580594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060897.1 protein_id gnl|my_center|LOCUS_05930 580610 581062 gene locus_tag LOCUS_05940 580610 581062 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876415.1 protein_id gnl|my_center|LOCUS_05940 581067 581372 gene locus_tag LOCUS_05950 581067 581372 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876414.1 protein_id gnl|my_center|LOCUS_05950 581381 582325 gene locus_tag LOCUS_05960 581381 582325 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876413.1 protein_id gnl|my_center|LOCUS_05960 583081 582329 gene locus_tag LOCUS_05970 gene cobM 583081 582329 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_05970 583199 583591 gene locus_tag LOCUS_05980 583199 583591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 583588 584082 gene locus_tag LOCUS_05990 583588 584082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 584108 584476 gene locus_tag LOCUS_06000 584108 584476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 585234 584473 gene locus_tag LOCUS_06010 585234 584473 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875872.1 protein_id gnl|my_center|LOCUS_06010 586004 585240 gene locus_tag LOCUS_06020 gene uppS 586004 585240 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875871.1 protein_id gnl|my_center|LOCUS_06020 586777 586061 gene locus_tag LOCUS_06030 gene mtxX 586777 586061 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875870.1 protein_id gnl|my_center|LOCUS_06030 586870 587460 gene locus_tag LOCUS_06040 586870 587460 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877389.1 protein_id gnl|my_center|LOCUS_06040 587474 588739 gene locus_tag LOCUS_06050 587474 588739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 589386 588775 gene locus_tag LOCUS_06060 589386 588775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 590848 589472 gene locus_tag LOCUS_06070 590848 589472 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060774.1 protein_id gnl|my_center|LOCUS_06070 591232 590945 gene locus_tag LOCUS_06080 591232 590945 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875863.1 protein_id gnl|my_center|LOCUS_06080 592147 591368 gene locus_tag LOCUS_06090 gene proG 592147 591368 CDS product pyrroline-5-carboxylate reductase ProG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232626.1 protein_id gnl|my_center|LOCUS_06090 592869 592153 gene locus_tag LOCUS_06100 592869 592153 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060890.1 protein_id gnl|my_center|LOCUS_06100 592989 593759 gene locus_tag LOCUS_06110 gene comA 592989 593759 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877281.1 protein_id gnl|my_center|LOCUS_06110 593792 595039 gene locus_tag LOCUS_06120 593792 595039 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877291.1 protein_id gnl|my_center|LOCUS_06120 595054 595662 gene locus_tag LOCUS_06130 595054 595662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 595646 596584 gene locus_tag LOCUS_06140 595646 596584 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023064.1 protein_id gnl|my_center|LOCUS_06140 596584 598890 gene locus_tag LOCUS_06150 596584 598890 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065616.1 protein_id gnl|my_center|LOCUS_06150 599438 598902 gene locus_tag LOCUS_06160 gene comE 599438 598902 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_06160 599934 599443 gene locus_tag LOCUS_06170 gene comD 599934 599443 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 protein_id gnl|my_center|LOCUS_06170 600099 601250 gene locus_tag LOCUS_06180 gene cofH 600099 601250 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 protein_id gnl|my_center|LOCUS_06180 601269 601937 gene locus_tag LOCUS_06190 601269 601937 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061278.1 protein_id gnl|my_center|LOCUS_06190 601942 602502 gene locus_tag LOCUS_06200 601942 602502 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060967.1 protein_id gnl|my_center|LOCUS_06200 602754 602497 gene locus_tag LOCUS_06210 602754 602497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 603734 602760 gene locus_tag LOCUS_06220 gene priS 603734 602760 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061231.1 protein_id gnl|my_center|LOCUS_06220 603836 604354 gene locus_tag LOCUS_06230 603836 604354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 605676 604351 gene locus_tag LOCUS_06240 gene priL 605676 604351 CDS product DNA primase large subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876225.1 protein_id gnl|my_center|LOCUS_06240 605806 607362 gene locus_tag LOCUS_06250 605806 607362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 607627 609609 gene locus_tag LOCUS_06260 gene metG 607627 609609 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876226.1 protein_id gnl|my_center|LOCUS_06260 609634 611211 gene locus_tag LOCUS_06270 609634 611211 CDS product DUF530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876227.1 protein_id gnl|my_center|LOCUS_06270 611217 611687 gene locus_tag LOCUS_06280 611217 611687 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060850.1 protein_id gnl|my_center|LOCUS_06280 611948 612076 gene locus_tag LOCUS_06290 611948 612076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 613353 612478 gene locus_tag LOCUS_06300 613353 612478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 613631 614647 gene locus_tag LOCUS_06310 613631 614647 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060851.1 protein_id gnl|my_center|LOCUS_06310 614653 615324 gene locus_tag LOCUS_06320 614653 615324 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875874.1 protein_id gnl|my_center|LOCUS_06320 615815 615348 gene locus_tag LOCUS_06330 615815 615348 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870151.1 protein_id gnl|my_center|LOCUS_06330 616477 615812 gene locus_tag LOCUS_06340 616477 615812 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060848.1 protein_id gnl|my_center|LOCUS_06340 616621 617127 gene locus_tag LOCUS_06350 616621 617127 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091620766.1 protein_id gnl|my_center|LOCUS_06350 617356 618543 gene locus_tag LOCUS_06360 617356 618543 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_06360 618570 619424 gene locus_tag LOCUS_06370 618570 619424 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892274.1 protein_id gnl|my_center|LOCUS_06370 619411 619950 gene locus_tag LOCUS_06380 619411 619950 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876217.1 protein_id gnl|my_center|LOCUS_06380 620044 624546 gene locus_tag LOCUS_06390 620044 624546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 624735 624944 gene locus_tag LOCUS_06400 624735 624944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 625075 625869 gene locus_tag LOCUS_06410 625075 625869 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_06410 625879 627009 gene locus_tag LOCUS_06420 625879 627009 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060849.1 protein_id gnl|my_center|LOCUS_06420 627019 627576 gene locus_tag LOCUS_06430 gene thpR 627019 627576 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_06430 627581 628951 gene locus_tag LOCUS_06440 gene cca 627581 628951 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876223.1 protein_id gnl|my_center|LOCUS_06440 629159 636751 gene locus_tag LOCUS_06450 629159 636751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 636985 639975 gene locus_tag LOCUS_06460 636985 639975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 640049 640597 gene locus_tag LOCUS_06470 640049 640597 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004289236.1 protein_id gnl|my_center|LOCUS_06470 640619 641299 gene locus_tag LOCUS_06480 gene npdG 640619 641299 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_06480 641971 641345 gene locus_tag LOCUS_06490 641971 641345 CDS product CatA-like O-acetyltransferase, family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705203.1 protein_id gnl|my_center|LOCUS_06490 642093 643427 gene locus_tag LOCUS_06500 642093 643427 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876966.1 protein_id gnl|my_center|LOCUS_06500 643508 644380 gene locus_tag LOCUS_06510 643508 644380 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060983.1 protein_id gnl|my_center|LOCUS_06510 644580 645713 gene locus_tag LOCUS_06520 644580 645713 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101954.1 protein_id gnl|my_center|LOCUS_06520 646499 645714 gene locus_tag LOCUS_06530 646499 645714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 646582 646761 gene locus_tag LOCUS_06540 646582 646761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 646772 647047 gene locus_tag LOCUS_06550 646772 647047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 647314 647042 gene locus_tag LOCUS_06560 647314 647042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 647759 647316 gene locus_tag LOCUS_06570 647759 647316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 648743 648255 gene locus_tag LOCUS_06580 648743 648255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 649868 649440 gene locus_tag LOCUS_06590 649868 649440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 649932 650636 gene locus_tag LOCUS_06600 649932 650636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 650853 651431 gene locus_tag LOCUS_06610 650853 651431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 651444 651779 gene locus_tag LOCUS_06620 651444 651779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 652726 651776 gene locus_tag LOCUS_06630 652726 651776 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881122.1 protein_id gnl|my_center|LOCUS_06630 653095 654159 gene locus_tag LOCUS_06640 653095 654159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 654260 654814 gene locus_tag LOCUS_06650 654260 654814 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877414.1 protein_id gnl|my_center|LOCUS_06650 654966 655232 gene locus_tag LOCUS_06660 654966 655232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 655496 655624 gene locus_tag LOCUS_06670 655496 655624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 656535 655933 gene locus_tag LOCUS_06680 656535 655933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 656669 658306 gene locus_tag LOCUS_06690 656669 658306 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_06690 658521 659102 gene locus_tag LOCUS_06700 658521 659102 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876297.1 protein_id gnl|my_center|LOCUS_06700 659125 660771 gene locus_tag LOCUS_06710 659125 660771 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876295.1 protein_id gnl|my_center|LOCUS_06710 661298 661573 gene locus_tag LOCUS_06720 661298 661573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 661570 662574 gene locus_tag LOCUS_06730 gene cas1 661570 662574 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_06730 662844 663155 gene locus_tag LOCUS_06740 662844 663155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 663391 663654 gene locus_tag LOCUS_06750 663391 663654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 663876 664046 gene locus_tag LOCUS_06760 663876 664046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 664215 664769 gene locus_tag LOCUS_06770 664215 664769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 665282 665791 gene locus_tag LOCUS_06780 665282 665791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 666375 665800 gene locus_tag LOCUS_06790 666375 665800 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892518.1 protein_id gnl|my_center|LOCUS_06790 666586 667404 gene locus_tag LOCUS_06800 666586 667404 CDS product nicotianamine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876313.1 protein_id gnl|my_center|LOCUS_06800 667593 667958 gene locus_tag LOCUS_06810 667593 667958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 667998 668540 gene locus_tag LOCUS_06820 667998 668540 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 protein_id gnl|my_center|LOCUS_06820 668625 669056 gene locus_tag LOCUS_06830 668625 669056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 670887 669808 gene locus_tag LOCUS_06840 670887 669808 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964483.1 protein_id gnl|my_center|LOCUS_06840 671262 672845 gene locus_tag LOCUS_06850 671262 672845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 672862 673062 gene locus_tag LOCUS_06860 672862 673062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 673372 674583 gene locus_tag LOCUS_06870 673372 674583 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_06870 675273 675100 gene locus_tag LOCUS_06880 675273 675100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 676217 675294 gene locus_tag LOCUS_06890 676217 675294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 676578 676228 gene locus_tag LOCUS_06900 676578 676228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 677992 676580 gene locus_tag LOCUS_06910 677992 676580 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886939.1 protein_id gnl|my_center|LOCUS_06910 679095 678211 gene locus_tag LOCUS_06920 679095 678211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876151.1 protein_id gnl|my_center|LOCUS_06920 679342 680775 gene locus_tag LOCUS_06930 679342 680775 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871161.1 protein_id gnl|my_center|LOCUS_06930 682217 680778 gene locus_tag LOCUS_06940 682217 680778 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871161.1 protein_id gnl|my_center|LOCUS_06940 683090 682437 gene locus_tag LOCUS_06950 683090 682437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 684405 683161 gene locus_tag LOCUS_06960 684405 683161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 684937 684416 gene locus_tag LOCUS_06970 684937 684416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 685187 686110 gene locus_tag LOCUS_06980 685187 686110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 686178 687116 gene locus_tag LOCUS_06990 686178 687116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 688417 687110 gene locus_tag LOCUS_07000 688417 687110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 688601 688443 gene locus_tag LOCUS_07010 688601 688443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 689125 688649 gene locus_tag LOCUS_07020 689125 688649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 689709 689155 gene locus_tag LOCUS_07030 689709 689155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 690239 689724 gene locus_tag LOCUS_07040 690239 689724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 691462 690536 gene locus_tag LOCUS_07050 691462 690536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 692020 691475 gene locus_tag LOCUS_07060 692020 691475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 692218 692487 gene locus_tag LOCUS_07070 692218 692487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 693471 692482 gene locus_tag LOCUS_07080 693471 692482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 694430 693513 gene locus_tag LOCUS_07090 694430 693513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 694590 694435 gene locus_tag LOCUS_07100 694590 694435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 695130 694753 gene locus_tag LOCUS_07110 695130 694753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 695890 695138 gene locus_tag LOCUS_07120 695890 695138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 696009 697844 gene locus_tag LOCUS_07130 696009 697844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 698153 697821 gene locus_tag LOCUS_07140 698153 697821 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876157.1 protein_id gnl|my_center|LOCUS_07140 698926 698150 gene locus_tag LOCUS_07150 698926 698150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 699359 699973 gene locus_tag LOCUS_07160 699359 699973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 700340 700065 gene locus_tag LOCUS_07170 700340 700065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 701262 700345 gene locus_tag LOCUS_07180 701262 700345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 703414 701255 gene locus_tag LOCUS_07190 703414 701255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 703778 704089 gene locus_tag LOCUS_07200 703778 704089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 704378 704100 gene locus_tag LOCUS_07210 704378 704100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 704941 706341 gene locus_tag LOCUS_07220 704941 706341 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_07220 710849 706545 gene locus_tag LOCUS_07230 710849 706545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 711051 710890 gene locus_tag LOCUS_07240 711051 710890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 711219 711917 gene locus_tag LOCUS_07250 711219 711917 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061245.1 protein_id gnl|my_center|LOCUS_07250 712540 711995 gene locus_tag LOCUS_07260 712540 711995 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_07260 712672 713373 gene locus_tag LOCUS_07270 712672 713373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 713603 714367 gene locus_tag LOCUS_07280 713603 714367 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_07280 714525 715340 gene locus_tag LOCUS_07290 714525 715340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 716119 715370 gene locus_tag LOCUS_07300 716119 715370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 716541 716185 gene locus_tag LOCUS_07310 716541 716185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 717074 716661 gene locus_tag LOCUS_07320 717074 716661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07320 718113 717193 gene locus_tag LOCUS_07330 718113 717193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 718953 718201 gene locus_tag LOCUS_07340 718953 718201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 719805 719032 gene locus_tag LOCUS_07350 719805 719032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 720960 719989 gene locus_tag LOCUS_07360 gene mch 720960 719989 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876411.1 protein_id gnl|my_center|LOCUS_07360 721510 721007 gene locus_tag LOCUS_07370 721510 721007 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_07370 723075 721507 gene locus_tag LOCUS_07380 723075 721507 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_07380 723425 723111 gene locus_tag LOCUS_07390 723425 723111 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061022.1 protein_id gnl|my_center|LOCUS_07390 723932 723594 gene locus_tag LOCUS_07400 723932 723594 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060878.1 protein_id gnl|my_center|LOCUS_07400 724581 723937 gene locus_tag LOCUS_07410 724581 723937 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876309.1 protein_id gnl|my_center|LOCUS_07410 725311 724601 gene locus_tag LOCUS_07420 725311 724601 CDS product DUF2162 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261160.1 protein_id gnl|my_center|LOCUS_07420 728463 725428 gene locus_tag LOCUS_07430 728463 725428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 728810 733825 gene locus_tag LOCUS_07440 728810 733825 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876353.1 protein_id gnl|my_center|LOCUS_07440 734015 735316 gene locus_tag LOCUS_07450 734015 735316 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060759.1 protein_id gnl|my_center|LOCUS_07450 735327 735764 gene locus_tag LOCUS_07460 735327 735764 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875801.1 protein_id gnl|my_center|LOCUS_07460 736302 735787 gene locus_tag LOCUS_07470 736302 735787 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_07470 736422 737702 gene locus_tag LOCUS_07480 736422 737702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 738991 737714 gene locus_tag LOCUS_07490 gene serS 738991 737714 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868451.1 protein_id gnl|my_center|LOCUS_07490 739980 739183 gene locus_tag LOCUS_07500 gene cfbC 739980 739183 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876281.1 protein_id gnl|my_center|LOCUS_07500 740493 739981 gene locus_tag LOCUS_07510 740493 739981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 741738 740500 gene locus_tag LOCUS_07520 741738 740500 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060867.1 protein_id gnl|my_center|LOCUS_07520 743166 741745 gene locus_tag LOCUS_07530 gene purF 743166 741745 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060868.1 protein_id gnl|my_center|LOCUS_07530 744116 743238 gene locus_tag LOCUS_07540 744116 743238 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876285.1 protein_id gnl|my_center|LOCUS_07540 745094 744126 gene locus_tag LOCUS_07550 gene galE 745094 744126 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_07550 746285 745104 gene locus_tag LOCUS_07560 746285 745104 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061196.1 protein_id gnl|my_center|LOCUS_07560 746465 746298 gene locus_tag LOCUS_07570 746465 746298 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061197.1 protein_id gnl|my_center|LOCUS_07570 746984 746559 gene locus_tag LOCUS_07580 746984 746559 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903106.1 protein_id gnl|my_center|LOCUS_07580 748691 746985 gene locus_tag LOCUS_07590 748691 746985 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060755.1 protein_id gnl|my_center|LOCUS_07590 748779 749078 gene locus_tag LOCUS_07600 748779 749078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 749668 749075 gene locus_tag LOCUS_07610 749668 749075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 751477 749726 gene locus_tag LOCUS_07620 gene uvrC 751477 749726 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876080.1 protein_id gnl|my_center|LOCUS_07620 758167 751487 gene locus_tag LOCUS_07630 758167 751487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 759175 758330 gene locus_tag LOCUS_07640 759175 758330 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_07640 760080 759199 gene locus_tag LOCUS_07650 gene pdxS 760080 759199 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876304.1 protein_id gnl|my_center|LOCUS_07650 760543 760289 gene locus_tag LOCUS_07660 760543 760289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 760502 760729 gene locus_tag LOCUS_07670 760502 760729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 761032 760832 gene locus_tag LOCUS_07680 761032 760832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 761448 761035 gene locus_tag LOCUS_07690 761448 761035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 761927 761445 gene locus_tag LOCUS_07700 761927 761445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 762679 761924 gene locus_tag LOCUS_07710 762679 761924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 763366 763025 gene locus_tag LOCUS_07720 763366 763025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 763553 763407 gene locus_tag LOCUS_07730 763553 763407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 764048 763863 gene locus_tag LOCUS_07740 764048 763863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 764980 764054 gene locus_tag LOCUS_07750 764980 764054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 765327 766529 gene locus_tag LOCUS_07760 765327 766529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 767723 766659 gene locus_tag LOCUS_07770 767723 766659 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_07770 768723 767758 gene locus_tag LOCUS_07780 768723 767758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 769717 768809 gene locus_tag LOCUS_07790 769717 768809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 770363 769749 gene locus_tag LOCUS_07800 770363 769749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 771220 770405 gene locus_tag LOCUS_07810 771220 770405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 773529 771232 gene locus_tag LOCUS_07820 773529 771232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 774222 773542 gene locus_tag LOCUS_07830 774222 773542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 774482 774219 gene locus_tag LOCUS_07840 774482 774219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 777287 774483 gene locus_tag LOCUS_07850 777287 774483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 778482 777313 gene locus_tag LOCUS_07860 778482 777313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 778922 778479 gene locus_tag LOCUS_07870 778922 778479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 779614 778925 gene locus_tag LOCUS_07880 779614 778925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 780888 779611 gene locus_tag LOCUS_07890 780888 779611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 781961 780903 gene locus_tag LOCUS_07900 781961 780903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 782421 781966 gene locus_tag LOCUS_07910 782421 781966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 786017 782424 gene locus_tag LOCUS_07920 786017 782424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 786209 786030 gene locus_tag LOCUS_07930 786209 786030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 786981 786217 gene locus_tag LOCUS_07940 786981 786217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 787461 787054 gene locus_tag LOCUS_07950 787461 787054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 788654 787482 gene locus_tag LOCUS_07960 788654 787482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 788948 788679 gene locus_tag LOCUS_07970 788948 788679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 789556 788945 gene locus_tag LOCUS_07980 789556 788945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 790007 789564 gene locus_tag LOCUS_07990 790007 789564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 790347 789991 gene locus_tag LOCUS_08000 790347 789991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 790928 790350 gene locus_tag LOCUS_08010 790928 790350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 791402 791013 gene locus_tag LOCUS_08020 791402 791013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 792671 791433 gene locus_tag LOCUS_08030 792671 791433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 793761 792676 gene locus_tag LOCUS_08040 793761 792676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 794688 794509 gene locus_tag LOCUS_08050 794688 794509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 796255 794747 gene locus_tag LOCUS_08060 796255 794747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 797541 796252 gene locus_tag LOCUS_08070 797541 796252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 798851 797538 gene locus_tag LOCUS_08080 798851 797538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 799362 798811 gene locus_tag LOCUS_08090 799362 798811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 800107 799802 gene locus_tag LOCUS_08100 800107 799802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 800261 800091 gene locus_tag LOCUS_08110 800261 800091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 800370 800294 gene locus_tag LOCUS_t00090 800370 800294 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 801063 800911 gene locus_tag LOCUS_08120 801063 800911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 801657 801196 gene locus_tag LOCUS_08130 801657 801196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 801929 801795 gene locus_tag LOCUS_08140 801929 801795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 802681 801935 gene locus_tag LOCUS_08150 802681 801935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 803366 802917 gene locus_tag LOCUS_08160 803366 802917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 803818 803504 gene locus_tag LOCUS_08170 803818 803504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 804053 803823 gene locus_tag LOCUS_08180 804053 803823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 804303 804040 gene locus_tag LOCUS_08190 804303 804040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 804621 804475 gene locus_tag LOCUS_08200 804621 804475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 804829 804635 gene locus_tag LOCUS_08210 804829 804635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 805115 804837 gene locus_tag LOCUS_08220 805115 804837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 805564 805148 gene locus_tag LOCUS_08230 805564 805148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 806167 805856 gene locus_tag LOCUS_08240 806167 805856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 807028 806354 gene locus_tag LOCUS_08250 807028 806354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 807198 807025 gene locus_tag LOCUS_08260 807198 807025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 807374 807195 gene locus_tag LOCUS_08270 807374 807195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 807646 807422 gene locus_tag LOCUS_08280 807646 807422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 807780 807643 gene locus_tag LOCUS_08290 807780 807643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 807970 808149 gene locus_tag LOCUS_08300 807970 808149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 809450 808626 gene locus_tag LOCUS_08310 809450 808626 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_08310 810098 809637 gene locus_tag LOCUS_08320 810098 809637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 810829 811161 gene locus_tag LOCUS_08330 810829 811161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 811541 811194 gene locus_tag LOCUS_08340 811541 811194 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870296.1 protein_id gnl|my_center|LOCUS_08340 811903 811616 gene locus_tag LOCUS_08350 811903 811616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 812136 811897 gene locus_tag LOCUS_08360 812136 811897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 812918 812136 gene locus_tag LOCUS_08370 812918 812136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 814142 812988 gene locus_tag LOCUS_08380 814142 812988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 815053 814154 gene locus_tag LOCUS_08390 815053 814154 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011235810.1 protein_id gnl|my_center|LOCUS_08390 815151 815333 gene locus_tag LOCUS_08400 815151 815333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 815781 815386 gene locus_tag LOCUS_08410 815781 815386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 816489 815800 gene locus_tag LOCUS_08420 816489 815800 CDS product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876307.1 protein_id gnl|my_center|LOCUS_08420 817422 817138 gene locus_tag LOCUS_08430 817422 817138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 817806 817456 gene locus_tag LOCUS_08440 817806 817456 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876316.1 protein_id gnl|my_center|LOCUS_08440 818135 817869 gene locus_tag LOCUS_08450 818135 817869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 818614 818132 gene locus_tag LOCUS_08460 818614 818132 CDS product Brix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876318.1 protein_id gnl|my_center|LOCUS_08460 819070 818801 gene locus_tag LOCUS_08470 gene rpl37A 819070 818801 CDS product 50S ribosomal protein L37Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876320.1 protein_id gnl|my_center|LOCUS_08470 820759 819278 gene locus_tag LOCUS_08480 gene guaB 820759 819278 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871141.1 protein_id gnl|my_center|LOCUS_08480 821491 820778 gene locus_tag LOCUS_08490 821491 820778 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875780.1 protein_id gnl|my_center|LOCUS_08490 821634 822545 gene locus_tag LOCUS_08500 821634 822545 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_08500 823735 822542 gene locus_tag LOCUS_08510 823735 822542 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875779.1 protein_id gnl|my_center|LOCUS_08510 824394 823735 gene locus_tag LOCUS_08520 824394 823735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 824858 824511 gene locus_tag LOCUS_08530 824858 824511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 825596 824874 gene locus_tag LOCUS_08540 825596 824874 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892786.1 protein_id gnl|my_center|LOCUS_08540 826068 825610 gene locus_tag LOCUS_08550 gene ribC 826068 825610 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061180.1 protein_id gnl|my_center|LOCUS_08550 826953 826117 gene locus_tag LOCUS_08560 826953 826117 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870600.1 protein_id gnl|my_center|LOCUS_08560 827651 826953 gene locus_tag LOCUS_08570 gene cbiQ 827651 826953 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060748.1 protein_id gnl|my_center|LOCUS_08570 827983 827693 gene locus_tag LOCUS_08580 827983 827693 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870602.1 protein_id gnl|my_center|LOCUS_08580 828658 827993 gene locus_tag LOCUS_08590 gene cbiM 828658 827993 CDS product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875769.1 protein_id gnl|my_center|LOCUS_08590 828968 829609 gene locus_tag LOCUS_08600 gene pyrF 828968 829609 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060747.1 protein_id gnl|my_center|LOCUS_08600 830165 829620 gene locus_tag LOCUS_08610 830165 829620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 831102 830188 gene locus_tag LOCUS_08620 831102 830188 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060746.1 protein_id gnl|my_center|LOCUS_08620 832026 831124 gene locus_tag LOCUS_08630 832026 831124 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060745.1 protein_id gnl|my_center|LOCUS_08630 834238 832211 gene locus_tag LOCUS_08640 834238 832211 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_08640 835739 834435 gene locus_tag LOCUS_08650 835739 834435 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_08650 837021 835984 gene locus_tag LOCUS_08660 837021 835984 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_08660 837711 837037 gene locus_tag LOCUS_08670 gene modB 837711 837037 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360415.1 protein_id gnl|my_center|LOCUS_08670 838563 837760 gene locus_tag LOCUS_08680 gene modA 838563 837760 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382290.1 protein_id gnl|my_center|LOCUS_08680 838935 840089 gene locus_tag LOCUS_08690 838935 840089 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022270.1 protein_id gnl|my_center|LOCUS_08690 840114 840323 gene locus_tag LOCUS_08700 840114 840323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 840412 841455 gene locus_tag LOCUS_08710 840412 841455 CDS product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 protein_id gnl|my_center|LOCUS_08710 841886 841707 gene locus_tag LOCUS_08720 841886 841707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 842888 842037 gene locus_tag LOCUS_08730 gene galU 842888 842037 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876273.1 protein_id gnl|my_center|LOCUS_08730 843272 842967 gene locus_tag LOCUS_08740 843272 842967 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060863.1 protein_id gnl|my_center|LOCUS_08740 843387 843303 gene locus_tag LOCUS_t00100 843387 843303 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 846127 843494 gene locus_tag LOCUS_08750 gene ggaB 846127 843494 CDS product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 protein_id gnl|my_center|LOCUS_08750 846220 846708 gene locus_tag LOCUS_08760 846220 846708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 847538 846726 gene locus_tag LOCUS_08770 847538 846726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 848158 847553 gene locus_tag LOCUS_08780 848158 847553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 848471 848271 gene locus_tag LOCUS_08790 848471 848271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 849098 848499 gene locus_tag LOCUS_08800 849098 848499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 850476 849436 gene locus_tag LOCUS_08810 850476 849436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 854077 850496 gene locus_tag LOCUS_08820 854077 850496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 854955 854356 gene locus_tag LOCUS_08830 854955 854356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 858556 854975 gene locus_tag LOCUS_08840 858556 854975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 858638 859417 gene locus_tag LOCUS_08850 858638 859417 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_08850 859428 860507 gene locus_tag LOCUS_08860 859428 860507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 860907 860494 gene locus_tag LOCUS_08870 860907 860494 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061234.1 protein_id gnl|my_center|LOCUS_08870 861337 861137 gene locus_tag LOCUS_08880 861337 861137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 861631 861341 gene locus_tag LOCUS_08890 861631 861341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 862379 861570 gene locus_tag LOCUS_08900 862379 861570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 868146 862549 gene locus_tag LOCUS_08910 868146 862549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 873593 868479 gene locus_tag LOCUS_08920 873593 868479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 879089 873594 gene locus_tag LOCUS_08930 879089 873594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 882862 879086 gene locus_tag LOCUS_08940 882862 879086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 883007 883411 gene locus_tag LOCUS_08950 883007 883411 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_08950 885976 883385 gene locus_tag LOCUS_08960 885976 883385 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060872.1 protein_id gnl|my_center|LOCUS_08960 886894 886031 gene locus_tag LOCUS_08970 886894 886031 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330368.1 protein_id gnl|my_center|LOCUS_08970 889881 886990 gene locus_tag LOCUS_08980 gene uvrA 889881 886990 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_08980 890215 890517 gene locus_tag LOCUS_08990 890215 890517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 890744 890493 gene locus_tag LOCUS_09000 890744 890493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 890902 891075 gene locus_tag LOCUS_09010 890902 891075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 893118 891151 gene locus_tag LOCUS_09020 gene uvrB 893118 891151 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330366.1 protein_id gnl|my_center|LOCUS_09020 893424 893125 gene locus_tag LOCUS_09030 893424 893125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 894323 893427 gene locus_tag LOCUS_09040 894323 893427 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876421.1 protein_id gnl|my_center|LOCUS_09040 894412 894903 gene locus_tag LOCUS_09050 894412 894903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 895858 895328 gene locus_tag LOCUS_09060 895858 895328 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817398.1 protein_id gnl|my_center|LOCUS_09060 896384 895863 gene locus_tag LOCUS_09070 896384 895863 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017046.1 protein_id gnl|my_center|LOCUS_09070 896406 897377 gene locus_tag LOCUS_09080 896406 897377 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_09080 897367 897849 gene locus_tag LOCUS_09090 897367 897849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 899266 897839 gene locus_tag LOCUS_09100 899266 897839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 901367 899388 gene locus_tag LOCUS_09110 gene lonB 901367 899388 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876422.1 protein_id gnl|my_center|LOCUS_09110 901984 902262 gene locus_tag LOCUS_09120 901984 902262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 908911 902330 gene locus_tag LOCUS_09130 908911 902330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 909084 910625 gene locus_tag LOCUS_09140 gene cobQ 909084 910625 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061247.1 protein_id gnl|my_center|LOCUS_09140 911331 910600 gene locus_tag LOCUS_09150 911331 910600 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_09150 911657 911391 gene locus_tag LOCUS_09160 911657 911391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 912892 911732 gene locus_tag LOCUS_09170 912892 911732 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_09170 913938 912901 gene locus_tag LOCUS_09180 913938 912901 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_09180 914164 914089 gene locus_tag LOCUS_t00110 914164 914089 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 914243 914168 gene locus_tag LOCUS_t00120 914243 914168 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 915725 914298 gene locus_tag LOCUS_09190 915725 914298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 917163 915775 gene locus_tag LOCUS_09200 917163 915775 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108520.1 protein_id gnl|my_center|LOCUS_09200 917920 917258 gene locus_tag LOCUS_09210 917920 917258 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_09210 919915 917936 gene locus_tag LOCUS_09220 gene tgtA 919915 917936 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060763.1 protein_id gnl|my_center|LOCUS_09220 921076 920018 gene locus_tag LOCUS_09230 921076 920018 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 protein_id gnl|my_center|LOCUS_09230 921287 922510 gene locus_tag LOCUS_09240 921287 922510 CDS product MnmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875814.1 protein_id gnl|my_center|LOCUS_09240 924378 922495 gene locus_tag LOCUS_09250 924378 922495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 925363 925055 gene locus_tag LOCUS_09260 925363 925055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 927150 925369 gene locus_tag LOCUS_09270 gene glmS 927150 925369 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875810.1 protein_id gnl|my_center|LOCUS_09270 927870 927160 gene locus_tag LOCUS_09280 gene cobA 927870 927160 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060761.1 protein_id gnl|my_center|LOCUS_09280 928524 927880 gene locus_tag LOCUS_09290 gene purQ 928524 927880 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875807.1 protein_id gnl|my_center|LOCUS_09290 928803 928537 gene locus_tag LOCUS_09300 gene purS 928803 928537 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875808.1 protein_id gnl|my_center|LOCUS_09300 929548 928817 gene locus_tag LOCUS_09310 929548 928817 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875809.1 protein_id gnl|my_center|LOCUS_09310 930793 930008 gene locus_tag LOCUS_09320 930793 930008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 930998 930798 gene locus_tag LOCUS_09330 930998 930798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 931769 931029 gene locus_tag LOCUS_09340 931769 931029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 933054 931771 gene locus_tag LOCUS_09350 933054 931771 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_09350 933816 933367 gene locus_tag LOCUS_09360 933816 933367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 934901 933843 gene locus_tag LOCUS_09370 934901 933843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 935016 935849 gene locus_tag LOCUS_09380 935016 935849 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_09380 937132 935837 gene locus_tag LOCUS_09390 937132 935837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 937831 937136 gene locus_tag LOCUS_09400 937831 937136 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638475.1 protein_id gnl|my_center|LOCUS_09400 938082 938495 gene locus_tag LOCUS_09410 938082 938495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 938661 938515 gene locus_tag LOCUS_09420 938661 938515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 940049 939084 gene locus_tag LOCUS_09430 940049 939084 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876007.1 protein_id gnl|my_center|LOCUS_09430 941144 940095 gene locus_tag LOCUS_09440 gene pseI 941144 940095 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_09440 942545 941148 gene locus_tag LOCUS_09450 942545 941148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 943372 942542 gene locus_tag LOCUS_09460 943372 942542 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_09460 944528 943377 gene locus_tag LOCUS_09470 gene pseC 944528 943377 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_09470 945524 944529 gene locus_tag LOCUS_09480 gene pseB 945524 944529 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015759.1 protein_id gnl|my_center|LOCUS_09480 958466 945756 gene locus_tag LOCUS_09490 958466 945756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 960686 959196 gene locus_tag LOCUS_09500 960686 959196 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986561.1 protein_id gnl|my_center|LOCUS_09500 962215 960719 gene locus_tag LOCUS_09510 962215 960719 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986561.1 protein_id gnl|my_center|LOCUS_09510 963846 962560 gene locus_tag LOCUS_09520 963846 962560 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_09520 964675 964088 gene locus_tag LOCUS_09530 964675 964088 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892541.1 protein_id gnl|my_center|LOCUS_09530 965473 966435 gene locus_tag LOCUS_09540 965473 966435 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545485.1 protein_id gnl|my_center|LOCUS_09540 966450 967313 gene locus_tag LOCUS_09550 966450 967313 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017014.1 protein_id gnl|my_center|LOCUS_09550 968635 967319 gene locus_tag LOCUS_09560 968635 967319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 969711 968635 gene locus_tag LOCUS_09570 969711 968635 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_09570 970809 969769 gene locus_tag LOCUS_09580 970809 969769 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_09580 970990 971709 gene locus_tag LOCUS_09590 970990 971709 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860694.1 protein_id gnl|my_center|LOCUS_09590 972112 971726 gene locus_tag LOCUS_09600 972112 971726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 972539 972123 gene locus_tag LOCUS_09610 972539 972123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09610 973052 972648 gene locus_tag LOCUS_09620 973052 972648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 973867 973055 gene locus_tag LOCUS_09630 973867 973055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09630 974202 974693 gene locus_tag LOCUS_09640 974202 974693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 974698 975045 gene locus_tag LOCUS_09650 974698 975045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 975184 975417 gene locus_tag LOCUS_09660 975184 975417 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438776.1 protein_id gnl|my_center|LOCUS_09660 975889 975512 gene locus_tag LOCUS_09670 975889 975512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 977034 976012 gene locus_tag LOCUS_09680 977034 976012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 977230 977406 gene locus_tag LOCUS_09690 977230 977406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 977396 977557 gene locus_tag LOCUS_09700 977396 977557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 977797 977558 gene locus_tag LOCUS_09710 977797 977558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 977997 978770 gene locus_tag LOCUS_09720 977997 978770 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875805.1 protein_id gnl|my_center|LOCUS_09720 978760 979863 gene locus_tag LOCUS_09730 978760 979863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 979870 980964 gene locus_tag LOCUS_09740 gene glf 979870 980964 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038781.1 protein_id gnl|my_center|LOCUS_09740 980983 981252 gene locus_tag LOCUS_09750 980983 981252 CDS product signal recognition particle subunit SRP19/SEC65 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870547.1 protein_id gnl|my_center|LOCUS_09750 981249 982670 gene locus_tag LOCUS_09760 gene recJ 981249 982670 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875803.1 protein_id gnl|my_center|LOCUS_09760 982727 983530 gene locus_tag LOCUS_09770 982727 983530 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875802.1 protein_id gnl|my_center|LOCUS_09770 984820 983531 gene locus_tag LOCUS_09780 984820 983531 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_09780 986218 984878 gene locus_tag LOCUS_09790 986218 984878 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_09790 986320 987003 gene locus_tag LOCUS_09800 986320 987003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 987123 987530 gene locus_tag LOCUS_09810 987123 987530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 988191 987550 gene locus_tag LOCUS_09820 988191 987550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 988630 988226 gene locus_tag LOCUS_09830 988630 988226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 989662 988643 gene locus_tag LOCUS_09840 gene hypE 989662 988643 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 protein_id gnl|my_center|LOCUS_09840 990397 989912 gene locus_tag LOCUS_09850 990397 989912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 993318 990469 gene locus_tag LOCUS_09860 993318 990469 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061029.1 protein_id gnl|my_center|LOCUS_09860 993771 994391 gene locus_tag LOCUS_09870 993771 994391 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875839.1 protein_id gnl|my_center|LOCUS_09870 994396 994881 gene locus_tag LOCUS_09880 994396 994881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 995389 995012 gene locus_tag LOCUS_09890 995389 995012 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_09890 995993 995607 gene locus_tag LOCUS_09900 995993 995607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 997166 996012 gene locus_tag LOCUS_09910 997166 996012 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142015.1 protein_id gnl|my_center|LOCUS_09910 998111 997173 gene locus_tag LOCUS_09920 998111 997173 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250095.1 protein_id gnl|my_center|LOCUS_09920 998631 998284 gene locus_tag LOCUS_09930 998631 998284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 998854 999537 gene locus_tag LOCUS_09940 gene polB2 998854 999537 CDS product DNA polymerase PolB subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875847.1 protein_id gnl|my_center|LOCUS_09940 999576 1000277 gene locus_tag LOCUS_09950 999576 1000277 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875848.1 protein_id gnl|my_center|LOCUS_09950 1001045 1000272 gene locus_tag LOCUS_09960 gene xth 1001045 1000272 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_09960 1002590 1001046 gene locus_tag LOCUS_09970 1002590 1001046 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876381.1 protein_id gnl|my_center|LOCUS_09970 1003631 1002747 gene locus_tag LOCUS_09980 1003631 1002747 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876382.1 protein_id gnl|my_center|LOCUS_09980 1004642 1003641 gene locus_tag LOCUS_09990 gene hemB 1004642 1003641 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060891.1 protein_id gnl|my_center|LOCUS_09990 1005399 1004689 gene locus_tag LOCUS_10000 1005399 1004689 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022247.1 protein_id gnl|my_center|LOCUS_10000 1005473 1006567 gene locus_tag LOCUS_10010 gene aroC 1005473 1006567 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061243.1 protein_id gnl|my_center|LOCUS_10010 1007488 1006568 gene locus_tag LOCUS_10020 1007488 1006568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1008424 1007504 gene locus_tag LOCUS_10030 1008424 1007504 CDS product DUF2121 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876390.1 protein_id gnl|my_center|LOCUS_10030 1008793 1010889 gene locus_tag LOCUS_10040 1008793 1010889 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_10040 1010966 1011415 gene locus_tag LOCUS_10050 1010966 1011415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1012582 1011632 gene locus_tag LOCUS_10060 1012582 1011632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1013770 1012748 gene locus_tag LOCUS_10070 1013770 1012748 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876254.1 protein_id gnl|my_center|LOCUS_10070 1013998 1014408 gene locus_tag LOCUS_10080 1013998 1014408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1014507 1015898 gene locus_tag LOCUS_10090 1014507 1015898 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875834.1 protein_id gnl|my_center|LOCUS_10090 1015985 1016197 gene locus_tag LOCUS_10100 1015985 1016197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1016409 1017791 gene locus_tag LOCUS_10110 1016409 1017791 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875834.1 protein_id gnl|my_center|LOCUS_10110 1018434 1017850 gene locus_tag LOCUS_10120 1018434 1017850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1019029 1018445 gene locus_tag LOCUS_10130 1019029 1018445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1019729 1019034 gene locus_tag LOCUS_10140 1019729 1019034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1020974 1019739 gene locus_tag LOCUS_10150 1020974 1019739 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_10150 1021136 1022851 gene locus_tag LOCUS_10160 1021136 1022851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1023336 1022878 gene locus_tag LOCUS_10170 1023336 1022878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1025013 1023346 gene locus_tag LOCUS_10180 gene gltX 1025013 1023346 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875691.1 protein_id gnl|my_center|LOCUS_10180 1025144 1026148 gene locus_tag LOCUS_10190 1025144 1026148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1026158 1027186 gene locus_tag LOCUS_10200 1026158 1027186 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_10200 1027202 1028281 gene locus_tag LOCUS_10210 1027202 1028281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1028309 1029127 gene locus_tag LOCUS_10220 1028309 1029127 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694515.1 protein_id gnl|my_center|LOCUS_10220 1029535 1029206 gene locus_tag LOCUS_10230 1029535 1029206 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_10230 1030832 1029537 gene locus_tag LOCUS_10240 gene hcp 1030832 1029537 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750458.1 protein_id gnl|my_center|LOCUS_10240 1030948 1031733 gene locus_tag LOCUS_10250 1030948 1031733 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061059.1 protein_id gnl|my_center|LOCUS_10250 1032961 1031711 gene locus_tag LOCUS_10260 1032961 1031711 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990274.1 protein_id gnl|my_center|LOCUS_10260 1034486 1033494 gene locus_tag LOCUS_10270 gene idsA 1034486 1033494 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_10270 1035852 1034488 gene locus_tag LOCUS_10280 1035852 1034488 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875689.1 protein_id gnl|my_center|LOCUS_10280 1036905 1035859 gene locus_tag LOCUS_10290 gene fni 1036905 1035859 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_10290 1037710 1036913 gene locus_tag LOCUS_10300 1037710 1036913 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_10300 1038678 1037716 gene locus_tag LOCUS_10310 gene mvk 1038678 1037716 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875686.1 protein_id gnl|my_center|LOCUS_10310 1039538 1038690 gene locus_tag LOCUS_10320 gene amrB 1039538 1038690 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869902.1 protein_id gnl|my_center|LOCUS_10320 1040144 1039548 gene locus_tag LOCUS_10330 gene rpsB 1040144 1039548 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875684.1 protein_id gnl|my_center|LOCUS_10330 1040391 1040197 gene locus_tag LOCUS_10340 1040391 1040197 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061279.1 protein_id gnl|my_center|LOCUS_10340 1041659 1040415 gene locus_tag LOCUS_10350 gene eno 1041659 1040415 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_10350 1041996 1041799 gene locus_tag LOCUS_10360 1041996 1041799 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828720.1 protein_id gnl|my_center|LOCUS_10360 1042236 1042066 gene locus_tag LOCUS_10370 1042236 1042066 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875681.1 protein_id gnl|my_center|LOCUS_10370 1042689 1042288 gene locus_tag LOCUS_10380 1042689 1042288 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_10380 1043130 1042708 gene locus_tag LOCUS_10390 gene rplM 1043130 1042708 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867656.1 protein_id gnl|my_center|LOCUS_10390 1043514 1043149 gene locus_tag LOCUS_10400 1043514 1043149 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875679.1 protein_id gnl|my_center|LOCUS_10400 1044338 1043514 gene locus_tag LOCUS_10410 1044338 1043514 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_10410 1044743 1044351 gene locus_tag LOCUS_10420 1044743 1044351 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875677.1 protein_id gnl|my_center|LOCUS_10420 1045291 1044755 gene locus_tag LOCUS_10430 gene rpsD 1045291 1044755 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875676.1 protein_id gnl|my_center|LOCUS_10430 1045826 1045383 gene locus_tag LOCUS_10440 1045826 1045383 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875675.1 protein_id gnl|my_center|LOCUS_10440 1046107 1046021 gene locus_tag LOCUS_t00130 1046107 1046021 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1048473 1046332 gene locus_tag LOCUS_10450 1048473 1046332 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470194.1 protein_id gnl|my_center|LOCUS_10450 1049378 1048473 gene locus_tag LOCUS_10460 1049378 1048473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1049607 1050170 gene locus_tag LOCUS_10470 1049607 1050170 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_10470 1050185 1051969 gene locus_tag LOCUS_10480 1050185 1051969 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022623.1 protein_id gnl|my_center|LOCUS_10480 1058436 1051966 gene locus_tag LOCUS_10490 1058436 1051966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1059554 1058592 gene locus_tag LOCUS_10500 1059554 1058592 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060731.1 protein_id gnl|my_center|LOCUS_10500 1059854 1059633 gene locus_tag LOCUS_10510 1059854 1059633 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875673.1 protein_id gnl|my_center|LOCUS_10510 1060372 1059854 gene locus_tag LOCUS_10520 1060372 1059854 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879393.1 protein_id gnl|my_center|LOCUS_10520 1060638 1060372 gene locus_tag LOCUS_10530 1060638 1060372 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875671.1 protein_id gnl|my_center|LOCUS_10530 1061331 1060756 gene locus_tag LOCUS_10540 1061331 1060756 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875670.1 protein_id gnl|my_center|LOCUS_10540 1061901 1061341 gene locus_tag LOCUS_10550 1061901 1061341 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060730.1 protein_id gnl|my_center|LOCUS_10550 1063306 1061942 gene locus_tag LOCUS_10560 gene secY 1063306 1061942 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875668.1 protein_id gnl|my_center|LOCUS_10560 1063781 1063344 gene locus_tag LOCUS_10570 1063781 1063344 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875667.1 protein_id gnl|my_center|LOCUS_10570 1064249 1063791 gene locus_tag LOCUS_10580 gene rpmD 1064249 1063791 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875666.1 protein_id gnl|my_center|LOCUS_10580 1064904 1064263 gene locus_tag LOCUS_10590 gene rpsE 1064904 1064263 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192961070.1 protein_id gnl|my_center|LOCUS_10590 1065488 1064907 gene locus_tag LOCUS_10600 1065488 1064907 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875664.1 protein_id gnl|my_center|LOCUS_10600 1065946 1065500 gene locus_tag LOCUS_10610 1065946 1065500 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875663.1 protein_id gnl|my_center|LOCUS_10610 1066402 1066073 gene locus_tag LOCUS_10620 1066402 1066073 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875662.1 protein_id gnl|my_center|LOCUS_10620 1066954 1066418 gene locus_tag LOCUS_10630 1066954 1066418 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 protein_id gnl|my_center|LOCUS_10630 1067355 1066963 gene locus_tag LOCUS_10640 1067355 1066963 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060728.1 protein_id gnl|my_center|LOCUS_10640 1067511 1067368 gene locus_tag LOCUS_10650 1067511 1067368 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295326.1 protein_id gnl|my_center|LOCUS_10650 1068040 1067528 gene locus_tag LOCUS_10660 1068040 1067528 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875658.1 protein_id gnl|my_center|LOCUS_10660 1068765 1068037 gene locus_tag LOCUS_10670 1068765 1068037 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_10670 1069120 1068767 gene locus_tag LOCUS_10680 gene rplX 1069120 1068767 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875656.1 protein_id gnl|my_center|LOCUS_10680 1069527 1069129 gene locus_tag LOCUS_10690 1069527 1069129 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875655.1 protein_id gnl|my_center|LOCUS_10690 1069850 1069533 gene locus_tag LOCUS_10700 1069850 1069533 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875654.1 protein_id gnl|my_center|LOCUS_10700 1070142 1069864 gene locus_tag LOCUS_10710 gene rnp1 1070142 1069864 CDS product ribonuclease P component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879410.1 protein_id gnl|my_center|LOCUS_10710 1070557 1070216 gene locus_tag LOCUS_10720 gene yciH 1070557 1070216 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875652.1 protein_id gnl|my_center|LOCUS_10720 1070764 1070558 gene locus_tag LOCUS_10730 gene rpmC 1070764 1070558 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875651.1 protein_id gnl|my_center|LOCUS_10730 1071555 1070803 gene locus_tag LOCUS_10740 1071555 1070803 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875650.1 protein_id gnl|my_center|LOCUS_10740 1072019 1071555 gene locus_tag LOCUS_10750 gene rplV 1072019 1071555 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875649.1 protein_id gnl|my_center|LOCUS_10750 1072442 1072032 gene locus_tag LOCUS_10760 gene rpsS 1072442 1072032 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875648.1 protein_id gnl|my_center|LOCUS_10760 1073183 1072458 gene locus_tag LOCUS_10770 1073183 1072458 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_10770 1073456 1073196 gene locus_tag LOCUS_10780 1073456 1073196 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060727.1 protein_id gnl|my_center|LOCUS_10780 1074245 1073481 gene locus_tag LOCUS_10790 gene rpl4p 1074245 1073481 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 protein_id gnl|my_center|LOCUS_10790 1075258 1074248 gene locus_tag LOCUS_10800 gene rpl3p 1075258 1074248 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875644.1 protein_id gnl|my_center|LOCUS_10800 1076423 1075596 gene locus_tag LOCUS_10810 1076423 1075596 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875643.1 protein_id gnl|my_center|LOCUS_10810 1077256 1076642 gene locus_tag LOCUS_10820 1077256 1076642 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892753.1 protein_id gnl|my_center|LOCUS_10820 1077327 1078820 gene locus_tag LOCUS_10830 1077327 1078820 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877513.1 protein_id gnl|my_center|LOCUS_10830 1078837 1079754 gene locus_tag LOCUS_10840 1078837 1079754 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_10840 1080898 1079744 gene locus_tag LOCUS_10850 1080898 1079744 CDS product TIGR03576 family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877510.1 protein_id gnl|my_center|LOCUS_10850 1081225 1080899 gene locus_tag LOCUS_10860 1081225 1080899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1081837 1081316 gene locus_tag LOCUS_10870 1081837 1081316 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485798.1 protein_id gnl|my_center|LOCUS_10870 1083469 1082024 gene locus_tag LOCUS_10880 1083469 1082024 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 protein_id gnl|my_center|LOCUS_10880 1084181 1083462 gene locus_tag LOCUS_10890 1084181 1083462 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815503.1 protein_id gnl|my_center|LOCUS_10890 1084772 1084191 gene locus_tag LOCUS_10900 1084772 1084191 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815501.1 protein_id gnl|my_center|LOCUS_10900 1086568 1084823 gene locus_tag LOCUS_10910 1086568 1084823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065725.1 protein_id gnl|my_center|LOCUS_10910 1088358 1086568 gene locus_tag LOCUS_10920 1088358 1086568 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173276.1 protein_id gnl|my_center|LOCUS_10920 1089566 1088580 gene locus_tag LOCUS_10930 1089566 1088580 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039866225.1 protein_id gnl|my_center|LOCUS_10930 1089830 1089591 gene locus_tag LOCUS_10940 1089830 1089591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1089733 1091553 gene locus_tag LOCUS_10950 1089733 1091553 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877505.1 protein_id gnl|my_center|LOCUS_10950 1091820 1091548 gene locus_tag LOCUS_10960 1091820 1091548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1091909 1093915 gene locus_tag LOCUS_10970 gene rqcH 1091909 1093915 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061171.1 protein_id gnl|my_center|LOCUS_10970 1094631 1093912 gene locus_tag LOCUS_10980 1094631 1093912 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877498.1 protein_id gnl|my_center|LOCUS_10980 1095770 1094643 gene locus_tag LOCUS_10990 1095770 1094643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1095954 1096163 gene locus_tag LOCUS_11000 1095954 1096163 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061337.1 protein_id gnl|my_center|LOCUS_11000 1096165 1096338 gene locus_tag LOCUS_11010 1096165 1096338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1097371 1096364 gene locus_tag LOCUS_11020 1097371 1096364 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876559.1 protein_id gnl|my_center|LOCUS_11020 1097571 1097380 gene locus_tag LOCUS_11030 1097571 1097380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1098147 1097689 gene locus_tag LOCUS_11040 1098147 1097689 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_11040 1101610 1098272 gene locus_tag LOCUS_11050 1101610 1098272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1102144 1103688 gene locus_tag LOCUS_11060 1102144 1103688 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877491.1 protein_id gnl|my_center|LOCUS_11060 1103747 1104859 gene locus_tag LOCUS_11070 gene gntC 1103747 1104859 CDS product guanitoxin biosynthesis PLP-dependent (S)-gamma-hydroxy-L-arginine cyclodehydratase GntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061335.1 protein_id gnl|my_center|LOCUS_11070 1104863 1105768 gene locus_tag LOCUS_11080 1104863 1105768 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877489.1 protein_id gnl|my_center|LOCUS_11080 1105862 1105777 gene locus_tag LOCUS_t00140 1105862 1105777 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1106948 1106559 gene locus_tag LOCUS_11090 1106948 1106559 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877486.1 protein_id gnl|my_center|LOCUS_11090 1107843 1106911 gene locus_tag LOCUS_11100 1107843 1106911 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877485.1 protein_id gnl|my_center|LOCUS_11100 1108656 1107967 gene locus_tag LOCUS_11110 1108656 1107967 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_11110 1109194 1108670 gene locus_tag LOCUS_11120 1109194 1108670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1109457 1109191 gene locus_tag LOCUS_11130 1109457 1109191 CDS product DUF749 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877482.1 protein_id gnl|my_center|LOCUS_11130 1110620 1109724 gene locus_tag LOCUS_11140 gene hdrB 1110620 1109724 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877481.1 protein_id gnl|my_center|LOCUS_11140 1111668 1110643 gene locus_tag LOCUS_11150 1111668 1110643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1111857 1112609 gene locus_tag LOCUS_11160 1111857 1112609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877479.1 protein_id gnl|my_center|LOCUS_11160 1113026 1112601 gene locus_tag LOCUS_11170 1113026 1112601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1113953 1113030 gene locus_tag LOCUS_11180 1113953 1113030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1114293 1114138 gene locus_tag LOCUS_11190 1114293 1114138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1115389 1114577 gene locus_tag LOCUS_11200 gene dph5 1115389 1114577 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877476.1 protein_id gnl|my_center|LOCUS_11200 1115461 1116468 gene locus_tag LOCUS_11210 1115461 1116468 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877475.1 protein_id gnl|my_center|LOCUS_11210 1117267 1116452 gene locus_tag LOCUS_11220 1117267 1116452 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890740.1 protein_id gnl|my_center|LOCUS_11220 1118197 1117268 gene locus_tag LOCUS_11230 gene mtnA 1118197 1117268 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061163.1 protein_id gnl|my_center|LOCUS_11230 1119225 1118542 gene locus_tag LOCUS_11240 1119225 1118542 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 protein_id gnl|my_center|LOCUS_11240 1119887 1119237 gene locus_tag LOCUS_11250 1119887 1119237 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262170.1 protein_id gnl|my_center|LOCUS_11250 1120725 1119904 gene locus_tag LOCUS_11260 1120725 1119904 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_11260 1121770 1120904 gene locus_tag LOCUS_11270 gene nifB 1121770 1120904 CDS product FeMo cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877473.1 protein_id gnl|my_center|LOCUS_11270 1122393 1121833 gene locus_tag LOCUS_11280 1122393 1121833 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877472.1 protein_id gnl|my_center|LOCUS_11280 1123650 1122409 gene locus_tag LOCUS_11290 1123650 1122409 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877471.1 protein_id gnl|my_center|LOCUS_11290 1124096 1123653 gene locus_tag LOCUS_11300 1124096 1123653 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877470.1 protein_id gnl|my_center|LOCUS_11300 1124577 1124101 gene locus_tag LOCUS_11310 1124577 1124101 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061162.1 protein_id gnl|my_center|LOCUS_11310 1126096 1124555 gene locus_tag LOCUS_11320 1126096 1124555 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061161.1 protein_id gnl|my_center|LOCUS_11320 1127158 1126154 gene locus_tag LOCUS_11330 1127158 1126154 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 protein_id gnl|my_center|LOCUS_11330 1128296 1127163 gene locus_tag LOCUS_11340 1128296 1127163 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869557.1 protein_id gnl|my_center|LOCUS_11340 1128809 1128309 gene locus_tag LOCUS_11350 1128809 1128309 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877464.1 protein_id gnl|my_center|LOCUS_11350 1129141 1129929 gene locus_tag LOCUS_11360 1129141 1129929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1129935 1130744 gene locus_tag LOCUS_11370 1129935 1130744 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173813.1 protein_id gnl|my_center|LOCUS_11370 1130741 1131031 gene locus_tag LOCUS_11380 1130741 1131031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1131049 1131555 gene locus_tag LOCUS_11390 1131049 1131555 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061158.1 protein_id gnl|my_center|LOCUS_11390 1132124 1131600 gene locus_tag LOCUS_11400 gene pyrE 1132124 1131600 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877462.1 protein_id gnl|my_center|LOCUS_11400 1132373 1132140 gene locus_tag LOCUS_11410 1132373 1132140 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877461.1 protein_id gnl|my_center|LOCUS_11410 1135090 1132442 gene locus_tag LOCUS_11420 1135090 1132442 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_11420 1135646 1135182 gene locus_tag LOCUS_11430 1135646 1135182 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027567.1 protein_id gnl|my_center|LOCUS_11430 1136699 1135680 gene locus_tag LOCUS_11440 1136699 1135680 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_11440 1138373 1136754 gene locus_tag LOCUS_11450 gene thsA 1138373 1136754 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876429.1 protein_id gnl|my_center|LOCUS_11450 1138510 1139130 gene locus_tag LOCUS_11460 1138510 1139130 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876431.1 protein_id gnl|my_center|LOCUS_11460 1139989 1139138 gene locus_tag LOCUS_11470 1139989 1139138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1141243 1140194 gene locus_tag LOCUS_11480 gene asd 1141243 1140194 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_11480 1142074 1141253 gene locus_tag LOCUS_11490 gene dapB 1142074 1141253 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876435.1 protein_id gnl|my_center|LOCUS_11490 1142980 1142087 gene locus_tag LOCUS_11500 gene dapA 1142980 1142087 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_11500 1144197 1142977 gene locus_tag LOCUS_11510 1144197 1142977 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 protein_id gnl|my_center|LOCUS_11510 1144587 1144390 gene locus_tag LOCUS_11520 1144587 1144390 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876438.1 protein_id gnl|my_center|LOCUS_11520 1144915 1144580 gene locus_tag LOCUS_11530 1144915 1144580 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876439.1 protein_id gnl|my_center|LOCUS_11530 1145903 1145034 gene locus_tag LOCUS_11540 1145903 1145034 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061249.1 protein_id gnl|my_center|LOCUS_11540 1146982 1145903 gene locus_tag LOCUS_11550 1146982 1145903 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249900.1 protein_id gnl|my_center|LOCUS_11550 1148064 1146979 gene locus_tag LOCUS_11560 gene cbiD 1148064 1146979 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876443.1 protein_id gnl|my_center|LOCUS_11560 1148355 1148095 gene locus_tag LOCUS_11570 1148355 1148095 CDS product MJ0307 family thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869805.1 protein_id gnl|my_center|LOCUS_11570 1148505 1150577 gene locus_tag LOCUS_11580 gene hel308 1148505 1150577 CDS product ATP-dependent DNA helicase Hel308 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876445.1 protein_id gnl|my_center|LOCUS_11580 1150891 1150595 gene locus_tag LOCUS_11590 1150891 1150595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1151200 1150922 gene locus_tag LOCUS_11600 1151200 1150922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1151316 1152980 gene locus_tag LOCUS_11610 1151316 1152980 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061250.1 protein_id gnl|my_center|LOCUS_11610 1153057 1153779 gene locus_tag LOCUS_11620 gene deoC 1153057 1153779 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_11620 1153971 1153897 gene locus_tag LOCUS_t00150 1153971 1153897 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1154045 1153974 gene locus_tag LOCUS_t00160 1154045 1153974 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1154376 1154176 gene locus_tag LOCUS_11630 1154376 1154176 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_11630 1155856 1154576 gene locus_tag LOCUS_11640 1155856 1154576 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876459.1 protein_id gnl|my_center|LOCUS_11640 1156488 1155862 gene locus_tag LOCUS_11650 1156488 1155862 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876461.1 protein_id gnl|my_center|LOCUS_11650 1156999 1156514 gene locus_tag LOCUS_11660 gene hacB 1156999 1156514 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876462.1 protein_id gnl|my_center|LOCUS_11660 1157998 1157009 gene locus_tag LOCUS_11670 1157998 1157009 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876463.1 protein_id gnl|my_center|LOCUS_11670 1159519 1158011 gene locus_tag LOCUS_11680 1159519 1158011 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060907.1 protein_id gnl|my_center|LOCUS_11680 1159681 1160247 gene locus_tag LOCUS_11690 1159681 1160247 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060908.1 protein_id gnl|my_center|LOCUS_11690 1161290 1160268 gene locus_tag LOCUS_11700 1161290 1160268 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876467.1 protein_id gnl|my_center|LOCUS_11700 1162390 1161293 gene locus_tag LOCUS_11710 1162390 1161293 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876468.1 protein_id gnl|my_center|LOCUS_11710 1163696 1162374 gene locus_tag LOCUS_11720 gene wecB 1163696 1162374 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_11720 1163792 1164040 gene locus_tag LOCUS_11730 1163792 1164040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1165018 1164152 gene locus_tag LOCUS_11740 gene truA 1165018 1164152 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876473.1 protein_id gnl|my_center|LOCUS_11740 1167350 1165083 gene locus_tag LOCUS_11750 1167350 1165083 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943948.1 protein_id gnl|my_center|LOCUS_11750 1168059 1167355 gene locus_tag LOCUS_11760 1168059 1167355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816854.1 protein_id gnl|my_center|LOCUS_11760 1168253 1168990 gene locus_tag LOCUS_11770 gene hisA 1168253 1168990 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060911.1 protein_id gnl|my_center|LOCUS_11770 1168998 1169459 gene locus_tag LOCUS_11780 1168998 1169459 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876477.1 protein_id gnl|my_center|LOCUS_11780 1169474 1170493 gene locus_tag LOCUS_11790 gene argC 1169474 1170493 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 protein_id gnl|my_center|LOCUS_11790 1170545 1171039 gene locus_tag LOCUS_11800 1170545 1171039 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060912.1 protein_id gnl|my_center|LOCUS_11800 1171043 1171522 gene locus_tag LOCUS_11810 gene pyrI 1171043 1171522 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_11810 1172750 1171551 gene locus_tag LOCUS_11820 1172750 1171551 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_11820 1172930 1174300 gene locus_tag LOCUS_11830 1172930 1174300 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876489.1 protein_id gnl|my_center|LOCUS_11830 1174319 1174876 gene locus_tag LOCUS_11840 1174319 1174876 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_11840 1177528 1174952 gene locus_tag LOCUS_11850 1177528 1174952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1178274 1177579 gene locus_tag LOCUS_11860 1178274 1177579 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065753.1 protein_id gnl|my_center|LOCUS_11860 1178594 1179604 gene locus_tag LOCUS_11870 1178594 1179604 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876491.1 protein_id gnl|my_center|LOCUS_11870 1179673 1180263 gene locus_tag LOCUS_11880 1179673 1180263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1181302 1180295 gene locus_tag LOCUS_11890 1181302 1180295 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876493.1 protein_id gnl|my_center|LOCUS_11890 1181417 1182043 gene locus_tag LOCUS_11900 1181417 1182043 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876496.1 protein_id gnl|my_center|LOCUS_11900 1183755 1182040 gene locus_tag LOCUS_11910 gene ade 1183755 1182040 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_11910 1184979 1183756 gene locus_tag LOCUS_11920 1184979 1183756 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_11920 1186026 1185151 gene locus_tag LOCUS_11930 gene speB 1186026 1185151 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876501.1 protein_id gnl|my_center|LOCUS_11930 1186443 1186054 gene locus_tag LOCUS_11940 gene eif5A 1186443 1186054 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 protein_id gnl|my_center|LOCUS_11940 1186617 1187078 gene locus_tag LOCUS_11950 1186617 1187078 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060917.1 protein_id gnl|my_center|LOCUS_11950 1187082 1188920 gene locus_tag LOCUS_11960 1187082 1188920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1188920 1190335 gene locus_tag LOCUS_11970 gene cfbE 1188920 1190335 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485764.1 protein_id gnl|my_center|LOCUS_11970 1190479 1191348 gene locus_tag LOCUS_11980 gene hemC 1190479 1191348 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876507.1 protein_id gnl|my_center|LOCUS_11980 1191363 1192319 gene locus_tag LOCUS_11990 1191363 1192319 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 protein_id gnl|my_center|LOCUS_11990 1192329 1192934 gene locus_tag LOCUS_12000 1192329 1192934 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876509.1 protein_id gnl|my_center|LOCUS_12000 1195253 1193004 gene locus_tag LOCUS_12010 1195253 1193004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1200681 1195489 gene locus_tag LOCUS_12020 1200681 1195489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1201549 1201079 gene locus_tag LOCUS_12030 1201549 1201079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1202405 1201986 gene locus_tag LOCUS_12040 1202405 1201986 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876531.1 protein_id gnl|my_center|LOCUS_12040 1204005 1202671 gene locus_tag LOCUS_12050 gene gdhA 1204005 1202671 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_12050 1204482 1204769 gene locus_tag LOCUS_12060 1204482 1204769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1206033 1204795 gene locus_tag LOCUS_12070 gene prf1 1206033 1204795 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_12070 1206147 1206674 gene locus_tag LOCUS_12080 1206147 1206674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1207101 1206664 gene locus_tag LOCUS_12090 gene rimI 1207101 1206664 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876630.1 protein_id gnl|my_center|LOCUS_12090 1207178 1207564 gene locus_tag LOCUS_12100 1207178 1207564 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876631.1 protein_id gnl|my_center|LOCUS_12100 1207576 1210032 gene locus_tag LOCUS_12110 1207576 1210032 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060943.1 protein_id gnl|my_center|LOCUS_12110 1210029 1210823 gene locus_tag LOCUS_12120 gene cobK 1210029 1210823 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876633.1 protein_id gnl|my_center|LOCUS_12120 1210918 1210834 gene locus_tag LOCUS_t00170 1210918 1210834 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1211056 1210972 gene locus_tag LOCUS_t00180 1211056 1210972 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1211402 1211094 gene locus_tag LOCUS_12130 gene rpsJ 1211402 1211094 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_12130 1212714 1211473 gene locus_tag LOCUS_12140 gene tuf 1212714 1211473 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876684.1 protein_id gnl|my_center|LOCUS_12140 1215058 1212866 gene locus_tag LOCUS_12150 1215058 1212866 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060960.1 protein_id gnl|my_center|LOCUS_12150 1215643 1215083 gene locus_tag LOCUS_12160 gene rpsG 1215643 1215083 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876682.1 protein_id gnl|my_center|LOCUS_12160 1216082 1215657 gene locus_tag LOCUS_12170 1216082 1215657 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_12170 1216690 1216932 gene locus_tag LOCUS_12180 1216690 1216932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1217027 1217485 gene locus_tag LOCUS_12190 1217027 1217485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1217664 1217846 gene locus_tag LOCUS_12200 1217664 1217846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1218644 1220206 gene locus_tag LOCUS_12210 1218644 1220206 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004335.1 protein_id gnl|my_center|LOCUS_12210 1220190 1220597 gene locus_tag LOCUS_12220 1220190 1220597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1221041 1220610 gene locus_tag LOCUS_12230 1221041 1220610 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 protein_id gnl|my_center|LOCUS_12230 1221344 1221048 gene locus_tag LOCUS_12240 1221344 1221048 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876679.1 protein_id gnl|my_center|LOCUS_12240 1222567 1221356 gene locus_tag LOCUS_12250 gene rpoA2 1222567 1221356 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876678.1 protein_id gnl|my_center|LOCUS_12250 1225260 1222576 gene locus_tag LOCUS_12260 gene rpoA1 1225260 1222576 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876677.1 protein_id gnl|my_center|LOCUS_12260 1227098 1225287 gene locus_tag LOCUS_12270 gene rpoB 1227098 1225287 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876676.1 protein_id gnl|my_center|LOCUS_12270 1228655 1227111 gene locus_tag LOCUS_12280 1228655 1227111 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060959.1 protein_id gnl|my_center|LOCUS_12280 1229127 1228894 gene locus_tag LOCUS_12290 1229127 1228894 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870552.1 protein_id gnl|my_center|LOCUS_12290 1229247 1229174 gene locus_tag LOCUS_t00190 1229247 1229174 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1229344 1229272 gene locus_tag LOCUS_t00200 1229344 1229272 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1229563 1229488 gene locus_tag LOCUS_t00210 1229563 1229488 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1229647 1229571 gene locus_tag LOCUS_t00220 1229647 1229571 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1229855 1229782 gene locus_tag LOCUS_t00230 1229855 1229782 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1230241 1229969 gene locus_tag LOCUS_12300 1230241 1229969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1231134 1230484 gene locus_tag LOCUS_12310 1231134 1230484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1231554 1231228 gene locus_tag LOCUS_12320 1231554 1231228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1232347 1231601 gene locus_tag LOCUS_12330 1232347 1231601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1232757 1233620 gene locus_tag LOCUS_12340 gene thiM 1232757 1233620 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_12340 1233617 1234243 gene locus_tag LOCUS_12350 gene thiE 1233617 1234243 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_12350 1235473 1234244 gene locus_tag LOCUS_12360 gene pgk 1235473 1234244 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_12360 1236190 1235522 gene locus_tag LOCUS_12370 gene tpiA 1236190 1235522 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876672.1 protein_id gnl|my_center|LOCUS_12370 1236321 1236659 gene locus_tag LOCUS_12380 1236321 1236659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1237289 1236681 gene locus_tag LOCUS_12390 1237289 1236681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1237441 1238355 gene locus_tag LOCUS_12400 gene twy1 1237441 1238355 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061270.1 protein_id gnl|my_center|LOCUS_12400 1238992 1238330 gene locus_tag LOCUS_12410 1238992 1238330 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021861.1 protein_id gnl|my_center|LOCUS_12410 1240104 1238989 gene locus_tag LOCUS_12420 gene sucC 1240104 1238989 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876667.1 protein_id gnl|my_center|LOCUS_12420 1240659 1240117 gene locus_tag LOCUS_12430 1240659 1240117 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060957.1 protein_id gnl|my_center|LOCUS_12430 1241545 1240673 gene locus_tag LOCUS_12440 gene korB 1241545 1240673 CDS product 2-oxoglutarate synthase subunit KorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876665.1 protein_id gnl|my_center|LOCUS_12440 1242673 1241546 gene locus_tag LOCUS_12450 1242673 1241546 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_12450 1242894 1242685 gene locus_tag LOCUS_12460 1242894 1242685 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869641.1 protein_id gnl|my_center|LOCUS_12460 1243138 1243629 gene locus_tag LOCUS_12470 1243138 1243629 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669045.1 protein_id gnl|my_center|LOCUS_12470 1244369 1243638 gene locus_tag LOCUS_12480 1244369 1243638 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876749.1 protein_id gnl|my_center|LOCUS_12480 1244534 1245628 gene locus_tag LOCUS_12490 1244534 1245628 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_12490 1247090 1245621 gene locus_tag LOCUS_12500 1247090 1245621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1248595 1247099 gene locus_tag LOCUS_12510 1248595 1247099 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899995.1 protein_id gnl|my_center|LOCUS_12510 1249339 1248800 gene locus_tag LOCUS_12520 1249339 1248800 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061280.1 protein_id gnl|my_center|LOCUS_12520 1250122 1249349 gene locus_tag LOCUS_12530 gene cobS 1250122 1249349 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876736.1 protein_id gnl|my_center|LOCUS_12530 1251230 1250130 gene locus_tag LOCUS_12540 1251230 1250130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1251333 1252514 gene locus_tag LOCUS_12550 gene larC 1251333 1252514 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060969.1 protein_id gnl|my_center|LOCUS_12550 1252507 1253187 gene locus_tag LOCUS_12560 gene queC 1252507 1253187 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876732.1 protein_id gnl|my_center|LOCUS_12560 1253180 1253671 gene locus_tag LOCUS_12570 1253180 1253671 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_12570 1255536 1253827 gene locus_tag LOCUS_12580 gene oadA 1255536 1253827 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876731.1 protein_id gnl|my_center|LOCUS_12580 1256759 1255665 gene locus_tag LOCUS_12590 1256759 1255665 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_12590 1256854 1257705 gene locus_tag LOCUS_12600 1256854 1257705 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876722.1 protein_id gnl|my_center|LOCUS_12600 1257732 1259309 gene locus_tag LOCUS_12610 1257732 1259309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1259402 1260922 gene locus_tag LOCUS_12620 1259402 1260922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1262646 1260979 gene locus_tag LOCUS_12630 1262646 1260979 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986975.1 protein_id gnl|my_center|LOCUS_12630 1262730 1263776 gene locus_tag LOCUS_12640 gene hypD 1262730 1263776 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876696.1 protein_id gnl|my_center|LOCUS_12640 1263778 1264482 gene locus_tag LOCUS_12650 1263778 1264482 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 protein_id gnl|my_center|LOCUS_12650 1264494 1265804 gene locus_tag LOCUS_12660 1264494 1265804 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876694.1 protein_id gnl|my_center|LOCUS_12660 1266055 1265801 gene locus_tag LOCUS_12670 1266055 1265801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1266525 1266064 gene locus_tag LOCUS_12680 1266525 1266064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1267783 1266554 gene locus_tag LOCUS_12690 1267783 1266554 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060944.1 protein_id gnl|my_center|LOCUS_12690 1267858 1268202 gene locus_tag LOCUS_12700 gene eif1A 1267858 1268202 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876635.1 protein_id gnl|my_center|LOCUS_12700 1268241 1269014 gene locus_tag LOCUS_12710 1268241 1269014 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 protein_id gnl|my_center|LOCUS_12710 1269903 1269004 gene locus_tag LOCUS_12720 1269903 1269004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1270041 1270661 gene locus_tag LOCUS_12730 1270041 1270661 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 protein_id gnl|my_center|LOCUS_12730 1270961 1272661 gene locus_tag LOCUS_12740 gene top6B 1270961 1272661 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876638.1 protein_id gnl|my_center|LOCUS_12740 1272675 1273775 gene locus_tag LOCUS_12750 1272675 1273775 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_12750 1274214 1276076 gene locus_tag LOCUS_12760 1274214 1276076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1276115 1276549 gene locus_tag LOCUS_12770 1276115 1276549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1276680 1276952 gene locus_tag LOCUS_12780 1276680 1276952 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_12780 1277008 1278834 gene locus_tag LOCUS_12790 1277008 1278834 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_12790 1278912 1279124 gene locus_tag LOCUS_12800 gene copZ 1278912 1279124 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244260.1 protein_id gnl|my_center|LOCUS_12800 1279295 1279083 gene locus_tag LOCUS_12810 1279295 1279083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1279261 1280277 gene locus_tag LOCUS_12820 1279261 1280277 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876640.1 protein_id gnl|my_center|LOCUS_12820 1280304 1281140 gene locus_tag LOCUS_12830 1280304 1281140 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_12830 1281975 1281142 gene locus_tag LOCUS_12840 1281975 1281142 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876803.1 protein_id gnl|my_center|LOCUS_12840 1282355 1283290 gene locus_tag LOCUS_12850 1282355 1283290 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153115.1 protein_id gnl|my_center|LOCUS_12850 1283506 1284630 gene locus_tag LOCUS_12860 1283506 1284630 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060948.1 protein_id gnl|my_center|LOCUS_12860 1285843 1284644 gene locus_tag LOCUS_12870 gene hemA 1285843 1284644 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060949.1 protein_id gnl|my_center|LOCUS_12870 1286459 1285833 gene locus_tag LOCUS_12880 1286459 1285833 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060950.1 protein_id gnl|my_center|LOCUS_12880 1286943 1286461 gene locus_tag LOCUS_12890 1286943 1286461 CDS product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876645.1 protein_id gnl|my_center|LOCUS_12890 1287348 1287043 gene locus_tag LOCUS_12900 1287348 1287043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1289141 1287546 gene locus_tag LOCUS_12910 gene atwA 1289141 1287546 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060951.1 protein_id gnl|my_center|LOCUS_12910 1289943 1289233 gene locus_tag LOCUS_12920 1289943 1289233 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876647.1 protein_id gnl|my_center|LOCUS_12920 1290728 1289973 gene locus_tag LOCUS_12930 1290728 1289973 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876648.1 protein_id gnl|my_center|LOCUS_12930 1291660 1290755 gene locus_tag LOCUS_12940 gene cofD 1291660 1290755 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060952.1 protein_id gnl|my_center|LOCUS_12940 1292443 1291679 gene locus_tag LOCUS_12950 gene cofE 1292443 1291679 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_12950 1293102 1292476 gene locus_tag LOCUS_12960 gene purO 1293102 1292476 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876651.1 protein_id gnl|my_center|LOCUS_12960 1293531 1293115 gene locus_tag LOCUS_12970 1293531 1293115 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876652.1 protein_id gnl|my_center|LOCUS_12970 1294379 1293540 gene locus_tag LOCUS_12980 1294379 1293540 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876653.1 protein_id gnl|my_center|LOCUS_12980 1295076 1294453 gene locus_tag LOCUS_12990 gene rnhB 1295076 1294453 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876654.1 protein_id gnl|my_center|LOCUS_12990 1296196 1295123 gene locus_tag LOCUS_13000 1296196 1295123 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_13000 1296834 1296199 gene locus_tag LOCUS_13010 1296834 1296199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876656.1 protein_id gnl|my_center|LOCUS_13010 1297311 1297877 gene locus_tag LOCUS_13020 1297311 1297877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1297922 1299094 gene locus_tag LOCUS_13030 1297922 1299094 CDS product DUF515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876659.1 protein_id gnl|my_center|LOCUS_13030 1299133 1299855 gene locus_tag LOCUS_13040 1299133 1299855 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876661.1 protein_id gnl|my_center|LOCUS_13040 1299859 1300227 gene locus_tag LOCUS_13050 1299859 1300227 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060955.1 protein_id gnl|my_center|LOCUS_13050 1301223 1300273 gene locus_tag LOCUS_13060 gene bsh 1301223 1300273 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287105.1 protein_id gnl|my_center|LOCUS_13060 1302472 1301315 gene locus_tag LOCUS_13070 gene mfnA 1302472 1301315 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496377.1 protein_id gnl|my_center|LOCUS_13070 1304806 1302524 gene locus_tag LOCUS_13080 gene ppsA 1304806 1302524 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_13080 1305480 1304998 gene locus_tag LOCUS_13090 gene rplJ 1305480 1304998 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876743.1 protein_id gnl|my_center|LOCUS_13090 1306418 1305669 gene locus_tag LOCUS_13100 1306418 1305669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438780.1 protein_id gnl|my_center|LOCUS_13100 1307972 1306428 gene locus_tag LOCUS_13110 1307972 1306428 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861882.1 protein_id gnl|my_center|LOCUS_13110 1308240 1308473 gene locus_tag LOCUS_13120 1308240 1308473 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876745.1 protein_id gnl|my_center|LOCUS_13120 1308629 1309978 gene locus_tag LOCUS_13130 1308629 1309978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1311049 1309967 gene locus_tag LOCUS_13140 1311049 1309967 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876750.1 protein_id gnl|my_center|LOCUS_13140 1313993 1311138 gene locus_tag LOCUS_13150 1313993 1311138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1316605 1314215 gene locus_tag LOCUS_13160 1316605 1314215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1316775 1318019 gene locus_tag LOCUS_13170 gene pyrC 1316775 1318019 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060972.1 protein_id gnl|my_center|LOCUS_13170 1319305 1318064 gene locus_tag LOCUS_13180 gene mvhB 1319305 1318064 CDS product polyferredoxin protein MvhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876757.1 protein_id gnl|my_center|LOCUS_13180 1320746 1319322 gene locus_tag LOCUS_13190 gene mvhA 1320746 1319322 CDS product F420-non-reducing hydrogenase subunit MvhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876758.1 protein_id gnl|my_center|LOCUS_13190 1321674 1320748 gene locus_tag LOCUS_13200 gene mvhG 1321674 1320748 CDS product F420-non-reducing hydrogenase subunit MvhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876759.1 protein_id gnl|my_center|LOCUS_13200 1322115 1321690 gene locus_tag LOCUS_13210 1322115 1321690 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_13210 1323669 1322434 gene locus_tag LOCUS_13220 1323669 1322434 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876774.1 protein_id gnl|my_center|LOCUS_13220 1324408 1323650 gene locus_tag LOCUS_13230 gene sufC 1324408 1323650 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_13230 1324842 1324576 gene locus_tag LOCUS_13240 1324842 1324576 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876775.1 protein_id gnl|my_center|LOCUS_13240 1325521 1324904 gene locus_tag LOCUS_13250 1325521 1324904 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457366.1 protein_id gnl|my_center|LOCUS_13250 1327012 1325543 gene locus_tag LOCUS_13260 1327012 1325543 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060979.1 protein_id gnl|my_center|LOCUS_13260 1328111 1327173 gene locus_tag LOCUS_13270 gene mtrH 1328111 1327173 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_13270 1328369 1328124 gene locus_tag LOCUS_13280 gene mtrG 1328369 1328124 CDS product tetrahydromethanopterin S-methyltransferase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876781.1 protein_id gnl|my_center|LOCUS_13280 1328588 1328382 gene locus_tag LOCUS_13290 gene mtrF 1328588 1328382 CDS product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876782.1 protein_id gnl|my_center|LOCUS_13290 1329317 1328601 gene locus_tag LOCUS_13300 gene mtrA 1329317 1328601 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876783.1 protein_id gnl|my_center|LOCUS_13300 1329647 1329318 gene locus_tag LOCUS_13310 1329647 1329318 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876784.1 protein_id gnl|my_center|LOCUS_13310 1330476 1329664 gene locus_tag LOCUS_13320 gene mtrC 1330476 1329664 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876785.1 protein_id gnl|my_center|LOCUS_13320 1331179 1330478 gene locus_tag LOCUS_13330 gene mtrD 1331179 1330478 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870362.1 protein_id gnl|my_center|LOCUS_13330 1332071 1331193 gene locus_tag LOCUS_13340 gene mtrE 1332071 1331193 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870361.1 protein_id gnl|my_center|LOCUS_13340 1333979 1332324 gene locus_tag LOCUS_13350 gene mcrA 1333979 1332324 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876788.1 protein_id gnl|my_center|LOCUS_13350 1334743 1333982 gene locus_tag LOCUS_13360 gene mcrG 1334743 1333982 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060982.1 protein_id gnl|my_center|LOCUS_13360 1335345 1334746 gene locus_tag LOCUS_13370 gene mcrC 1335345 1334746 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876790.1 protein_id gnl|my_center|LOCUS_13370 1335814 1335347 gene locus_tag LOCUS_13380 gene mcrD 1335814 1335347 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876791.1 protein_id gnl|my_center|LOCUS_13380 1337174 1335843 gene locus_tag LOCUS_13390 gene mcrB 1337174 1335843 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061283.1 protein_id gnl|my_center|LOCUS_13390 1337480 1337671 gene locus_tag LOCUS_13400 1337480 1337671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1337763 1339010 gene locus_tag LOCUS_13410 gene mmp10 1337763 1339010 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876794.1 protein_id gnl|my_center|LOCUS_13410 1339945 1339025 gene locus_tag LOCUS_13420 1339945 1339025 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876804.1 protein_id gnl|my_center|LOCUS_13420 1340488 1339994 gene locus_tag LOCUS_13430 1340488 1339994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060984.1 protein_id gnl|my_center|LOCUS_13430 1340569 1341261 gene locus_tag LOCUS_13440 gene comB 1340569 1341261 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876806.1 protein_id gnl|my_center|LOCUS_13440 1341320 1342489 gene locus_tag LOCUS_13450 1341320 1342489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1342544 1342771 gene locus_tag LOCUS_13460 1342544 1342771 CDS product DUF1922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876808.1 protein_id gnl|my_center|LOCUS_13460 1342869 1344134 gene locus_tag LOCUS_13470 1342869 1344134 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_13470 1344131 1345072 gene locus_tag LOCUS_13480 1344131 1345072 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_13480 1345906 1345040 gene locus_tag LOCUS_13490 1345906 1345040 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876810.1 protein_id gnl|my_center|LOCUS_13490 1345961 1346266 gene locus_tag LOCUS_13500 1345961 1346266 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876811.1 protein_id gnl|my_center|LOCUS_13500 1347386 1346280 gene locus_tag LOCUS_13510 1347386 1346280 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_13510 1347489 1348655 gene locus_tag LOCUS_13520 1347489 1348655 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_13520 1349103 1349579 gene locus_tag LOCUS_13530 1349103 1349579 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060987.1 protein_id gnl|my_center|LOCUS_13530 1349754 1350689 gene locus_tag LOCUS_13540 gene mptA 1349754 1350689 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876820.1 protein_id gnl|my_center|LOCUS_13540 1350694 1351134 gene locus_tag LOCUS_13550 1350694 1351134 CDS product DUF2120 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061284.1 protein_id gnl|my_center|LOCUS_13550 1351138 1352220 gene locus_tag LOCUS_13560 gene cofG 1351138 1352220 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876822.1 protein_id gnl|my_center|LOCUS_13560 1352944 1352207 gene locus_tag LOCUS_13570 1352944 1352207 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060988.1 protein_id gnl|my_center|LOCUS_13570 1353152 1353766 gene locus_tag LOCUS_13580 gene psmB 1353152 1353766 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_13580 1353897 1355807 gene locus_tag LOCUS_13590 1353897 1355807 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_13590 1355898 1356917 gene locus_tag LOCUS_13600 gene purM 1355898 1356917 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 protein_id gnl|my_center|LOCUS_13600 1356945 1357973 gene locus_tag LOCUS_13610 gene comC 1356945 1357973 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876829.1 protein_id gnl|my_center|LOCUS_13610 1359774 1357987 gene locus_tag LOCUS_13620 gene polB1 1359774 1357987 CDS product DNA polymerase PolB subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876832.1 protein_id gnl|my_center|LOCUS_13620 1360824 1359778 gene locus_tag LOCUS_13630 1360824 1359778 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876835.1 protein_id gnl|my_center|LOCUS_13630 1361646 1360840 gene locus_tag LOCUS_13640 1361646 1360840 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061285.1 protein_id gnl|my_center|LOCUS_13640 1362561 1361650 gene locus_tag LOCUS_13650 1362561 1361650 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060992.1 protein_id gnl|my_center|LOCUS_13650 1363193 1362621 gene locus_tag LOCUS_13660 1363193 1362621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1363313 1364476 gene locus_tag LOCUS_13670 1363313 1364476 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876838.1 protein_id gnl|my_center|LOCUS_13670 1364480 1365121 gene locus_tag LOCUS_13680 1364480 1365121 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876839.1 protein_id gnl|my_center|LOCUS_13680 1366068 1365454 gene locus_tag LOCUS_13690 1366068 1365454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13690 1366608 1366102 gene locus_tag LOCUS_13700 1366608 1366102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13700 1367207 1366638 gene locus_tag LOCUS_13710 1367207 1366638 CDS product PsbP-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876842.1 protein_id gnl|my_center|LOCUS_13710 1367900 1367229 gene locus_tag LOCUS_13720 1367900 1367229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1368768 1367962 gene locus_tag LOCUS_13730 gene pheA 1368768 1367962 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060994.1 protein_id gnl|my_center|LOCUS_13730 1369679 1368861 gene locus_tag LOCUS_13740 1369679 1368861 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060996.1 protein_id gnl|my_center|LOCUS_13740 1370702 1369764 gene locus_tag LOCUS_13750 1370702 1369764 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876848.1 protein_id gnl|my_center|LOCUS_13750 1371483 1370785 gene locus_tag LOCUS_13760 1371483 1370785 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060998.1 protein_id gnl|my_center|LOCUS_13760 1372007 1371486 gene locus_tag LOCUS_13770 1372007 1371486 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060999.1 protein_id gnl|my_center|LOCUS_13770 1372613 1372020 gene locus_tag LOCUS_13780 1372613 1372020 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061000.1 protein_id gnl|my_center|LOCUS_13780 1372765 1373838 gene locus_tag LOCUS_13790 1372765 1373838 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876855.1 protein_id gnl|my_center|LOCUS_13790 1373978 1374772 gene locus_tag LOCUS_13800 1373978 1374772 CDS product Dna2/Cas4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485777.1 protein_id gnl|my_center|LOCUS_13800 1375428 1374769 gene locus_tag LOCUS_13810 1375428 1374769 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876859.1 protein_id gnl|my_center|LOCUS_13810 1375684 1375430 gene locus_tag LOCUS_13820 1375684 1375430 CDS product energy-converting hydrogenase B subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061002.1 protein_id gnl|my_center|LOCUS_13820 1376692 1375694 gene locus_tag LOCUS_13830 1376692 1375694 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876861.1 protein_id gnl|my_center|LOCUS_13830 1377824 1376697 gene locus_tag LOCUS_13840 1377824 1376697 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061003.1 protein_id gnl|my_center|LOCUS_13840 1378289 1377843 gene locus_tag LOCUS_13850 1378289 1377843 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876863.1 protein_id gnl|my_center|LOCUS_13850 1378785 1378300 gene locus_tag LOCUS_13860 1378785 1378300 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061004.1 protein_id gnl|my_center|LOCUS_13860 1380201 1378786 gene locus_tag LOCUS_13870 1380201 1378786 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061005.1 protein_id gnl|my_center|LOCUS_13870 1380460 1380212 gene locus_tag LOCUS_13880 1380460 1380212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876866.1 protein_id gnl|my_center|LOCUS_13880 1380943 1380470 gene locus_tag LOCUS_13890 1380943 1380470 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876867.1 protein_id gnl|my_center|LOCUS_13890 1381218 1380940 gene locus_tag LOCUS_13900 1381218 1380940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061006.1 protein_id gnl|my_center|LOCUS_13900 1381546 1381211 gene locus_tag LOCUS_13910 1381546 1381211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1383000 1381543 gene locus_tag LOCUS_13920 gene ehbF 1383000 1381543 CDS product energy conserving hydrogenase EhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876870.1 protein_id gnl|my_center|LOCUS_13920 1383379 1382993 gene locus_tag LOCUS_13930 1383379 1382993 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330371.1 protein_id gnl|my_center|LOCUS_13930 1383612 1383379 gene locus_tag LOCUS_13940 1383612 1383379 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869936.1 protein_id gnl|my_center|LOCUS_13940 1384045 1383614 gene locus_tag LOCUS_13950 1384045 1383614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1384254 1384045 gene locus_tag LOCUS_13960 1384254 1384045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1384663 1384349 gene locus_tag LOCUS_13970 1384663 1384349 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876875.1 protein_id gnl|my_center|LOCUS_13970 1385196 1384870 gene locus_tag LOCUS_13980 1385196 1384870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1385453 1385941 gene locus_tag LOCUS_13990 1385453 1385941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1386689 1385973 gene locus_tag LOCUS_14000 1386689 1385973 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876876.1 protein_id gnl|my_center|LOCUS_14000 1387568 1386816 gene locus_tag LOCUS_14010 1387568 1386816 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061008.1 protein_id gnl|my_center|LOCUS_14010 1387634 1389610 gene locus_tag LOCUS_14020 1387634 1389610 CDS product IGHMBP2 family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877242.1 protein_id gnl|my_center|LOCUS_14020 1390538 1389819 gene locus_tag LOCUS_14030 1390538 1389819 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875869.1 protein_id gnl|my_center|LOCUS_14030 1391400 1390681 gene locus_tag LOCUS_14040 1391400 1390681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1391712 1392887 gene locus_tag LOCUS_14050 1391712 1392887 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061009.1 protein_id gnl|my_center|LOCUS_14050 1393631 1392957 gene locus_tag LOCUS_14060 1393631 1392957 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064390.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14060 1395240 1393741 gene locus_tag LOCUS_14070 1395240 1393741 CDS product DUF2193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875740.1 protein_id gnl|my_center|LOCUS_14070 1395361 1396083 gene locus_tag LOCUS_14080 1395361 1396083 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947920.1 protein_id gnl|my_center|LOCUS_14080 1396762 1396106 gene locus_tag LOCUS_14090 1396762 1396106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1397548 1396829 gene locus_tag LOCUS_14100 gene sfsA 1397548 1396829 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963470.1 protein_id gnl|my_center|LOCUS_14100 1399082 1397550 gene locus_tag LOCUS_14110 1399082 1397550 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876880.1 protein_id gnl|my_center|LOCUS_14110 1400405 1399515 gene locus_tag LOCUS_14120 gene fhcD 1400405 1399515 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061010.1 protein_id gnl|my_center|LOCUS_14120 1401488 1400490 gene locus_tag LOCUS_14130 1401488 1400490 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_14130 1401694 1403061 gene locus_tag LOCUS_14140 1401694 1403061 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061013.1 protein_id gnl|my_center|LOCUS_14140 1403118 1403768 gene locus_tag LOCUS_14150 1403118 1403768 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061014.1 protein_id gnl|my_center|LOCUS_14150 1404378 1403770 gene locus_tag LOCUS_14160 1404378 1403770 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876891.1 protein_id gnl|my_center|LOCUS_14160 1405046 1404639 gene locus_tag LOCUS_14170 gene hjc 1405046 1404639 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876892.1 protein_id gnl|my_center|LOCUS_14170 1405155 1405080 gene locus_tag LOCUS_t00240 1405155 1405080 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1405266 1405184 gene locus_tag LOCUS_t00250 1405266 1405184 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1405398 1405322 gene locus_tag LOCUS_t00260 1405398 1405322 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1405497 1405422 gene locus_tag LOCUS_t00270 1405497 1405422 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1405574 1405501 gene locus_tag LOCUS_t00280 1405574 1405501 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1405785 1406765 gene locus_tag LOCUS_14180 1405785 1406765 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496555.1 protein_id gnl|my_center|LOCUS_14180 1407094 1406762 gene locus_tag LOCUS_14190 1407094 1406762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1407197 1408549 gene locus_tag LOCUS_14200 gene gatB 1407197 1408549 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876897.1 protein_id gnl|my_center|LOCUS_14200 1408565 1409365 gene locus_tag LOCUS_14210 1408565 1409365 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876899.1 protein_id gnl|my_center|LOCUS_14210 1409366 1409656 gene locus_tag LOCUS_14220 gene hisE 1409366 1409656 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876900.1 protein_id gnl|my_center|LOCUS_14220 1410228 1409659 gene locus_tag LOCUS_14230 1410228 1409659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1410991 1410230 gene locus_tag LOCUS_14240 gene larB 1410991 1410230 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061016.1 protein_id gnl|my_center|LOCUS_14240 1411044 1413293 gene locus_tag LOCUS_14250 gene hypF 1411044 1413293 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868352.1 protein_id gnl|my_center|LOCUS_14250 1413917 1413333 gene locus_tag LOCUS_14260 1413917 1413333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1414158 1414715 gene locus_tag LOCUS_14270 1414158 1414715 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876906.1 protein_id gnl|my_center|LOCUS_14270 1414761 1416641 gene locus_tag LOCUS_14280 gene dnaK 1414761 1416641 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_14280 1416789 1417937 gene locus_tag LOCUS_14290 gene dnaJ 1416789 1417937 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876908.1 protein_id gnl|my_center|LOCUS_14290 1423871 1418145 gene locus_tag LOCUS_14300 1423871 1418145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1430303 1424019 gene locus_tag LOCUS_14310 1430303 1424019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1436222 1430472 gene locus_tag LOCUS_14320 1436222 1430472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1440852 1436377 gene locus_tag LOCUS_14330 1440852 1436377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1445833 1441022 gene locus_tag LOCUS_14340 1445833 1441022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1445757 1445954 gene locus_tag LOCUS_14350 1445757 1445954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1446544 1446469 gene locus_tag LOCUS_t00290 1446544 1446469 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1447163 1446639 gene locus_tag LOCUS_14360 1447163 1446639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876909.1 protein_id gnl|my_center|LOCUS_14360 1447574 1447173 gene locus_tag LOCUS_14370 1447574 1447173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876910.1 protein_id gnl|my_center|LOCUS_14370 1447664 1448584 gene locus_tag LOCUS_14380 gene map 1447664 1448584 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061017.1 protein_id gnl|my_center|LOCUS_14380 1449471 1448614 gene locus_tag LOCUS_14390 gene frhB 1449471 1448614 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876912.1 protein_id gnl|my_center|LOCUS_14390 1450314 1449484 gene locus_tag LOCUS_14400 gene frhG 1450314 1449484 CDS product coenzyme F420 hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876913.1 protein_id gnl|my_center|LOCUS_14400 1450787 1450314 gene locus_tag LOCUS_14410 gene frhD 1450787 1450314 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876914.1 protein_id gnl|my_center|LOCUS_14410 1452024 1450807 gene locus_tag LOCUS_14420 gene frhA 1452024 1450807 CDS product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061018.1 protein_id gnl|my_center|LOCUS_14420 1452293 1452811 gene locus_tag LOCUS_14430 1452293 1452811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1452926 1452999 gene locus_tag LOCUS_t00300 1452926 1452999 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1453060 1453135 gene locus_tag LOCUS_t00310 1453060 1453135 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1453240 1453596 gene locus_tag LOCUS_14440 1453240 1453596 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_14440 1453580 1455625 gene locus_tag LOCUS_14450 1453580 1455625 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989665.1 protein_id gnl|my_center|LOCUS_14450 1455785 1456219 gene locus_tag LOCUS_14460 1455785 1456219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1457414 1456227 gene locus_tag LOCUS_14470 1457414 1456227 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876918.1 protein_id gnl|my_center|LOCUS_14470 1458030 1457431 gene locus_tag LOCUS_14480 1458030 1457431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1458866 1458096 gene locus_tag LOCUS_14490 1458866 1458096 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496756.1 protein_id gnl|my_center|LOCUS_14490 1459043 1458867 gene locus_tag LOCUS_14500 1459043 1458867 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876920.1 protein_id gnl|my_center|LOCUS_14500 1459847 1459050 gene locus_tag LOCUS_14510 1459847 1459050 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061020.1 protein_id gnl|my_center|LOCUS_14510 1460105 1459926 gene locus_tag LOCUS_14520 1460105 1459926 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876922.1 protein_id gnl|my_center|LOCUS_14520 1460394 1460116 gene locus_tag LOCUS_14530 1460394 1460116 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876923.1 protein_id gnl|my_center|LOCUS_14530 1461470 1460625 gene locus_tag LOCUS_14540 1461470 1460625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061021.1 protein_id gnl|my_center|LOCUS_14540 1462264 1461530 gene locus_tag LOCUS_14550 gene pcn 1462264 1461530 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876925.1 protein_id gnl|my_center|LOCUS_14550 1463123 1462392 gene locus_tag LOCUS_14560 1463123 1462392 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582439.1 protein_id gnl|my_center|LOCUS_14560 1464469 1463120 gene locus_tag LOCUS_14570 1464469 1463120 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582440.1 protein_id gnl|my_center|LOCUS_14570 1465239 1466042 gene locus_tag LOCUS_14580 1465239 1466042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1466787 1466389 gene locus_tag LOCUS_14590 1466787 1466389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1467580 1466834 gene locus_tag LOCUS_14600 1467580 1466834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1468346 1467618 gene locus_tag LOCUS_14610 1468346 1467618 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_14610 1468553 1468350 gene locus_tag LOCUS_14620 1468553 1468350 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876941.1 protein_id gnl|my_center|LOCUS_14620 1468727 1470079 gene locus_tag LOCUS_14630 gene purB 1468727 1470079 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877146.1 protein_id gnl|my_center|LOCUS_14630 1470113 1470964 gene locus_tag LOCUS_14640 1470113 1470964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1473417 1470970 gene locus_tag LOCUS_14650 1473417 1470970 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877144.1 protein_id gnl|my_center|LOCUS_14650 1474763 1473540 gene locus_tag LOCUS_14660 1474763 1473540 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457408.1 protein_id gnl|my_center|LOCUS_14660 1475167 1474778 gene locus_tag LOCUS_14670 1475167 1474778 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877139.1 protein_id gnl|my_center|LOCUS_14670 1476606 1475344 gene locus_tag LOCUS_14680 gene truD 1476606 1475344 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877138.1 protein_id gnl|my_center|LOCUS_14680 1476710 1476637 gene locus_tag LOCUS_t00320 1476710 1476637 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1477219 1476788 gene locus_tag LOCUS_14690 1477219 1476788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1478635 1477271 gene locus_tag LOCUS_14700 1478635 1477271 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061078.1 protein_id gnl|my_center|LOCUS_14700 1479247 1478651 gene locus_tag LOCUS_14710 gene hisH 1479247 1478651 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_14710 1480319 1479252 gene locus_tag LOCUS_14720 gene cfbD 1480319 1479252 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877132.1 protein_id gnl|my_center|LOCUS_14720 1480452 1481399 gene locus_tag LOCUS_14730 1480452 1481399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1481456 1481854 gene locus_tag LOCUS_14740 1481456 1481854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1481938 1482114 gene locus_tag LOCUS_14750 1481938 1482114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1483313 1482123 gene locus_tag LOCUS_14760 1483313 1482123 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_14760 1483398 1484285 gene locus_tag LOCUS_14770 1483398 1484285 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095324.1 protein_id gnl|my_center|LOCUS_14770 1484482 1484306 gene locus_tag LOCUS_14780 1484482 1484306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1484553 1486433 gene locus_tag LOCUS_14790 1484553 1486433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1486435 1487073 gene locus_tag LOCUS_14800 1486435 1487073 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877124.1 protein_id gnl|my_center|LOCUS_14800 1487202 1490369 gene locus_tag LOCUS_14810 1487202 1490369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1490381 1490599 gene locus_tag LOCUS_14820 1490381 1490599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1491652 1490645 gene locus_tag LOCUS_14830 1491652 1490645 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_14830 1491798 1492598 gene locus_tag LOCUS_14840 gene nadE 1491798 1492598 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496806.1 protein_id gnl|my_center|LOCUS_14840 1492598 1495453 gene locus_tag LOCUS_14850 gene leuS 1492598 1495453 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061305.1 protein_id gnl|my_center|LOCUS_14850 1496838 1496107 gene locus_tag LOCUS_14860 1496838 1496107 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061045.1 protein_id gnl|my_center|LOCUS_14860 1497807 1496848 gene locus_tag LOCUS_14870 gene htpX 1497807 1496848 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_14870 1498240 1497863 gene locus_tag LOCUS_14880 1498240 1497863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1498356 1499303 gene locus_tag LOCUS_14890 1498356 1499303 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060778.1 protein_id gnl|my_center|LOCUS_14890 1499313 1500791 gene locus_tag LOCUS_14900 1499313 1500791 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875879.1 protein_id gnl|my_center|LOCUS_14900 1501460 1500777 gene locus_tag LOCUS_14910 1501460 1500777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892482.1 protein_id gnl|my_center|LOCUS_14910 1502315 1501470 gene locus_tag LOCUS_14920 1502315 1501470 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_14920 1502371 1503177 gene locus_tag LOCUS_14930 1502371 1503177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1503296 1504591 gene locus_tag LOCUS_14940 gene hisS 1503296 1504591 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 protein_id gnl|my_center|LOCUS_14940 1504595 1504993 gene locus_tag LOCUS_14950 gene hisI 1504595 1504993 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_14950 1504995 1506845 gene locus_tag LOCUS_14960 1504995 1506845 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875885.1 protein_id gnl|my_center|LOCUS_14960 1506855 1507601 gene locus_tag LOCUS_14970 1506855 1507601 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485719.1 protein_id gnl|my_center|LOCUS_14970 1508093 1507584 gene locus_tag LOCUS_14980 1508093 1507584 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_14980 1508368 1508958 gene locus_tag LOCUS_14990 1508368 1508958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14990 1509034 1509354 gene locus_tag LOCUS_15000 1509034 1509354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15000 1511696 1509378 gene locus_tag LOCUS_15010 1511696 1509378 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877027.1 protein_id gnl|my_center|LOCUS_15010 1520934 1511836 gene locus_tag LOCUS_15020 1520934 1511836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1521173 1520961 gene locus_tag LOCUS_15030 1521173 1520961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1523105 1521570 gene locus_tag LOCUS_15040 1523105 1521570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15040 1524480 1523098 gene locus_tag LOCUS_15050 1524480 1523098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1525902 1524715 gene locus_tag LOCUS_15060 1525902 1524715 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_15060 1527238 1525904 gene locus_tag LOCUS_15070 1527238 1525904 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330372.1 protein_id gnl|my_center|LOCUS_15070 1527626 1527228 gene locus_tag LOCUS_15080 1527626 1527228 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061047.1 protein_id gnl|my_center|LOCUS_15080 1528231 1527683 gene locus_tag LOCUS_15090 1528231 1527683 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877036.1 protein_id gnl|my_center|LOCUS_15090 1528987 1530261 gene locus_tag LOCUS_15100 1528987 1530261 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_15100 1532173 1530566 gene locus_tag LOCUS_15110 1532173 1530566 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877037.1 protein_id gnl|my_center|LOCUS_15110 1532327 1532788 gene locus_tag LOCUS_15120 1532327 1532788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1532785 1533852 gene locus_tag LOCUS_15130 1532785 1533852 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061048.1 protein_id gnl|my_center|LOCUS_15130 1534689 1533856 gene locus_tag LOCUS_15140 1534689 1533856 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_15140 1535625 1534702 gene locus_tag LOCUS_15150 gene ilvE 1535625 1534702 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_15150 1535781 1536923 gene locus_tag LOCUS_15160 1535781 1536923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1536983 1537055 gene locus_tag LOCUS_t00330 1536983 1537055 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1537240 1538067 gene locus_tag LOCUS_15170 1537240 1538067 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877074.1 protein_id gnl|my_center|LOCUS_15170 1538778 1538143 gene locus_tag LOCUS_15180 1538778 1538143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1539357 1538779 gene locus_tag LOCUS_15190 gene hisB 1539357 1538779 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061060.1 protein_id gnl|my_center|LOCUS_15190 1540312 1539620 gene locus_tag LOCUS_15200 1540312 1539620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1542201 1540645 gene locus_tag LOCUS_15210 1542201 1540645 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870892.1 protein_id gnl|my_center|LOCUS_15210 1542879 1542292 gene locus_tag LOCUS_15220 1542879 1542292 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879016.1 protein_id gnl|my_center|LOCUS_15220 1543048 1544502 gene locus_tag LOCUS_15230 1543048 1544502 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_15230 1544542 1545327 gene locus_tag LOCUS_15240 1544542 1545327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1545602 1545324 gene locus_tag LOCUS_15250 1545602 1545324 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788894.1 protein_id gnl|my_center|LOCUS_15250 1546879 1545653 gene locus_tag LOCUS_15260 1546879 1545653 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877084.1 protein_id gnl|my_center|LOCUS_15260 1549232 1547406 gene locus_tag LOCUS_15270 1549232 1547406 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877065.1 protein_id gnl|my_center|LOCUS_15270 1549334 1550689 gene locus_tag LOCUS_15280 gene cfbB 1549334 1550689 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877070.1 protein_id gnl|my_center|LOCUS_15280 1550695 1551792 gene locus_tag LOCUS_15290 1550695 1551792 CDS product oligosaccharide repeat unit polymerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877071.1 protein_id gnl|my_center|LOCUS_15290 1552681 1551773 gene locus_tag LOCUS_15300 1552681 1551773 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061050.1 protein_id gnl|my_center|LOCUS_15300 1552804 1553580 gene locus_tag LOCUS_15310 gene surE 1552804 1553580 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878442.1 protein_id gnl|my_center|LOCUS_15310 1553725 1553582 gene locus_tag LOCUS_15320 1553725 1553582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1553836 1554033 gene locus_tag LOCUS_15330 1553836 1554033 CDS product LSM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877050.1 protein_id gnl|my_center|LOCUS_15330 1555038 1554022 gene locus_tag LOCUS_15340 1555038 1554022 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061052.1 protein_id gnl|my_center|LOCUS_15340 1556095 1555103 gene locus_tag LOCUS_15350 gene ilvC 1556095 1555103 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061053.1 protein_id gnl|my_center|LOCUS_15350 1557485 1556958 gene locus_tag LOCUS_15360 1557485 1556958 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941475.1 protein_id gnl|my_center|LOCUS_15360 1557973 1557482 gene locus_tag LOCUS_15370 gene ilvN 1557973 1557482 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061054.1 protein_id gnl|my_center|LOCUS_15370 1559674 1557983 gene locus_tag LOCUS_15380 1559674 1557983 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_15380 1560691 1559786 gene locus_tag LOCUS_15390 gene argF 1560691 1559786 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877056.1 protein_id gnl|my_center|LOCUS_15390 1562227 1560917 gene locus_tag LOCUS_15400 gene purD 1562227 1560917 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061056.1 protein_id gnl|my_center|LOCUS_15400 1562313 1563674 gene locus_tag LOCUS_15410 1562313 1563674 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_15410 1563923 1565293 gene locus_tag LOCUS_15420 1563923 1565293 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_15420 1565283 1565729 gene locus_tag LOCUS_15430 1565283 1565729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1567472 1565745 gene locus_tag LOCUS_15440 gene argS 1567472 1565745 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877057.1 protein_id gnl|my_center|LOCUS_15440 1567910 1567488 gene locus_tag LOCUS_15450 1567910 1567488 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877058.1 protein_id gnl|my_center|LOCUS_15450 1569318 1568047 gene locus_tag LOCUS_15460 gene hemL 1569318 1568047 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_15460 1569957 1569328 gene locus_tag LOCUS_15470 1569957 1569328 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060776.1 protein_id gnl|my_center|LOCUS_15470 1571227 1570019 gene locus_tag LOCUS_15480 1571227 1570019 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439456.1 protein_id gnl|my_center|LOCUS_15480 1572559 1571240 gene locus_tag LOCUS_15490 gene aspS 1572559 1571240 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875865.1 protein_id gnl|my_center|LOCUS_15490 1572919 1574568 gene locus_tag LOCUS_15500 gene ilvD 1572919 1574568 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061057.1 protein_id gnl|my_center|LOCUS_15500 1574574 1575848 gene locus_tag LOCUS_15510 gene hisD 1574574 1575848 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060775.1 protein_id gnl|my_center|LOCUS_15510 1575919 1577037 gene locus_tag LOCUS_15520 1575919 1577037 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061302.1 protein_id gnl|my_center|LOCUS_15520 1577817 1577020 gene locus_tag LOCUS_15530 1577817 1577020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1578594 1577818 gene locus_tag LOCUS_15540 1578594 1577818 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_15540 1580566 1579265 gene locus_tag LOCUS_15550 1580566 1579265 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877086.1 protein_id gnl|my_center|LOCUS_15550 1580657 1581691 gene locus_tag LOCUS_15560 1580657 1581691 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892670.1 protein_id gnl|my_center|LOCUS_15560 1581693 1582352 gene locus_tag LOCUS_15570 1581693 1582352 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_15570 1582653 1582375 gene locus_tag LOCUS_15580 gene albA 1582653 1582375 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878567.1 protein_id gnl|my_center|LOCUS_15580 1584261 1582726 gene locus_tag LOCUS_15590 1584261 1582726 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877091.1 protein_id gnl|my_center|LOCUS_15590 1585554 1584319 gene locus_tag LOCUS_15600 1585554 1584319 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_15600 1586784 1585567 gene locus_tag LOCUS_15610 1586784 1585567 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877096.1 protein_id gnl|my_center|LOCUS_15610 1587829 1586771 gene locus_tag LOCUS_15620 1587829 1586771 CDS product DrrA-related ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877097.1 protein_id gnl|my_center|LOCUS_15620 1588241 1587813 gene locus_tag LOCUS_15630 1588241 1587813 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485784.1 protein_id gnl|my_center|LOCUS_15630 1588352 1589071 gene locus_tag LOCUS_15640 1588352 1589071 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877099.1 protein_id gnl|my_center|LOCUS_15640 1589846 1589052 gene locus_tag LOCUS_15650 1589846 1589052 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877103.1 protein_id gnl|my_center|LOCUS_15650 1590275 1591645 gene locus_tag LOCUS_15660 gene gatA 1590275 1591645 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061065.1 protein_id gnl|my_center|LOCUS_15660 1592067 1593587 gene locus_tag LOCUS_15670 1592067 1593587 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061066.1 protein_id gnl|my_center|LOCUS_15670 1593588 1594013 gene locus_tag LOCUS_15680 1593588 1594013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1594694 1594014 gene locus_tag LOCUS_15690 gene ribB 1594694 1594014 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_15690 1595304 1594930 gene locus_tag LOCUS_15700 1595304 1594930 CDS product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877110.1 protein_id gnl|my_center|LOCUS_15700 1595543 1597192 gene locus_tag LOCUS_15710 1595543 1597192 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_15710 1598502 1597195 gene locus_tag LOCUS_15720 1598502 1597195 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_15720 1598753 1598544 gene locus_tag LOCUS_15730 gene hpkA 1598753 1598544 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_15730 1598970 1599830 gene locus_tag LOCUS_15740 gene hisG 1598970 1599830 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877116.1 protein_id gnl|my_center|LOCUS_15740 1599827 1600318 gene locus_tag LOCUS_15750 1599827 1600318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1600325 1601275 gene locus_tag LOCUS_15760 gene pyrB 1600325 1601275 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877025.1 protein_id gnl|my_center|LOCUS_15760 1602414 1601263 gene locus_tag LOCUS_15770 gene cdc6-1 1602414 1601263 CDS product ORC1-type DNA replication protein Cdc6-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877024.1 protein_id gnl|my_center|LOCUS_15770 1603836 1603351 gene locus_tag LOCUS_15780 1603836 1603351 CDS product DUF2299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270501.1 protein_id gnl|my_center|LOCUS_15780 1604262 1604942 gene locus_tag LOCUS_15790 1604262 1604942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1604939 1605958 gene locus_tag LOCUS_15800 1604939 1605958 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877020.1 protein_id gnl|my_center|LOCUS_15800 1606213 1605965 gene locus_tag LOCUS_15810 1606213 1605965 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061044.1 protein_id gnl|my_center|LOCUS_15810 1606330 1606521 gene locus_tag LOCUS_15820 1606330 1606521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1607100 1606513 gene locus_tag LOCUS_15830 1607100 1606513 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892716.1 protein_id gnl|my_center|LOCUS_15830 1608790 1607153 gene locus_tag LOCUS_15840 1608790 1607153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1608976 1609470 gene locus_tag LOCUS_15850 1608976 1609470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1609480 1610556 gene locus_tag LOCUS_15860 gene cobJ 1609480 1610556 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877015.1 protein_id gnl|my_center|LOCUS_15860 1610568 1611170 gene locus_tag LOCUS_15870 1610568 1611170 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877014.1 protein_id gnl|my_center|LOCUS_15870 1611224 1612477 gene locus_tag LOCUS_15880 1611224 1612477 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_15880 1613340 1612474 gene locus_tag LOCUS_15890 1613340 1612474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1614281 1613340 gene locus_tag LOCUS_15900 1614281 1613340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877011.1 protein_id gnl|my_center|LOCUS_15900 1614548 1615753 gene locus_tag LOCUS_15910 1614548 1615753 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_15910 1615872 1616270 gene locus_tag LOCUS_15920 1615872 1616270 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061298.1 protein_id gnl|my_center|LOCUS_15920 1616242 1617168 gene locus_tag LOCUS_15930 1616242 1617168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1617209 1617700 gene locus_tag LOCUS_15940 gene cfbA 1617209 1617700 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061042.1 protein_id gnl|my_center|LOCUS_15940 1617825 1619402 gene locus_tag LOCUS_15950 1617825 1619402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1619509 1620429 gene locus_tag LOCUS_15960 gene thiL 1619509 1620429 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877008.1 protein_id gnl|my_center|LOCUS_15960 1620419 1621420 gene locus_tag LOCUS_15970 gene amrS 1620419 1621420 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877007.1 protein_id gnl|my_center|LOCUS_15970 1622672 1621410 gene locus_tag LOCUS_15980 1622672 1621410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1623931 1622675 gene locus_tag LOCUS_15990 1623931 1622675 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_15990 1624960 1623941 gene locus_tag LOCUS_16000 gene purE 1624960 1623941 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061041.1 protein_id gnl|my_center|LOCUS_16000 1625539 1625111 gene locus_tag LOCUS_16010 1625539 1625111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1626964 1625654 gene locus_tag LOCUS_16020 1626964 1625654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1627497 1628423 gene locus_tag LOCUS_16030 1627497 1628423 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_16030 1630699 1628552 gene locus_tag LOCUS_16040 1630699 1628552 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_16040 1631032 1631547 gene locus_tag LOCUS_16050 1631032 1631547 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964859.1 protein_id gnl|my_center|LOCUS_16050 1631608 1633314 gene locus_tag LOCUS_16060 1631608 1633314 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877004.1 protein_id gnl|my_center|LOCUS_16060 1634270 1633332 gene locus_tag LOCUS_16070 1634270 1633332 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877003.1 protein_id gnl|my_center|LOCUS_16070 1634695 1634279 gene locus_tag LOCUS_16080 gene ribH 1634695 1634279 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877002.1 protein_id gnl|my_center|LOCUS_16080 1637183 1634850 gene locus_tag LOCUS_16090 1637183 1634850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1638202 1637192 gene locus_tag LOCUS_16100 1638202 1637192 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061040.1 protein_id gnl|my_center|LOCUS_16100 1638656 1638174 gene locus_tag LOCUS_16110 1638656 1638174 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876999.1 protein_id gnl|my_center|LOCUS_16110 1639908 1638661 gene locus_tag LOCUS_16120 gene hacA 1639908 1638661 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_16120 1640203 1641411 gene locus_tag LOCUS_16130 1640203 1641411 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201963.1 protein_id gnl|my_center|LOCUS_16130 1641738 1642913 gene locus_tag LOCUS_16140 1641738 1642913 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201963.1 protein_id gnl|my_center|LOCUS_16140 1644141 1642903 gene locus_tag LOCUS_16150 gene cap8O 1644141 1642903 CDS product type 8 capsular polysaccharide synthesis protein Cap8O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779504.1 protein_id gnl|my_center|LOCUS_16150 1644238 1645080 gene locus_tag LOCUS_16160 gene rfbD 1644238 1645080 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_16160 1651215 1645105 gene locus_tag LOCUS_16170 1651215 1645105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1651590 1653077 gene locus_tag LOCUS_16180 1651590 1653077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1652998 1655877 gene locus_tag LOCUS_16190 1652998 1655877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1656140 1657009 gene locus_tag LOCUS_16200 gene rfbA 1656140 1657009 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_16200 1657011 1657568 gene locus_tag LOCUS_16210 gene rfbC 1657011 1657568 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_16210 1657579 1658583 gene locus_tag LOCUS_16220 gene rfbB 1657579 1658583 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_16220 1658593 1659732 gene locus_tag LOCUS_16230 1658593 1659732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1659729 1661144 gene locus_tag LOCUS_16240 1659729 1661144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1661151 1662689 gene locus_tag LOCUS_16250 1661151 1662689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1662694 1665264 gene locus_tag LOCUS_16260 1662694 1665264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1665379 1666920 gene locus_tag LOCUS_16270 1665379 1666920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1668034 1666925 gene locus_tag LOCUS_16280 1668034 1666925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1668072 1669610 gene locus_tag LOCUS_16290 1668072 1669610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1670152 1670418 gene locus_tag LOCUS_16300 1670152 1670418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1670437 1670715 gene locus_tag LOCUS_16310 1670437 1670715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1670864 1671904 gene locus_tag LOCUS_16320 1670864 1671904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1671897 1673498 gene locus_tag LOCUS_16330 1671897 1673498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1673495 1675003 gene locus_tag LOCUS_16340 1673495 1675003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1674993 1676039 gene locus_tag LOCUS_16350 1674993 1676039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1676041 1677075 gene locus_tag LOCUS_16360 1676041 1677075 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476439.1 protein_id gnl|my_center|LOCUS_16360 1677249 1678034 gene locus_tag LOCUS_16370 1677249 1678034 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_16370 1678049 1679809 gene locus_tag LOCUS_16380 1678049 1679809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1679812 1680906 gene locus_tag LOCUS_16390 1679812 1680906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1680899 1681861 gene locus_tag LOCUS_16400 1680899 1681861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1681867 1682832 gene locus_tag LOCUS_16410 1681867 1682832 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875811.1 protein_id gnl|my_center|LOCUS_16410 1682848 1683705 gene locus_tag LOCUS_16420 1682848 1683705 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965618.1 protein_id gnl|my_center|LOCUS_16420 1683755 1685158 gene locus_tag LOCUS_16430 1683755 1685158 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_16430 1685313 1687715 gene locus_tag LOCUS_16440 1685313 1687715 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115891889.1 protein_id gnl|my_center|LOCUS_16440 1687746 1688681 gene locus_tag LOCUS_16450 gene radA 1687746 1688681 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876995.1 protein_id gnl|my_center|LOCUS_16450 1688996 1689901 gene locus_tag LOCUS_16460 1688996 1689901 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876994.1 protein_id gnl|my_center|LOCUS_16460 1690425 1692413 gene locus_tag LOCUS_16470 gene hdrA 1690425 1692413 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_16470 1692634 1693902 gene locus_tag LOCUS_16480 gene glyA 1692634 1693902 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_16480 1693908 1694609 gene locus_tag LOCUS_16490 1693908 1694609 CDS product dihydromethanopterin reductase (acceptor) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876991.1 protein_id gnl|my_center|LOCUS_16490 1694959 1694606 gene locus_tag LOCUS_16500 1694959 1694606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1695120 1696325 gene locus_tag LOCUS_16510 1695120 1696325 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061035.1 protein_id gnl|my_center|LOCUS_16510 1696488 1699760 gene locus_tag LOCUS_16520 gene ileS 1696488 1699760 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876987.1 protein_id gnl|my_center|LOCUS_16520 1699770 1701920 gene locus_tag LOCUS_16530 gene purL 1699770 1701920 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876986.1 protein_id gnl|my_center|LOCUS_16530 1701939 1703150 gene locus_tag LOCUS_16540 1701939 1703150 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876981.1 protein_id gnl|my_center|LOCUS_16540 1703167 1704312 gene locus_tag LOCUS_16550 1703167 1704312 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061033.1 protein_id gnl|my_center|LOCUS_16550 1705040 1704642 gene locus_tag LOCUS_16560 1705040 1704642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1705728 1705315 gene locus_tag LOCUS_16570 1705728 1705315 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870251.1 protein_id gnl|my_center|LOCUS_16570 1707003 1705777 gene locus_tag LOCUS_16580 1707003 1705777 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870253.1 protein_id gnl|my_center|LOCUS_16580 1707229 1707990 gene locus_tag LOCUS_16590 1707229 1707990 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876961.1 protein_id gnl|my_center|LOCUS_16590 1708697 1707993 gene locus_tag LOCUS_16600 gene cobI 1708697 1707993 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876960.1 protein_id gnl|my_center|LOCUS_16600 1708790 1710628 gene locus_tag LOCUS_16610 1708790 1710628 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876959.1 protein_id gnl|my_center|LOCUS_16610 1710721 1710646 gene locus_tag LOCUS_t00340 1710721 1710646 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1711750 1710731 gene locus_tag LOCUS_16620 1711750 1710731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 1712076 1711762 gene locus_tag LOCUS_16630 1712076 1711762 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061022.1 protein_id gnl|my_center|LOCUS_16630 1712595 1712173 gene locus_tag LOCUS_16640 1712595 1712173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1712919 1712632 gene locus_tag LOCUS_16650 1712919 1712632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1713506 1712934 gene locus_tag LOCUS_16660 1713506 1712934 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876931.1 protein_id gnl|my_center|LOCUS_16660 1714579 1713575 gene locus_tag LOCUS_16670 gene dph2 1714579 1713575 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_16670 1715150 1714581 gene locus_tag LOCUS_16680 gene hpt 1715150 1714581 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061024.1 protein_id gnl|my_center|LOCUS_16680 1715254 1716597 gene locus_tag LOCUS_16690 1715254 1716597 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876934.1 protein_id gnl|my_center|LOCUS_16690 1716603 1717808 gene locus_tag LOCUS_16700 1716603 1717808 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876935.1 protein_id gnl|my_center|LOCUS_16700 1717819 1718286 gene locus_tag LOCUS_16710 gene moaC 1717819 1718286 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943324.1 protein_id gnl|my_center|LOCUS_16710 1718356 1718517 gene locus_tag LOCUS_16720 1718356 1718517 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013294958.1 protein_id gnl|my_center|LOCUS_16720 1718582 1719406 gene locus_tag LOCUS_16730 gene hisF 1718582 1719406 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061292.1 protein_id gnl|my_center|LOCUS_16730 1719403 1720338 gene locus_tag LOCUS_16740 1719403 1720338 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876955.1 protein_id gnl|my_center|LOCUS_16740 1720343 1720699 gene locus_tag LOCUS_16750 gene gloA 1720343 1720699 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112890.1 protein_id gnl|my_center|LOCUS_16750 1721144 1720710 gene locus_tag LOCUS_16760 1721144 1720710 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_16760 1721219 1722385 gene locus_tag LOCUS_16770 1721219 1722385 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 protein_id gnl|my_center|LOCUS_16770 1722786 1722382 gene locus_tag LOCUS_16780 1722786 1722382 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023884.1 protein_id gnl|my_center|LOCUS_16780 1722949 1724025 gene locus_tag LOCUS_16790 1722949 1724025 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993669.1 protein_id gnl|my_center|LOCUS_16790 1724114 1725397 gene locus_tag LOCUS_16800 gene lysA 1724114 1725397 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_16800 1725406 1726266 gene locus_tag LOCUS_16810 gene dapF 1725406 1726266 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876947.1 protein_id gnl|my_center|LOCUS_16810 1726865 1726284 gene locus_tag LOCUS_16820 1726865 1726284 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061290.1 protein_id gnl|my_center|LOCUS_16820 1727783 1726872 gene locus_tag LOCUS_16830 gene rsmA 1727783 1726872 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867501.1 protein_id gnl|my_center|LOCUS_16830 1728449 1727793 gene locus_tag LOCUS_16840 1728449 1727793 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_16840 1729043 1728699 gene locus_tag LOCUS_16850 1729043 1728699 CDS product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061025.1 protein_id gnl|my_center|LOCUS_16850 1729350 1729054 gene locus_tag LOCUS_16860 1729350 1729054 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876936.1 protein_id gnl|my_center|LOCUS_16860 1729841 1729545 gene locus_tag LOCUS_16870 1729841 1729545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1730961 1729891 gene locus_tag LOCUS_16880 1730961 1729891 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_16880 1731759 1731148 gene locus_tag LOCUS_16890 1731759 1731148 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 protein_id gnl|my_center|LOCUS_16890 1734237 1731919 gene locus_tag LOCUS_16900 gene nrdD 1734237 1731919 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330373.1 protein_id gnl|my_center|LOCUS_16900 1737713 1734420 gene locus_tag LOCUS_16910 gene polC 1737713 1734420 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061308.1 protein_id gnl|my_center|LOCUS_16910 1737909 1738667 gene locus_tag LOCUS_16920 1737909 1738667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1738692 1739168 gene locus_tag LOCUS_16930 1738692 1739168 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071603.1 protein_id gnl|my_center|LOCUS_16930 1740748 1739165 gene locus_tag LOCUS_16940 gene lysS 1740748 1739165 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 protein_id gnl|my_center|LOCUS_16940 1742350 1741052 gene locus_tag LOCUS_16950 gene thiC 1742350 1741052 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877152.1 protein_id gnl|my_center|LOCUS_16950 1743451 1742537 gene locus_tag LOCUS_16960 1743451 1742537 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877153.1 protein_id gnl|my_center|LOCUS_16960 1744467 1743598 gene locus_tag LOCUS_16970 1744467 1743598 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061082.1 protein_id gnl|my_center|LOCUS_16970 1744550 1745131 gene locus_tag LOCUS_16980 gene hxlB 1744550 1745131 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061311.1 protein_id gnl|my_center|LOCUS_16980 1745889 1745140 gene locus_tag LOCUS_16990 gene fdhD 1745889 1745140 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877156.1 protein_id gnl|my_center|LOCUS_16990 1746122 1746883 gene locus_tag LOCUS_17000 1746122 1746883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17000 1746937 1747074 gene locus_tag LOCUS_17010 1746937 1747074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1747084 1747662 gene locus_tag LOCUS_17020 1747084 1747662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1748040 1747744 gene locus_tag LOCUS_17030 1748040 1747744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1749240 1748212 gene locus_tag LOCUS_17040 1749240 1748212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1749887 1750153 gene locus_tag LOCUS_17050 1749887 1750153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1750159 1750458 gene locus_tag LOCUS_17060 1750159 1750458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1751025 1751813 gene locus_tag LOCUS_17070 1751025 1751813 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_17070 1751899 1753956 gene locus_tag LOCUS_17080 gene fdhF 1751899 1753956 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_17080 1753963 1755168 gene locus_tag LOCUS_17090 1753963 1755168 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_17090 1756172 1755243 gene locus_tag LOCUS_17100 gene moaA 1756172 1755243 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061083.1 protein_id gnl|my_center|LOCUS_17100 1757226 1756177 gene locus_tag LOCUS_17110 1757226 1756177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1757627 1758076 gene locus_tag LOCUS_17120 1757627 1758076 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061085.1 protein_id gnl|my_center|LOCUS_17120 1758079 1759176 gene locus_tag LOCUS_17130 1758079 1759176 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061086.1 protein_id gnl|my_center|LOCUS_17130 1759185 1759415 gene locus_tag LOCUS_17140 1759185 1759415 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877164.1 protein_id gnl|my_center|LOCUS_17140 1759427 1759996 gene locus_tag LOCUS_17150 1759427 1759996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1759986 1761362 gene locus_tag LOCUS_17160 1759986 1761362 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_17160 1761372 1763081 gene locus_tag LOCUS_17170 1761372 1763081 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877166.1 protein_id gnl|my_center|LOCUS_17170 1763096 1763962 gene locus_tag LOCUS_17180 1763096 1763962 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870684.1 protein_id gnl|my_center|LOCUS_17180 1764153 1764446 gene locus_tag LOCUS_17190 1764153 1764446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1764556 1764846 gene locus_tag LOCUS_17200 1764556 1764846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1766531 1764852 gene locus_tag LOCUS_17210 1766531 1764852 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061091.1 protein_id gnl|my_center|LOCUS_17210 1767978 1766620 gene locus_tag LOCUS_17220 gene glnA 1767978 1766620 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877179.1 protein_id gnl|my_center|LOCUS_17220 1768992 1768237 gene locus_tag LOCUS_17230 1768992 1768237 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877180.1 protein_id gnl|my_center|LOCUS_17230 1770168 1769002 gene locus_tag LOCUS_17240 1770168 1769002 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022050.1 protein_id gnl|my_center|LOCUS_17240 1770709 1771959 gene locus_tag LOCUS_17250 gene ahcY 1770709 1771959 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877244.1 protein_id gnl|my_center|LOCUS_17250 1772000 1772650 gene locus_tag LOCUS_17260 1772000 1772650 CDS product DUF2119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061105.1 protein_id gnl|my_center|LOCUS_17260 1773630 1772647 gene locus_tag LOCUS_17270 gene fen 1773630 1772647 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877241.1 protein_id gnl|my_center|LOCUS_17270 1774206 1773643 gene locus_tag LOCUS_17280 1774206 1773643 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877240.1 protein_id gnl|my_center|LOCUS_17280 1775467 1774214 gene locus_tag LOCUS_17290 gene hacA 1775467 1774214 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061104.1 protein_id gnl|my_center|LOCUS_17290 1776649 1775477 gene locus_tag LOCUS_17300 1776649 1775477 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877238.1 protein_id gnl|my_center|LOCUS_17300 1777244 1776705 gene locus_tag LOCUS_17310 gene cyaB 1777244 1776705 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 protein_id gnl|my_center|LOCUS_17310 1777439 1777984 gene locus_tag LOCUS_17320 1777439 1777984 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877235.1 protein_id gnl|my_center|LOCUS_17320 1777997 1779586 gene locus_tag LOCUS_17330 gene serB 1777997 1779586 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061103.1 protein_id gnl|my_center|LOCUS_17330 1779642 1779791 gene locus_tag LOCUS_17340 1779642 1779791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1779962 1782112 gene locus_tag LOCUS_17350 gene topA 1779962 1782112 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061102.1 protein_id gnl|my_center|LOCUS_17350 1782320 1785088 gene locus_tag LOCUS_17360 1782320 1785088 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877231.1 protein_id gnl|my_center|LOCUS_17360 1785146 1786240 gene locus_tag LOCUS_17370 1785146 1786240 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 protein_id gnl|my_center|LOCUS_17370 1786243 1786797 gene locus_tag LOCUS_17380 1786243 1786797 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877227.1 protein_id gnl|my_center|LOCUS_17380 1787496 1787086 gene locus_tag LOCUS_17390 1787496 1787086 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009914334.1 protein_id gnl|my_center|LOCUS_17390 1787779 1788144 gene locus_tag LOCUS_17400 1787779 1788144 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877226.1 protein_id gnl|my_center|LOCUS_17400 1788113 1788370 gene locus_tag LOCUS_17410 1788113 1788370 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061101.1 protein_id gnl|my_center|LOCUS_17410 1788327 1788479 gene locus_tag LOCUS_17420 1788327 1788479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1788476 1788913 gene locus_tag LOCUS_17430 1788476 1788913 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877224.1 protein_id gnl|my_center|LOCUS_17430 1788937 1789293 gene locus_tag LOCUS_17440 1788937 1789293 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877223.1 protein_id gnl|my_center|LOCUS_17440 1789299 1789883 gene locus_tag LOCUS_17450 1789299 1789883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877222.1 protein_id gnl|my_center|LOCUS_17450 1789905 1790060 gene locus_tag LOCUS_17460 1789905 1790060 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868637.1 protein_id gnl|my_center|LOCUS_17460 1790073 1790318 gene locus_tag LOCUS_17470 1790073 1790318 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877220.1 protein_id gnl|my_center|LOCUS_17470 1790355 1791026 gene locus_tag LOCUS_17480 1790355 1791026 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877219.1 protein_id gnl|my_center|LOCUS_17480 1791048 1791272 gene locus_tag LOCUS_17490 gene rpl18a 1791048 1791272 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250273.1 protein_id gnl|my_center|LOCUS_17490 1791283 1791723 gene locus_tag LOCUS_17500 gene pfdA 1791283 1791723 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877217.1 protein_id gnl|my_center|LOCUS_17500