>Feature sequence001 8 1201 gene locus_tag LOCUS_00010 8 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533119.1 protein_id gnl|my_center|LOCUS_00010 1375 2313 gene locus_tag LOCUS_00020 1375 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2773 4575 gene locus_tag LOCUS_00030 2773 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5263 4622 gene locus_tag LOCUS_00040 5263 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6426 5260 gene locus_tag LOCUS_00050 6426 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7637 6423 gene locus_tag LOCUS_00060 7637 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8395 7634 gene locus_tag LOCUS_00070 8395 7634 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535747.1 protein_id gnl|my_center|LOCUS_00070 9660 8392 gene locus_tag LOCUS_00080 9660 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10817 9657 gene locus_tag LOCUS_00090 10817 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11669 10821 gene locus_tag LOCUS_00100 11669 10821 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930875.1 protein_id gnl|my_center|LOCUS_00100 12847 11681 gene locus_tag LOCUS_00110 12847 11681 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_00110 14184 12844 gene locus_tag LOCUS_00120 14184 12844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15112 14315 gene locus_tag LOCUS_00130 15112 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16224 15097 gene locus_tag LOCUS_00140 16224 15097 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_00140 17194 16229 gene locus_tag LOCUS_00150 17194 16229 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_00150 18246 17191 gene locus_tag LOCUS_00160 18246 17191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19777 18290 gene locus_tag LOCUS_00170 19777 18290 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023666.1 protein_id gnl|my_center|LOCUS_00170 20912 19779 gene locus_tag LOCUS_00180 20912 19779 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533209.1 protein_id gnl|my_center|LOCUS_00180 21864 20917 gene locus_tag LOCUS_00190 21864 20917 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703802.1 protein_id gnl|my_center|LOCUS_00190 24002 21861 gene locus_tag LOCUS_00200 24002 21861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23843 23750 gene locus_tag LOCUS_t00010 23843 23750 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24889 23999 gene locus_tag LOCUS_00210 24889 23999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25920 24889 gene locus_tag LOCUS_00220 gene nadE 25920 24889 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061276.1 protein_id gnl|my_center|LOCUS_00220 26204 25950 gene locus_tag LOCUS_00230 26204 25950 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061274.1 protein_id gnl|my_center|LOCUS_00230 27778 26246 gene locus_tag LOCUS_00240 27778 26246 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171507.1 protein_id gnl|my_center|LOCUS_00240 29767 27794 gene locus_tag LOCUS_00250 gene asnB 29767 27794 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_00250 31040 29988 gene locus_tag LOCUS_00260 31040 29988 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_00260 32459 31044 gene locus_tag LOCUS_00270 32459 31044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32442 32690 gene locus_tag LOCUS_00280 32442 32690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33606 32614 gene locus_tag LOCUS_00290 33606 32614 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390867.1 protein_id gnl|my_center|LOCUS_00290 35217 33616 gene locus_tag LOCUS_00300 35217 33616 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_00300 35874 35275 gene locus_tag LOCUS_00310 35874 35275 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_00310 36223 37503 gene locus_tag LOCUS_00320 36223 37503 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_00320 37515 38573 gene locus_tag LOCUS_00330 37515 38573 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_00330 40016 38643 gene locus_tag LOCUS_00340 40016 38643 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_00340 41054 40233 gene locus_tag LOCUS_00350 41054 40233 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813848.1 protein_id gnl|my_center|LOCUS_00350 41141 43384 gene locus_tag LOCUS_00360 41141 43384 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193103.1 protein_id gnl|my_center|LOCUS_00360 43992 43393 gene locus_tag LOCUS_00370 gene mog 43992 43393 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094685.1 protein_id gnl|my_center|LOCUS_00370 44521 44021 gene locus_tag LOCUS_00380 gene yjgA 44521 44021 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189393.1 protein_id gnl|my_center|LOCUS_00380 >Feature sequence002 2209 677 gene locus_tag LOCUS_00390 2209 677 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063675.1 protein_id gnl|my_center|LOCUS_00390 2997 2410 gene locus_tag LOCUS_00400 2997 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 3698 2994 gene locus_tag LOCUS_00410 3698 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 4769 3795 gene locus_tag LOCUS_00420 4769 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 6545 4836 gene locus_tag LOCUS_00430 6545 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 8396 7341 gene locus_tag LOCUS_00440 8396 7341 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002067912.1 protein_id gnl|my_center|LOCUS_00440 9100 8393 gene locus_tag LOCUS_00450 9100 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 10251 9091 gene locus_tag LOCUS_00460 10251 9091 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_00460 11084 10305 gene locus_tag LOCUS_00470 11084 10305 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_00470 11521 11081 gene locus_tag LOCUS_00480 11521 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 12372 11518 gene locus_tag LOCUS_00490 12372 11518 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_00490 13179 12388 gene locus_tag LOCUS_00500 13179 12388 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804111.1 protein_id gnl|my_center|LOCUS_00500 13775 13176 gene locus_tag LOCUS_00510 13775 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 14514 15644 gene locus_tag LOCUS_00520 14514 15644 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808213.1 protein_id gnl|my_center|LOCUS_00520 15647 16054 gene locus_tag LOCUS_00530 15647 16054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 16051 16905 gene locus_tag LOCUS_00540 16051 16905 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529615.1 protein_id gnl|my_center|LOCUS_00540 16902 18455 gene locus_tag LOCUS_00550 16902 18455 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978555.1 protein_id gnl|my_center|LOCUS_00550 20006 18459 gene locus_tag LOCUS_00560 20006 18459 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_00560 21387 20080 gene locus_tag LOCUS_00570 21387 20080 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385434.1 protein_id gnl|my_center|LOCUS_00570 21932 21384 gene locus_tag LOCUS_00580 21932 21384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 22994 21945 gene locus_tag LOCUS_00590 gene dctP 22994 21945 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965687.1 protein_id gnl|my_center|LOCUS_00590 24211 23009 gene locus_tag LOCUS_00600 24211 23009 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966119.1 protein_id gnl|my_center|LOCUS_00600 26142 24208 gene locus_tag LOCUS_00610 26142 24208 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_00610 26906 26133 gene locus_tag LOCUS_00620 26906 26133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_00620 27666 26908 gene locus_tag LOCUS_00630 27666 26908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090654.1 protein_id gnl|my_center|LOCUS_00630 28739 27663 gene locus_tag LOCUS_00640 28739 27663 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090655.1 protein_id gnl|my_center|LOCUS_00640 29631 28744 gene locus_tag LOCUS_00650 29631 28744 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_00650 29792 30820 gene locus_tag LOCUS_00660 29792 30820 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529671.1 protein_id gnl|my_center|LOCUS_00660 30896 32422 gene locus_tag LOCUS_00670 gene fadD13 30896 32422 CDS product long-chain-fatty-acid--CoA ligase FadD13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416081.1 protein_id gnl|my_center|LOCUS_00670 33004 32825 gene locus_tag LOCUS_00680 33004 32825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 35319 33274 gene locus_tag LOCUS_00690 35319 33274 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035993.1 protein_id gnl|my_center|LOCUS_00690 >Feature sequence003 1695 379 gene locus_tag LOCUS_00700 1695 379 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_00700 2203 1715 gene locus_tag LOCUS_00710 2203 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 3241 2213 gene locus_tag LOCUS_00720 3241 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 3357 5498 gene locus_tag LOCUS_00730 3357 5498 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527966.1 protein_id gnl|my_center|LOCUS_00730 5509 7035 gene locus_tag LOCUS_00740 5509 7035 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086194.1 protein_id gnl|my_center|LOCUS_00740 7109 8563 gene locus_tag LOCUS_00750 7109 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 8560 9294 gene locus_tag LOCUS_00760 8560 9294 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 protein_id gnl|my_center|LOCUS_00760 9291 9950 gene locus_tag LOCUS_00770 9291 9950 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194517.1 protein_id gnl|my_center|LOCUS_00770 9997 11199 gene locus_tag LOCUS_00780 gene pcaF 9997 11199 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 protein_id gnl|my_center|LOCUS_00780 11396 11815 gene locus_tag LOCUS_00790 11396 11815 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204701.1 protein_id gnl|my_center|LOCUS_00790 12008 11808 gene locus_tag LOCUS_00800 12008 11808 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366461.1 protein_id gnl|my_center|LOCUS_00800 12050 14356 gene locus_tag LOCUS_00810 12050 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 14422 14853 gene locus_tag LOCUS_00820 14422 14853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 16130 14907 gene locus_tag LOCUS_00830 16130 14907 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 protein_id gnl|my_center|LOCUS_00830 16674 16222 gene locus_tag LOCUS_00840 16674 16222 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267564.1 protein_id gnl|my_center|LOCUS_00840 17208 16771 gene locus_tag LOCUS_00850 17208 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 18899 17268 gene locus_tag LOCUS_00860 18899 17268 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037320.1 protein_id gnl|my_center|LOCUS_00860 19792 18956 gene locus_tag LOCUS_00870 19792 18956 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809257.1 protein_id gnl|my_center|LOCUS_00870 20350 19808 gene locus_tag LOCUS_00880 20350 19808 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199294.1 protein_id gnl|my_center|LOCUS_00880 20651 20325 gene locus_tag LOCUS_00890 20651 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809253.1 protein_id gnl|my_center|LOCUS_00890 20581 20760 gene locus_tag LOCUS_00900 20581 20760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 20839 21819 gene locus_tag LOCUS_00910 20839 21819 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_00910 23950 21842 gene locus_tag LOCUS_00920 gene malQ 23950 21842 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480181.1 protein_id gnl|my_center|LOCUS_00920 26103 23947 gene locus_tag LOCUS_00930 gene glgX 26103 23947 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 protein_id gnl|my_center|LOCUS_00930 <26662 26096 gene locus_tag LOCUS_00940 <26662 26096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880434.1:1,4-alpha-glucan branching protein GlgB >Feature sequence004 1454 1131 gene locus_tag LOCUS_00950 1454 1131 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931551.1 protein_id gnl|my_center|LOCUS_00950 2505 1504 gene locus_tag LOCUS_00960 2505 1504 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084684.1 protein_id gnl|my_center|LOCUS_00960 2690 3883 gene locus_tag LOCUS_00970 2690 3883 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_00970 3892 5181 gene locus_tag LOCUS_00980 3892 5181 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_00980 5191 6621 gene locus_tag LOCUS_00990 5191 6621 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929684.1 protein_id gnl|my_center|LOCUS_00990 10195 6641 gene locus_tag LOCUS_01000 10195 6641 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086601.1 protein_id gnl|my_center|LOCUS_01000 10859 10320 gene locus_tag LOCUS_01010 10859 10320 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086602.1 protein_id gnl|my_center|LOCUS_01010 11377 10910 gene locus_tag LOCUS_01020 gene bpsR 11377 10910 CDS product MarR family transcriptional regulator BpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820159.1 protein_id gnl|my_center|LOCUS_01020 12178 11426 gene locus_tag LOCUS_01030 12178 11426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 protein_id gnl|my_center|LOCUS_01030 12960 12175 gene locus_tag LOCUS_01040 12960 12175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810082.1 protein_id gnl|my_center|LOCUS_01040 14855 12957 gene locus_tag LOCUS_01050 14855 12957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810078.1 protein_id gnl|my_center|LOCUS_01050 16103 14883 gene locus_tag LOCUS_01060 16103 14883 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930653.1 protein_id gnl|my_center|LOCUS_01060 16799 16158 gene locus_tag LOCUS_01070 16799 16158 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086605.1 protein_id gnl|my_center|LOCUS_01070 17422 16781 gene locus_tag LOCUS_01080 17422 16781 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530297.1 protein_id gnl|my_center|LOCUS_01080 18351 17443 gene locus_tag LOCUS_01090 18351 17443 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086604.1 protein_id gnl|my_center|LOCUS_01090 19993 18362 gene locus_tag LOCUS_01100 19993 18362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966263.1 protein_id gnl|my_center|LOCUS_01100 20194 20967 gene locus_tag LOCUS_01110 20194 20967 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 protein_id gnl|my_center|LOCUS_01110 21011 21724 gene locus_tag LOCUS_01120 21011 21724 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967752.1 protein_id gnl|my_center|LOCUS_01120 21782 22972 gene locus_tag LOCUS_01130 21782 22972 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086611.1 protein_id gnl|my_center|LOCUS_01130 >Feature sequence005 569 982 gene locus_tag LOCUS_01140 gene fliS 569 982 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 protein_id gnl|my_center|LOCUS_01140 1004 1345 gene locus_tag LOCUS_01150 1004 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 1356 2102 gene locus_tag LOCUS_01160 1356 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 2323 2117 gene locus_tag LOCUS_01170 2323 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 2603 4246 gene locus_tag LOCUS_01180 gene fliF 2603 4246 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_01180 4250 5245 gene locus_tag LOCUS_01190 gene fliG 4250 5245 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_01190 5232 6080 gene locus_tag LOCUS_01200 5232 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 6077 7543 gene locus_tag LOCUS_01210 gene fliI 6077 7543 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 protein_id gnl|my_center|LOCUS_01210 7540 7992 gene locus_tag LOCUS_01220 7540 7992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 7997 9391 gene locus_tag LOCUS_01230 7997 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 9542 10084 gene locus_tag LOCUS_01240 9542 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 10093 11094 gene locus_tag LOCUS_01250 gene fliM 10093 11094 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 protein_id gnl|my_center|LOCUS_01250 11081 11479 gene locus_tag LOCUS_01260 11081 11479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 11509 11820 gene locus_tag LOCUS_01270 11509 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 11876 12589 gene locus_tag LOCUS_01280 gene fliP 11876 12589 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549847.1 protein_id gnl|my_center|LOCUS_01280 12594 12878 gene locus_tag LOCUS_01290 gene fliQ 12594 12878 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 protein_id gnl|my_center|LOCUS_01290 12875 13636 gene locus_tag LOCUS_01300 gene fliR 12875 13636 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_01300 13703 14836 gene locus_tag LOCUS_01310 13703 14836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 14833 15465 gene locus_tag LOCUS_01320 gene rqpR 14833 15465 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_01320 16963 15482 gene locus_tag LOCUS_01330 16963 15482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 19233 16960 gene locus_tag LOCUS_01340 19233 16960 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044977.1 protein_id gnl|my_center|LOCUS_01340 19360 21246 gene locus_tag LOCUS_01350 19360 21246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 21364 21290 gene locus_tag LOCUS_t00020 21364 21290 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence006 <1 675 gene locus_tag LOCUS_01360 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704514.1:cytochrome b/b6 domain-containing protein 1426 713 gene locus_tag LOCUS_01370 1426 713 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526980.1 protein_id gnl|my_center|LOCUS_01370 1895 1584 gene locus_tag LOCUS_01380 1895 1584 CDS product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531020.1 protein_id gnl|my_center|LOCUS_01380 2159 3007 gene locus_tag LOCUS_01390 2159 3007 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318655.1 protein_id gnl|my_center|LOCUS_01390 3894 3031 gene locus_tag LOCUS_01400 3894 3031 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921324.1 protein_id gnl|my_center|LOCUS_01400 4012 4905 gene locus_tag LOCUS_01410 4012 4905 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704700.1 protein_id gnl|my_center|LOCUS_01410 5203 4895 gene locus_tag LOCUS_01420 5203 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 5334 5957 gene locus_tag LOCUS_01430 5334 5957 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463347.1 protein_id gnl|my_center|LOCUS_01430 7198 5945 gene locus_tag LOCUS_01440 7198 5945 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807943.1 protein_id gnl|my_center|LOCUS_01440 8408 7248 gene locus_tag LOCUS_01450 8408 7248 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088689.1 protein_id gnl|my_center|LOCUS_01450 8505 9494 gene locus_tag LOCUS_01460 8505 9494 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382879.1 protein_id gnl|my_center|LOCUS_01460 11707 9503 gene locus_tag LOCUS_01470 11707 9503 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072227.1 protein_id gnl|my_center|LOCUS_01470 12149 11694 gene locus_tag LOCUS_01480 12149 11694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 12287 12739 gene locus_tag LOCUS_01490 12287 12739 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091672.1 protein_id gnl|my_center|LOCUS_01490 12736 13065 gene locus_tag LOCUS_01500 12736 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 13084 13503 gene locus_tag LOCUS_01510 13084 13503 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971025.1 protein_id gnl|my_center|LOCUS_01510 13979 13539 gene locus_tag LOCUS_01520 13979 13539 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_01520 14491 14117 gene locus_tag LOCUS_01530 14491 14117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 14620 15915 gene locus_tag LOCUS_01540 14620 15915 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929184.1 protein_id gnl|my_center|LOCUS_01540 16073 17374 gene locus_tag LOCUS_01550 gene cytX 16073 17374 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105254.1 protein_id gnl|my_center|LOCUS_01550 17371 18354 gene locus_tag LOCUS_01560 17371 18354 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084062.1 protein_id gnl|my_center|LOCUS_01560 18604 19830 gene locus_tag LOCUS_01570 18604 19830 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817751.1 protein_id gnl|my_center|LOCUS_01570 >Feature sequence007 1575 1048 gene locus_tag LOCUS_01580 1575 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 2600 1572 gene locus_tag LOCUS_01590 2600 1572 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_01590 3403 2657 gene locus_tag LOCUS_01600 3403 2657 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_01600 3838 5160 gene locus_tag LOCUS_01610 gene aceA 3838 5160 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192082.1 protein_id gnl|my_center|LOCUS_01610 5344 6882 gene locus_tag LOCUS_01620 5344 6882 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_01620 7093 7401 gene locus_tag LOCUS_01630 7093 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 7446 8807 gene locus_tag LOCUS_01640 7446 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 8797 9636 gene locus_tag LOCUS_01650 8797 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 9633 10457 gene locus_tag LOCUS_01660 9633 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 10543 10692 gene locus_tag LOCUS_01670 10543 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 10689 11774 gene locus_tag LOCUS_01680 gene cpaB 10689 11774 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128354298.1 protein_id gnl|my_center|LOCUS_01680 11771 13081 gene locus_tag LOCUS_01690 11771 13081 CDS product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930977.1 protein_id gnl|my_center|LOCUS_01690 13083 14729 gene locus_tag LOCUS_01700 13083 14729 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064053.1 protein_id gnl|my_center|LOCUS_01700 14726 15592 gene locus_tag LOCUS_01710 14726 15592 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812713.1 protein_id gnl|my_center|LOCUS_01710 15589 16467 gene locus_tag LOCUS_01720 15589 16467 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064052.1 protein_id gnl|my_center|LOCUS_01720 16464 16883 gene locus_tag LOCUS_01730 16464 16883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 17051 17719 gene locus_tag LOCUS_01740 17051 17719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 17833 18897 gene locus_tag LOCUS_01750 17833 18897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 19817 19017 gene locus_tag LOCUS_01760 19817 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 >Feature sequence008 882 652 gene locus_tag LOCUS_01770 882 652 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_01770 1307 915 gene locus_tag LOCUS_01780 1307 915 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878062.1 protein_id gnl|my_center|LOCUS_01780 2558 1662 gene locus_tag LOCUS_01790 gene yihU 2558 1662 CDS product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099368.1 protein_id gnl|my_center|LOCUS_01790 3229 2555 gene locus_tag LOCUS_01800 3229 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 3149 3541 gene locus_tag LOCUS_01810 3149 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 4305 3553 gene locus_tag LOCUS_01820 4305 3553 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_01820 5666 4398 gene locus_tag LOCUS_01830 5666 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01830 6197 5679 gene locus_tag LOCUS_01840 6197 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01840 7421 6267 gene locus_tag LOCUS_01850 7421 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 7656 7483 gene locus_tag LOCUS_01860 7656 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 8163 10349 gene locus_tag LOCUS_01870 8163 10349 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528128.1 protein_id gnl|my_center|LOCUS_01870 10351 10854 gene locus_tag LOCUS_01880 10351 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 10865 12178 gene locus_tag LOCUS_01890 10865 12178 CDS product acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067244.1 protein_id gnl|my_center|LOCUS_01890 13116 12319 gene locus_tag LOCUS_01900 13116 12319 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208810.1 protein_id gnl|my_center|LOCUS_01900 14313 13144 gene locus_tag LOCUS_01910 14313 13144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 14575 15600 gene locus_tag LOCUS_01920 14575 15600 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243759.1 protein_id gnl|my_center|LOCUS_01920 16620 15622 gene locus_tag LOCUS_01930 16620 15622 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_01930 17404 16637 gene locus_tag LOCUS_01940 17404 16637 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384660.1 protein_id gnl|my_center|LOCUS_01940 18731 17418 gene locus_tag LOCUS_01950 gene hisD 18731 17418 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827738.1 protein_id gnl|my_center|LOCUS_01950 >Feature sequence009 896 510 gene locus_tag LOCUS_01960 gene gcvH 896 510 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098622.1 protein_id gnl|my_center|LOCUS_01960 3832 1214 gene locus_tag LOCUS_01970 gene mgtA 3832 1214 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_01970 4260 3976 gene locus_tag LOCUS_01980 4260 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 4492 5919 gene locus_tag LOCUS_01990 4492 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 6029 7591 gene locus_tag LOCUS_02000 6029 7591 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194074.1 protein_id gnl|my_center|LOCUS_02000 7591 8682 gene locus_tag LOCUS_02010 gene glcE 7591 8682 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_02010 8689 9948 gene locus_tag LOCUS_02020 gene glcF 8689 9948 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 protein_id gnl|my_center|LOCUS_02020 13466 9996 gene locus_tag LOCUS_02030 13466 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 13438 13689 gene locus_tag LOCUS_02040 13438 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 14255 13617 gene locus_tag LOCUS_02050 14255 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 15346 14255 gene locus_tag LOCUS_02060 15346 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 15731 15360 gene locus_tag LOCUS_02070 15731 15360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 16264 15722 gene locus_tag LOCUS_02080 16264 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 16662 16258 gene locus_tag LOCUS_02090 16662 16258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 17784 17023 gene locus_tag LOCUS_02100 17784 17023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 18180 17833 gene locus_tag LOCUS_02110 18180 17833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814593.1 protein_id gnl|my_center|LOCUS_02110 18833 18183 gene locus_tag LOCUS_02120 18833 18183 CDS product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349179.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence010 1247 600 gene locus_tag LOCUS_02130 gene maiA 1247 600 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930265.1 protein_id gnl|my_center|LOCUS_02130 2297 1266 gene locus_tag LOCUS_02140 2297 1266 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855886.1 protein_id gnl|my_center|LOCUS_02140 3319 2318 gene locus_tag LOCUS_02150 3319 2318 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_02150 4627 3350 gene locus_tag LOCUS_02160 4627 3350 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003516526.1 protein_id gnl|my_center|LOCUS_02160 5190 4624 gene locus_tag LOCUS_02170 5190 4624 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974960.1 protein_id gnl|my_center|LOCUS_02170 5740 5201 gene locus_tag LOCUS_02180 5740 5201 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_02180 5858 6760 gene locus_tag LOCUS_02190 5858 6760 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975043.1 protein_id gnl|my_center|LOCUS_02190 6901 7560 gene locus_tag LOCUS_02200 6901 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 7557 8936 gene locus_tag LOCUS_02210 7557 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 8952 9371 gene locus_tag LOCUS_02220 8952 9371 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_02220 9400 10506 gene locus_tag LOCUS_02230 9400 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 10520 11152 gene locus_tag LOCUS_02240 10520 11152 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_02240 11268 12143 gene locus_tag LOCUS_02250 11268 12143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 12227 12484 gene locus_tag LOCUS_02260 12227 12484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 12626 13846 gene locus_tag LOCUS_02270 12626 13846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 13863 15236 gene locus_tag LOCUS_02280 13863 15236 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_02280 15236 15754 gene locus_tag LOCUS_02290 15236 15754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 15751 16509 gene locus_tag LOCUS_02300 15751 16509 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071334.1 protein_id gnl|my_center|LOCUS_02300 16497 17000 gene locus_tag LOCUS_02310 16497 17000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 17982 17008 gene locus_tag LOCUS_02320 17982 17008 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_02320 >Feature sequence011 1751 783 gene locus_tag LOCUS_02330 1751 783 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191272.1 protein_id gnl|my_center|LOCUS_02330 3102 1852 gene locus_tag LOCUS_02340 3102 1852 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_02340 4867 3224 gene locus_tag LOCUS_02350 4867 3224 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_02350 5034 5459 gene locus_tag LOCUS_02360 gene msrB 5034 5459 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_02360 5608 5480 gene locus_tag LOCUS_02370 5608 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018026767.1 protein_id gnl|my_center|LOCUS_02370 5669 6202 gene locus_tag LOCUS_02380 5669 6202 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813872.1 protein_id gnl|my_center|LOCUS_02380 6202 6474 gene locus_tag LOCUS_02390 6202 6474 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813873.1 protein_id gnl|my_center|LOCUS_02390 6539 7330 gene locus_tag LOCUS_02400 6539 7330 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191958.1 protein_id gnl|my_center|LOCUS_02400 7965 7474 gene locus_tag LOCUS_02410 gene tadA 7965 7474 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191221.1 protein_id gnl|my_center|LOCUS_02410 8154 8642 gene locus_tag LOCUS_02420 8154 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 8639 9835 gene locus_tag LOCUS_02430 8639 9835 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970225.1 protein_id gnl|my_center|LOCUS_02430 9841 10143 gene locus_tag LOCUS_02440 9841 10143 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066942.1 protein_id gnl|my_center|LOCUS_02440 10815 10192 gene locus_tag LOCUS_02450 10815 10192 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931020.1 protein_id gnl|my_center|LOCUS_02450 11528 12241 gene locus_tag LOCUS_02460 11528 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 12293 12472 gene locus_tag LOCUS_02470 12293 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 12527 14287 gene locus_tag LOCUS_02480 12527 14287 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037772.1 protein_id gnl|my_center|LOCUS_02480 14593 14315 gene locus_tag LOCUS_02490 14593 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 17306 14763 gene locus_tag LOCUS_02500 17306 14763 CDS product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993482.1 protein_id gnl|my_center|LOCUS_02500 >Feature sequence012 <1 1475 gene locus_tag LOCUS_02510 <1 1475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038412.1:sodium-translocating pyrophosphatase 2209 1532 gene locus_tag LOCUS_02520 2209 1532 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 protein_id gnl|my_center|LOCUS_02520 2350 3114 gene locus_tag LOCUS_02530 2350 3114 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537945.1 protein_id gnl|my_center|LOCUS_02530 4510 3170 gene locus_tag LOCUS_02540 4510 3170 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228924.1 protein_id gnl|my_center|LOCUS_02540 4558 6408 gene locus_tag LOCUS_02550 gene ggt 4558 6408 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814321.1 protein_id gnl|my_center|LOCUS_02550 6703 6987 gene locus_tag LOCUS_02560 6703 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 7065 8072 gene locus_tag LOCUS_02570 gene earP 7065 8072 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064145.1 protein_id gnl|my_center|LOCUS_02570 8212 8736 gene locus_tag LOCUS_02580 gene efp 8212 8736 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_02580 9631 8774 gene locus_tag LOCUS_02590 9631 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 10065 9772 gene locus_tag LOCUS_02600 10065 9772 CDS product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812933.1 protein_id gnl|my_center|LOCUS_02600 10271 11470 gene locus_tag LOCUS_02610 10271 11470 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064106.1 protein_id gnl|my_center|LOCUS_02610 11485 12405 gene locus_tag LOCUS_02620 gene argF 11485 12405 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064107.1 protein_id gnl|my_center|LOCUS_02620 13175 12450 gene locus_tag LOCUS_02630 13175 12450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 14110 13385 gene locus_tag LOCUS_02640 14110 13385 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337653.1 protein_id gnl|my_center|LOCUS_02640 15103 14117 gene locus_tag LOCUS_02650 15103 14117 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965338.1 protein_id gnl|my_center|LOCUS_02650 15802 15227 gene locus_tag LOCUS_02660 15802 15227 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506786.1 protein_id gnl|my_center|LOCUS_02660 15924 16658 gene locus_tag LOCUS_02670 15924 16658 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence013 636 1055 gene locus_tag LOCUS_02680 636 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02680 1119 2177 gene locus_tag LOCUS_02690 gene rtcA 1119 2177 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_02690 3877 2174 gene locus_tag LOCUS_02700 gene glgP 3877 2174 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584150.1 protein_id gnl|my_center|LOCUS_02700 4021 4365 gene locus_tag LOCUS_02710 4021 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 4442 5812 gene locus_tag LOCUS_02720 4442 5812 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_02720 5827 6741 gene locus_tag LOCUS_02730 5827 6741 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_02730 6738 7505 gene locus_tag LOCUS_02740 6738 7505 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_02740 7520 8092 gene locus_tag LOCUS_02750 7520 8092 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947367.1 protein_id gnl|my_center|LOCUS_02750 8128 9330 gene locus_tag LOCUS_02760 8128 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 10658 9372 gene locus_tag LOCUS_02770 gene dctM 10658 9372 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085927.1 protein_id gnl|my_center|LOCUS_02770 11227 10655 gene locus_tag LOCUS_02780 11227 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 12245 11241 gene locus_tag LOCUS_02790 12245 11241 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_02790 13486 12275 gene locus_tag LOCUS_02800 13486 12275 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_02800 14018 13551 gene locus_tag LOCUS_02810 14018 13551 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704690.1 protein_id gnl|my_center|LOCUS_02810 15293 14163 gene locus_tag LOCUS_02820 15293 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 15819 15352 gene locus_tag LOCUS_02830 15819 15352 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094746.1 protein_id gnl|my_center|LOCUS_02830 17066 15864 gene locus_tag LOCUS_02840 17066 15864 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_02840 >Feature sequence014 3 194 gene locus_tag LOCUS_02850 3 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 234 470 gene locus_tag LOCUS_02860 234 470 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_02860 550 840 gene locus_tag LOCUS_02870 550 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 2023 833 gene locus_tag LOCUS_02880 2023 833 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200944.1 protein_id gnl|my_center|LOCUS_02880 2159 3547 gene locus_tag LOCUS_02890 2159 3547 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038211423.1 protein_id gnl|my_center|LOCUS_02890 4018 3557 gene locus_tag LOCUS_02900 4018 3557 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186668.1 protein_id gnl|my_center|LOCUS_02900 4444 4043 gene locus_tag LOCUS_02910 4444 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 5134 4478 gene locus_tag LOCUS_02920 5134 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 5586 5131 gene locus_tag LOCUS_02930 5586 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 7519 5558 gene locus_tag LOCUS_02940 7519 5558 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_02940 9180 7516 gene locus_tag LOCUS_02950 9180 7516 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955347.1 protein_id gnl|my_center|LOCUS_02950 9713 9264 gene locus_tag LOCUS_02960 9713 9264 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972384.1 protein_id gnl|my_center|LOCUS_02960 10902 9754 gene locus_tag LOCUS_02970 10902 9754 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_02970 11004 12143 gene locus_tag LOCUS_02980 11004 12143 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175116.1 protein_id gnl|my_center|LOCUS_02980 12173 12856 gene locus_tag LOCUS_02990 12173 12856 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_02990 13803 12952 gene locus_tag LOCUS_03000 13803 12952 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064297.1 protein_id gnl|my_center|LOCUS_03000 13688 13906 gene locus_tag LOCUS_03010 13688 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 14008 13933 gene locus_tag LOCUS_t00030 14008 13933 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 14816 14145 gene locus_tag LOCUS_03020 gene queC 14816 14145 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463447.1 protein_id gnl|my_center|LOCUS_03020 15601 14816 gene locus_tag LOCUS_03030 gene ybgF 15601 14816 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_03030 16159 15614 gene locus_tag LOCUS_03040 gene pal 16159 15614 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 protein_id gnl|my_center|LOCUS_03040 <16786 16210 gene locus_tag LOCUS_03050 <16786 16210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931417.1:Tol-Pal system beta propeller repeat protein TolB >Feature sequence015 <1 531 gene locus_tag LOCUS_03060 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185672.1:NADH-quinone oxidoreductase subunit J 528 836 gene locus_tag LOCUS_03070 gene nuoK 528 836 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_03070 845 2851 gene locus_tag LOCUS_03080 gene nuoL 845 2851 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813919.1 protein_id gnl|my_center|LOCUS_03080 2876 4357 gene locus_tag LOCUS_03090 2876 4357 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_03090 4364 5839 gene locus_tag LOCUS_03100 gene nuoN 4364 5839 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_03100 5854 6426 gene locus_tag LOCUS_03110 5854 6426 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185716.1 protein_id gnl|my_center|LOCUS_03110 6962 6492 gene locus_tag LOCUS_03120 6962 6492 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809516.1 protein_id gnl|my_center|LOCUS_03120 7264 6962 gene locus_tag LOCUS_03130 7264 6962 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214787.1 protein_id gnl|my_center|LOCUS_03130 7521 7432 gene locus_tag LOCUS_t00040 7521 7432 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7719 8909 gene locus_tag LOCUS_03140 7719 8909 CDS product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525828.1 protein_id gnl|my_center|LOCUS_03140 9011 9991 gene locus_tag LOCUS_03150 9011 9991 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_03150 10904 10044 gene locus_tag LOCUS_03160 10904 10044 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_03160 10975 11712 gene locus_tag LOCUS_03170 10975 11712 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_03170 11721 14276 gene locus_tag LOCUS_03180 11721 14276 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813269.1 protein_id gnl|my_center|LOCUS_03180 14665 14288 gene locus_tag LOCUS_03190 14665 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 >Feature sequence016 <1 1277 gene locus_tag LOCUS_03200 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009936411.1:ABC transporter permease subunit 1289 2584 gene locus_tag LOCUS_03210 1289 2584 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192968.1 protein_id gnl|my_center|LOCUS_03210 2630 3436 gene locus_tag LOCUS_03220 2630 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 3444 4445 gene locus_tag LOCUS_03230 3444 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4442 5173 gene locus_tag LOCUS_03240 4442 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 6499 5195 gene locus_tag LOCUS_03250 6499 5195 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880594.1 protein_id gnl|my_center|LOCUS_03250 7179 6496 gene locus_tag LOCUS_03260 7179 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 7349 8083 gene locus_tag LOCUS_03270 7349 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 8241 8450 gene locus_tag LOCUS_03280 8241 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 8447 8641 gene locus_tag LOCUS_03290 8447 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 8857 9417 gene locus_tag LOCUS_03300 8857 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 9410 9880 gene locus_tag LOCUS_03310 9410 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 9820 10350 gene locus_tag LOCUS_03320 9820 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 10455 10985 gene locus_tag LOCUS_03330 10455 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 13637 11070 gene locus_tag LOCUS_03340 13637 11070 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_03340 14179 13706 gene locus_tag LOCUS_03350 14179 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 14676 14212 gene locus_tag LOCUS_03360 14676 14212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 <15376 14673 gene locus_tag LOCUS_03370 <15376 14673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267928.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence017 1794 397 gene locus_tag LOCUS_03380 1794 397 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_03380 1888 2547 gene locus_tag LOCUS_03390 1888 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173306.1 protein_id gnl|my_center|LOCUS_03390 3927 2557 gene locus_tag LOCUS_03400 3927 2557 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_03400 4261 4031 gene locus_tag LOCUS_03410 4261 4031 CDS product hexameric tyrosine-coordinated heme protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963152.1 protein_id gnl|my_center|LOCUS_03410 4789 4361 gene locus_tag LOCUS_03420 4789 4361 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_03420 4983 5951 gene locus_tag LOCUS_03430 4983 5951 CDS product Na+-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966848.1 protein_id gnl|my_center|LOCUS_03430 6120 7577 gene locus_tag LOCUS_03440 6120 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 7564 8910 gene locus_tag LOCUS_03450 7564 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 9419 8913 gene locus_tag LOCUS_03460 9419 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 9730 9416 gene locus_tag LOCUS_03470 gene soxZ 9730 9416 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932697.1 protein_id gnl|my_center|LOCUS_03470 10204 9758 gene locus_tag LOCUS_03480 10204 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 11178 10261 gene locus_tag LOCUS_03490 gene soxA 11178 10261 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965225.1 protein_id gnl|my_center|LOCUS_03490 11747 11175 gene locus_tag LOCUS_03500 11747 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 13221 11761 gene locus_tag LOCUS_03510 13221 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 13903 13271 gene locus_tag LOCUS_03520 13903 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 14697 13930 gene locus_tag LOCUS_03530 14697 13930 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969401.1 protein_id gnl|my_center|LOCUS_03530 >Feature sequence018 151 1383 gene locus_tag LOCUS_03540 151 1383 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_03540 1402 4527 gene locus_tag LOCUS_03550 1402 4527 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_03550 4524 6050 gene locus_tag LOCUS_03560 4524 6050 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_03560 7189 5954 gene locus_tag LOCUS_03570 7189 5954 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832356.1 protein_id gnl|my_center|LOCUS_03570 7070 8833 gene locus_tag LOCUS_03580 7070 8833 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526341.1 protein_id gnl|my_center|LOCUS_03580 8952 9290 gene locus_tag LOCUS_03590 8952 9290 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193987.1 protein_id gnl|my_center|LOCUS_03590 9981 9322 gene locus_tag LOCUS_03600 9981 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 10071 10676 gene locus_tag LOCUS_03610 10071 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 11405 10734 gene locus_tag LOCUS_03620 11405 10734 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186084.1 protein_id gnl|my_center|LOCUS_03620 12361 11402 gene locus_tag LOCUS_03630 gene trxB 12361 11402 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186294.1 protein_id gnl|my_center|LOCUS_03630 12521 13195 gene locus_tag LOCUS_03640 12521 13195 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_03640 >Feature sequence019 1988 1296 gene locus_tag LOCUS_03650 1988 1296 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815471.1 protein_id gnl|my_center|LOCUS_03650 2110 3339 gene locus_tag LOCUS_03660 2110 3339 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 protein_id gnl|my_center|LOCUS_03660 3381 4433 gene locus_tag LOCUS_03670 3381 4433 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_03670 4462 4983 gene locus_tag LOCUS_03680 4462 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 5036 6319 gene locus_tag LOCUS_03690 5036 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 6352 7539 gene locus_tag LOCUS_03700 6352 7539 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194932.1 protein_id gnl|my_center|LOCUS_03700 8695 7610 gene locus_tag LOCUS_03710 8695 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 9030 10586 gene locus_tag LOCUS_03720 9030 10586 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809435.1 protein_id gnl|my_center|LOCUS_03720 11769 10543 gene locus_tag LOCUS_03730 11769 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 11949 12683 gene locus_tag LOCUS_03740 11949 12683 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041164662.1 protein_id gnl|my_center|LOCUS_03740 13026 12721 gene locus_tag LOCUS_03750 13026 12721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 >Feature sequence020 329 1666 gene locus_tag LOCUS_03760 gene sufD 329 1666 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_03760 1663 2967 gene locus_tag LOCUS_03770 1663 2967 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_03770 2964 3419 gene locus_tag LOCUS_03780 2964 3419 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_03780 3430 4005 gene locus_tag LOCUS_03790 gene sufT 3430 4005 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_03790 5104 4034 gene locus_tag LOCUS_03800 5104 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 5260 6135 gene locus_tag LOCUS_03810 5260 6135 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_03810 6171 6425 gene locus_tag LOCUS_03820 6171 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 6477 7808 gene locus_tag LOCUS_03830 6477 7808 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035275.1 protein_id gnl|my_center|LOCUS_03830 7833 8165 gene locus_tag LOCUS_03840 7833 8165 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693989.1 protein_id gnl|my_center|LOCUS_03840 8315 8542 gene locus_tag LOCUS_03850 8315 8542 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932528.1 protein_id gnl|my_center|LOCUS_03850 8607 9077 gene locus_tag LOCUS_03860 8607 9077 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_03860 9085 9504 gene locus_tag LOCUS_03870 9085 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 9515 10594 gene locus_tag LOCUS_03880 9515 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 11045 10545 gene locus_tag LOCUS_03890 11045 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 11292 11065 gene locus_tag LOCUS_03900 11292 11065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 11944 11315 gene locus_tag LOCUS_03910 11944 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 13431 11968 gene locus_tag LOCUS_03920 13431 11968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence021 2588 447 gene locus_tag LOCUS_03930 gene ligA 2588 447 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_03930 3952 2627 gene locus_tag LOCUS_03940 3952 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 7473 3949 gene locus_tag LOCUS_03950 gene smc 7473 3949 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198894.1 protein_id gnl|my_center|LOCUS_03950 7648 8067 gene locus_tag LOCUS_03960 7648 8067 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_03960 8107 9297 gene locus_tag LOCUS_03970 gene dapC 8107 9297 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448163.1 protein_id gnl|my_center|LOCUS_03970 9313 10134 gene locus_tag LOCUS_03980 gene dapD 9313 10134 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191680.1 protein_id gnl|my_center|LOCUS_03980 10199 11401 gene locus_tag LOCUS_03990 10199 11401 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_03990 11403 11786 gene locus_tag LOCUS_04000 11403 11786 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098220.1 protein_id gnl|my_center|LOCUS_04000 11783 12919 gene locus_tag LOCUS_04010 gene dapE 11783 12919 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521179.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence022 <1 1142 gene locus_tag LOCUS_04020 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812701.1:YihY family inner membrane protein 2055 1222 gene locus_tag LOCUS_04030 2055 1222 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_04030 3401 2097 gene locus_tag LOCUS_04040 3401 2097 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_04040 3667 4788 gene locus_tag LOCUS_04050 3667 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 4800 5195 gene locus_tag LOCUS_04060 4800 5195 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 protein_id gnl|my_center|LOCUS_04060 5192 5671 gene locus_tag LOCUS_04070 5192 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 5675 7066 gene locus_tag LOCUS_04080 5675 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 7080 10595 gene locus_tag LOCUS_04090 7080 10595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 10751 11215 gene locus_tag LOCUS_04100 10751 11215 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 protein_id gnl|my_center|LOCUS_04100 11249 11995 gene locus_tag LOCUS_04110 gene surE 11249 11995 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_04110 12012 12791 gene locus_tag LOCUS_04120 12012 12791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04120 >Feature sequence023 1534 104 gene locus_tag LOCUS_04130 1534 104 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_04130 3858 1534 gene locus_tag LOCUS_04140 3858 1534 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039135.1 protein_id gnl|my_center|LOCUS_04140 3999 5054 gene locus_tag LOCUS_04150 3999 5054 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931410.1 protein_id gnl|my_center|LOCUS_04150 5071 5775 gene locus_tag LOCUS_04160 5071 5775 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927035.1 protein_id gnl|my_center|LOCUS_04160 5788 7188 gene locus_tag LOCUS_04170 5788 7188 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549996.1 protein_id gnl|my_center|LOCUS_04170 7185 8273 gene locus_tag LOCUS_04180 7185 8273 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039175.1 protein_id gnl|my_center|LOCUS_04180 8414 9442 gene locus_tag LOCUS_04190 gene dusB 8414 9442 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_04190 9439 9681 gene locus_tag LOCUS_04200 9439 9681 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_04200 9678 11273 gene locus_tag LOCUS_04210 gene purH 9678 11273 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_04210 11285 11797 gene locus_tag LOCUS_04220 gene ruvC 11285 11797 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_04220 11808 12386 gene locus_tag LOCUS_04230 gene ruvA 11808 12386 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence024 321 719 gene locus_tag LOCUS_04240 321 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 1611 619 gene locus_tag LOCUS_04250 gene dusA 1611 619 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812705.1 protein_id gnl|my_center|LOCUS_04250 1847 2506 gene locus_tag LOCUS_04260 1847 2506 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_04260 3324 2548 gene locus_tag LOCUS_04270 3324 2548 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027324.1 protein_id gnl|my_center|LOCUS_04270 4322 3342 gene locus_tag LOCUS_04280 4322 3342 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814852.1 protein_id gnl|my_center|LOCUS_04280 5664 4405 gene locus_tag LOCUS_04290 5664 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04290 6155 5661 gene locus_tag LOCUS_04300 6155 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 7281 6229 gene locus_tag LOCUS_04310 7281 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 8062 7340 gene locus_tag LOCUS_04320 gene fabG 8062 7340 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_04320 9663 8071 gene locus_tag LOCUS_04330 9663 8071 CDS product acetolactate synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967500.1 protein_id gnl|my_center|LOCUS_04330 9956 11095 gene locus_tag LOCUS_04340 9956 11095 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921512.1 protein_id gnl|my_center|LOCUS_04340 11082 12011 gene locus_tag LOCUS_04350 11082 12011 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040427.1 protein_id gnl|my_center|LOCUS_04350 12137 12565 gene locus_tag LOCUS_04360 gene trxC 12137 12565 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence025 1011 28 gene locus_tag LOCUS_04370 1011 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 1180 1680 gene locus_tag LOCUS_04380 1180 1680 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929804.1 protein_id gnl|my_center|LOCUS_04380 1748 2752 gene locus_tag LOCUS_04390 1748 2752 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_04390 2742 3290 gene locus_tag LOCUS_04400 2742 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 3298 4566 gene locus_tag LOCUS_04410 gene dctM 3298 4566 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_04410 4586 6025 gene locus_tag LOCUS_04420 4586 6025 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_04420 6057 7220 gene locus_tag LOCUS_04430 6057 7220 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225183.1 protein_id gnl|my_center|LOCUS_04430 7217 8407 gene locus_tag LOCUS_04440 7217 8407 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_04440 8404 9168 gene locus_tag LOCUS_04450 8404 9168 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665641.1 protein_id gnl|my_center|LOCUS_04450 9168 10373 gene locus_tag LOCUS_04460 9168 10373 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086066.1 protein_id gnl|my_center|LOCUS_04460 10386 11189 gene locus_tag LOCUS_04470 10386 11189 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925778.1 protein_id gnl|my_center|LOCUS_04470 11186 11887 gene locus_tag LOCUS_04480 11186 11887 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 protein_id gnl|my_center|LOCUS_04480 12282 11902 gene locus_tag LOCUS_04490 12282 11902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence026 555 785 gene locus_tag LOCUS_04500 555 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 1542 1264 gene locus_tag LOCUS_04510 1542 1264 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252128.1 protein_id gnl|my_center|LOCUS_04510 4421 2025 gene locus_tag LOCUS_04520 4421 2025 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_04520 5399 4422 gene locus_tag LOCUS_04530 5399 4422 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892059.1 protein_id gnl|my_center|LOCUS_04530 6397 5396 gene locus_tag LOCUS_04540 6397 5396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_04540 7239 6394 gene locus_tag LOCUS_04550 7239 6394 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173684.1 protein_id gnl|my_center|LOCUS_04550 8230 7232 gene locus_tag LOCUS_04560 8230 7232 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084029.1 protein_id gnl|my_center|LOCUS_04560 9915 8299 gene locus_tag LOCUS_04570 9915 8299 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973036.1 protein_id gnl|my_center|LOCUS_04570 10330 9938 gene locus_tag LOCUS_04580 10330 9938 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036517.1 protein_id gnl|my_center|LOCUS_04580 10598 11188 gene locus_tag LOCUS_04590 10598 11188 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808172.1 protein_id gnl|my_center|LOCUS_04590 11408 11926 gene locus_tag LOCUS_04600 11408 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 12274 11954 gene locus_tag LOCUS_04610 12274 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 >Feature sequence027 <1 729 gene locus_tag LOCUS_04620 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211483.1:phospholipase A 1029 739 gene locus_tag LOCUS_04630 1029 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 1451 1071 gene locus_tag LOCUS_04640 1451 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3155 1632 gene locus_tag LOCUS_04650 3155 1632 CDS product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103141.1 protein_id gnl|my_center|LOCUS_04650 4654 3155 gene locus_tag LOCUS_04660 4654 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 5657 4686 gene locus_tag LOCUS_04670 5657 4686 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150678942.1 protein_id gnl|my_center|LOCUS_04670 5771 5977 gene locus_tag LOCUS_04680 5771 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 8717 5994 gene locus_tag LOCUS_04690 8717 5994 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092687825.1 protein_id gnl|my_center|LOCUS_04690 8938 8717 gene locus_tag LOCUS_04700 8938 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 9386 9018 gene locus_tag LOCUS_04710 9386 9018 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720317.1 protein_id gnl|my_center|LOCUS_04710 11063 9489 gene locus_tag LOCUS_04720 gene pccR 11063 9489 CDS product propionyl-CoA assimilation transcriptional regulator PccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719339.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence028 5 97 gene locus_tag LOCUS_t00050 5 97 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 257 1588 gene locus_tag LOCUS_04730 257 1588 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706186.1 protein_id gnl|my_center|LOCUS_04730 1585 2004 gene locus_tag LOCUS_04740 1585 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2098 2421 gene locus_tag LOCUS_04750 2098 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 2418 2723 gene locus_tag LOCUS_04760 2418 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 2710 3162 gene locus_tag LOCUS_04770 2710 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 3159 3494 gene locus_tag LOCUS_04780 3159 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3487 5664 gene locus_tag LOCUS_04790 3487 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 6041 6532 gene locus_tag LOCUS_04800 6041 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 6529 6708 gene locus_tag LOCUS_04810 6529 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 6699 7091 gene locus_tag LOCUS_04820 6699 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 7088 8068 gene locus_tag LOCUS_04830 7088 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 8071 8295 gene locus_tag LOCUS_04840 8071 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 8292 8522 gene locus_tag LOCUS_04850 8292 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 8853 8497 gene locus_tag LOCUS_04860 8853 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 9208 10386 gene locus_tag LOCUS_04870 9208 10386 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804023.1 protein_id gnl|my_center|LOCUS_04870 10562 11989 gene locus_tag LOCUS_04880 10562 11989 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665631.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence029 381 1151 gene locus_tag LOCUS_04890 381 1151 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_04890 1571 1176 gene locus_tag LOCUS_04900 1571 1176 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821377.1 protein_id gnl|my_center|LOCUS_04900 2425 1610 gene locus_tag LOCUS_04910 2425 1610 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 protein_id gnl|my_center|LOCUS_04910 4351 2429 gene locus_tag LOCUS_04920 4351 2429 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 protein_id gnl|my_center|LOCUS_04920 4939 4616 gene locus_tag LOCUS_04930 4939 4616 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813757.1 protein_id gnl|my_center|LOCUS_04930 5109 6158 gene locus_tag LOCUS_04940 5109 6158 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_04940 6542 6192 gene locus_tag LOCUS_04950 6542 6192 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036517.1 protein_id gnl|my_center|LOCUS_04950 7411 6539 gene locus_tag LOCUS_04960 7411 6539 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832186.1 protein_id gnl|my_center|LOCUS_04960 10793 7944 gene locus_tag LOCUS_04970 10793 7944 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039712.1 protein_id gnl|my_center|LOCUS_04970 11672 10875 gene locus_tag LOCUS_04980 11672 10875 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816840.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence030 140 1777 gene locus_tag LOCUS_04990 140 1777 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_04990 1774 2727 gene locus_tag LOCUS_05000 1774 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 4669 2675 gene locus_tag LOCUS_05010 4669 2675 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300896.1 protein_id gnl|my_center|LOCUS_05010 4826 5338 gene locus_tag LOCUS_05020 4826 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 5374 6621 gene locus_tag LOCUS_05030 5374 6621 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 protein_id gnl|my_center|LOCUS_05030 6757 7416 gene locus_tag LOCUS_05040 6757 7416 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203514.1 protein_id gnl|my_center|LOCUS_05040 7434 8207 gene locus_tag LOCUS_05050 7434 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706124.1 protein_id gnl|my_center|LOCUS_05050 8210 9595 gene locus_tag LOCUS_05060 8210 9595 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038811.1 protein_id gnl|my_center|LOCUS_05060 11351 9582 gene locus_tag LOCUS_05070 11351 9582 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447544.1 protein_id gnl|my_center|LOCUS_05070 <12125 11374 gene locus_tag LOCUS_05080 <12125 11374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942182.1:exodeoxyribonuclease V subunit alpha >Feature sequence031 95 442 gene locus_tag LOCUS_05090 gene erpA 95 442 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_05090 1591 443 gene locus_tag LOCUS_05100 1591 443 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814881.1 protein_id gnl|my_center|LOCUS_05100 2957 1617 gene locus_tag LOCUS_05110 2957 1617 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814879.1 protein_id gnl|my_center|LOCUS_05110 3133 4416 gene locus_tag LOCUS_05120 gene tyrS 3133 4416 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814877.1 protein_id gnl|my_center|LOCUS_05120 4504 5142 gene locus_tag LOCUS_05130 4504 5142 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_05130 5139 5897 gene locus_tag LOCUS_05140 5139 5897 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_05140 5903 7147 gene locus_tag LOCUS_05150 5903 7147 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_05150 7570 7184 gene locus_tag LOCUS_05160 7570 7184 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_05160 7845 7606 gene locus_tag LOCUS_05170 7845 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 7988 8452 gene locus_tag LOCUS_05180 gene nrdR 7988 8452 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185666.1 protein_id gnl|my_center|LOCUS_05180 10291 8576 gene locus_tag LOCUS_05190 10291 8576 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205307.1 protein_id gnl|my_center|LOCUS_05190 10392 11492 gene locus_tag LOCUS_05200 gene ribD 10392 11492 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527563.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence032 514 53 gene locus_tag LOCUS_05210 514 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1587 577 gene locus_tag LOCUS_05220 1587 577 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038553.1 protein_id gnl|my_center|LOCUS_05220 3209 1773 gene locus_tag LOCUS_05230 3209 1773 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_05230 4787 3243 gene locus_tag LOCUS_05240 4787 3243 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040261.1 protein_id gnl|my_center|LOCUS_05240 5902 4784 gene locus_tag LOCUS_05250 5902 4784 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389543.1 protein_id gnl|my_center|LOCUS_05250 7050 5908 gene locus_tag LOCUS_05260 7050 5908 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391776.1 protein_id gnl|my_center|LOCUS_05260 8849 7074 gene locus_tag LOCUS_05270 8849 7074 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996091.1 protein_id gnl|my_center|LOCUS_05270 9879 8851 gene locus_tag LOCUS_05280 gene hlyD 9879 8851 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097481.1 protein_id gnl|my_center|LOCUS_05280 10484 9876 gene locus_tag LOCUS_05290 gene slmA 10484 9876 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918350.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence033 777 1715 gene locus_tag LOCUS_05300 777 1715 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 protein_id gnl|my_center|LOCUS_05300 1712 2971 gene locus_tag LOCUS_05310 1712 2971 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039217.1 protein_id gnl|my_center|LOCUS_05310 2968 3381 gene locus_tag LOCUS_05320 gene arfB 2968 3381 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 protein_id gnl|my_center|LOCUS_05320 3530 3724 gene locus_tag LOCUS_05330 3530 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4946 3756 gene locus_tag LOCUS_05340 4946 3756 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_05340 5437 4949 gene locus_tag LOCUS_05350 5437 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 6055 5498 gene locus_tag LOCUS_05360 6055 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 7150 6128 gene locus_tag LOCUS_05370 gene murB 7150 6128 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106928.1 protein_id gnl|my_center|LOCUS_05370 8036 7164 gene locus_tag LOCUS_05380 8036 7164 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_05380 8221 8033 gene locus_tag LOCUS_05390 8221 8033 CDS product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815055.1 protein_id gnl|my_center|LOCUS_05390 9935 8259 gene locus_tag LOCUS_05400 gene sulP 9935 8259 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_05400 <12021 9932 gene locus_tag LOCUS_05410 <12021 9932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004538477.1:methionine--tRNA ligase >Feature sequence034 <1 500 gene locus_tag LOCUS_05420 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389922.1:electron transfer flavoprotein subunit beta/FixA family protein 497 1588 gene locus_tag LOCUS_05430 497 1588 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389921.1 protein_id gnl|my_center|LOCUS_05430 1605 2903 gene locus_tag LOCUS_05440 1605 2903 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389920.1 protein_id gnl|my_center|LOCUS_05440 2900 3190 gene locus_tag LOCUS_05450 2900 3190 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389919.1 protein_id gnl|my_center|LOCUS_05450 4441 3218 gene locus_tag LOCUS_05460 gene ald 4441 3218 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084547.1 protein_id gnl|my_center|LOCUS_05460 4468 5460 gene locus_tag LOCUS_05470 4468 5460 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_05470 5596 6048 gene locus_tag LOCUS_05480 5596 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 7111 6068 gene locus_tag LOCUS_05490 7111 6068 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877593.1 protein_id gnl|my_center|LOCUS_05490 8058 7108 gene locus_tag LOCUS_05500 8058 7108 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057859.1 protein_id gnl|my_center|LOCUS_05500 9064 8033 gene locus_tag LOCUS_05510 9064 8033 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_05510 10043 9090 gene locus_tag LOCUS_05520 10043 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 10899 10111 gene locus_tag LOCUS_05530 10899 10111 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence035 842 264 gene locus_tag LOCUS_05540 842 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085577.1 protein_id gnl|my_center|LOCUS_05540 1046 2533 gene locus_tag LOCUS_05550 1046 2533 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_05550 3428 2538 gene locus_tag LOCUS_05560 gene gluQRS 3428 2538 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064768.1 protein_id gnl|my_center|LOCUS_05560 4294 3455 gene locus_tag LOCUS_05570 4294 3455 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815269.1 protein_id gnl|my_center|LOCUS_05570 5216 4305 gene locus_tag LOCUS_05580 5216 4305 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869481.1 protein_id gnl|my_center|LOCUS_05580 5246 8728 gene locus_tag LOCUS_05590 gene dnaE 5246 8728 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813231.1 protein_id gnl|my_center|LOCUS_05590 8725 10497 gene locus_tag LOCUS_05600 gene msbA 8725 10497 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186431.1 protein_id gnl|my_center|LOCUS_05600 10512 11096 gene locus_tag LOCUS_05610 10512 11096 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 protein_id gnl|my_center|LOCUS_05610 11115 11471 gene locus_tag LOCUS_05620 11115 11471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202812.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence036 <1 1598 gene locus_tag LOCUS_05630 <1 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931522.1:ribonuclease R 1629 2366 gene locus_tag LOCUS_05640 gene rlmB 1629 2366 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812973.1 protein_id gnl|my_center|LOCUS_05640 2363 3115 gene locus_tag LOCUS_05650 2363 3115 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112491.1 protein_id gnl|my_center|LOCUS_05650 3560 3135 gene locus_tag LOCUS_05660 3560 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3583 3909 gene locus_tag LOCUS_05670 3583 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 3912 4358 gene locus_tag LOCUS_05680 3912 4358 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187137.1 protein_id gnl|my_center|LOCUS_05680 4761 4258 gene locus_tag LOCUS_05690 4761 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 5166 4789 gene locus_tag LOCUS_05700 5166 4789 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185460.1 protein_id gnl|my_center|LOCUS_05700 5521 5204 gene locus_tag LOCUS_05710 5521 5204 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200395.1 protein_id gnl|my_center|LOCUS_05710 6003 5560 gene locus_tag LOCUS_05720 6003 5560 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_05720 7394 6063 gene locus_tag LOCUS_05730 7394 6063 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 protein_id gnl|my_center|LOCUS_05730 7690 8304 gene locus_tag LOCUS_05740 gene fnr 7690 8304 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358997.1 protein_id gnl|my_center|LOCUS_05740 10549 8351 gene locus_tag LOCUS_05750 10549 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 11262 10546 gene locus_tag LOCUS_05760 11262 10546 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence037 311 1159 gene locus_tag LOCUS_05770 gene napH 311 1159 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013528.1 protein_id gnl|my_center|LOCUS_05770 1677 1438 gene locus_tag LOCUS_05780 1677 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 1958 2161 gene locus_tag LOCUS_05790 1958 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 2655 3437 gene locus_tag LOCUS_05800 2655 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3439 4770 gene locus_tag LOCUS_05810 3439 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 6258 5098 gene locus_tag LOCUS_05820 6258 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 9199 7346 gene locus_tag LOCUS_05830 gene glmS 9199 7346 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035815.1 protein_id gnl|my_center|LOCUS_05830 10595 9228 gene locus_tag LOCUS_05840 gene glmU 10595 9228 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531007.1 protein_id gnl|my_center|LOCUS_05840 <11704 10710 gene locus_tag LOCUS_05850 <11704 10710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121872.1:sodium:solute symporter family protein >Feature sequence038 884 399 gene locus_tag LOCUS_05860 884 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 1459 881 gene locus_tag LOCUS_05870 1459 881 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810192.1 protein_id gnl|my_center|LOCUS_05870 2268 1570 gene locus_tag LOCUS_05880 2268 1570 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810191.1 protein_id gnl|my_center|LOCUS_05880 2396 3334 gene locus_tag LOCUS_05890 2396 3334 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_05890 3355 3687 gene locus_tag LOCUS_05900 3355 3687 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114963.1 protein_id gnl|my_center|LOCUS_05900 3716 4993 gene locus_tag LOCUS_05910 3716 4993 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395366.1 protein_id gnl|my_center|LOCUS_05910 7218 4951 gene locus_tag LOCUS_05920 7218 4951 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815335.1 protein_id gnl|my_center|LOCUS_05920 8633 7545 gene locus_tag LOCUS_05930 gene hemE 8633 7545 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524502.1 protein_id gnl|my_center|LOCUS_05930 9333 8644 gene locus_tag LOCUS_05940 9333 8644 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073551.1 protein_id gnl|my_center|LOCUS_05940 10233 9385 gene locus_tag LOCUS_05950 10233 9385 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194102.1 protein_id gnl|my_center|LOCUS_05950 10592 10323 gene locus_tag LOCUS_05960 10592 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 >Feature sequence039 <1 1442 gene locus_tag LOCUS_05970 <1 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527965.1:indolepyruvate oxidoreductase subunit beta family protein 1499 1780 gene locus_tag LOCUS_05980 1499 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05980 1814 2530 gene locus_tag LOCUS_05990 1814 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05990 2630 3133 gene locus_tag LOCUS_06000 2630 3133 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090564.1 protein_id gnl|my_center|LOCUS_06000 3162 4424 gene locus_tag LOCUS_06010 3162 4424 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_06010 5889 4435 gene locus_tag LOCUS_06020 5889 4435 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 protein_id gnl|my_center|LOCUS_06020 5980 6525 gene locus_tag LOCUS_06030 5980 6525 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084450.1 protein_id gnl|my_center|LOCUS_06030 7254 6586 gene locus_tag LOCUS_06040 7254 6586 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201020.1 protein_id gnl|my_center|LOCUS_06040 7426 8313 gene locus_tag LOCUS_06050 7426 8313 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529276.1 protein_id gnl|my_center|LOCUS_06050 8328 10001 gene locus_tag LOCUS_06060 8328 10001 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083806.1 protein_id gnl|my_center|LOCUS_06060 10055 11203 gene locus_tag LOCUS_06070 10055 11203 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965217.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence040 71 1285 gene locus_tag LOCUS_06080 71 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 2220 1231 gene locus_tag LOCUS_06090 2220 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 2349 3635 gene locus_tag LOCUS_06100 2349 3635 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163651105.1 protein_id gnl|my_center|LOCUS_06100 3648 4415 gene locus_tag LOCUS_06110 3648 4415 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_06110 4412 5644 gene locus_tag LOCUS_06120 4412 5644 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971979.1 protein_id gnl|my_center|LOCUS_06120 5641 6366 gene locus_tag LOCUS_06130 5641 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6378 7643 gene locus_tag LOCUS_06140 6378 7643 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_06140 7640 8224 gene locus_tag LOCUS_06150 7640 8224 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407549.1 protein_id gnl|my_center|LOCUS_06150 8233 9063 gene locus_tag LOCUS_06160 8233 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 9080 9523 gene locus_tag LOCUS_06170 9080 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 9591 10094 gene locus_tag LOCUS_06180 gene rfaE2 9591 10094 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686901.1 protein_id gnl|my_center|LOCUS_06180 10995 10147 gene locus_tag LOCUS_06190 10995 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 11291 11010 gene locus_tag LOCUS_06200 11291 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence041 503 1042 gene locus_tag LOCUS_06210 503 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1048 2040 gene locus_tag LOCUS_06220 gene glk 1048 2040 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087427.1 protein_id gnl|my_center|LOCUS_06220 3050 2037 gene locus_tag LOCUS_06230 3050 2037 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114438.1 protein_id gnl|my_center|LOCUS_06230 4122 3178 gene locus_tag LOCUS_06240 4122 3178 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258947.1 protein_id gnl|my_center|LOCUS_06240 4134 5420 gene locus_tag LOCUS_06250 4134 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 5557 6057 gene locus_tag LOCUS_06260 5557 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 6101 8488 gene locus_tag LOCUS_06270 6101 8488 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555925.1 protein_id gnl|my_center|LOCUS_06270 9340 8537 gene locus_tag LOCUS_06280 9340 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 10305 9337 gene locus_tag LOCUS_06290 10305 9337 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812707.1 protein_id gnl|my_center|LOCUS_06290 <11064 10323 gene locus_tag LOCUS_06300 <11064 10323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530319.1:TIGR00730 family Rossman fold protein >Feature sequence042 140 213 gene locus_tag LOCUS_t00060 140 213 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 344 1528 gene locus_tag LOCUS_06310 344 1528 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088694.1 protein_id gnl|my_center|LOCUS_06310 1565 2431 gene locus_tag LOCUS_06320 1565 2431 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088693.1 protein_id gnl|my_center|LOCUS_06320 2428 3399 gene locus_tag LOCUS_06330 2428 3399 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088692.1 protein_id gnl|my_center|LOCUS_06330 3396 4151 gene locus_tag LOCUS_06340 3396 4151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088691.1 protein_id gnl|my_center|LOCUS_06340 4144 4902 gene locus_tag LOCUS_06350 4144 4902 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088690.1 protein_id gnl|my_center|LOCUS_06350 4960 6975 gene locus_tag LOCUS_06360 4960 6975 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_06360 7072 6988 gene locus_tag LOCUS_t00070 7072 6988 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7515 7099 gene locus_tag LOCUS_06370 7515 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 7915 7502 gene locus_tag LOCUS_06380 7915 7502 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065983.1 protein_id gnl|my_center|LOCUS_06380 9160 7949 gene locus_tag LOCUS_06390 9160 7949 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925781.1 protein_id gnl|my_center|LOCUS_06390 9843 9169 gene locus_tag LOCUS_06400 9843 9169 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 protein_id gnl|my_center|LOCUS_06400 9893 10570 gene locus_tag LOCUS_06410 9893 10570 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_06410 >Feature sequence043 <1 835 gene locus_tag LOCUS_06420 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258386.1:universal stress protein 2173 854 gene locus_tag LOCUS_06430 2173 854 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_06430 3155 2193 gene locus_tag LOCUS_06440 3155 2193 CDS product Bug family tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930661.1 protein_id gnl|my_center|LOCUS_06440 3265 4062 gene locus_tag LOCUS_06450 3265 4062 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973988.1 protein_id gnl|my_center|LOCUS_06450 4059 5255 gene locus_tag LOCUS_06460 4059 5255 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_06460 6042 5272 gene locus_tag LOCUS_06470 6042 5272 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 protein_id gnl|my_center|LOCUS_06470 7328 6018 gene locus_tag LOCUS_06480 7328 6018 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243031.1 protein_id gnl|my_center|LOCUS_06480 7861 7325 gene locus_tag LOCUS_06490 7861 7325 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339251.1 protein_id gnl|my_center|LOCUS_06490 8964 7858 gene locus_tag LOCUS_06500 8964 7858 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082910123.1 protein_id gnl|my_center|LOCUS_06500 9204 10871 gene locus_tag LOCUS_06510 9204 10871 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061781.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence044 394 1194 gene locus_tag LOCUS_06520 394 1194 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804973.1 protein_id gnl|my_center|LOCUS_06520 1191 2039 gene locus_tag LOCUS_06530 gene metF 1191 2039 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_06530 2182 3825 gene locus_tag LOCUS_06540 2182 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 4426 3812 gene locus_tag LOCUS_06550 4426 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 4476 6437 gene locus_tag LOCUS_06560 4476 6437 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197235.1 protein_id gnl|my_center|LOCUS_06560 6448 7413 gene locus_tag LOCUS_06570 6448 7413 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_06570 7448 8683 gene locus_tag LOCUS_06580 7448 8683 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525896.1 protein_id gnl|my_center|LOCUS_06580 8880 8686 gene locus_tag LOCUS_06590 8880 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 10086 8893 gene locus_tag LOCUS_06600 10086 8893 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_06600 <10795 10115 gene locus_tag LOCUS_06610 <10795 10115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707863.1:acyltransferase >Feature sequence045 31 540 gene locus_tag LOCUS_06620 31 540 CDS product hydrogenase/oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528368.1 protein_id gnl|my_center|LOCUS_06620 1723 578 gene locus_tag LOCUS_06630 1723 578 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929834.1 protein_id gnl|my_center|LOCUS_06630 3309 1828 gene locus_tag LOCUS_06640 gene glpK 3309 1828 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_06640 3460 4878 gene locus_tag LOCUS_06650 3460 4878 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198974.1 protein_id gnl|my_center|LOCUS_06650 7036 4901 gene locus_tag LOCUS_06660 gene ppk1 7036 4901 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521820.1 protein_id gnl|my_center|LOCUS_06660 7139 8638 gene locus_tag LOCUS_06670 gene ppx 7139 8638 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_06670 9180 8680 gene locus_tag LOCUS_06680 gene sixA 9180 8680 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_06680 9540 9241 gene locus_tag LOCUS_06690 9540 9241 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_06690 10056 9559 gene locus_tag LOCUS_06700 gene coaD 10056 9559 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195249.1 protein_id gnl|my_center|LOCUS_06700 <10737 10059 gene locus_tag LOCUS_06710 <10737 10059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195251.1:16S rRNA (guanine(966)-N(2))-methyltransferase RsmD >Feature sequence046 57 839 gene locus_tag LOCUS_06720 57 839 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812687.1 protein_id gnl|my_center|LOCUS_06720 861 2270 gene locus_tag LOCUS_06730 gene leuC 861 2270 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_06730 2289 2420 gene locus_tag LOCUS_06740 2289 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 2442 3095 gene locus_tag LOCUS_06750 gene leuD 2442 3095 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187882.1 protein_id gnl|my_center|LOCUS_06750 3202 4266 gene locus_tag LOCUS_06760 gene leuB 3202 4266 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 protein_id gnl|my_center|LOCUS_06760 4313 5434 gene locus_tag LOCUS_06770 gene asd 4313 5434 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188178.1 protein_id gnl|my_center|LOCUS_06770 5655 8549 gene locus_tag LOCUS_06780 5655 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 8609 9397 gene locus_tag LOCUS_06790 gene truA 8609 9397 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930384.1 protein_id gnl|my_center|LOCUS_06790 9394 10146 gene locus_tag LOCUS_06800 9394 10146 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528978.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence047 1087 428 gene locus_tag LOCUS_06810 1087 428 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_06810 2001 1084 gene locus_tag LOCUS_06820 2001 1084 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193008.1 protein_id gnl|my_center|LOCUS_06820 2984 1998 gene locus_tag LOCUS_06830 2984 1998 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_06830 3029 4696 gene locus_tag LOCUS_06840 3029 4696 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040198.1 protein_id gnl|my_center|LOCUS_06840 4836 5366 gene locus_tag LOCUS_06850 4836 5366 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337845.1 protein_id gnl|my_center|LOCUS_06850 5366 6289 gene locus_tag LOCUS_06860 gene hslO 5366 6289 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550203.1 protein_id gnl|my_center|LOCUS_06860 6703 6365 gene locus_tag LOCUS_06870 gene ftsB 6703 6365 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065137.1 protein_id gnl|my_center|LOCUS_06870 8027 6744 gene locus_tag LOCUS_06880 gene eno 8027 6744 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065136.1 protein_id gnl|my_center|LOCUS_06880 8323 8024 gene locus_tag LOCUS_06890 8323 8024 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206410.1 protein_id gnl|my_center|LOCUS_06890 9197 8340 gene locus_tag LOCUS_06900 gene kdsA 9197 8340 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065134.1 protein_id gnl|my_center|LOCUS_06900 <10582 9209 gene locus_tag LOCUS_06910 <10582 9209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813705.1:CTP synthase >Feature sequence048 478 1569 gene locus_tag LOCUS_06920 gene cbbX 478 1569 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969558.1 protein_id gnl|my_center|LOCUS_06920 1566 2603 gene locus_tag LOCUS_06930 1566 2603 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_06930 2626 3501 gene locus_tag LOCUS_06940 2626 3501 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_06940 4044 3532 gene locus_tag LOCUS_06950 4044 3532 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918920.1 protein_id gnl|my_center|LOCUS_06950 4699 4088 gene locus_tag LOCUS_06960 4699 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 5549 4740 gene locus_tag LOCUS_06970 5549 4740 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966630.1 protein_id gnl|my_center|LOCUS_06970 6105 5599 gene locus_tag LOCUS_06980 6105 5599 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_06980 6289 6618 gene locus_tag LOCUS_06990 6289 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 7990 6638 gene locus_tag LOCUS_07000 7990 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 8501 8004 gene locus_tag LOCUS_07010 8501 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 8598 9500 gene locus_tag LOCUS_07020 8598 9500 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 protein_id gnl|my_center|LOCUS_07020 10180 9488 gene locus_tag LOCUS_07030 10180 9488 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence049 1294 653 gene locus_tag LOCUS_07040 1294 653 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531468.1 protein_id gnl|my_center|LOCUS_07040 1366 2502 gene locus_tag LOCUS_07050 1366 2502 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294607.1 protein_id gnl|my_center|LOCUS_07050 2499 3269 gene locus_tag LOCUS_07060 2499 3269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_07060 3259 4227 gene locus_tag LOCUS_07070 3259 4227 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771786.1 protein_id gnl|my_center|LOCUS_07070 4224 4925 gene locus_tag LOCUS_07080 4224 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 5229 4885 gene locus_tag LOCUS_07090 5229 4885 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_07090 5689 5258 gene locus_tag LOCUS_07100 5689 5258 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_07100 6282 5686 gene locus_tag LOCUS_07110 6282 5686 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186908.1 protein_id gnl|my_center|LOCUS_07110 6635 6315 gene locus_tag LOCUS_07120 gene grxD 6635 6315 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807622.1 protein_id gnl|my_center|LOCUS_07120 7640 6720 gene locus_tag LOCUS_07130 gene prmC 7640 6720 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186904.1 protein_id gnl|my_center|LOCUS_07130 8710 7637 gene locus_tag LOCUS_07140 gene prfA 8710 7637 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186862.1 protein_id gnl|my_center|LOCUS_07140 10053 8734 gene locus_tag LOCUS_07150 gene hemA 10053 8734 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807616.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence050 1212 349 gene locus_tag LOCUS_07160 1212 349 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971611.1 protein_id gnl|my_center|LOCUS_07160 1458 2267 gene locus_tag LOCUS_07170 1458 2267 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090568.1 protein_id gnl|my_center|LOCUS_07170 2264 4114 gene locus_tag LOCUS_07180 2264 4114 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267921.1 protein_id gnl|my_center|LOCUS_07180 4152 5288 gene locus_tag LOCUS_07190 4152 5288 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 protein_id gnl|my_center|LOCUS_07190 5329 6366 gene locus_tag LOCUS_07200 5329 6366 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813866.1 protein_id gnl|my_center|LOCUS_07200 6371 8182 gene locus_tag LOCUS_07210 6371 8182 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530467.1 protein_id gnl|my_center|LOCUS_07210 8193 8939 gene locus_tag LOCUS_07220 8193 8939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090558.1 protein_id gnl|my_center|LOCUS_07220 8936 9421 gene locus_tag LOCUS_07230 8936 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 <10369 9443 gene locus_tag LOCUS_07240 <10369 9443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975113.1:ATP-binding protein >Feature sequence051 1282 365 gene locus_tag LOCUS_07250 1282 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 1697 1290 gene locus_tag LOCUS_07260 1697 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 3595 1886 gene locus_tag LOCUS_07270 3595 1886 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_07270 3737 4858 gene locus_tag LOCUS_07280 3737 4858 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088689.1 protein_id gnl|my_center|LOCUS_07280 4992 5546 gene locus_tag LOCUS_07290 4992 5546 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079074.1 protein_id gnl|my_center|LOCUS_07290 6597 5584 gene locus_tag LOCUS_07300 6597 5584 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_07300 6821 7165 gene locus_tag LOCUS_07310 6821 7165 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205776.1 protein_id gnl|my_center|LOCUS_07310 7199 8851 gene locus_tag LOCUS_07320 7199 8851 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_07320 8841 9434 gene locus_tag LOCUS_07330 8841 9434 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403102.1 protein_id gnl|my_center|LOCUS_07330 9478 10083 gene locus_tag LOCUS_07340 9478 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence052 353 592 gene locus_tag LOCUS_07350 353 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 1049 1219 gene locus_tag LOCUS_07360 1049 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1615 3204 gene locus_tag LOCUS_07370 1615 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 3221 3694 gene locus_tag LOCUS_07380 3221 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3691 4896 gene locus_tag LOCUS_07390 3691 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 5258 5614 gene locus_tag LOCUS_07400 5258 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 5656 7323 gene locus_tag LOCUS_07410 5656 7323 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198453.1 protein_id gnl|my_center|LOCUS_07410 7507 7809 gene locus_tag LOCUS_07420 7507 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 8319 8038 gene locus_tag LOCUS_07430 8319 8038 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556002.1 protein_id gnl|my_center|LOCUS_07430 8570 8316 gene locus_tag LOCUS_07440 8570 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 8575 8898 gene locus_tag LOCUS_07450 8575 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 8927 9232 gene locus_tag LOCUS_07460 8927 9232 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_07460 9234 9617 gene locus_tag LOCUS_07470 9234 9617 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence053 487 1053 gene locus_tag LOCUS_07480 487 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1050 2072 gene locus_tag LOCUS_07490 gene holA 1050 2072 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_07490 2074 3357 gene locus_tag LOCUS_07500 2074 3357 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_07500 3361 3783 gene locus_tag LOCUS_07510 3361 3783 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531998.1 protein_id gnl|my_center|LOCUS_07510 3783 5051 gene locus_tag LOCUS_07520 3783 5051 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194083.1 protein_id gnl|my_center|LOCUS_07520 5379 4990 gene locus_tag LOCUS_07530 5379 4990 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_07530 6278 5376 gene locus_tag LOCUS_07540 6278 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 7344 6268 gene locus_tag LOCUS_07550 7344 6268 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405967.1 protein_id gnl|my_center|LOCUS_07550 7636 7857 gene locus_tag LOCUS_07560 gene infA 7636 7857 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809486.1 protein_id gnl|my_center|LOCUS_07560 9051 7918 gene locus_tag LOCUS_07570 gene pilU 9051 7918 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_07570 <10153 9206 gene locus_tag LOCUS_07580 <10153 9206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003084552.1:type IV pilus twitching motility protein PilT >Feature sequence054 978 166 gene locus_tag LOCUS_07590 978 166 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_07590 1669 1091 gene locus_tag LOCUS_07600 1669 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07600 1944 1600 gene locus_tag LOCUS_07610 1944 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 2919 2002 gene locus_tag LOCUS_07620 2919 2002 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082021145.1 protein_id gnl|my_center|LOCUS_07620 3698 3018 gene locus_tag LOCUS_07630 3698 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 7320 3691 gene locus_tag LOCUS_07640 7320 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 9162 8677 gene locus_tag LOCUS_07650 9162 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 <10134 9446 gene locus_tag LOCUS_07660 <10134 9446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000846383.1:DUF2779 domain-containing protein >Feature sequence055 503 1360 gene locus_tag LOCUS_07670 503 1360 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_07670 1380 1898 gene locus_tag LOCUS_07680 1380 1898 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879943.1 protein_id gnl|my_center|LOCUS_07680 2851 1970 gene locus_tag LOCUS_07690 2851 1970 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119903.1 protein_id gnl|my_center|LOCUS_07690 3535 2951 gene locus_tag LOCUS_07700 3535 2951 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 protein_id gnl|my_center|LOCUS_07700 3931 3539 gene locus_tag LOCUS_07710 3931 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4181 5110 gene locus_tag LOCUS_07720 4181 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5107 6111 gene locus_tag LOCUS_07730 5107 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 6155 6664 gene locus_tag LOCUS_07740 6155 6664 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929250.1 protein_id gnl|my_center|LOCUS_07740 7528 6674 gene locus_tag LOCUS_07750 7528 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 7598 8188 gene locus_tag LOCUS_07760 7598 8188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 8618 8253 gene locus_tag LOCUS_07770 8618 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 9111 8584 gene locus_tag LOCUS_07780 9111 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 9244 9735 gene locus_tag LOCUS_07790 9244 9735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 9862 9704 gene locus_tag LOCUS_07800 9862 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence056 1942 401 gene locus_tag LOCUS_07810 1942 401 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_07810 2677 1946 gene locus_tag LOCUS_07820 gene dsrM 2677 1946 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_07820 3091 2756 gene locus_tag LOCUS_07830 3091 2756 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_07830 3433 3137 gene locus_tag LOCUS_07840 gene tusB 3433 3137 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_07840 3815 3450 gene locus_tag LOCUS_07850 gene tusC 3815 3450 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_07850 4183 3824 gene locus_tag LOCUS_07860 gene tusD 4183 3824 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_07860 5307 4198 gene locus_tag LOCUS_07870 gene dsrB 5307 4198 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_07870 6660 5365 gene locus_tag LOCUS_07880 gene dsrA 6660 5365 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_07880 6786 7112 gene locus_tag LOCUS_07890 6786 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 7109 7750 gene locus_tag LOCUS_07900 7109 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 7794 8282 gene locus_tag LOCUS_07910 7794 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 8328 8927 gene locus_tag LOCUS_07920 8328 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 8931 9893 gene locus_tag LOCUS_07930 8931 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence057 <1 1205 gene locus_tag LOCUS_07940 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039151.1:DNA mismatch repair endonuclease MutL 1209 2498 gene locus_tag LOCUS_07950 1209 2498 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223726.1 protein_id gnl|my_center|LOCUS_07950 2498 3493 gene locus_tag LOCUS_07960 gene miaA 2498 3493 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814337.1 protein_id gnl|my_center|LOCUS_07960 7433 3507 gene locus_tag LOCUS_07970 7433 3507 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204931.1 protein_id gnl|my_center|LOCUS_07970 9232 7433 gene locus_tag LOCUS_07980 9232 7433 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_07980 <10054 9255 gene locus_tag LOCUS_07990 <10054 9255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194386.1:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence058 5155 1142 gene locus_tag LOCUS_08000 5155 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 6048 5491 gene locus_tag LOCUS_08010 gene ampD 6048 5491 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194313.1 protein_id gnl|my_center|LOCUS_08010 7532 6048 gene locus_tag LOCUS_08020 gene pilR 7532 6048 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_08020 9176 7536 gene locus_tag LOCUS_08030 gene pilS 9176 7536 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_08030 9478 9173 gene locus_tag LOCUS_08040 9478 9173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence059 311 1477 gene locus_tag LOCUS_08050 311 1477 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_08050 1474 2670 gene locus_tag LOCUS_08060 1474 2670 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_08060 2667 5012 gene locus_tag LOCUS_08070 2667 5012 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776827.1 protein_id gnl|my_center|LOCUS_08070 6383 5025 gene locus_tag LOCUS_08080 6383 5025 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195503.1 protein_id gnl|my_center|LOCUS_08080 7093 6380 gene locus_tag LOCUS_08090 7093 6380 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528551.1 protein_id gnl|my_center|LOCUS_08090 8163 7090 gene locus_tag LOCUS_08100 8163 7090 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013725.1 protein_id gnl|my_center|LOCUS_08100 9891 8167 gene locus_tag LOCUS_08110 9891 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence060 <1 832 gene locus_tag LOCUS_08120 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037395802.1:TRAP transporter substrate-binding protein 822 1370 gene locus_tag LOCUS_08130 822 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1378 2646 gene locus_tag LOCUS_08140 gene dctM 1378 2646 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_08140 2666 4105 gene locus_tag LOCUS_08150 2666 4105 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_08150 4137 5300 gene locus_tag LOCUS_08160 4137 5300 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225183.1 protein_id gnl|my_center|LOCUS_08160 5297 6487 gene locus_tag LOCUS_08170 5297 6487 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_08170 6484 7248 gene locus_tag LOCUS_08180 6484 7248 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665641.1 protein_id gnl|my_center|LOCUS_08180 7248 8453 gene locus_tag LOCUS_08190 7248 8453 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086066.1 protein_id gnl|my_center|LOCUS_08190 8466 9269 gene locus_tag LOCUS_08200 8466 9269 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925778.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence061 1210 3555 gene locus_tag LOCUS_08210 1210 3555 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545674.1 protein_id gnl|my_center|LOCUS_08210 3741 4322 gene locus_tag LOCUS_08220 3741 4322 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 protein_id gnl|my_center|LOCUS_08220 4330 5235 gene locus_tag LOCUS_08230 gene xerD 4330 5235 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535956.1 protein_id gnl|my_center|LOCUS_08230 6148 5264 gene locus_tag LOCUS_08240 6148 5264 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114805.1 protein_id gnl|my_center|LOCUS_08240 6852 6253 gene locus_tag LOCUS_08250 6852 6253 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 protein_id gnl|my_center|LOCUS_08250 6966 7883 gene locus_tag LOCUS_08260 6966 7883 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088921.1 protein_id gnl|my_center|LOCUS_08260 7876 9258 gene locus_tag LOCUS_08270 gene gor 7876 9258 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969519.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence062 <1 830 gene locus_tag LOCUS_08280 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004547256.1:LuxR C-terminal-related transcriptional regulator 1140 1796 gene locus_tag LOCUS_08290 1140 1796 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244058.1 protein_id gnl|my_center|LOCUS_08290 1816 2784 gene locus_tag LOCUS_08300 1816 2784 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814852.1 protein_id gnl|my_center|LOCUS_08300 2826 3230 gene locus_tag LOCUS_08310 2826 3230 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_08310 3250 4098 gene locus_tag LOCUS_08320 3250 4098 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_08320 4201 4881 gene locus_tag LOCUS_08330 4201 4881 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_08330 4926 5360 gene locus_tag LOCUS_08340 4926 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 5402 6454 gene locus_tag LOCUS_08350 5402 6454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 protein_id gnl|my_center|LOCUS_08350 6461 7327 gene locus_tag LOCUS_08360 6461 7327 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089930.1 protein_id gnl|my_center|LOCUS_08360 7324 8130 gene locus_tag LOCUS_08370 7324 8130 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383453.1 protein_id gnl|my_center|LOCUS_08370 8127 9221 gene locus_tag LOCUS_08380 8127 9221 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975634.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence063 651 259 gene locus_tag LOCUS_08390 651 259 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_08390 926 648 gene locus_tag LOCUS_08400 926 648 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_08400 2425 1013 gene locus_tag LOCUS_08410 2425 1013 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039542.1 protein_id gnl|my_center|LOCUS_08410 4129 2552 gene locus_tag LOCUS_08420 4129 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 5121 4126 gene locus_tag LOCUS_08430 5121 4126 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869089.1 protein_id gnl|my_center|LOCUS_08430 5286 5504 gene locus_tag LOCUS_08440 5286 5504 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811628.1 protein_id gnl|my_center|LOCUS_08440 5501 7060 gene locus_tag LOCUS_08450 5501 7060 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978555.1 protein_id gnl|my_center|LOCUS_08450 7842 7072 gene locus_tag LOCUS_08460 7842 7072 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_08460 8039 8590 gene locus_tag LOCUS_08470 8039 8590 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_08470 9200 8607 gene locus_tag LOCUS_08480 9200 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence064 4858 50 gene locus_tag LOCUS_08490 4858 50 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_08490 6324 5149 gene locus_tag LOCUS_08500 6324 5149 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521919.1 protein_id gnl|my_center|LOCUS_08500 7421 6339 gene locus_tag LOCUS_08510 gene aroB 7421 6339 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_08510 8047 7478 gene locus_tag LOCUS_08520 8047 7478 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_08520 <9256 8085 gene locus_tag LOCUS_08530 <9256 8085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070657.1:type IV pilus secretin PilQ family protein >Feature sequence065 3759 1408 gene locus_tag LOCUS_08540 3759 1408 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103704.1 protein_id gnl|my_center|LOCUS_08540 5041 3764 gene locus_tag LOCUS_08550 5041 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 5601 5038 gene locus_tag LOCUS_08560 5601 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 6592 5612 gene locus_tag LOCUS_08570 6592 5612 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930890.1 protein_id gnl|my_center|LOCUS_08570 7013 6624 gene locus_tag LOCUS_08580 7013 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 7832 7119 gene locus_tag LOCUS_08590 7832 7119 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222219.1 protein_id gnl|my_center|LOCUS_08590 7959 9077 gene locus_tag LOCUS_08600 7959 9077 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089089.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence066 606 415 gene locus_tag LOCUS_08610 606 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 684 1559 gene locus_tag LOCUS_08620 684 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069846.1 protein_id gnl|my_center|LOCUS_08620 1543 2502 gene locus_tag LOCUS_08630 1543 2502 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_08630 3411 2575 gene locus_tag LOCUS_08640 3411 2575 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_08640 3516 4292 gene locus_tag LOCUS_08650 3516 4292 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544079.1 protein_id gnl|my_center|LOCUS_08650 4289 5473 gene locus_tag LOCUS_08660 gene prpF 4289 5473 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 protein_id gnl|my_center|LOCUS_08660 5508 6251 gene locus_tag LOCUS_08670 gene cysE 5508 6251 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 protein_id gnl|my_center|LOCUS_08670 7056 6259 gene locus_tag LOCUS_08680 7056 6259 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064171.1 protein_id gnl|my_center|LOCUS_08680 7649 7053 gene locus_tag LOCUS_08690 7649 7053 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191635.1 protein_id gnl|my_center|LOCUS_08690 8338 7649 gene locus_tag LOCUS_08700 8338 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence067 <1 509 gene locus_tag LOCUS_08710 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930101.1:30S ribosomal protein S1 662 961 gene locus_tag LOCUS_08720 662 961 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_08720 1131 1460 gene locus_tag LOCUS_08730 1131 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 1480 2676 gene locus_tag LOCUS_08740 gene lapB 1480 2676 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_08740 2669 3604 gene locus_tag LOCUS_08750 gene rfaE1 2669 3604 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189069.1 protein_id gnl|my_center|LOCUS_08750 3601 4059 gene locus_tag LOCUS_08760 3601 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 4087 5019 gene locus_tag LOCUS_08770 gene ubiA 4087 5019 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_08770 5891 5076 gene locus_tag LOCUS_08780 gene proC 5891 5076 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_08780 7584 5986 gene locus_tag LOCUS_08790 gene murJ 7584 5986 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039578.1 protein_id gnl|my_center|LOCUS_08790 7698 8060 gene locus_tag LOCUS_08800 7698 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 8862 8044 gene locus_tag LOCUS_08810 8862 8044 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence068 1628 441 gene locus_tag LOCUS_08820 1628 441 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 protein_id gnl|my_center|LOCUS_08820 5247 1660 gene locus_tag LOCUS_08830 5247 1660 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_08830 6429 5272 gene locus_tag LOCUS_08840 6429 5272 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200062.1 protein_id gnl|my_center|LOCUS_08840 7303 6548 gene locus_tag LOCUS_08850 7303 6548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813864.1 protein_id gnl|my_center|LOCUS_08850 9102 7300 gene locus_tag LOCUS_08860 9102 7300 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195813.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence069 352 1431 gene locus_tag LOCUS_08870 352 1431 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 protein_id gnl|my_center|LOCUS_08870 1428 2426 gene locus_tag LOCUS_08880 1428 2426 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088828.1 protein_id gnl|my_center|LOCUS_08880 2489 3628 gene locus_tag LOCUS_08890 2489 3628 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 protein_id gnl|my_center|LOCUS_08890 3654 4697 gene locus_tag LOCUS_08900 3654 4697 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813866.1 protein_id gnl|my_center|LOCUS_08900 4694 6457 gene locus_tag LOCUS_08910 4694 6457 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530467.1 protein_id gnl|my_center|LOCUS_08910 6454 7182 gene locus_tag LOCUS_08920 6454 7182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813864.1 protein_id gnl|my_center|LOCUS_08920 7179 8783 gene locus_tag LOCUS_08930 7179 8783 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence070 <1 1516 gene locus_tag LOCUS_08940 <1 1516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268952.1:bifunctional aminoglycoside phosphotransferase/ATP-binding protein 2634 1477 gene locus_tag LOCUS_08950 2634 1477 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557566.1 protein_id gnl|my_center|LOCUS_08950 4061 2631 gene locus_tag LOCUS_08960 4061 2631 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356999.1 protein_id gnl|my_center|LOCUS_08960 4531 4073 gene locus_tag LOCUS_08970 4531 4073 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162839581.1 protein_id gnl|my_center|LOCUS_08970 4732 7545 gene locus_tag LOCUS_08980 4732 7545 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_08980 7574 8620 gene locus_tag LOCUS_08990 7574 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence071 425 1180 gene locus_tag LOCUS_09000 425 1180 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063645.1 protein_id gnl|my_center|LOCUS_09000 1498 1343 gene locus_tag LOCUS_09010 gene rpmG 1498 1343 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 protein_id gnl|my_center|LOCUS_09010 1752 1516 gene locus_tag LOCUS_09020 gene rpmB 1752 1516 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_09020 1970 2452 gene locus_tag LOCUS_09030 1970 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3145 2471 gene locus_tag LOCUS_09040 gene radC 3145 2471 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073923.1 protein_id gnl|my_center|LOCUS_09040 3250 3684 gene locus_tag LOCUS_09050 3250 3684 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 protein_id gnl|my_center|LOCUS_09050 3693 4634 gene locus_tag LOCUS_09060 gene ispH 3693 4634 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_09060 6215 4716 gene locus_tag LOCUS_09070 6215 4716 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035422.1 protein_id gnl|my_center|LOCUS_09070 6979 6212 gene locus_tag LOCUS_09080 6979 6212 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035421.1 protein_id gnl|my_center|LOCUS_09080 7101 7679 gene locus_tag LOCUS_09090 7101 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 7898 8036 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgcataggcagctcagaaa 8210 8658 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctgagctgcctatgcggcagtgaacg >Feature sequence072 1399 131 gene locus_tag LOCUS_09100 gene pgaC 1399 131 CDS product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164390.1 protein_id gnl|my_center|LOCUS_09100 3384 1405 gene locus_tag LOCUS_09110 gene pgaB 3384 1405 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064163.1 protein_id gnl|my_center|LOCUS_09110 5854 3386 gene locus_tag LOCUS_09120 gene pgaA 5854 3386 CDS product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082816276.1 protein_id gnl|my_center|LOCUS_09120 6107 7174 gene locus_tag LOCUS_09130 6107 7174 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646058.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence073 578 2281 gene locus_tag LOCUS_09140 578 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 3329 2247 gene locus_tag LOCUS_09150 3329 2247 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615893.1 protein_id gnl|my_center|LOCUS_09150 3457 4791 gene locus_tag LOCUS_09160 gene egtB 3457 4791 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_09160 4884 5264 gene locus_tag LOCUS_09170 4884 5264 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230330.1 protein_id gnl|my_center|LOCUS_09170 5240 6235 gene locus_tag LOCUS_09180 gene egtD 5240 6235 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 protein_id gnl|my_center|LOCUS_09180 6248 6634 gene locus_tag LOCUS_09190 6248 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 6821 7309 gene locus_tag LOCUS_09200 6821 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 7427 8332 gene locus_tag LOCUS_09210 7427 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 8563 8487 gene locus_tag LOCUS_t00080 8563 8487 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 <1 1722 gene locus_tag LOCUS_09220 <1 1722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814283.1:excinuclease ABC subunit UvrA 1799 3289 gene locus_tag LOCUS_09230 1799 3289 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063675.1 protein_id gnl|my_center|LOCUS_09230 3512 5266 gene locus_tag LOCUS_09240 3512 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5263 6300 gene locus_tag LOCUS_09250 5263 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 7138 6287 gene locus_tag LOCUS_09260 7138 6287 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407292.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence075 2204 6151 gene locus_tag LOCUS_09270 2204 6151 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009241452.1 protein_id gnl|my_center|LOCUS_09270 6163 7044 gene locus_tag LOCUS_09280 6163 7044 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931197.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence076 364 1824 gene locus_tag LOCUS_09290 gene pyk 364 1824 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_09290 2044 3093 gene locus_tag LOCUS_09300 gene fba 2044 3093 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809510.1 protein_id gnl|my_center|LOCUS_09300 3110 3988 gene locus_tag LOCUS_09310 3110 3988 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037844.1 protein_id gnl|my_center|LOCUS_09310 4381 4070 gene locus_tag LOCUS_09320 4381 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4474 5250 gene locus_tag LOCUS_09330 4474 5250 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524357.1 protein_id gnl|my_center|LOCUS_09330 5366 6262 gene locus_tag LOCUS_09340 5366 6262 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_09340 6304 6795 gene locus_tag LOCUS_09350 gene purE 6304 6795 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188932.1 protein_id gnl|my_center|LOCUS_09350 6795 8033 gene locus_tag LOCUS_09360 6795 8033 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809527.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence077 929 231 gene locus_tag LOCUS_09370 929 231 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228740.1 protein_id gnl|my_center|LOCUS_09370 1001 2179 gene locus_tag LOCUS_09380 gene pobA 1001 2179 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532959.1 protein_id gnl|my_center|LOCUS_09380 3140 2187 gene locus_tag LOCUS_09390 3140 2187 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_09390 4882 3137 gene locus_tag LOCUS_09400 4882 3137 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_09400 5342 4959 gene locus_tag LOCUS_09410 5342 4959 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387834.1 protein_id gnl|my_center|LOCUS_09410 5706 5416 gene locus_tag LOCUS_09420 5706 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 6176 5703 gene locus_tag LOCUS_09430 6176 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 6312 7367 gene locus_tag LOCUS_09440 gene ugpC 6312 7367 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061266.1 protein_id gnl|my_center|LOCUS_09440 <8289 7399 gene locus_tag LOCUS_09450 <8289 7399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000060640.1:DMT family transporter >Feature sequence078 625 209 gene locus_tag LOCUS_09460 625 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 963 622 gene locus_tag LOCUS_09470 963 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1706 1002 gene locus_tag LOCUS_09480 1706 1002 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723682.1 protein_id gnl|my_center|LOCUS_09480 1793 2695 gene locus_tag LOCUS_09490 1793 2695 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811986.1 protein_id gnl|my_center|LOCUS_09490 2861 4069 gene locus_tag LOCUS_09500 2861 4069 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085967.1 protein_id gnl|my_center|LOCUS_09500 4166 5032 gene locus_tag LOCUS_09510 4166 5032 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_09510 5032 6033 gene locus_tag LOCUS_09520 5032 6033 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 protein_id gnl|my_center|LOCUS_09520 6030 6824 gene locus_tag LOCUS_09530 6030 6824 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088973.1 protein_id gnl|my_center|LOCUS_09530 6817 7599 gene locus_tag LOCUS_09540 6817 7599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_09540 7681 7606 gene locus_tag LOCUS_t00090 7681 7606 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence079 1314 361 gene locus_tag LOCUS_09550 1314 361 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525142.1 protein_id gnl|my_center|LOCUS_09550 1625 1314 gene locus_tag LOCUS_09560 1625 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1858 2958 gene locus_tag LOCUS_09570 1858 2958 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_09570 3019 3867 gene locus_tag LOCUS_09580 3019 3867 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820280.1 protein_id gnl|my_center|LOCUS_09580 3884 4459 gene locus_tag LOCUS_09590 3884 4459 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191695.1 protein_id gnl|my_center|LOCUS_09590 5258 4473 gene locus_tag LOCUS_09600 5258 4473 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_09600 8092 5261 gene locus_tag LOCUS_09610 gene polA 8092 5261 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence080 162 569 gene locus_tag LOCUS_09620 162 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1228 605 gene locus_tag LOCUS_09630 1228 605 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_09630 3503 1236 gene locus_tag LOCUS_09640 3503 1236 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925780.1 protein_id gnl|my_center|LOCUS_09640 4077 3625 gene locus_tag LOCUS_09650 4077 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4297 4139 gene locus_tag LOCUS_09660 4297 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4912 4325 gene locus_tag LOCUS_09670 4912 4325 CDS product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888792.1 protein_id gnl|my_center|LOCUS_09670 5937 4975 gene locus_tag LOCUS_09680 5937 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 6974 5961 gene locus_tag LOCUS_09690 6974 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922267.1 protein_id gnl|my_center|LOCUS_09690 7205 7423 gene locus_tag LOCUS_09700 7205 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 7386 7733 gene locus_tag LOCUS_09710 7386 7733 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941219.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence081 731 2056 gene locus_tag LOCUS_09720 731 2056 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_09720 2067 2369 gene locus_tag LOCUS_09730 2067 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2586 3206 gene locus_tag LOCUS_09740 2586 3206 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812635.1 protein_id gnl|my_center|LOCUS_09740 3227 5047 gene locus_tag LOCUS_09750 3227 5047 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812634.1 protein_id gnl|my_center|LOCUS_09750 6199 5132 gene locus_tag LOCUS_09760 6199 5132 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567739.1 protein_id gnl|my_center|LOCUS_09760 7795 6377 gene locus_tag LOCUS_09770 gene lpdA 7795 6377 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459591.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence082 <1 3023 gene locus_tag LOCUS_09780 <1 3023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063897.1:error-prone DNA polymerase 4248 3031 gene locus_tag LOCUS_09790 4248 3031 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_09790 5809 4280 gene locus_tag LOCUS_09800 gene purF 5809 4280 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_09800 6326 5832 gene locus_tag LOCUS_09810 6326 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 7021 6329 gene locus_tag LOCUS_09820 7021 6329 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525194.1 protein_id gnl|my_center|LOCUS_09820 <8061 7096 gene locus_tag LOCUS_09830 <8061 7096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039854.1:bifunctional tetrahydrofolate synthase/dihydrofolate synthase >Feature sequence083 <1 909 gene locus_tag LOCUS_09840 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242719.1:acyl-CoA dehydrogenase AcdA 906 1334 gene locus_tag LOCUS_09850 906 1334 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_09850 1331 2944 gene locus_tag LOCUS_09860 1331 2944 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_09860 2964 3830 gene locus_tag LOCUS_09870 2964 3830 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528449.1 protein_id gnl|my_center|LOCUS_09870 3811 4296 gene locus_tag LOCUS_09880 3811 4296 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_09880 4323 6653 gene locus_tag LOCUS_09890 4323 6653 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_09890 6660 6911 gene locus_tag LOCUS_09900 gene moaD 6660 6911 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532479.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence084 483 986 gene locus_tag LOCUS_09910 gene dadR 483 986 CDS product transcriptional regulator DadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096535.1 protein_id gnl|my_center|LOCUS_09910 983 1930 gene locus_tag LOCUS_09920 983 1930 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810987.1 protein_id gnl|my_center|LOCUS_09920 2974 1976 gene locus_tag LOCUS_09930 2974 1976 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_09930 4026 3007 gene locus_tag LOCUS_09940 4026 3007 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039166.1 protein_id gnl|my_center|LOCUS_09940 5012 4023 gene locus_tag LOCUS_09950 5012 4023 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814268.1 protein_id gnl|my_center|LOCUS_09950 6059 5118 gene locus_tag LOCUS_09960 6059 5118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039165.1 protein_id gnl|my_center|LOCUS_09960 7689 6064 gene locus_tag LOCUS_09970 7689 6064 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085661.1 protein_id gnl|my_center|LOCUS_09970 7963 7769 gene locus_tag LOCUS_09980 7963 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence085 1446 601 gene locus_tag LOCUS_09990 gene trxA 1446 601 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522640.1 protein_id gnl|my_center|LOCUS_09990 2439 1510 gene locus_tag LOCUS_10000 gene gcvA 2439 1510 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388543.1 protein_id gnl|my_center|LOCUS_10000 2499 2915 gene locus_tag LOCUS_10010 2499 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2915 3526 gene locus_tag LOCUS_10020 2915 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 4060 3584 gene locus_tag LOCUS_10030 4060 3584 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082056.1 protein_id gnl|my_center|LOCUS_10030 4329 4123 gene locus_tag LOCUS_10040 4329 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 4368 5018 gene locus_tag LOCUS_10050 4368 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 5648 5076 gene locus_tag LOCUS_10060 5648 5076 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529391.1 protein_id gnl|my_center|LOCUS_10060 6434 5739 gene locus_tag LOCUS_10070 6434 5739 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812732.1 protein_id gnl|my_center|LOCUS_10070 7587 6484 gene locus_tag LOCUS_10080 gene gtdA 7587 6484 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113291.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence086 604 1218 gene locus_tag LOCUS_10090 604 1218 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_10090 2182 1190 gene locus_tag LOCUS_10100 2182 1190 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064547.1 protein_id gnl|my_center|LOCUS_10100 3203 2214 gene locus_tag LOCUS_10110 3203 2214 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_10110 3356 4303 gene locus_tag LOCUS_10120 3356 4303 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038961.1 protein_id gnl|my_center|LOCUS_10120 4878 4342 gene locus_tag LOCUS_10130 4878 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 6446 4878 gene locus_tag LOCUS_10140 6446 4878 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_10140 7219 6464 gene locus_tag LOCUS_10150 7219 6464 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018701913.1 protein_id gnl|my_center|LOCUS_10150 7801 7319 gene locus_tag LOCUS_10160 7801 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence087 <1 1904 gene locus_tag LOCUS_10170 <1 1904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088782.1:FAD-binding and (Fe-S)-binding domain-containing protein 2392 4680 gene locus_tag LOCUS_10180 2392 4680 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194063.1 protein_id gnl|my_center|LOCUS_10180 4899 7214 gene locus_tag LOCUS_10190 4899 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 7294 7680 gene locus_tag LOCUS_10200 7294 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence088 218 802 gene locus_tag LOCUS_10210 218 802 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_10210 850 1977 gene locus_tag LOCUS_10220 850 1977 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_10220 2816 2061 gene locus_tag LOCUS_10230 2816 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 4260 2890 gene locus_tag LOCUS_10240 4260 2890 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_10240 4901 4410 gene locus_tag LOCUS_10250 gene ispF 4901 4410 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_10250 5593 4898 gene locus_tag LOCUS_10260 gene ispD 5593 4898 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040254.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence089 2329 1286 gene locus_tag LOCUS_10270 2329 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3160 2336 gene locus_tag LOCUS_10280 gene pilW 3160 2336 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227268.1 protein_id gnl|my_center|LOCUS_10280 4290 3157 gene locus_tag LOCUS_10290 gene rlmN 4290 3157 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192451.1 protein_id gnl|my_center|LOCUS_10290 4749 4324 gene locus_tag LOCUS_10300 gene ndk 4749 4324 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810689.1 protein_id gnl|my_center|LOCUS_10300 5106 5816 gene locus_tag LOCUS_10310 5106 5816 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521332.1 protein_id gnl|my_center|LOCUS_10310 7284 5899 gene locus_tag LOCUS_10320 gene rlmD 7284 5899 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926715.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence090 1085 150 gene locus_tag LOCUS_10330 1085 150 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086979.1 protein_id gnl|my_center|LOCUS_10330 2112 1072 gene locus_tag LOCUS_10340 2112 1072 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_10340 3197 2181 gene locus_tag LOCUS_10350 3197 2181 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_10350 3347 4498 gene locus_tag LOCUS_10360 3347 4498 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257480.1 protein_id gnl|my_center|LOCUS_10360 4510 5688 gene locus_tag LOCUS_10370 4510 5688 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968365.1 protein_id gnl|my_center|LOCUS_10370 5685 6542 gene locus_tag LOCUS_10380 5685 6542 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532465.1 protein_id gnl|my_center|LOCUS_10380 <7610 6651 gene locus_tag LOCUS_10390 <7610 6651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093950374.1:PD40 domain-containing protein note possible pseudo, frameshifted >Feature sequence091 949 859 gene locus_tag LOCUS_t00100 949 859 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2340 1039 gene locus_tag LOCUS_10400 gene serS 2340 1039 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_10400 3855 2518 gene locus_tag LOCUS_10410 3855 2518 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930945.1 protein_id gnl|my_center|LOCUS_10410 5077 3833 gene locus_tag LOCUS_10420 5077 3833 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_10420 6322 5135 gene locus_tag LOCUS_10430 6322 5135 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448968.1 protein_id gnl|my_center|LOCUS_10430 6944 6306 gene locus_tag LOCUS_10440 gene lolA 6944 6306 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930946.1 protein_id gnl|my_center|LOCUS_10440 7600 6944 gene locus_tag LOCUS_10450 7600 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence092 1215 1616 gene locus_tag LOCUS_10460 1215 1616 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087893.1 protein_id gnl|my_center|LOCUS_10460 1638 2411 gene locus_tag LOCUS_10470 1638 2411 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083530.1 protein_id gnl|my_center|LOCUS_10470 3644 2415 gene locus_tag LOCUS_10480 gene chrA 3644 2415 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931200.1 protein_id gnl|my_center|LOCUS_10480 3740 4702 gene locus_tag LOCUS_10490 3740 4702 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814230.1 protein_id gnl|my_center|LOCUS_10490 7254 4675 gene locus_tag LOCUS_10500 7254 4675 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063974.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence093 947 555 gene locus_tag LOCUS_10510 947 555 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921451.1 protein_id gnl|my_center|LOCUS_10510 946 1830 gene locus_tag LOCUS_10520 946 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 3025 1856 gene locus_tag LOCUS_10530 3025 1856 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242904.1 protein_id gnl|my_center|LOCUS_10530 2975 3151 gene locus_tag LOCUS_10540 2975 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3819 3127 gene locus_tag LOCUS_10550 3819 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5057 3819 gene locus_tag LOCUS_10560 5057 3819 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_10560 7276 5219 gene locus_tag LOCUS_10570 7276 5219 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064497.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence094 220 1134 gene locus_tag LOCUS_10580 220 1134 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_10580 1124 2080 gene locus_tag LOCUS_10590 1124 2080 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521279.1 protein_id gnl|my_center|LOCUS_10590 2082 3215 gene locus_tag LOCUS_10600 2082 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3993 3184 gene locus_tag LOCUS_10610 3993 3184 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_10610 4302 4012 gene locus_tag LOCUS_10620 4302 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 5428 4313 gene locus_tag LOCUS_10630 5428 4313 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_10630 5486 6499 gene locus_tag LOCUS_10640 gene mltG 5486 6499 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191597.1 protein_id gnl|my_center|LOCUS_10640 6496 7110 gene locus_tag LOCUS_10650 gene tmk 6496 7110 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811733.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence095 1064 141 gene locus_tag LOCUS_10660 gene prmA 1064 141 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814950.1 protein_id gnl|my_center|LOCUS_10660 2441 1092 gene locus_tag LOCUS_10670 gene accC 2441 1092 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_10670 2904 2443 gene locus_tag LOCUS_10680 gene accB 2904 2443 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_10680 3386 2910 gene locus_tag LOCUS_10690 gene aroQ 3386 2910 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194379.1 protein_id gnl|my_center|LOCUS_10690 4024 3497 gene locus_tag LOCUS_10700 4024 3497 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527768.1 protein_id gnl|my_center|LOCUS_10700 4608 4021 gene locus_tag LOCUS_10710 4608 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195097.1 protein_id gnl|my_center|LOCUS_10710 4644 6005 gene locus_tag LOCUS_10720 gene mpl 4644 6005 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_10720 6007 6630 gene locus_tag LOCUS_10730 6007 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194143.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence096 1 1920 gene locus_tag LOCUS_10740 1 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1917 3068 gene locus_tag LOCUS_10750 gene gcvT 1917 3068 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463296.1 protein_id gnl|my_center|LOCUS_10750 3191 4204 gene locus_tag LOCUS_10760 3191 4204 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532423.1 protein_id gnl|my_center|LOCUS_10760 4263 5405 gene locus_tag LOCUS_10770 4263 5405 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388758.1 protein_id gnl|my_center|LOCUS_10770 5413 6456 gene locus_tag LOCUS_10780 5413 6456 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815066.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence097 215 1066 gene locus_tag LOCUS_10790 215 1066 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_10790 1195 1782 gene locus_tag LOCUS_10800 gene coaE 1195 1782 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_10800 1948 2703 gene locus_tag LOCUS_10810 gene zapD 1948 2703 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_10810 2720 2947 gene locus_tag LOCUS_10820 2720 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3906 2959 gene locus_tag LOCUS_10830 3906 2959 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_10830 4844 3903 gene locus_tag LOCUS_10840 4844 3903 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_10840 6099 4870 gene locus_tag LOCUS_10850 gene argJ 6099 4870 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549958.1 protein_id gnl|my_center|LOCUS_10850 <7092 6122 gene locus_tag LOCUS_10860 <7092 6122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814564.1:preprotein translocase subunit SecA >Feature sequence098 3 755 gene locus_tag LOCUS_10870 3 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 800 1696 gene locus_tag LOCUS_10880 800 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1701 2216 gene locus_tag LOCUS_10890 gene mreD 1701 2216 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_10890 2239 4185 gene locus_tag LOCUS_10900 gene mrdA 2239 4185 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10900 4182 5294 gene locus_tag LOCUS_10910 gene rodA 4182 5294 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 protein_id gnl|my_center|LOCUS_10910 6362 5313 gene locus_tag LOCUS_10920 6362 5313 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992236.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence099 977 297 gene locus_tag LOCUS_10930 977 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1494 970 gene locus_tag LOCUS_10940 gene rimI 1494 970 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_10940 2388 1504 gene locus_tag LOCUS_10950 2388 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10950 2853 2491 gene locus_tag LOCUS_10960 2853 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2996 3715 gene locus_tag LOCUS_10970 gene ompR 2996 3715 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199523.1 protein_id gnl|my_center|LOCUS_10970 3712 5112 gene locus_tag LOCUS_10980 3712 5112 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196632.1 protein_id gnl|my_center|LOCUS_10980 5249 5668 gene locus_tag LOCUS_10990 5249 5668 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence100 538 83 gene locus_tag LOCUS_11000 538 83 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_11000 2189 564 gene locus_tag LOCUS_11010 2189 564 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_11010 2384 2851 gene locus_tag LOCUS_11020 gene mioC 2384 2851 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352400.1 protein_id gnl|my_center|LOCUS_11020 3813 2893 gene locus_tag LOCUS_11030 3813 2893 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083896.1 protein_id gnl|my_center|LOCUS_11030 3856 4641 gene locus_tag LOCUS_11040 3856 4641 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930761.1 protein_id gnl|my_center|LOCUS_11040 4772 6109 gene locus_tag LOCUS_11050 4772 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 <6980 6122 gene locus_tag LOCUS_11060 <6980 6122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188980.1:L-threonylcarbamoyladenylate synthase >Feature sequence101 1040 192 gene locus_tag LOCUS_11070 1040 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1357 1058 gene locus_tag LOCUS_11080 1357 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2778 1354 gene locus_tag LOCUS_11090 gene cobB 2778 1354 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_11090 3989 2787 gene locus_tag LOCUS_11100 gene nrfD 3989 2787 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272584.1 protein_id gnl|my_center|LOCUS_11100 4776 3994 gene locus_tag LOCUS_11110 4776 3994 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393110.1 protein_id gnl|my_center|LOCUS_11110 5282 4773 gene locus_tag LOCUS_11120 5282 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 <6932 5293 gene locus_tag LOCUS_11130 <6932 5293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932535.1:NAD(P)-binding protein >Feature sequence102 <1 686 gene locus_tag LOCUS_11140 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401565.1:LytTR family DNA-binding domain-containing protein 689 1633 gene locus_tag LOCUS_11150 gene hemC 689 1633 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193185.1 protein_id gnl|my_center|LOCUS_11150 1615 2403 gene locus_tag LOCUS_11160 1615 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11160 2396 3442 gene locus_tag LOCUS_11170 2396 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 3464 4687 gene locus_tag LOCUS_11180 3464 4687 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526333.1 protein_id gnl|my_center|LOCUS_11180 6134 4659 gene locus_tag LOCUS_11190 6134 4659 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193515.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence103 151 1527 gene locus_tag LOCUS_11200 151 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1524 2498 gene locus_tag LOCUS_11210 1524 2498 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025227807.1 protein_id gnl|my_center|LOCUS_11210 2495 2674 gene locus_tag LOCUS_11220 2495 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2671 3144 gene locus_tag LOCUS_11230 2671 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 3141 3416 gene locus_tag LOCUS_11240 3141 3416 CDS product Ref family recombination enhancement nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062266925.1 protein_id gnl|my_center|LOCUS_11240 3413 4345 gene locus_tag LOCUS_11250 3413 4345 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926409.1 protein_id gnl|my_center|LOCUS_11250 4342 4986 gene locus_tag LOCUS_11260 4342 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 5227 5367 gene locus_tag LOCUS_11270 5227 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 5370 5819 gene locus_tag LOCUS_11280 5370 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 5822 6031 gene locus_tag LOCUS_11290 5822 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 6028 6213 gene locus_tag LOCUS_11300 6028 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 6210 6434 gene locus_tag LOCUS_11310 6210 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence104 1182 13 gene locus_tag LOCUS_11320 gene mraY 1182 13 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247664.1 protein_id gnl|my_center|LOCUS_11320 2558 1182 gene locus_tag LOCUS_11330 gene murF 2558 1182 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 protein_id gnl|my_center|LOCUS_11330 4080 2551 gene locus_tag LOCUS_11340 4080 2551 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194154.1 protein_id gnl|my_center|LOCUS_11340 5822 4077 gene locus_tag LOCUS_11350 5822 4077 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532007.1 protein_id gnl|my_center|LOCUS_11350 6181 5819 gene locus_tag LOCUS_11360 6181 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 <6747 6210 gene locus_tag LOCUS_11370 <6747 6210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194427.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH >Feature sequence105 <1 1278 gene locus_tag LOCUS_11380 <1 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814079.1:molecular chaperone DnaK 1281 2402 gene locus_tag LOCUS_11390 gene dnaJ 1281 2402 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821186.1 protein_id gnl|my_center|LOCUS_11390 2399 3760 gene locus_tag LOCUS_11400 2399 3760 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555126.1 protein_id gnl|my_center|LOCUS_11400 3833 5527 gene locus_tag LOCUS_11410 3833 5527 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence106 <1 780 gene locus_tag LOCUS_11420 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808619.1:chaperonin GroEL 1575 904 gene locus_tag LOCUS_11430 1575 904 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927036.1 protein_id gnl|my_center|LOCUS_11430 1679 2413 gene locus_tag LOCUS_11440 1679 2413 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_11440 3390 2485 gene locus_tag LOCUS_11450 3390 2485 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087048.1 protein_id gnl|my_center|LOCUS_11450 3434 4243 gene locus_tag LOCUS_11460 gene pyrF 3434 4243 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_11460 4302 4988 gene locus_tag LOCUS_11470 4302 4988 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_11470 4985 6535 gene locus_tag LOCUS_11480 4985 6535 CDS product sensor histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence107 3097 5 gene locus_tag LOCUS_11490 3097 5 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_11490 4262 3108 gene locus_tag LOCUS_11500 4262 3108 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494086.1 protein_id gnl|my_center|LOCUS_11500 4529 6394 gene locus_tag LOCUS_11510 4529 6394 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729028.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence108 666 385 gene locus_tag LOCUS_11520 666 385 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_11520 819 1562 gene locus_tag LOCUS_11530 819 1562 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196014.1 protein_id gnl|my_center|LOCUS_11530 1574 2734 gene locus_tag LOCUS_11540 1574 2734 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089089.1 protein_id gnl|my_center|LOCUS_11540 2825 3718 gene locus_tag LOCUS_11550 2825 3718 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812282.1 protein_id gnl|my_center|LOCUS_11550 3711 4670 gene locus_tag LOCUS_11560 3711 4670 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339265.1 protein_id gnl|my_center|LOCUS_11560 4675 6192 gene locus_tag LOCUS_11570 4675 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11570 6215 6634 gene locus_tag LOCUS_11580 6215 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence109 1975 827 gene locus_tag LOCUS_11590 1975 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2555 2043 gene locus_tag LOCUS_11600 2555 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2779 4716 gene locus_tag LOCUS_11610 2779 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 4766 5407 gene locus_tag LOCUS_11620 gene pncA 4766 5407 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528448.1 protein_id gnl|my_center|LOCUS_11620 5461 6537 gene locus_tag LOCUS_11630 5461 6537 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121674.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence110 <1 738 gene locus_tag LOCUS_11640 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521310.1:ATP-dependent chaperone ClpB 1051 758 gene locus_tag LOCUS_11650 1051 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1037 1783 gene locus_tag LOCUS_11660 1037 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1722 4178 gene locus_tag LOCUS_11670 gene tex 1722 4178 CDS product RNA-binding transcriptional accessory protein Tex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813599.1 protein_id gnl|my_center|LOCUS_11670 4278 4481 gene locus_tag LOCUS_11680 4278 4481 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670205.1 protein_id gnl|my_center|LOCUS_11680 4478 4873 gene locus_tag LOCUS_11690 4478 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 5889 4924 gene locus_tag LOCUS_11700 5889 4924 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186428.1 protein_id gnl|my_center|LOCUS_11700 5888 6310 gene locus_tag LOCUS_11710 5888 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence111 2905 3855 gene locus_tag LOCUS_11720 2905 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5019 3961 gene locus_tag LOCUS_11730 5019 3961 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_11730 5137 6246 gene locus_tag LOCUS_11740 5137 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence112 2200 80 gene locus_tag LOCUS_11750 gene glyS 2200 80 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064983.1 protein_id gnl|my_center|LOCUS_11750 3077 2190 gene locus_tag LOCUS_11760 gene glyQ 3077 2190 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929585.1 protein_id gnl|my_center|LOCUS_11760 4740 3103 gene locus_tag LOCUS_11770 gene lnt 4740 3103 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064331.1 protein_id gnl|my_center|LOCUS_11770 5590 4748 gene locus_tag LOCUS_11780 5590 4748 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_11780 6229 5708 gene locus_tag LOCUS_11790 gene ybeY 6229 5708 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064329.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence113 <1 930 gene locus_tag LOCUS_11800 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776441.1:cation-translocating P-type ATPase 2150 1017 gene locus_tag LOCUS_11810 2150 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 protein_id gnl|my_center|LOCUS_11810 2850 2344 gene locus_tag LOCUS_11820 2850 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 3034 2828 gene locus_tag LOCUS_11830 3034 2828 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521228.1 protein_id gnl|my_center|LOCUS_11830 3528 3031 gene locus_tag LOCUS_11840 3528 3031 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970313.1 protein_id gnl|my_center|LOCUS_11840 3748 3506 gene locus_tag LOCUS_11850 3748 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 5393 3813 gene locus_tag LOCUS_11860 gene paaZ 5393 3813 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976331.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence114 181 1065 gene locus_tag LOCUS_11870 181 1065 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528527.1 protein_id gnl|my_center|LOCUS_11870 1073 2038 gene locus_tag LOCUS_11880 1073 2038 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086817.1 protein_id gnl|my_center|LOCUS_11880 3679 2099 gene locus_tag LOCUS_11890 gene pruA 3679 2099 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438089.1 protein_id gnl|my_center|LOCUS_11890 3922 5487 gene locus_tag LOCUS_11900 3922 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 5879 5499 gene locus_tag LOCUS_11910 5879 5499 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346527.1 protein_id gnl|my_center|LOCUS_11910 <6471 5921 gene locus_tag LOCUS_11920 <6471 5921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084368.1:cytochrome c peroxidase >Feature sequence115 786 175 gene locus_tag LOCUS_11930 786 175 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_11930 965 1630 gene locus_tag LOCUS_11940 gene yihA 965 1630 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521909.1 protein_id gnl|my_center|LOCUS_11940 1672 2691 gene locus_tag LOCUS_11950 gene hemB 1672 2691 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521908.1 protein_id gnl|my_center|LOCUS_11950 2741 3847 gene locus_tag LOCUS_11960 2741 3847 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 protein_id gnl|my_center|LOCUS_11960 4361 3885 gene locus_tag LOCUS_11970 4361 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 5176 4397 gene locus_tag LOCUS_11980 5176 4397 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810480.1 protein_id gnl|my_center|LOCUS_11980 6122 5199 gene locus_tag LOCUS_11990 6122 5199 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810478.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence116 <1 597 gene locus_tag LOCUS_12000 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040629.1:enoyl-CoA hydratase/isomerase family protein 616 1644 gene locus_tag LOCUS_12010 616 1644 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088354.1 protein_id gnl|my_center|LOCUS_12010 2605 1994 gene locus_tag LOCUS_12020 2605 1994 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929111.1 protein_id gnl|my_center|LOCUS_12020 2583 3083 gene locus_tag LOCUS_12030 2583 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 3493 3113 gene locus_tag LOCUS_12040 3493 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4355 3516 gene locus_tag LOCUS_12050 4355 3516 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088098.1 protein_id gnl|my_center|LOCUS_12050 4734 4411 gene locus_tag LOCUS_12060 4734 4411 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157881.1 protein_id gnl|my_center|LOCUS_12060 5194 4742 gene locus_tag LOCUS_12070 5194 4742 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704236.1 protein_id gnl|my_center|LOCUS_12070 5597 5220 gene locus_tag LOCUS_12080 5597 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 6442 5762 gene locus_tag LOCUS_12090 6442 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence117 272 1297 gene locus_tag LOCUS_12100 272 1297 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261263.1 protein_id gnl|my_center|LOCUS_12100 1290 2090 gene locus_tag LOCUS_12110 1290 2090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933420.1 protein_id gnl|my_center|LOCUS_12110 3108 2119 gene locus_tag LOCUS_12120 3108 2119 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818502.1 protein_id gnl|my_center|LOCUS_12120 3712 3119 gene locus_tag LOCUS_12130 3712 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 4914 3709 gene locus_tag LOCUS_12140 4914 3709 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531444.1 protein_id gnl|my_center|LOCUS_12140 5822 4911 gene locus_tag LOCUS_12150 5822 4911 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969441.1 protein_id gnl|my_center|LOCUS_12150 <6423 5915 gene locus_tag LOCUS_12160 <6423 5915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083169.1:xanthine dehydrogenase family protein subunit M >Feature sequence118 1425 667 gene locus_tag LOCUS_12170 gene gpmA 1425 667 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807430.1 protein_id gnl|my_center|LOCUS_12170 1500 1901 gene locus_tag LOCUS_12180 1500 1901 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198006.1 protein_id gnl|my_center|LOCUS_12180 1919 2179 gene locus_tag LOCUS_12190 gene grxC 1919 2179 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_12190 2243 2722 gene locus_tag LOCUS_12200 gene secB 2243 2722 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198004.1 protein_id gnl|my_center|LOCUS_12200 2765 3295 gene locus_tag LOCUS_12210 2765 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 3313 4326 gene locus_tag LOCUS_12220 3313 4326 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_12220 4323 4892 gene locus_tag LOCUS_12230 4323 4892 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_12230 5436 4882 gene locus_tag LOCUS_12240 gene trmL 5436 4882 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185046.1 protein_id gnl|my_center|LOCUS_12240 6286 5396 gene locus_tag LOCUS_12250 gene gntX 6286 5396 CDS product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303702.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence119 84 1094 gene locus_tag LOCUS_12260 84 1094 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 protein_id gnl|my_center|LOCUS_12260 1106 1876 gene locus_tag LOCUS_12270 gene ypfH 1106 1876 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810880.1 protein_id gnl|my_center|LOCUS_12270 1949 3133 gene locus_tag LOCUS_12280 1949 3133 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527148.1 protein_id gnl|my_center|LOCUS_12280 4577 3348 gene locus_tag LOCUS_12290 4577 3348 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_12290 5857 4577 gene locus_tag LOCUS_12300 gene hemL 5857 4577 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence120 256 663 gene locus_tag LOCUS_12310 256 663 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_12310 1065 709 gene locus_tag LOCUS_12320 1065 709 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207553.1 protein_id gnl|my_center|LOCUS_12320 1200 2873 gene locus_tag LOCUS_12330 1200 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2919 3710 gene locus_tag LOCUS_12340 2919 3710 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 protein_id gnl|my_center|LOCUS_12340 4861 3689 gene locus_tag LOCUS_12350 gene pbpG 4861 3689 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557110.1 protein_id gnl|my_center|LOCUS_12350 5511 5041 gene locus_tag LOCUS_12360 5511 5041 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_12360 5785 6324 gene locus_tag LOCUS_12370 5785 6324 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence121 <1 632 gene locus_tag LOCUS_12380 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403093.1:b(o/a)3-type cytochrome-c oxidase subunit 1 708 1574 gene locus_tag LOCUS_12390 708 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12390 1567 2430 gene locus_tag LOCUS_12400 1567 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2431 4068 gene locus_tag LOCUS_12410 2431 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 4061 4567 gene locus_tag LOCUS_12420 4061 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 4564 5985 gene locus_tag LOCUS_12430 4564 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880043.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence122 <1 985 gene locus_tag LOCUS_12440 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192693.1:DNA polymerase III subunit delta' 1031 1513 gene locus_tag LOCUS_12450 1031 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1572 2354 gene locus_tag LOCUS_12460 1572 2354 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_12460 2377 3147 gene locus_tag LOCUS_12470 2377 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 3980 3177 gene locus_tag LOCUS_12480 3980 3177 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144264.1 protein_id gnl|my_center|LOCUS_12480 4133 4594 gene locus_tag LOCUS_12490 4133 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 5474 4599 gene locus_tag LOCUS_12500 5474 4599 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089063.1 protein_id gnl|my_center|LOCUS_12500 5473 5970 gene locus_tag LOCUS_12510 5473 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence123 589 1329 gene locus_tag LOCUS_12520 589 1329 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550123.1 protein_id gnl|my_center|LOCUS_12520 1349 2320 gene locus_tag LOCUS_12530 1349 2320 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_12530 3254 2328 gene locus_tag LOCUS_12540 gene rsgA 3254 2328 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_12540 3579 3226 gene locus_tag LOCUS_12550 3579 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4835 3576 gene locus_tag LOCUS_12560 4835 3576 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_12560 4875 5495 gene locus_tag LOCUS_12570 gene orn 4875 5495 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189767.1 protein_id gnl|my_center|LOCUS_12570 <6283 5456 gene locus_tag LOCUS_12580 <6283 5456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550337.1:MATE family efflux transporter >Feature sequence124 1202 783 gene locus_tag LOCUS_12590 1202 783 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770968.1 protein_id gnl|my_center|LOCUS_12590 1441 1202 gene locus_tag LOCUS_12600 1441 1202 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770970.1 protein_id gnl|my_center|LOCUS_12600 1543 2664 gene locus_tag LOCUS_12610 1543 2664 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083007.1 protein_id gnl|my_center|LOCUS_12610 2667 3341 gene locus_tag LOCUS_12620 2667 3341 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038720.1 protein_id gnl|my_center|LOCUS_12620 4364 3396 gene locus_tag LOCUS_12630 4364 3396 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083045.1 protein_id gnl|my_center|LOCUS_12630 4803 4405 gene locus_tag LOCUS_12640 4803 4405 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_12640 5024 4803 gene locus_tag LOCUS_12650 5024 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 5543 5097 gene locus_tag LOCUS_12660 gene moaE 5543 5097 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_12660 5860 5546 gene locus_tag LOCUS_12670 5860 5546 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529164.1 protein_id gnl|my_center|LOCUS_12670 6152 5880 gene locus_tag LOCUS_12680 6152 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence125 1506 1012 gene locus_tag LOCUS_12690 1506 1012 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967083.1 protein_id gnl|my_center|LOCUS_12690 2518 1514 gene locus_tag LOCUS_12700 gene dctP 2518 1514 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970021.1 protein_id gnl|my_center|LOCUS_12700 3400 2642 gene locus_tag LOCUS_12710 3400 2642 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729617.1 protein_id gnl|my_center|LOCUS_12710 3576 4559 gene locus_tag LOCUS_12720 3576 4559 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447262.1 protein_id gnl|my_center|LOCUS_12720 4581 5198 gene locus_tag LOCUS_12730 4581 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence126 <1 866 gene locus_tag LOCUS_12740 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526224.1:DegQ family serine endoprotease 880 1104 gene locus_tag LOCUS_12750 880 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 2998 1130 gene locus_tag LOCUS_12760 2998 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 5195 3114 gene locus_tag LOCUS_12770 gene pdsS 5195 3114 CDS product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 protein_id gnl|my_center|LOCUS_12770 5904 5176 gene locus_tag LOCUS_12780 gene pdsR 5904 5176 CDS product proteobacterial dedicated sortase system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence127 1265 1825 gene locus_tag LOCUS_12790 1265 1825 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695952.1 protein_id gnl|my_center|LOCUS_12790 1888 2712 gene locus_tag LOCUS_12800 1888 2712 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227672.1 protein_id gnl|my_center|LOCUS_12800 2795 4279 gene locus_tag LOCUS_12810 2795 4279 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526224.1 protein_id gnl|my_center|LOCUS_12810 4312 4920 gene locus_tag LOCUS_12820 gene petA 4312 4920 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064798.1 protein_id gnl|my_center|LOCUS_12820 <6165 4988 gene locus_tag LOCUS_12830 <6165 4988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967584.1:divalent metal cation transporter >Feature sequence128 <1 2025 gene locus_tag LOCUS_12840 <1 2025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038196.1:glycoside hydrolase family 15 protein 2037 3482 gene locus_tag LOCUS_12850 gene otsA 2037 3482 CDS product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205173.1 protein_id gnl|my_center|LOCUS_12850 3908 3528 gene locus_tag LOCUS_12860 3908 3528 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194251.1 protein_id gnl|my_center|LOCUS_12860 4396 3926 gene locus_tag LOCUS_12870 4396 3926 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194168.1 protein_id gnl|my_center|LOCUS_12870 4587 5294 gene locus_tag LOCUS_12880 4587 5294 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence129 477 1385 gene locus_tag LOCUS_12890 477 1385 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103396.1 protein_id gnl|my_center|LOCUS_12890 2078 1434 gene locus_tag LOCUS_12900 2078 1434 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 protein_id gnl|my_center|LOCUS_12900 2184 3344 gene locus_tag LOCUS_12910 2184 3344 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633142.1 protein_id gnl|my_center|LOCUS_12910 3347 4369 gene locus_tag LOCUS_12920 gene waaC 3347 4369 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 protein_id gnl|my_center|LOCUS_12920 5862 4375 gene locus_tag LOCUS_12930 5862 4375 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969004.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence130 <1 974 gene locus_tag LOCUS_12940 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033447525.1:ABC-F family ATPase 997 1677 gene locus_tag LOCUS_12950 997 1677 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_12950 1674 2990 gene locus_tag LOCUS_12960 1674 2990 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931316.1 protein_id gnl|my_center|LOCUS_12960 3137 5137 gene locus_tag LOCUS_12970 3137 5137 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence131 360 1442 gene locus_tag LOCUS_12980 gene alr 360 1442 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532720.1 protein_id gnl|my_center|LOCUS_12980 1457 2815 gene locus_tag LOCUS_12990 gene radA 1457 2815 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928233.1 protein_id gnl|my_center|LOCUS_12990 4204 2864 gene locus_tag LOCUS_13000 gene hpnE 4204 2864 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_13000 5067 4219 gene locus_tag LOCUS_13010 gene hpnD 5067 4219 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_13010 5897 5064 gene locus_tag LOCUS_13020 gene hpnC 5897 5064 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_13020 5971 6055 gene locus_tag LOCUS_t00110 5971 6055 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence132 274 2103 gene locus_tag LOCUS_13030 274 2103 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_13030 2103 3944 gene locus_tag LOCUS_13040 2103 3944 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_13040 3955 5010 gene locus_tag LOCUS_13050 3955 5010 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_13050 <6025 5101 gene locus_tag LOCUS_13060 <6025 5101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188362.1:citrate synthase >Feature sequence133 <1 993 gene locus_tag LOCUS_13070 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522912.1:phosphoenolpyruvate--protein phosphotransferase 3052 1025 gene locus_tag LOCUS_13080 3052 1025 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392706.1 protein_id gnl|my_center|LOCUS_13080 3631 3074 gene locus_tag LOCUS_13090 3631 3074 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968864.1 protein_id gnl|my_center|LOCUS_13090 4109 3708 gene locus_tag LOCUS_13100 4109 3708 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_13100 4285 4106 gene locus_tag LOCUS_13110 4285 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence134 <1 907 gene locus_tag LOCUS_13120 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009935893.1:DNA-processing protein DprA 1144 3975 gene locus_tag LOCUS_13130 1144 3975 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_13130 4425 4207 gene locus_tag LOCUS_13140 4425 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4312 4806 gene locus_tag LOCUS_13150 4312 4806 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966628.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence135 401 841 gene locus_tag LOCUS_13160 401 841 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140046606.1 protein_id gnl|my_center|LOCUS_13160 838 1536 gene locus_tag LOCUS_13170 838 1536 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390641.1 protein_id gnl|my_center|LOCUS_13170 2028 1582 gene locus_tag LOCUS_13180 2028 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2786 2067 gene locus_tag LOCUS_13190 2786 2067 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197238.1 protein_id gnl|my_center|LOCUS_13190 2888 3976 gene locus_tag LOCUS_13200 2888 3976 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 protein_id gnl|my_center|LOCUS_13200 4065 5843 gene locus_tag LOCUS_13210 gene gshA 4065 5843 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence136 1339 617 gene locus_tag LOCUS_13220 gene rph 1339 617 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_13220 2419 1511 gene locus_tag LOCUS_13230 2419 1511 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174155.1 protein_id gnl|my_center|LOCUS_13230 3447 2443 gene locus_tag LOCUS_13240 3447 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3565 4440 gene locus_tag LOCUS_13250 3565 4440 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185526.1 protein_id gnl|my_center|LOCUS_13250 4451 5098 gene locus_tag LOCUS_13260 gene gmk 4451 5098 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930442.1 protein_id gnl|my_center|LOCUS_13260 5100 5303 gene locus_tag LOCUS_13270 gene rpoZ 5100 5303 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence137 <1 1011 gene locus_tag LOCUS_13280 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941039.1:glycosyltransferase family 1 protein 1008 2495 gene locus_tag LOCUS_13290 gene glgA 1008 2495 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089199.1 protein_id gnl|my_center|LOCUS_13290 3227 2529 gene locus_tag LOCUS_13300 3227 2529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039306.1 protein_id gnl|my_center|LOCUS_13300 5095 3224 gene locus_tag LOCUS_13310 5095 3224 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195813.1 protein_id gnl|my_center|LOCUS_13310 <5914 5109 gene locus_tag LOCUS_13320 <5914 5109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966751.1:branched-chain amino acid ABC transporter permease >Feature sequence138 649 8 gene locus_tag LOCUS_13330 649 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 2561 657 gene locus_tag LOCUS_13340 2561 657 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269181.1 protein_id gnl|my_center|LOCUS_13340 3544 2591 gene locus_tag LOCUS_13350 3544 2591 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811759.1 protein_id gnl|my_center|LOCUS_13350 4006 3569 gene locus_tag LOCUS_13360 4006 3569 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063756.1 protein_id gnl|my_center|LOCUS_13360 4165 5304 gene locus_tag LOCUS_13370 4165 5304 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence139 1266 379 gene locus_tag LOCUS_13380 1266 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1634 1263 gene locus_tag LOCUS_13390 1634 1263 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881197.1 protein_id gnl|my_center|LOCUS_13390 2029 1637 gene locus_tag LOCUS_13400 gene exbB 2029 1637 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881140.1 protein_id gnl|my_center|LOCUS_13400 4359 2074 gene locus_tag LOCUS_13410 4359 2074 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920055.1 protein_id gnl|my_center|LOCUS_13410 4250 4495 gene locus_tag LOCUS_13420 4250 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 4818 4456 gene locus_tag LOCUS_13430 4818 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 4932 5813 gene locus_tag LOCUS_13440 4932 5813 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815017.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence140 1451 228 gene locus_tag LOCUS_13450 gene carA 1451 228 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_13450 2503 1691 gene locus_tag LOCUS_13460 2503 1691 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809582.1 protein_id gnl|my_center|LOCUS_13460 3319 2504 gene locus_tag LOCUS_13470 3319 2504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568207.1 protein_id gnl|my_center|LOCUS_13470 4356 3319 gene locus_tag LOCUS_13480 4356 3319 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809579.1 protein_id gnl|my_center|LOCUS_13480 5703 4462 gene locus_tag LOCUS_13490 5703 4462 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550341.1 protein_id gnl|my_center|LOCUS_13490 5885 5700 gene locus_tag LOCUS_13500 5885 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence141 730 266 gene locus_tag LOCUS_13510 730 266 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_13510 1157 786 gene locus_tag LOCUS_13520 1157 786 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_13520 1239 2444 gene locus_tag LOCUS_13530 gene alaC 1239 2444 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_13530 2446 3789 gene locus_tag LOCUS_13540 2446 3789 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_13540 3807 5219 gene locus_tag LOCUS_13550 gene thrC 3807 5219 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_13550 5282 5803 gene locus_tag LOCUS_13560 gene mobB 5282 5803 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence142 <1 903 gene locus_tag LOCUS_13570 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727331.1:TAXI family TRAP transporter solute-binding subunit 953 2932 gene locus_tag LOCUS_13580 953 2932 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316996.1 protein_id gnl|my_center|LOCUS_13580 4411 2975 gene locus_tag LOCUS_13590 gene argH 4411 2975 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191886.1 protein_id gnl|my_center|LOCUS_13590 4518 5657 gene locus_tag LOCUS_13600 4518 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence143 2331 1093 gene locus_tag LOCUS_13610 2331 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 5348 2733 gene locus_tag LOCUS_13620 5348 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 5739 5663 gene locus_tag LOCUS_t00120 5739 5663 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence144 1196 162 gene locus_tag LOCUS_13630 gene tsaD 1196 162 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811013.1 protein_id gnl|my_center|LOCUS_13630 2476 1265 gene locus_tag LOCUS_13640 2476 1265 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039866.1 protein_id gnl|my_center|LOCUS_13640 2646 3878 gene locus_tag LOCUS_13650 2646 3878 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249381.1 protein_id gnl|my_center|LOCUS_13650 5111 3912 gene locus_tag LOCUS_13660 5111 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence145 158 523 gene locus_tag LOCUS_13670 gene priB 158 523 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192181.1 protein_id gnl|my_center|LOCUS_13670 554 829 gene locus_tag LOCUS_13680 gene rpsR 554 829 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813094.1 protein_id gnl|my_center|LOCUS_13680 846 1298 gene locus_tag LOCUS_13690 gene rplI 846 1298 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931135.1 protein_id gnl|my_center|LOCUS_13690 1534 3945 gene locus_tag LOCUS_13700 1534 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3996 4958 gene locus_tag LOCUS_13710 3996 4958 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 protein_id gnl|my_center|LOCUS_13710 5661 5062 gene locus_tag LOCUS_13720 5661 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence146 <1 731 gene locus_tag LOCUS_13730 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003111532.1:nitrite reductase 748 1071 gene locus_tag LOCUS_13740 748 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1130 2230 gene locus_tag LOCUS_13750 1130 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2918 2223 gene locus_tag LOCUS_13760 2918 2223 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 protein_id gnl|my_center|LOCUS_13760 4049 2940 gene locus_tag LOCUS_13770 gene queG 4049 2940 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550792.1 protein_id gnl|my_center|LOCUS_13770 4066 4605 gene locus_tag LOCUS_13780 4066 4605 CDS product bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929706.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence147 869 75 gene locus_tag LOCUS_13790 869 75 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811028.1 protein_id gnl|my_center|LOCUS_13790 1043 1435 gene locus_tag LOCUS_13800 1043 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2232 1510 gene locus_tag LOCUS_13810 2232 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2861 2229 gene locus_tag LOCUS_13820 2861 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3247 3032 gene locus_tag LOCUS_13830 3247 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 3137 4609 gene locus_tag LOCUS_13840 3137 4609 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926358.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence148 491 1084 gene locus_tag LOCUS_13850 491 1084 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_13850 2854 1160 gene locus_tag LOCUS_13860 2854 1160 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 protein_id gnl|my_center|LOCUS_13860 3004 3777 gene locus_tag LOCUS_13870 3004 3777 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_13870 5147 3861 gene locus_tag LOCUS_13880 5147 3861 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_13880 5211 5630 gene locus_tag LOCUS_13890 5211 5630 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191805.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence149 108 968 gene locus_tag LOCUS_13900 108 968 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192869.1 protein_id gnl|my_center|LOCUS_13900 980 1810 gene locus_tag LOCUS_13910 980 1810 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 protein_id gnl|my_center|LOCUS_13910 2890 1817 gene locus_tag LOCUS_13920 gene hisC 2890 1817 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530940.1 protein_id gnl|my_center|LOCUS_13920 3959 2901 gene locus_tag LOCUS_13930 3959 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4099 5310 gene locus_tag LOCUS_13940 4099 5310 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086066.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence150 <1 1178 gene locus_tag LOCUS_13950 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001240763.1:SpoVR family protein 1658 1179 gene locus_tag LOCUS_13960 1658 1179 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944109.1 protein_id gnl|my_center|LOCUS_13960 2255 1668 gene locus_tag LOCUS_13970 gene pth 2255 1668 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931308.1 protein_id gnl|my_center|LOCUS_13970 2498 5128 gene locus_tag LOCUS_13980 2498 5128 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228248.1 protein_id gnl|my_center|LOCUS_13980 <5622 5113 gene locus_tag LOCUS_13990 <5622 5113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036313.1:multidrug effflux MFS transporter >Feature sequence151 <1 1946 gene locus_tag LOCUS_14000 <1 1946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198364.1:DNA-directed RNA polymerase subunit beta' 1966 2697 gene locus_tag LOCUS_14010 1966 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2906 3283 gene locus_tag LOCUS_14020 gene rpsL 2906 3283 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005017264.1 protein_id gnl|my_center|LOCUS_14020 3516 3187 gene locus_tag LOCUS_14030 3516 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 3515 3985 gene locus_tag LOCUS_14040 gene rpsG 3515 3985 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence152 897 331 gene locus_tag LOCUS_14050 897 331 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095346.1 protein_id gnl|my_center|LOCUS_14050 2404 911 gene locus_tag LOCUS_14060 2404 911 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970709.1 protein_id gnl|my_center|LOCUS_14060 2909 2415 gene locus_tag LOCUS_14070 2909 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 3883 2912 gene locus_tag LOCUS_14080 3883 2912 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529611.1 protein_id gnl|my_center|LOCUS_14080 4673 3963 gene locus_tag LOCUS_14090 4673 3963 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186399.1 protein_id gnl|my_center|LOCUS_14090 5106 4684 gene locus_tag LOCUS_14100 5106 4684 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189308.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence153 321 1004 gene locus_tag LOCUS_14110 321 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1040 1654 gene locus_tag LOCUS_14120 1040 1654 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098133.1 protein_id gnl|my_center|LOCUS_14120 2084 1665 gene locus_tag LOCUS_14130 2084 1665 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090571.1 protein_id gnl|my_center|LOCUS_14130 3735 2152 gene locus_tag LOCUS_14140 3735 2152 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393478.1 protein_id gnl|my_center|LOCUS_14140 5162 3747 gene locus_tag LOCUS_14150 5162 3747 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458967.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence154 652 1074 gene locus_tag LOCUS_14160 652 1074 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_14160 1096 1413 gene locus_tag LOCUS_14170 1096 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1413 1754 gene locus_tag LOCUS_14180 gene chpB 1413 1754 CDS product endoribonuclease toxin ChpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239579.1 protein_id gnl|my_center|LOCUS_14180 2452 1802 gene locus_tag LOCUS_14190 gene coq7 2452 1802 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039033.1 protein_id gnl|my_center|LOCUS_14190 2720 3808 gene locus_tag LOCUS_14200 2720 3808 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523784.1 protein_id gnl|my_center|LOCUS_14200 3928 4470 gene locus_tag LOCUS_14210 3928 4470 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815019.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence155 <1 662 gene locus_tag LOCUS_14220 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003406424.1:NYN domain-containing protein 634 2328 gene locus_tag LOCUS_14230 634 2328 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535987.1 protein_id gnl|my_center|LOCUS_14230 2333 3466 gene locus_tag LOCUS_14240 2333 3466 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527179.1 protein_id gnl|my_center|LOCUS_14240 3467 4408 gene locus_tag LOCUS_14250 3467 4408 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191549.1 protein_id gnl|my_center|LOCUS_14250 4405 5355 gene locus_tag LOCUS_14260 4405 5355 CDS product formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192441.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence156 286 8 gene locus_tag LOCUS_14270 286 8 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810975.1 protein_id gnl|my_center|LOCUS_14270 771 283 gene locus_tag LOCUS_14280 771 283 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771170.1 protein_id gnl|my_center|LOCUS_14280 2429 768 gene locus_tag LOCUS_14290 2429 768 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394067.1 protein_id gnl|my_center|LOCUS_14290 2767 2426 gene locus_tag LOCUS_14300 2767 2426 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810969.1 protein_id gnl|my_center|LOCUS_14300 <5447 2758 gene locus_tag LOCUS_14310 <5447 2758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810967.1:monovalent cation/H+ antiporter subunit A >Feature sequence157 99 1583 gene locus_tag LOCUS_14320 99 1583 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448901.1 protein_id gnl|my_center|LOCUS_14320 1639 3042 gene locus_tag LOCUS_14330 1639 3042 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222025.1 protein_id gnl|my_center|LOCUS_14330 3538 3068 gene locus_tag LOCUS_14340 3538 3068 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_14340 3600 4019 gene locus_tag LOCUS_14350 3600 4019 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811999.1 protein_id gnl|my_center|LOCUS_14350 4274 4014 gene locus_tag LOCUS_14360 4274 4014 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930778.1 protein_id gnl|my_center|LOCUS_14360 4807 4307 gene locus_tag LOCUS_14370 4807 4307 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688232.1 protein_id gnl|my_center|LOCUS_14370 <5422 4827 gene locus_tag LOCUS_14380 <5422 4827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040146.1:cytochrome c oxidase accessory protein CcoG >Feature sequence158 164 1933 gene locus_tag LOCUS_14390 164 1933 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814636.1 protein_id gnl|my_center|LOCUS_14390 1959 2639 gene locus_tag LOCUS_14400 1959 2639 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_14400 3036 2563 gene locus_tag LOCUS_14410 3036 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3074 4579 gene locus_tag LOCUS_14420 3074 4579 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481647.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence159 713 222 gene locus_tag LOCUS_14430 713 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 797 1915 gene locus_tag LOCUS_14440 gene ribBA 797 1915 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039073.1 protein_id gnl|my_center|LOCUS_14440 1919 2524 gene locus_tag LOCUS_14450 gene ribH 1919 2524 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_14450 2524 2985 gene locus_tag LOCUS_14460 gene nusB 2524 2985 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185707.1 protein_id gnl|my_center|LOCUS_14460 3011 3967 gene locus_tag LOCUS_14470 gene thiL 3011 3967 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194308.1 protein_id gnl|my_center|LOCUS_14470 3981 4451 gene locus_tag LOCUS_14480 3981 4451 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194201.1 protein_id gnl|my_center|LOCUS_14480 4477 5031 gene locus_tag LOCUS_14490 4477 5031 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence160 106 1140 gene locus_tag LOCUS_14500 106 1140 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 protein_id gnl|my_center|LOCUS_14500 1144 2808 gene locus_tag LOCUS_14510 1144 2808 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192088.1 protein_id gnl|my_center|LOCUS_14510 4593 2833 gene locus_tag LOCUS_14520 4593 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 <5381 4698 gene locus_tag LOCUS_14530 <5381 4698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526568.1:hydroxyacylglutathione hydrolase >Feature sequence161 220 1158 gene locus_tag LOCUS_14540 220 1158 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_14540 1948 1181 gene locus_tag LOCUS_14550 gene dapB 1948 1181 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 protein_id gnl|my_center|LOCUS_14550 2457 1981 gene locus_tag LOCUS_14560 2457 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2532 2960 gene locus_tag LOCUS_14570 gene fur 2532 2960 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_14570 4684 3035 gene locus_tag LOCUS_14580 gene recN 4684 3035 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550021.1 protein_id gnl|my_center|LOCUS_14580 <5372 4728 gene locus_tag LOCUS_14590 <5372 4728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004533590.1:NAD kinase >Feature sequence162 784 2667 gene locus_tag LOCUS_14600 784 2667 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_14600 2664 3260 gene locus_tag LOCUS_14610 2664 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3298 4185 gene locus_tag LOCUS_14620 gene ispE 3298 4185 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039050.1 protein_id gnl|my_center|LOCUS_14620 4262 4338 gene locus_tag LOCUS_t00130 4262 4338 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence163 375 1334 gene locus_tag LOCUS_14630 375 1334 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039637.1 protein_id gnl|my_center|LOCUS_14630 1331 2068 gene locus_tag LOCUS_14640 1331 2068 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817053.1 protein_id gnl|my_center|LOCUS_14640 3752 2103 gene locus_tag LOCUS_14650 3752 2103 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339087.1 protein_id gnl|my_center|LOCUS_14650 <5363 3756 gene locus_tag LOCUS_14660 <5363 3756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339081.1:FAD-binding protein >Feature sequence164 339 1826 gene locus_tag LOCUS_14670 339 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2278 1850 gene locus_tag LOCUS_14680 2278 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2429 2911 gene locus_tag LOCUS_14690 2429 2911 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083755.1 protein_id gnl|my_center|LOCUS_14690 2908 4011 gene locus_tag LOCUS_14700 2908 4011 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532371.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence165 1171 1683 gene locus_tag LOCUS_14710 1171 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1993 1739 gene locus_tag LOCUS_14720 1993 1739 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965812.1 protein_id gnl|my_center|LOCUS_14720 2611 2009 gene locus_tag LOCUS_14730 gene sodB 2611 2009 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185841.1 protein_id gnl|my_center|LOCUS_14730 4132 2786 gene locus_tag LOCUS_14740 gene xseA 4132 2786 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812887.1 protein_id gnl|my_center|LOCUS_14740 4497 5105 gene locus_tag LOCUS_14750 4497 5105 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence166 <1 936 gene locus_tag LOCUS_14760 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064340.1:DUF748 domain-containing protein 1624 947 gene locus_tag LOCUS_14770 1624 947 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_14770 3861 1648 gene locus_tag LOCUS_14780 3861 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4132 5199 gene locus_tag LOCUS_14790 gene aroG 4132 5199 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813056.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence167 79 3 gene locus_tag LOCUS_t00140 79 3 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 182 1864 gene locus_tag LOCUS_14800 182 1864 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_14800 2252 1836 gene locus_tag LOCUS_14810 2252 1836 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161056164.1 protein_id gnl|my_center|LOCUS_14810 2706 2299 gene locus_tag LOCUS_14820 2706 2299 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812826.1 protein_id gnl|my_center|LOCUS_14820 5157 2755 gene locus_tag LOCUS_14830 gene pheT 5157 2755 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence168 <1 657 gene locus_tag LOCUS_14840 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811259.1:sn-glycerol-3-phosphate ABC transporter permease UgpE 654 1382 gene locus_tag LOCUS_14850 gene ugpQ 654 1382 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063880.1 protein_id gnl|my_center|LOCUS_14850 1499 1882 gene locus_tag LOCUS_14860 1499 1882 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924922.1 protein_id gnl|my_center|LOCUS_14860 3477 1906 gene locus_tag LOCUS_14870 3477 1906 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550915.1 protein_id gnl|my_center|LOCUS_14870 4272 3550 gene locus_tag LOCUS_14880 gene imuA 4272 3550 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195290.1 protein_id gnl|my_center|LOCUS_14880 4924 4280 gene locus_tag LOCUS_14890 gene lexA 4924 4280 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930566.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence169 160 363 gene locus_tag LOCUS_14900 160 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 392 742 gene locus_tag LOCUS_14910 392 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 910 1221 gene locus_tag LOCUS_14920 910 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1169 2560 gene locus_tag LOCUS_14930 1169 2560 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626412.1 protein_id gnl|my_center|LOCUS_14930 2561 2692 gene locus_tag LOCUS_14940 2561 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2676 4664 gene locus_tag LOCUS_14950 2676 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 4651 4878 gene locus_tag LOCUS_14960 4651 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence170 <1 533 gene locus_tag LOCUS_14970 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105262.1:transcriptional regulator FeaR 2656 719 gene locus_tag LOCUS_14980 2656 719 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_14980 4718 2775 gene locus_tag LOCUS_14990 4718 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence171 <1 2597 gene locus_tag LOCUS_15000 <1 2597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388324.1:FAD-dependent oxidoreductase 2706 3980 gene locus_tag LOCUS_15010 gene phaZ 2706 3980 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813854.1 protein_id gnl|my_center|LOCUS_15010 3977 4558 gene locus_tag LOCUS_15020 3977 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15020 >Feature sequence172 <1 517 gene locus_tag LOCUS_15030 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010928921.1:restriction endonuclease 1475 474 gene locus_tag LOCUS_15040 1475 474 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_15040 1827 1477 gene locus_tag LOCUS_15050 1827 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1996 2484 gene locus_tag LOCUS_15060 1996 2484 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112629.1 protein_id gnl|my_center|LOCUS_15060 2676 2957 gene locus_tag LOCUS_15070 2676 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2974 4293 gene locus_tag LOCUS_15080 gene glgC 2974 4293 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532699.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence173 956 711 gene locus_tag LOCUS_15090 956 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1564 1130 gene locus_tag LOCUS_15100 1564 1130 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 protein_id gnl|my_center|LOCUS_15100 3008 1569 gene locus_tag LOCUS_15110 3008 1569 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522572.1 protein_id gnl|my_center|LOCUS_15110 3088 4179 gene locus_tag LOCUS_15120 gene lptF 3088 4179 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence174 1110 499 gene locus_tag LOCUS_15130 gene caiE 1110 499 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122865.1 protein_id gnl|my_center|LOCUS_15130 1274 2464 gene locus_tag LOCUS_15140 1274 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 3470 2484 gene locus_tag LOCUS_15150 3470 2484 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403426.1 protein_id gnl|my_center|LOCUS_15150 4378 3569 gene locus_tag LOCUS_15160 gene meaB 4378 3569 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223478.1 protein_id gnl|my_center|LOCUS_15160 5089 4424 gene locus_tag LOCUS_15170 5089 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence175 320 1129 gene locus_tag LOCUS_15180 gene map 320 1129 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_15180 1126 3687 gene locus_tag LOCUS_15190 1126 3687 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811808.1 protein_id gnl|my_center|LOCUS_15190 4476 3739 gene locus_tag LOCUS_15200 4476 3739 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_15200 <5073 4494 gene locus_tag LOCUS_15210 <5073 4494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192544.1:UTP--glucose-1-phosphate uridylyltransferase GalU >Feature sequence176 1389 46 gene locus_tag LOCUS_15220 1389 46 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530861.1 protein_id gnl|my_center|LOCUS_15220 2420 1452 gene locus_tag LOCUS_15230 2420 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 4562 2436 gene locus_tag LOCUS_15240 4562 2436 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064152.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence177 955 20 gene locus_tag LOCUS_15250 955 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1967 963 gene locus_tag LOCUS_15260 1967 963 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814852.1 protein_id gnl|my_center|LOCUS_15260 2117 2761 gene locus_tag LOCUS_15270 gene can 2117 2761 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 protein_id gnl|my_center|LOCUS_15270 2838 4130 gene locus_tag LOCUS_15280 2838 4130 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence178 133 1485 gene locus_tag LOCUS_15290 133 1485 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389729.1 protein_id gnl|my_center|LOCUS_15290 1490 1954 gene locus_tag LOCUS_15300 1490 1954 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975049.1 protein_id gnl|my_center|LOCUS_15300 1959 4364 gene locus_tag LOCUS_15310 gene xdhA 1959 4364 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence179 3277 3597 gene locus_tag LOCUS_15320 3277 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3653 4183 gene locus_tag LOCUS_15330 3653 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence180 301 1065 gene locus_tag LOCUS_15340 301 1065 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_15340 1479 1081 gene locus_tag LOCUS_15350 1479 1081 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_15350 1592 3460 gene locus_tag LOCUS_15360 1592 3460 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_15360 4001 3444 gene locus_tag LOCUS_15370 4001 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence181 <1 1175 gene locus_tag LOCUS_15380 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208029.1:sulfonate ABC transporter substrate-binding protein 1389 2105 gene locus_tag LOCUS_15390 gene tauC 1389 2105 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105423.1 protein_id gnl|my_center|LOCUS_15390 2122 2925 gene locus_tag LOCUS_15400 2122 2925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_15400 3032 3751 gene locus_tag LOCUS_15410 3032 3751 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879510.1 protein_id gnl|my_center|LOCUS_15410 3809 4729 gene locus_tag LOCUS_15420 3809 4729 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence182 453 1211 gene locus_tag LOCUS_15430 453 1211 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071334.1 protein_id gnl|my_center|LOCUS_15430 1199 1705 gene locus_tag LOCUS_15440 1199 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2687 1713 gene locus_tag LOCUS_15450 2687 1713 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_15450 3677 2709 gene locus_tag LOCUS_15460 3677 2709 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390046.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence183 140 1486 gene locus_tag LOCUS_15470 gene hisS 140 1486 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_15470 1502 2140 gene locus_tag LOCUS_15480 1502 2140 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_15480 2142 3314 gene locus_tag LOCUS_15490 gene bamB 2142 3314 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810701.1 protein_id gnl|my_center|LOCUS_15490 3321 4826 gene locus_tag LOCUS_15500 3321 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence184 1660 167 gene locus_tag LOCUS_15510 1660 167 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 protein_id gnl|my_center|LOCUS_15510 2736 1708 gene locus_tag LOCUS_15520 2736 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3215 2733 gene locus_tag LOCUS_15530 3215 2733 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970396.1 protein_id gnl|my_center|LOCUS_15530 <4949 3238 gene locus_tag LOCUS_15540 <4949 3238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072544.1:MMPL family transporter >Feature sequence185 3822 190 gene locus_tag LOCUS_15550 3822 190 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197902.1 protein_id gnl|my_center|LOCUS_15550 4636 3857 gene locus_tag LOCUS_15560 4636 3857 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814179.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence186 2 319 gene locus_tag LOCUS_15570 2 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 409 1329 gene locus_tag LOCUS_15580 409 1329 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189141.1 protein_id gnl|my_center|LOCUS_15580 1346 2008 gene locus_tag LOCUS_15590 1346 2008 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815107.1 protein_id gnl|my_center|LOCUS_15590 2082 2798 gene locus_tag LOCUS_15600 2082 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4110 2770 gene locus_tag LOCUS_15610 4110 2770 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence187 744 43 gene locus_tag LOCUS_15620 gene mtgA 744 43 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 protein_id gnl|my_center|LOCUS_15620 1707 769 gene locus_tag LOCUS_15630 gene aroE 1707 769 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_15630 2618 1704 gene locus_tag LOCUS_15640 2618 1704 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931246.1 protein_id gnl|my_center|LOCUS_15640 4599 2644 gene locus_tag LOCUS_15650 4599 2644 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014486102.1 protein_id gnl|my_center|LOCUS_15650 4926 4714 gene locus_tag LOCUS_15660 4926 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence188 1026 1760 gene locus_tag LOCUS_15670 1026 1760 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930861.1 protein_id gnl|my_center|LOCUS_15670 1757 3049 gene locus_tag LOCUS_15680 gene purD 1757 3049 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186246.1 protein_id gnl|my_center|LOCUS_15680 3046 3978 gene locus_tag LOCUS_15690 gene hemF 3046 3978 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813191.1 protein_id gnl|my_center|LOCUS_15690 4000 4701 gene locus_tag LOCUS_15700 gene nadD 4000 4701 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence189 560 33 gene locus_tag LOCUS_15710 560 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1156 557 gene locus_tag LOCUS_15720 1156 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1704 1153 gene locus_tag LOCUS_15730 1704 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2855 1704 gene locus_tag LOCUS_15740 2855 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3134 4138 gene locus_tag LOCUS_15750 3134 4138 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195868.1 protein_id gnl|my_center|LOCUS_15750 <4896 4129 gene locus_tag LOCUS_15760 <4896 4129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189298.1:tRNA 2-thiocytidine(32) synthetase TtcA >Feature sequence190 1521 853 gene locus_tag LOCUS_15770 1521 853 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192421.1 protein_id gnl|my_center|LOCUS_15770 3425 1521 gene locus_tag LOCUS_15780 3425 1521 CDS product type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550179.1 protein_id gnl|my_center|LOCUS_15780 3640 3422 gene locus_tag LOCUS_15790 3640 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence191 <1 854 gene locus_tag LOCUS_15800 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113468.1:phosphoethanolamine--lipid A transferase 1251 865 gene locus_tag LOCUS_15810 1251 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 3281 1350 gene locus_tag LOCUS_15820 gene mnmC 3281 1350 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204185.1 protein_id gnl|my_center|LOCUS_15820 3402 3746 gene locus_tag LOCUS_15830 3402 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence192 466 3159 gene locus_tag LOCUS_15840 466 3159 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_15840 3182 3967 gene locus_tag LOCUS_15850 3182 3967 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102136.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence193 2349 1525 gene locus_tag LOCUS_15860 2349 1525 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_15860 2698 3039 gene locus_tag LOCUS_15870 gene flhD 2698 3039 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198199.1 protein_id gnl|my_center|LOCUS_15870 3036 3566 gene locus_tag LOCUS_15880 gene flhC 3036 3566 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_15880 3799 4656 gene locus_tag LOCUS_15890 gene motA 3799 4656 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence194 489 836 gene locus_tag LOCUS_15900 489 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 847 1260 gene locus_tag LOCUS_15910 847 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1257 2318 gene locus_tag LOCUS_15920 1257 2318 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 protein_id gnl|my_center|LOCUS_15920 2851 2315 gene locus_tag LOCUS_15930 2851 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 4248 2866 gene locus_tag LOCUS_15940 4248 2866 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084045.1 protein_id gnl|my_center|LOCUS_15940 <4846 4319 gene locus_tag LOCUS_15950 <4846 4319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006315769.1:NAD-dependent succinate-semialdehyde dehydrogenase >Feature sequence195 <1 1232 gene locus_tag LOCUS_15960 <1 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009563408.1:MFS transporter 2443 1235 gene locus_tag LOCUS_15970 2443 1235 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 protein_id gnl|my_center|LOCUS_15970 3279 2443 gene locus_tag LOCUS_15980 3279 2443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531071.1 protein_id gnl|my_center|LOCUS_15980 4565 3276 gene locus_tag LOCUS_15990 4565 3276 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924854.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence196 <1 796 gene locus_tag LOCUS_16000 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941286.1:glycosyltransferase family 2 protein 828 1811 gene locus_tag LOCUS_16010 828 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2991 1735 gene locus_tag LOCUS_16020 2991 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 4031 2988 gene locus_tag LOCUS_16030 4031 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3220 3137 gene locus_tag LOCUS_t00150 3220 3137 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <4810 4174 gene locus_tag LOCUS_16040 <4810 4174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011787371.1:catalase >Feature sequence197 846 217 gene locus_tag LOCUS_16050 846 217 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197988.1 protein_id gnl|my_center|LOCUS_16050 1769 870 gene locus_tag LOCUS_16060 gene cyoE 1769 870 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522902.1 protein_id gnl|my_center|LOCUS_16060 2824 1766 gene locus_tag LOCUS_16070 2824 1766 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526026.1 protein_id gnl|my_center|LOCUS_16070 3542 2826 gene locus_tag LOCUS_16080 3542 2826 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553808.1 protein_id gnl|my_center|LOCUS_16080 4276 3539 gene locus_tag LOCUS_16090 4276 3539 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197992.1 protein_id gnl|my_center|LOCUS_16090 4337 4549 gene locus_tag LOCUS_16100 4337 4549 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200193.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence198 <1 1460 gene locus_tag LOCUS_16110 <1 1460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535491.1:FAD/FMN-binding oxidoreductase 1478 1948 gene locus_tag LOCUS_16120 1478 1948 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925740.1 protein_id gnl|my_center|LOCUS_16120 2100 3782 gene locus_tag LOCUS_16130 2100 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3838 4254 gene locus_tag LOCUS_16140 3838 4254 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence199 1372 872 gene locus_tag LOCUS_16150 1372 872 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811812.1 protein_id gnl|my_center|LOCUS_16150 2808 1507 gene locus_tag LOCUS_16160 2808 1507 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_16160 3466 2822 gene locus_tag LOCUS_16170 3466 2822 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818147.1 protein_id gnl|my_center|LOCUS_16170 4172 3516 gene locus_tag LOCUS_16180 4172 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence200 2135 375 gene locus_tag LOCUS_16190 2135 375 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058461124.1 protein_id gnl|my_center|LOCUS_16190 2560 2132 gene locus_tag LOCUS_16200 2560 2132 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926422.1 protein_id gnl|my_center|LOCUS_16200 3402 2578 gene locus_tag LOCUS_16210 3402 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3707 3510 gene locus_tag LOCUS_16220 3707 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 3913 3704 gene locus_tag LOCUS_16230 3913 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 4290 4102 gene locus_tag LOCUS_16240 4290 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 4676 4287 gene locus_tag LOCUS_16250 4676 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence201 2842 131 gene locus_tag LOCUS_16260 gene aceE 2842 131 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811941.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence202 3381 901 gene locus_tag LOCUS_16270 3381 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4038 3616 gene locus_tag LOCUS_16280 4038 3616 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence203 1965 691 gene locus_tag LOCUS_16290 1965 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence204 1540 203 gene locus_tag LOCUS_16300 1540 203 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113322.1 protein_id gnl|my_center|LOCUS_16300 3008 1578 gene locus_tag LOCUS_16310 3008 1578 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187957.1 protein_id gnl|my_center|LOCUS_16310 3694 3071 gene locus_tag LOCUS_16320 3694 3071 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_16320 4550 3783 gene locus_tag LOCUS_16330 4550 3783 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931558.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16330 >Feature sequence205 <1 613 gene locus_tag LOCUS_16340 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098565.1:selenium metabolism membrane protein YedE/FdhT 650 901 gene locus_tag LOCUS_16350 650 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 905 1216 gene locus_tag LOCUS_16360 905 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1227 1484 gene locus_tag LOCUS_16370 1227 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1481 1690 gene locus_tag LOCUS_16380 1481 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1761 3236 gene locus_tag LOCUS_16390 1761 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3256 4494 gene locus_tag LOCUS_16400 3256 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence206 1955 909 gene locus_tag LOCUS_16410 1955 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 2759 1992 gene locus_tag LOCUS_16420 2759 1992 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943078.1 protein_id gnl|my_center|LOCUS_16420 3592 2756 gene locus_tag LOCUS_16430 3592 2756 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_16430 4393 3731 gene locus_tag LOCUS_16440 4393 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence207 2864 1140 gene locus_tag LOCUS_16450 gene pilB 2864 1140 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221967.1 protein_id gnl|my_center|LOCUS_16450 4354 3047 gene locus_tag LOCUS_16460 4354 3047 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194395.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence208 <1 1056 gene locus_tag LOCUS_16470 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929707.1:class II fumarate hydratase 1438 998 gene locus_tag LOCUS_16480 1438 998 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524671.1 protein_id gnl|my_center|LOCUS_16480 1448 3343 gene locus_tag LOCUS_16490 1448 3343 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036668.1 protein_id gnl|my_center|LOCUS_16490 3340 4188 gene locus_tag LOCUS_16500 3340 4188 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921637.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence209 4586 3879 gene locus_tag LOCUS_16510 4586 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence210 <1 1698 gene locus_tag LOCUS_16520 <1 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813105.1:1-deoxy-D-xylulose-5-phosphate synthase 1730 2542 gene locus_tag LOCUS_16530 gene folE2 1730 2542 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014580530.1 protein_id gnl|my_center|LOCUS_16530 3505 2597 gene locus_tag LOCUS_16540 3505 2597 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191750.1 protein_id gnl|my_center|LOCUS_16540 <4543 3519 gene locus_tag LOCUS_16550 <4543 3519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193921.1:bifunctional UDP-4-keto-pentose/UDP-xylose synthase >Feature sequence211 784 302 gene locus_tag LOCUS_16560 gene bfr 784 302 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188572.1 protein_id gnl|my_center|LOCUS_16560 914 1717 gene locus_tag LOCUS_16570 gene lgt 914 1717 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_16570 1754 3271 gene locus_tag LOCUS_16580 1754 3271 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064005.1 protein_id gnl|my_center|LOCUS_16580 4087 3281 gene locus_tag LOCUS_16590 4087 3281 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813022.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence212 2152 278 gene locus_tag LOCUS_16600 2152 278 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204928.1 protein_id gnl|my_center|LOCUS_16600 <4506 2549 gene locus_tag LOCUS_16610 <4506 2549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530052.1:thioredoxin family protein >Feature sequence213 <1 1450 gene locus_tag LOCUS_16620 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521705.1:valine--tRNA ligase 2062 1520 gene locus_tag LOCUS_16630 2062 1520 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_16630 2618 2091 gene locus_tag LOCUS_16640 2618 2091 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089256.1 protein_id gnl|my_center|LOCUS_16640 3268 2615 gene locus_tag LOCUS_16650 3268 2615 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550965.1 protein_id gnl|my_center|LOCUS_16650 <4499 3309 gene locus_tag LOCUS_16660 <4499 3309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004204967.1:alanine--tRNA ligase >Feature sequence214 <1 915 gene locus_tag LOCUS_16670 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924829.1:sigma-54 dependent transcriptional regulator 2091 940 gene locus_tag LOCUS_16680 gene alkT 2091 940 CDS product rubredoxin-NAD(+) reductase AlkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114369.1 protein_id gnl|my_center|LOCUS_16680 2286 2107 gene locus_tag LOCUS_16690 gene rubA 2286 2107 CDS product rubredoxin RubA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760495.1 protein_id gnl|my_center|LOCUS_16690 2832 2344 gene locus_tag LOCUS_16700 2832 2344 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143723.1 protein_id gnl|my_center|LOCUS_16700 2975 3922 gene locus_tag LOCUS_16710 gene oxyR 2975 3922 CDS product LysR family transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117503.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence215 744 241 gene locus_tag LOCUS_16720 744 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929589.1 protein_id gnl|my_center|LOCUS_16720 853 1185 gene locus_tag LOCUS_16730 853 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1828 1169 gene locus_tag LOCUS_16740 1828 1169 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105540.1 protein_id gnl|my_center|LOCUS_16740 1934 2941 gene locus_tag LOCUS_16750 1934 2941 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618838.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence216 976 341 gene locus_tag LOCUS_16760 976 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2572 1229 gene locus_tag LOCUS_16770 gene ugpB 2572 1229 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039943.1 protein_id gnl|my_center|LOCUS_16770 2705 3589 gene locus_tag LOCUS_16780 2705 3589 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390908.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence217 831 172 gene locus_tag LOCUS_16790 831 172 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_16790 1160 3079 gene locus_tag LOCUS_16800 gene mnmG 1160 3079 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818282.1 protein_id gnl|my_center|LOCUS_16800 3102 3815 gene locus_tag LOCUS_16810 gene rsmG 3102 3815 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202905.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence218 428 913 gene locus_tag LOCUS_16820 428 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1246 1716 gene locus_tag LOCUS_16830 1246 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2044 1754 gene locus_tag LOCUS_16840 2044 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2423 3412 gene locus_tag LOCUS_16850 gene istA 2423 3412 CDS product IS21-like element ISPsy4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551322.1 protein_id gnl|my_center|LOCUS_16850 3409 4194 gene locus_tag LOCUS_16860 gene istB 3409 4194 CDS product IS21-like element ISPsy4 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005741073.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence219 121 1176 gene locus_tag LOCUS_16870 121 1176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815923.1 protein_id gnl|my_center|LOCUS_16870 1173 2459 gene locus_tag LOCUS_16880 1173 2459 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 protein_id gnl|my_center|LOCUS_16880 2475 3368 gene locus_tag LOCUS_16890 2475 3368 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 protein_id gnl|my_center|LOCUS_16890 3365 4192 gene locus_tag LOCUS_16900 3365 4192 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815929.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence220 148 1218 gene locus_tag LOCUS_16910 gene murG 148 1218 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_16910 1215 2618 gene locus_tag LOCUS_16920 gene murC 1215 2618 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522018.1 protein_id gnl|my_center|LOCUS_16920 2608 3579 gene locus_tag LOCUS_16930 2608 3579 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_16930 3576 4364 gene locus_tag LOCUS_16940 3576 4364 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814570.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence221 405 1001 gene locus_tag LOCUS_16950 405 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1016 1225 gene locus_tag LOCUS_16960 1016 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1222 2160 gene locus_tag LOCUS_16970 1222 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 2400 2176 gene locus_tag LOCUS_16980 2400 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2672 2749 gene locus_tag LOCUS_t00160 2672 2749 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence222 <1 662 gene locus_tag LOCUS_16990 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477129.1:AarF/ABC1/UbiB kinase family protein 1412 675 gene locus_tag LOCUS_17000 1412 675 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083847.1 protein_id gnl|my_center|LOCUS_17000 1767 1417 gene locus_tag LOCUS_17010 1767 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2456 1803 gene locus_tag LOCUS_17020 2456 1803 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 protein_id gnl|my_center|LOCUS_17020 2589 3902 gene locus_tag LOCUS_17030 2589 3902 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_17030 4084 3923 gene locus_tag LOCUS_17040 4084 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence223 <1 1145 gene locus_tag LOCUS_17050 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930377.1:substrate-binding domain-containing protein 1316 2071 gene locus_tag LOCUS_17060 gene modA 1316 2071 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195689.1 protein_id gnl|my_center|LOCUS_17060 2089 2763 gene locus_tag LOCUS_17070 gene modB 2089 2763 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 protein_id gnl|my_center|LOCUS_17070 2774 3475 gene locus_tag LOCUS_17080 2774 3475 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 protein_id gnl|my_center|LOCUS_17080 3507 4280 gene locus_tag LOCUS_17090 3507 4280 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818535.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence224 279 542 gene locus_tag LOCUS_17100 279 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 687 601 gene locus_tag LOCUS_t00170 687 601 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1409 777 gene locus_tag LOCUS_17110 1409 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2749 1391 gene locus_tag LOCUS_17120 2749 1391 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_17120 3965 2751 gene locus_tag LOCUS_17130 3965 2751 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189668.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence225 696 1898 gene locus_tag LOCUS_17140 696 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1961 3316 gene locus_tag LOCUS_17150 1961 3316 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063972.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence226 <1 551 gene locus_tag LOCUS_17160 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088353.1:glutathione S-transferase N-terminal domain-containing protein 1029 556 gene locus_tag LOCUS_17170 1029 556 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185972.1 protein_id gnl|my_center|LOCUS_17170 1154 2218 gene locus_tag LOCUS_17180 gene mnmH 1154 2218 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_17180 4202 2286 gene locus_tag LOCUS_17190 4202 2286 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191640.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence227 1334 396 gene locus_tag LOCUS_17200 1334 396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_17200 1645 1331 gene locus_tag LOCUS_17210 1645 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 2340 1708 gene locus_tag LOCUS_17220 2340 1708 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_17220 3152 2337 gene locus_tag LOCUS_17230 3152 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3619 3149 gene locus_tag LOCUS_17240 gene mlaD 3619 3149 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17240 <4303 3665 gene locus_tag LOCUS_17250 <4303 3665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199929.1:lipid asymmetry maintenance ABC transporter permease subunit MlaE >Feature sequence228 109 1218 gene locus_tag LOCUS_17260 109 1218 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_17260 1597 1259 gene locus_tag LOCUS_17270 1597 1259 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932532.1 protein_id gnl|my_center|LOCUS_17270 1867 2373 gene locus_tag LOCUS_17280 1867 2373 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087757.1 protein_id gnl|my_center|LOCUS_17280 2370 3302 gene locus_tag LOCUS_17290 2370 3302 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815555.1 protein_id gnl|my_center|LOCUS_17290 3372 4028 gene locus_tag LOCUS_17300 3372 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 4268 4062 gene locus_tag LOCUS_17310 4268 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence229 240 2126 gene locus_tag LOCUS_17320 240 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2137 3534 gene locus_tag LOCUS_17330 gene zraR 2137 3534 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368806.1 protein_id gnl|my_center|LOCUS_17330 3785 4108 gene locus_tag LOCUS_17340 3785 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence230 <1 2075 gene locus_tag LOCUS_17350 <1 2075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014917883.1:ATP-dependent DNA helicase RecG 3060 2095 gene locus_tag LOCUS_17360 3060 2095 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036918.1 protein_id gnl|my_center|LOCUS_17360 3108 4052 gene locus_tag LOCUS_17370 3108 4052 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence231 12 1307 gene locus_tag LOCUS_17380 12 1307 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040549.1 protein_id gnl|my_center|LOCUS_17380 1322 2275 gene locus_tag LOCUS_17390 1322 2275 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_17390 2592 2254 gene locus_tag LOCUS_17400 2592 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3173 2601 gene locus_tag LOCUS_17410 3173 2601 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194943.1 protein_id gnl|my_center|LOCUS_17410 3741 3313 gene locus_tag LOCUS_17420 3741 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 4257 4048 gene locus_tag LOCUS_17430 4257 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence232 893 135 gene locus_tag LOCUS_17440 893 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 2949 1072 gene locus_tag LOCUS_17450 gene typA 2949 1072 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810554.1 protein_id gnl|my_center|LOCUS_17450 3886 2930 gene locus_tag LOCUS_17460 gene truB 3886 2930 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence233 <1 502 gene locus_tag LOCUS_17470 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877401.1:flavodoxin family protein 682 918 gene locus_tag LOCUS_17480 682 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 921 1907 gene locus_tag LOCUS_17490 921 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1907 3658 gene locus_tag LOCUS_17500 1907 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 <4205 3679 gene locus_tag LOCUS_17510 <4205 3679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224369.1:methylmalonyl-CoA mutase family protein >Feature sequence234 <1 1848 gene locus_tag LOCUS_17520 <1 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257348.1:BTAD domain-containing putative transcriptional regulator 2387 1779 gene locus_tag LOCUS_17530 2387 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2707 2384 gene locus_tag LOCUS_17540 2707 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence235 1951 917 gene locus_tag LOCUS_17550 gene fmt 1951 917 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549892.1 protein_id gnl|my_center|LOCUS_17550 2498 1992 gene locus_tag LOCUS_17560 gene def 2498 1992 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525852.1 protein_id gnl|my_center|LOCUS_17560 2659 3753 gene locus_tag LOCUS_17570 2659 3753 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence236 1442 789 gene locus_tag LOCUS_17580 gene adk 1442 789 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_17580 2546 1674 gene locus_tag LOCUS_17590 gene kdsB 2546 1674 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_17590 2773 2567 gene locus_tag LOCUS_17600 2773 2567 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196455.1 protein_id gnl|my_center|LOCUS_17600 3794 2754 gene locus_tag LOCUS_17610 gene lpxK 3794 2754 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064091.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence237 451 182 gene locus_tag LOCUS_17620 gene rpsO 451 182 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_17620 1920 577 gene locus_tag LOCUS_17630 1920 577 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_17630 3467 1920 gene locus_tag LOCUS_17640 3467 1920 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence238 <1 1672 gene locus_tag LOCUS_17650 <1 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879591.1:thiamine pyrophosphate-binding protein 1683 2594 gene locus_tag LOCUS_17660 1683 2594 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_17660 2591 3541 gene locus_tag LOCUS_17670 2591 3541 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17670 >Feature sequence239 88 12 gene locus_tag LOCUS_t00180 88 12 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1495 119 gene locus_tag LOCUS_17680 gene glmM 1495 119 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_17680 2425 1577 gene locus_tag LOCUS_17690 gene folP 2425 1577 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_17690 <4123 2520 gene locus_tag LOCUS_17700 <4123 2520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930174.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence240 1257 145 gene locus_tag LOCUS_17710 gene rodA 1257 145 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 protein_id gnl|my_center|LOCUS_17710 3200 1254 gene locus_tag LOCUS_17720 gene mrdA 3200 1254 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_17720 3738 3223 gene locus_tag LOCUS_17730 gene mreD 3738 3223 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence241 <1 1244 gene locus_tag LOCUS_17740 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965457.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 1381 2949 gene locus_tag LOCUS_17750 1381 2949 CDS product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941870.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence242 35 568 gene locus_tag LOCUS_17760 gene gmhB 35 568 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814404.1 protein_id gnl|my_center|LOCUS_17760 568 1350 gene locus_tag LOCUS_17770 568 1350 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064981.1 protein_id gnl|my_center|LOCUS_17770 1347 2216 gene locus_tag LOCUS_17780 1347 2216 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_17780 2257 2652 gene locus_tag LOCUS_17790 gene gloA 2257 2652 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096923.1 protein_id gnl|my_center|LOCUS_17790 3131 2610 gene locus_tag LOCUS_17800 3131 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 <4092 3290 gene locus_tag LOCUS_17810 <4092 3290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113212.1:16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA >Feature sequence243 147 1199 gene locus_tag LOCUS_17820 gene lpxD 147 1199 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_17820 1196 1678 gene locus_tag LOCUS_17830 gene fabZ 1196 1678 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811776.1 protein_id gnl|my_center|LOCUS_17830 1687 2637 gene locus_tag LOCUS_17840 1687 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2647 3816 gene locus_tag LOCUS_17850 gene lpxB 2647 3816 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192608.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence244 490 2085 gene locus_tag LOCUS_17860 490 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2100 3020 gene locus_tag LOCUS_17870 2100 3020 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193435.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence245 458 297 gene locus_tag LOCUS_17880 458 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 912 523 gene locus_tag LOCUS_17890 912 523 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818201.1 protein_id gnl|my_center|LOCUS_17890 1667 945 gene locus_tag LOCUS_17900 1667 945 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_17900 2806 1958 gene locus_tag LOCUS_17910 2806 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 3662 2862 gene locus_tag LOCUS_17920 3662 2862 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence246 270 1427 gene locus_tag LOCUS_17930 gene pseC 270 1427 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_17930 1424 2125 gene locus_tag LOCUS_17940 gene pseF 1424 2125 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_17940 2122 3642 gene locus_tag LOCUS_17950 2122 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence247 384 587 gene locus_tag LOCUS_17960 384 587 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812875.1 protein_id gnl|my_center|LOCUS_17960 1110 676 gene locus_tag LOCUS_17970 1110 676 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066553.1 protein_id gnl|my_center|LOCUS_17970 2249 1119 gene locus_tag LOCUS_17980 2249 1119 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880477.1 protein_id gnl|my_center|LOCUS_17980 2484 3707 gene locus_tag LOCUS_17990 gene egtB 2484 3707 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence248 429 1418 gene locus_tag LOCUS_18000 429 1418 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064892.1 protein_id gnl|my_center|LOCUS_18000 2103 1405 gene locus_tag LOCUS_18010 2103 1405 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814436.1 protein_id gnl|my_center|LOCUS_18010 <4006 2169 gene locus_tag LOCUS_18020 <4006 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524472.1:UvrD-helicase domain-containing protein >Feature sequence249 434 1435 gene locus_tag LOCUS_18030 434 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2777 1449 gene locus_tag LOCUS_18040 gene paaF 2777 1449 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527791.1 protein_id gnl|my_center|LOCUS_18040 2942 3718 gene locus_tag LOCUS_18050 2942 3718 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence250 909 91 gene locus_tag LOCUS_18060 gene esaR 909 91 CDS product response regulator transcription factor EsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935896.1 protein_id gnl|my_center|LOCUS_18060 3250 884 gene locus_tag LOCUS_18070 3250 884 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_18070 3789 3202 gene locus_tag LOCUS_18080 3789 3202 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence251 734 1420 gene locus_tag LOCUS_18090 gene rpiA 734 1420 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813244.1 protein_id gnl|my_center|LOCUS_18090 1511 2098 gene locus_tag LOCUS_18100 1511 2098 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123659.1 protein_id gnl|my_center|LOCUS_18100 2417 2145 gene locus_tag LOCUS_18110 2417 2145 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_18110 3826 2426 gene locus_tag LOCUS_18120 gene argA 3826 2426 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence252 >Feature sequence253 183 827 gene locus_tag LOCUS_18130 gene hisG 183 827 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_18130 824 2140 gene locus_tag LOCUS_18140 gene hisD 824 2140 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_18140 2137 3222 gene locus_tag LOCUS_18150 gene hisC 2137 3222 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_18150 3266 3853 gene locus_tag LOCUS_18160 gene hisB 3266 3853 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199911.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence254 2239 1820 gene locus_tag LOCUS_18170 2239 1820 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_18170 2386 2769 gene locus_tag LOCUS_18180 2386 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence255 <1 853 gene locus_tag LOCUS_18190 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930517.1:TRAP transporter large permease subunit 855 2177 gene locus_tag LOCUS_18200 855 2177 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_18200 2207 2488 gene locus_tag LOCUS_18210 2207 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 2510 3967 gene locus_tag LOCUS_18220 2510 3967 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219613.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence256 778 152 gene locus_tag LOCUS_18230 gene lptA 778 152 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 protein_id gnl|my_center|LOCUS_18230 1431 835 gene locus_tag LOCUS_18240 1431 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1970 1428 gene locus_tag LOCUS_18250 1970 1428 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 protein_id gnl|my_center|LOCUS_18250 2959 1970 gene locus_tag LOCUS_18260 2959 1970 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_18260 3075 3872 gene locus_tag LOCUS_18270 3075 3872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence257 1232 471 gene locus_tag LOCUS_18280 1232 471 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525670.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence258 951 169 gene locus_tag LOCUS_18290 gene menB 951 169 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_18290 1520 1014 gene locus_tag LOCUS_18300 gene moaC 1520 1014 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_18300 1614 3062 gene locus_tag LOCUS_18310 1614 3062 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 protein_id gnl|my_center|LOCUS_18310 3618 3070 gene locus_tag LOCUS_18320 3618 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence259 1472 204 gene locus_tag LOCUS_18330 1472 204 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191166.1 protein_id gnl|my_center|LOCUS_18330 2818 1523 gene locus_tag LOCUS_18340 gene tilS 2818 1523 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524749.1 protein_id gnl|my_center|LOCUS_18340 3881 2913 gene locus_tag LOCUS_18350 3881 2913 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence260 1638 658 gene locus_tag LOCUS_18360 1638 658 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775988.1 protein_id gnl|my_center|LOCUS_18360 1740 2939 gene locus_tag LOCUS_18370 1740 2939 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_18370 2954 3130 gene locus_tag LOCUS_18380 2954 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 <3912 3172 gene locus_tag LOCUS_18390 <3912 3172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061453.1:slipin family protein >Feature sequence261 314 757 gene locus_tag LOCUS_18400 314 757 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_18400 796 1113 gene locus_tag LOCUS_18410 796 1113 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200395.1 protein_id gnl|my_center|LOCUS_18410 1151 1528 gene locus_tag LOCUS_18420 1151 1528 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185460.1 protein_id gnl|my_center|LOCUS_18420 1556 2059 gene locus_tag LOCUS_18430 1556 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2405 1959 gene locus_tag LOCUS_18440 2405 1959 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187137.1 protein_id gnl|my_center|LOCUS_18440 2505 3182 gene locus_tag LOCUS_18450 2505 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 <3904 3202 gene locus_tag LOCUS_18460 <3904 3202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112491.1:NAD-dependent deacylase >Feature sequence262 <1 1221 gene locus_tag LOCUS_18470 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091320.1:DUF1329 domain-containing protein 1301 3133 gene locus_tag LOCUS_18480 1301 3133 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence263 423 1598 gene locus_tag LOCUS_18490 423 1598 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_18490 3891 1645 gene locus_tag LOCUS_18500 3891 1645 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974776.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence264 3 638 gene locus_tag LOCUS_18510 gene hisH 3 638 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 protein_id gnl|my_center|LOCUS_18510 738 1478 gene locus_tag LOCUS_18520 gene hisA 738 1478 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_18520 1481 2242 gene locus_tag LOCUS_18530 gene hisF 1481 2242 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_18530 2253 2669 gene locus_tag LOCUS_18540 gene hisI 2253 2669 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_18540 2666 3058 gene locus_tag LOCUS_18550 2666 3058 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927225.1 protein_id gnl|my_center|LOCUS_18550 3055 3438 gene locus_tag LOCUS_18560 3055 3438 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815807.1 protein_id gnl|my_center|LOCUS_18560 3451 3663 gene locus_tag LOCUS_18570 gene tatA 3451 3663 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence265 700 53 gene locus_tag LOCUS_18580 gene purN 700 53 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522603.1 protein_id gnl|my_center|LOCUS_18580 790 1818 gene locus_tag LOCUS_18590 790 1818 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence266 460 1113 gene locus_tag LOCUS_18600 460 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1106 1774 gene locus_tag LOCUS_18610 1106 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1858 2793 gene locus_tag LOCUS_18620 gene rlmJ 1858 2793 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926714.1 protein_id gnl|my_center|LOCUS_18620 3281 2775 gene locus_tag LOCUS_18630 3281 2775 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762644.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence267 841 326 gene locus_tag LOCUS_18640 gene accB 841 326 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039290.1 protein_id gnl|my_center|LOCUS_18640 2316 856 gene locus_tag LOCUS_18650 2316 856 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039291.1 protein_id gnl|my_center|LOCUS_18650 3049 2492 gene locus_tag LOCUS_18660 3049 2492 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082696.1 protein_id gnl|my_center|LOCUS_18660 <3841 3115 gene locus_tag LOCUS_18670 <3841 3115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112802.1:multidrug efflux transporter outer membrane subunit OprJ >Feature sequence268 <1 856 gene locus_tag LOCUS_18680 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140090.1:malate synthase G >Feature sequence269 <1 789 gene locus_tag LOCUS_18690 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189943.1:gamma-glutamyl-gamma-aminobutyrate hydrolase 1678 797 gene locus_tag LOCUS_18700 1678 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2954 1707 gene locus_tag LOCUS_18710 gene clsB 2954 1707 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_18710 <3831 3010 gene locus_tag LOCUS_18720 <3831 3010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807040.1:endonuclease/exonuclease/phosphatase family protein >Feature sequence270 1017 508 gene locus_tag LOCUS_18730 1017 508 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930615.1 protein_id gnl|my_center|LOCUS_18730 1985 1017 gene locus_tag LOCUS_18740 1985 1017 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 protein_id gnl|my_center|LOCUS_18740 2173 2736 gene locus_tag LOCUS_18750 2173 2736 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106702718.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence271 1285 2097 gene locus_tag LOCUS_18760 1285 2097 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 protein_id gnl|my_center|LOCUS_18760 3496 2099 gene locus_tag LOCUS_18770 3496 2099 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence272 <1 1048 gene locus_tag LOCUS_18780 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114249.1:AMP-binding protein 1053 2810 gene locus_tag LOCUS_18790 1053 2810 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_18790 2908 3123 gene locus_tag LOCUS_18800 2908 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 <3804 3130 gene locus_tag LOCUS_18810 <3804 3130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102956.1:metallophosphoesterase family protein >Feature sequence273 1591 488 gene locus_tag LOCUS_18820 gene pheA 1591 488 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 protein_id gnl|my_center|LOCUS_18820 2632 1667 gene locus_tag LOCUS_18830 2632 1667 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088482926.1 protein_id gnl|my_center|LOCUS_18830 <3796 2660 gene locus_tag LOCUS_18840 <3796 2660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926826.1:DNA gyrase subunit A >Feature sequence274 3177 1324 gene locus_tag LOCUS_18850 3177 1324 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence275 <1 2630 gene locus_tag LOCUS_18860 <1 2630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809588.1:carbamoyl-phosphate synthase large subunit 2764 3240 gene locus_tag LOCUS_18870 gene greA 2764 3240 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence276 <1 1357 gene locus_tag LOCUS_18880 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040766.1:peptide chain release factor 3 1453 3522 gene locus_tag LOCUS_18890 gene tkt 1453 3522 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064313.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence277 1305 1802 gene locus_tag LOCUS_18900 1305 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 <3728 1827 gene locus_tag LOCUS_18910 <3728 1827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105498.1:RHS repeat-associated core domain-containing protein >Feature sequence278 50 712 gene locus_tag LOCUS_18920 50 712 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_18920 2146 743 gene locus_tag LOCUS_18930 2146 743 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191317219.1 protein_id gnl|my_center|LOCUS_18930 3297 2143 gene locus_tag LOCUS_18940 3297 2143 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence279 1221 2360 gene locus_tag LOCUS_18950 1221 2360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_18950 3099 2386 gene locus_tag LOCUS_18960 3099 2386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446410.1 protein_id gnl|my_center|LOCUS_18960 <3696 3135 gene locus_tag LOCUS_18970 <3696 3135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083886.1:ABC transporter ATP-binding protein >Feature sequence280 <1 573 gene locus_tag LOCUS_18980 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811948.1:bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD 596 2722 gene locus_tag LOCUS_18990 596 2722 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191126.1 protein_id gnl|my_center|LOCUS_18990 2715 3422 gene locus_tag LOCUS_19000 2715 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence281 1385 495 gene locus_tag LOCUS_19010 gene focA 1385 495 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263633.1 protein_id gnl|my_center|LOCUS_19010 1610 1900 gene locus_tag LOCUS_19020 1610 1900 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082959.1 protein_id gnl|my_center|LOCUS_19020 1948 2514 gene locus_tag LOCUS_19030 1948 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2660 3163 gene locus_tag LOCUS_19040 2660 3163 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193764.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence282 <1 824 gene locus_tag LOCUS_19050 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478687.1:EAL domain-containing protein 1467 856 gene locus_tag LOCUS_19060 1467 856 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 protein_id gnl|my_center|LOCUS_19060 1895 1476 gene locus_tag LOCUS_19070 1895 1476 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522995.1 protein_id gnl|my_center|LOCUS_19070 <3686 1998 gene locus_tag LOCUS_19080 <3686 1998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941614.1:EAL domain-containing protein >Feature sequence283 716 222 gene locus_tag LOCUS_19090 716 222 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821327.1 protein_id gnl|my_center|LOCUS_19090 1162 713 gene locus_tag LOCUS_19100 gene dut 1162 713 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812576.1 protein_id gnl|my_center|LOCUS_19100 2361 1159 gene locus_tag LOCUS_19110 gene coaBC 2361 1159 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186216.1 protein_id gnl|my_center|LOCUS_19110 2449 2916 gene locus_tag LOCUS_19120 2449 2916 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 protein_id gnl|my_center|LOCUS_19120 3465 2974 gene locus_tag LOCUS_19130 gene lspA 3465 2974 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence284 41 655 gene locus_tag LOCUS_19140 41 655 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930988.1 protein_id gnl|my_center|LOCUS_19140 652 1812 gene locus_tag LOCUS_19150 gene sucC 652 1812 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189251.1 protein_id gnl|my_center|LOCUS_19150 1827 2708 gene locus_tag LOCUS_19160 gene sucD 1827 2708 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550822.1 protein_id gnl|my_center|LOCUS_19160 2721 3440 gene locus_tag LOCUS_19170 2721 3440 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930986.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence285 3025 1511 gene locus_tag LOCUS_19180 3025 1511 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547316.1 protein_id gnl|my_center|LOCUS_19180 <3649 3062 gene locus_tag LOCUS_19190 <3649 3062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039977.1:TRAP transporter large permease subunit >Feature sequence286 >Feature sequence287 1312 1082 gene locus_tag LOCUS_19200 1312 1082 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861284.1 protein_id gnl|my_center|LOCUS_19200 2217 1438 gene locus_tag LOCUS_19210 2217 1438 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776439.1 protein_id gnl|my_center|LOCUS_19210 <3591 2240 gene locus_tag LOCUS_19220 <3591 2240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113728.1:dihydrolipoamide acetyltransferase family protein >Feature sequence288 1584 574 gene locus_tag LOCUS_19230 1584 574 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088245.1 protein_id gnl|my_center|LOCUS_19230 1708 1986 gene locus_tag LOCUS_19240 1708 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2130 3248 gene locus_tag LOCUS_19250 2130 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence289 751 2 gene locus_tag LOCUS_19260 751 2 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372679.1 protein_id gnl|my_center|LOCUS_19260 1809 748 gene locus_tag LOCUS_19270 gene mtnA 1809 748 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_19270 1993 2760 gene locus_tag LOCUS_19280 1993 2760 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence290 310 122 gene locus_tag LOCUS_19290 310 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2026 386 gene locus_tag LOCUS_19300 2026 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2366 2124 gene locus_tag LOCUS_19310 2366 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3238 2480 gene locus_tag LOCUS_19320 3238 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence291 1337 2872 gene locus_tag LOCUS_19330 1337 2872 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 protein_id gnl|my_center|LOCUS_19330 2884 3270 gene locus_tag LOCUS_19340 2884 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence292 502 122 gene locus_tag LOCUS_19350 gene apaG 502 122 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186878.1 protein_id gnl|my_center|LOCUS_19350 603 1295 gene locus_tag LOCUS_19360 gene rpe 603 1295 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522003.1 protein_id gnl|my_center|LOCUS_19360 1300 1983 gene locus_tag LOCUS_19370 1300 1983 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence293 983 492 gene locus_tag LOCUS_19380 983 492 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_19380 1758 1114 gene locus_tag LOCUS_19390 1758 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_19390 1932 2534 gene locus_tag LOCUS_19400 gene slmA 1932 2534 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417043.1 protein_id gnl|my_center|LOCUS_19400 <3492 2571 gene locus_tag LOCUS_19410 <3492 2571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087406.1:chaperonin GroEL >Feature sequence294 632 105 gene locus_tag LOCUS_19420 632 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 1073 651 gene locus_tag LOCUS_19430 1073 651 CDS product DUF1924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337164.1 protein_id gnl|my_center|LOCUS_19430 2092 1178 gene locus_tag LOCUS_19440 2092 1178 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173331.1 protein_id gnl|my_center|LOCUS_19440 2217 2675 gene locus_tag LOCUS_19450 2217 2675 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530635.1 protein_id gnl|my_center|LOCUS_19450 <3470 2717 gene locus_tag LOCUS_19460 <3470 2717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940229.1:bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase >Feature sequence295 1594 56 gene locus_tag LOCUS_19470 1594 56 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815305.1 protein_id gnl|my_center|LOCUS_19470 1582 2307 gene locus_tag LOCUS_19480 1582 2307 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196420.1 protein_id gnl|my_center|LOCUS_19480 <3468 2347 gene locus_tag LOCUS_19490 <3468 2347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930546.1:ATP-binding cassette domain-containing protein >Feature sequence296 <1 2559 gene locus_tag LOCUS_19500 <1 2559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191961.1:exodeoxyribonuclease V subunit gamma >Feature sequence297 146 763 gene locus_tag LOCUS_19510 146 763 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464880.1 protein_id gnl|my_center|LOCUS_19510 1651 770 gene locus_tag LOCUS_19520 1651 770 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_19520 3323 1659 gene locus_tag LOCUS_19530 3323 1659 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812128.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence298 1038 424 gene locus_tag LOCUS_19540 1038 424 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524381.1 protein_id gnl|my_center|LOCUS_19540 1648 1061 gene locus_tag LOCUS_19550 1648 1061 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446211.1 protein_id gnl|my_center|LOCUS_19550 2098 1745 gene locus_tag LOCUS_19560 2098 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3294 2095 gene locus_tag LOCUS_19570 3294 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence299 632 1114 gene locus_tag LOCUS_19580 632 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 <3412 1124 gene locus_tag LOCUS_19590 <3412 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202033.1:ATP-dependent RNA helicase HrpA >Feature sequence300 1579 719 gene locus_tag LOCUS_19600 1579 719 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 protein_id gnl|my_center|LOCUS_19600 1847 2350 gene locus_tag LOCUS_19610 1847 2350 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086612.1 protein_id gnl|my_center|LOCUS_19610 2795 2478 gene locus_tag LOCUS_19620 2795 2478 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036266.1 protein_id gnl|my_center|LOCUS_19620 3019 2792 gene locus_tag LOCUS_19630 3019 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3129 3287 gene locus_tag LOCUS_19640 3129 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence301 210 1238 gene locus_tag LOCUS_19650 210 1238 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039293.1 protein_id gnl|my_center|LOCUS_19650 1732 1319 gene locus_tag LOCUS_19660 1732 1319 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398820.1 protein_id gnl|my_center|LOCUS_19660 2473 1772 gene locus_tag LOCUS_19670 2473 1772 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence302 2197 521 gene locus_tag LOCUS_19680 2197 521 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205437.1 protein_id gnl|my_center|LOCUS_19680 2467 2201 gene locus_tag LOCUS_19690 2467 2201 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_19690 2858 2454 gene locus_tag LOCUS_19700 2858 2454 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_19700 <3384 2855 gene locus_tag LOCUS_19710 <3384 2855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198015.1:glutathione synthase >Feature sequence303 <1 1422 gene locus_tag LOCUS_19720 <1 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063702.1:tripartite tricarboxylate transporter permease 2190 1555 gene locus_tag LOCUS_19730 2190 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2405 3127 gene locus_tag LOCUS_19740 2405 3127 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552063.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence304 1329 199 gene locus_tag LOCUS_19750 gene tgt 1329 199 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809419.1 protein_id gnl|my_center|LOCUS_19750 1412 2149 gene locus_tag LOCUS_19760 1412 2149 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_19760 2842 2189 gene locus_tag LOCUS_19770 2842 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence305 198 1199 gene locus_tag LOCUS_19780 198 1199 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064098.1 protein_id gnl|my_center|LOCUS_19780 2016 1210 gene locus_tag LOCUS_19790 2016 1210 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395936.1 protein_id gnl|my_center|LOCUS_19790 2250 3287 gene locus_tag LOCUS_19800 2250 3287 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195812.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence306 <1 686 gene locus_tag LOCUS_19810 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706587.1:DUF853 family protein 787 1566 gene locus_tag LOCUS_19820 787 1566 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186027.1 protein_id gnl|my_center|LOCUS_19820 1577 2371 gene locus_tag LOCUS_19830 gene tcdA 1577 2371 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190050.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence307 1731 367 gene locus_tag LOCUS_19840 1731 367 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204730.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19840 <3373 1830 gene locus_tag LOCUS_19850 <3373 1830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815800.1:multidrug efflux RND transporter permease subunit MdtC >Feature sequence308 1430 504 gene locus_tag LOCUS_19860 1430 504 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063866.1 protein_id gnl|my_center|LOCUS_19860 1594 2439 gene locus_tag LOCUS_19870 1594 2439 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence309 2054 672 gene locus_tag LOCUS_19880 2054 672 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169161074.1 protein_id gnl|my_center|LOCUS_19880 3079 2201 gene locus_tag LOCUS_19890 3079 2201 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence310 469 1824 gene locus_tag LOCUS_19900 gene ffh 469 1824 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_19900 1847 2395 gene locus_tag LOCUS_19910 1847 2395 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844895.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence311 <1 545 gene locus_tag LOCUS_19920 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193229.1:NUDIX hydrolase 581 1312 gene locus_tag LOCUS_19930 gene aat 581 1312 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814164.1 protein_id gnl|my_center|LOCUS_19930 1309 2058 gene locus_tag LOCUS_19940 1309 2058 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039188.1 protein_id gnl|my_center|LOCUS_19940 2055 3086 gene locus_tag LOCUS_19950 2055 3086 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534868.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence312 <1 876 gene locus_tag LOCUS_19960 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003817147.1:PAS domain S-box protein 901 1572 gene locus_tag LOCUS_19970 gene fixJ 901 1572 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_19970 2560 1544 gene locus_tag LOCUS_19980 2560 1544 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812659.1 protein_id gnl|my_center|LOCUS_19980 2629 3327 gene locus_tag LOCUS_19990 2629 3327 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence313 862 17 gene locus_tag LOCUS_20000 862 17 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202928.1 protein_id gnl|my_center|LOCUS_20000 1137 958 gene locus_tag LOCUS_20010 1137 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 1567 1953 gene locus_tag LOCUS_20020 1567 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2068 2478 gene locus_tag LOCUS_20030 2068 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence314 2092 1430 gene locus_tag LOCUS_20040 2092 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2937 2218 gene locus_tag LOCUS_20050 2937 2218 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930986.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence315 273 950 gene locus_tag LOCUS_20060 273 950 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522956.1 protein_id gnl|my_center|LOCUS_20060 955 2097 gene locus_tag LOCUS_20070 955 2097 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence316 1073 321 gene locus_tag LOCUS_20080 gene istB 1073 321 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_20080 2586 1051 gene locus_tag LOCUS_20090 gene istA 2586 1051 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_20090 2795 3109 gene locus_tag LOCUS_20100 2795 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence317 1049 2368 gene locus_tag LOCUS_20110 1049 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence318 677 1405 gene locus_tag LOCUS_20120 677 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2950 1439 gene locus_tag LOCUS_20130 2950 1439 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337441.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence319 262 5 gene locus_tag LOCUS_20140 262 5 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191359.1 protein_id gnl|my_center|LOCUS_20140 338 1798 gene locus_tag LOCUS_20150 338 1798 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706123.1 protein_id gnl|my_center|LOCUS_20150 1789 2382 gene locus_tag LOCUS_20160 1789 2382 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533660.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence320 474 1469 gene locus_tag LOCUS_20170 474 1469 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807415.1 protein_id gnl|my_center|LOCUS_20170 1525 2322 gene locus_tag LOCUS_20180 1525 2322 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928340.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence321 1636 1355 gene locus_tag LOCUS_20190 gene yidD 1636 1355 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037400.1 protein_id gnl|my_center|LOCUS_20190 1986 1651 gene locus_tag LOCUS_20200 1986 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2254 2054 gene locus_tag LOCUS_20210 2254 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence322 1216 1875 gene locus_tag LOCUS_20220 gene pdxH 1216 1875 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_20220 2368 1913 gene locus_tag LOCUS_20230 2368 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 <3284 2473 gene locus_tag LOCUS_20240 <3284 2473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199069.1:methionine adenosyltransferase >Feature sequence323 1712 189 gene locus_tag LOCUS_20250 gene ilvA 1712 189 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_20250 1798 2292 gene locus_tag LOCUS_20260 1798 2292 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815154.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence324 2552 1386 gene locus_tag LOCUS_20270 gene hemW 2552 1386 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039962.1 protein_id gnl|my_center|LOCUS_20270 <3272 2542 gene locus_tag LOCUS_20280 <3272 2542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186211.1:RdgB/HAM1 family non-canonical purine NTP pyrophosphatase >Feature sequence325 <1 896 gene locus_tag LOCUS_20290 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004551284.1:selenide, water dikinase SelD 902 1594 gene locus_tag LOCUS_20300 902 1594 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942828.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence326 2445 1702 gene locus_tag LOCUS_20310 2445 1702 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_20310 3170 2442 gene locus_tag LOCUS_20320 gene pgl 3170 2442 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence327 244 774 gene locus_tag LOCUS_20330 gene iscR 244 774 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_20330 791 1114 gene locus_tag LOCUS_20340 gene iscA 791 1114 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100617.1 protein_id gnl|my_center|LOCUS_20340 2307 1111 gene locus_tag LOCUS_20350 2307 1111 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337698.1 protein_id gnl|my_center|LOCUS_20350 <3240 2339 gene locus_tag LOCUS_20360 <3240 2339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003816835.1:lysine--tRNA ligase >Feature sequence328 1484 114 gene locus_tag LOCUS_20370 1484 114 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence329 <1 985 gene locus_tag LOCUS_20380 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931666.1:MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit >Feature sequence330 264 1190 gene locus_tag LOCUS_20390 264 1190 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533906.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence331 293 1843 gene locus_tag LOCUS_20400 293 1843 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088826.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence332 661 1758 gene locus_tag LOCUS_20410 gene mutY 661 1758 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 protein_id gnl|my_center|LOCUS_20410 2683 1805 gene locus_tag LOCUS_20420 gene rapZ 2683 1805 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815183.1 protein_id gnl|my_center|LOCUS_20420 <3199 2691 gene locus_tag LOCUS_20430 <3199 2691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929965.1:HPr(Ser) kinase/phosphatase >Feature sequence333 1661 750 gene locus_tag LOCUS_20440 1661 750 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_20440 3174 1672 gene locus_tag LOCUS_20450 3174 1672 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence334 195 1373 gene locus_tag LOCUS_20460 195 1373 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186079.1 protein_id gnl|my_center|LOCUS_20460 1402 2619 gene locus_tag LOCUS_20470 1402 2619 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence335 1011 724 gene locus_tag LOCUS_20480 gene cas2 1011 724 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545199.1 protein_id gnl|my_center|LOCUS_20480 2554 1073 gene locus_tag LOCUS_20490 gene rmuC 2554 1073 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527474.1 protein_id gnl|my_center|LOCUS_20490 2668 3048 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaatcccttttcgttcagggcttcatgctgac >Feature sequence336 1546 182 gene locus_tag LOCUS_20500 1546 182 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195190.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence337 450 1097 gene locus_tag LOCUS_20510 450 1097 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_20510 1094 2422 gene locus_tag LOCUS_20520 1094 2422 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190128.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence338 822 526 gene locus_tag LOCUS_20530 822 526 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_20530 1676 819 gene locus_tag LOCUS_20540 1676 819 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_20540 2856 1693 gene locus_tag LOCUS_20550 2856 1693 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807138.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence339 <1 724 gene locus_tag LOCUS_20560 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002216619.1:cytochrome-c oxidase, cbb3-type subunit I 744 1361 gene locus_tag LOCUS_20570 gene ccoO 744 1361 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_20570 1536 2465 gene locus_tag LOCUS_20580 1536 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20580 >Feature sequence340 286 1932 gene locus_tag LOCUS_20590 286 1932 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480219.1 protein_id gnl|my_center|LOCUS_20590 1932 2531 gene locus_tag LOCUS_20600 1932 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3137 2541 gene locus_tag LOCUS_20610 3137 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence341 >Feature sequence342 412 663 gene locus_tag LOCUS_20620 412 663 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810513.1 protein_id gnl|my_center|LOCUS_20620 814 2544 gene locus_tag LOCUS_20630 814 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191882.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence343 1826 387 gene locus_tag LOCUS_20640 1826 387 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975813.1 protein_id gnl|my_center|LOCUS_20640 2265 1873 gene locus_tag LOCUS_20650 2265 1873 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061778.1 protein_id gnl|my_center|LOCUS_20650 <3102 2332 gene locus_tag LOCUS_20660 <3102 2332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986861.1:YeiH family protein >Feature sequence344 813 490 gene locus_tag LOCUS_20670 813 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 1062 2243 gene locus_tag LOCUS_20680 1062 2243 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206489.1 protein_id gnl|my_center|LOCUS_20680 3020 2271 gene locus_tag LOCUS_20690 3020 2271 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836202.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence345 <1 1512 gene locus_tag LOCUS_20700 <1 1512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879591.1:thiamine pyrophosphate-binding protein 1523 2434 gene locus_tag LOCUS_20710 1523 2434 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence346 324 2624 gene locus_tag LOCUS_20720 324 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence347 <1 830 gene locus_tag LOCUS_20730 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004549948.1:MltA domain-containing protein 1572 796 gene locus_tag LOCUS_20740 gene dsbC 1572 796 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815375.1 protein_id gnl|my_center|LOCUS_20740 2912 1638 gene locus_tag LOCUS_20750 2912 1638 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence348 160 1710 gene locus_tag LOCUS_20760 gene phaC 160 1710 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527151.1 protein_id gnl|my_center|LOCUS_20760 1809 2546 gene locus_tag LOCUS_20770 gene phbB 1809 2546 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813586.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence349 <1 760 gene locus_tag LOCUS_20780 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813988.1:CaiB/BaiF CoA-transferase family protein 2083 875 gene locus_tag LOCUS_20790 2083 875 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_20790 2260 2835 gene locus_tag LOCUS_20800 2260 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 >Feature sequence350 22 97 gene locus_tag LOCUS_t00190 22 97 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 278 499 gene locus_tag LOCUS_20810 278 499 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408469.1 protein_id gnl|my_center|LOCUS_20810 551 709 gene locus_tag LOCUS_20820 551 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 814 1146 gene locus_tag LOCUS_20830 814 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1143 1640 gene locus_tag LOCUS_20840 1143 1640 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_20840 1920 2849 gene locus_tag LOCUS_20850 gene cysK 1920 2849 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887435.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence351 1048 128 gene locus_tag LOCUS_20860 1048 128 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_20860 2018 1083 gene locus_tag LOCUS_20870 2018 1083 CDS product DUF1932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494215.1 protein_id gnl|my_center|LOCUS_20870 2722 2033 gene locus_tag LOCUS_20880 2722 2033 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086623.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence352 465 1541 gene locus_tag LOCUS_20890 465 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193226.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence353 162 629 gene locus_tag LOCUS_20900 162 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1950 676 gene locus_tag LOCUS_20910 1950 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence354 428 1171 gene locus_tag LOCUS_20920 gene dnaQ 428 1171 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064948.1 protein_id gnl|my_center|LOCUS_20920 1207 2409 gene locus_tag LOCUS_20930 1207 2409 CDS product DUF2863 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199318.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence355 1755 2174 gene locus_tag LOCUS_20940 1755 2174 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_20940 3010 2189 gene locus_tag LOCUS_20950 3010 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence356 169 1092 gene locus_tag LOCUS_20960 gene ispE 169 1092 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195241.1 protein_id gnl|my_center|LOCUS_20960 1070 1146 gene locus_tag LOCUS_t00200 1070 1146 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1171 2151 gene locus_tag LOCUS_20970 1171 2151 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_20970 2289 2918 gene locus_tag LOCUS_20980 2289 2918 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence357 368 2710 gene locus_tag LOCUS_20990 368 2710 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110255951.1 protein_id gnl|my_center|LOCUS_20990 2711 2920 gene locus_tag LOCUS_21000 2711 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence358 >Feature sequence359 903 22 gene locus_tag LOCUS_21010 903 22 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_21010 1272 949 gene locus_tag LOCUS_21020 1272 949 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811464.1 protein_id gnl|my_center|LOCUS_21020 2243 1428 gene locus_tag LOCUS_21030 2243 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence360 547 164 gene locus_tag LOCUS_21040 547 164 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_21040 1213 548 gene locus_tag LOCUS_21050 1213 548 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815097.1 protein_id gnl|my_center|LOCUS_21050 2980 1265 gene locus_tag LOCUS_21060 2980 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence361 <1 868 gene locus_tag LOCUS_21070 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039581.1:3-oxoadipyl-CoA thiolase 1065 1484 gene locus_tag LOCUS_21080 1065 1484 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204701.1 protein_id gnl|my_center|LOCUS_21080 1677 1477 gene locus_tag LOCUS_21090 1677 1477 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366461.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence362 1584 1060 gene locus_tag LOCUS_21100 1584 1060 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_21100 2279 1581 gene locus_tag LOCUS_21110 2279 1581 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_21110 2934 2284 gene locus_tag LOCUS_21120 2934 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence363 175 879 gene locus_tag LOCUS_21130 175 879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103312601.1 protein_id gnl|my_center|LOCUS_21130 903 1835 gene locus_tag LOCUS_21140 903 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1832 2410 gene locus_tag LOCUS_21150 1832 2410 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457820.1 protein_id gnl|my_center|LOCUS_21150 <2964 2411 gene locus_tag LOCUS_21160 <2964 2411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931317.1:FAD-binding oxidoreductase >Feature sequence364 >Feature sequence365 <1 1871 gene locus_tag LOCUS_21170 <1 1871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009940969.1:DNA primase >Feature sequence366 1098 886 gene locus_tag LOCUS_21180 gene ccoS 1098 886 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 protein_id gnl|my_center|LOCUS_21180 <2950 1098 gene locus_tag LOCUS_21190 <2950 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114668.1:heavy metal translocating P-type ATPase >Feature sequence367 <1 933 gene locus_tag LOCUS_21200 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454824.1:fumarylacetoacetate hydrolase family protein 952 1599 gene locus_tag LOCUS_21210 gene maiA 952 1599 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930265.1 protein_id gnl|my_center|LOCUS_21210 1706 2398 gene locus_tag LOCUS_21220 1706 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence368 <1 629 gene locus_tag LOCUS_21230 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083152.1:FAD:protein FMN transferase 1873 530 gene locus_tag LOCUS_21240 gene dadA 1873 530 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403947.1 protein_id gnl|my_center|LOCUS_21240 2012 2515 gene locus_tag LOCUS_21250 gene dadR 2012 2515 CDS product transcriptional regulator DadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096535.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence369 1011 1505 gene locus_tag LOCUS_21260 1011 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1538 2551 gene locus_tag LOCUS_21270 1538 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2576 2887 gene locus_tag LOCUS_21280 2576 2887 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence370 1999 95 gene locus_tag LOCUS_21290 gene selB 1999 95 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102294.1 protein_id gnl|my_center|LOCUS_21290 <2913 1996 gene locus_tag LOCUS_21300 <2913 1996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187099.1:L-seryl-tRNA(Sec) selenium transferase >Feature sequence371 >Feature sequence372 1025 1828 gene locus_tag LOCUS_21310 1025 1828 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230346.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence373 413 616 gene locus_tag LOCUS_21320 gene thiS 413 616 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_21320 627 1439 gene locus_tag LOCUS_21330 627 1439 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931559.1 protein_id gnl|my_center|LOCUS_21330 1436 2164 gene locus_tag LOCUS_21340 gene trmB 1436 2164 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446655.1 protein_id gnl|my_center|LOCUS_21340 <2882 2161 gene locus_tag LOCUS_21350 <2882 2161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185904.1:undecaprenyl-diphosphate phosphatase >Feature sequence374 82 1722 gene locus_tag LOCUS_21360 gene murD 82 1722 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203798.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence375 64 738 gene locus_tag LOCUS_21370 64 738 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807272.1 protein_id gnl|my_center|LOCUS_21370 1410 751 gene locus_tag LOCUS_21380 1410 751 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_21380 2261 1407 gene locus_tag LOCUS_21390 2261 1407 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 protein_id gnl|my_center|LOCUS_21390 2477 2328 gene locus_tag LOCUS_21400 2477 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2858 2550 gene locus_tag LOCUS_21410 2858 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence376 344 1294 gene locus_tag LOCUS_21420 344 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1874 2302 gene locus_tag LOCUS_21430 gene mraZ 1874 2302 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194130.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence377 446 1765 gene locus_tag LOCUS_21440 gene waaA 446 1765 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185503.1 protein_id gnl|my_center|LOCUS_21440 <2849 1830 gene locus_tag LOCUS_21450 <2849 1830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815100.1:TolC family outer membrane protein >Feature sequence378 42 1982 gene locus_tag LOCUS_21460 42 1982 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550744.1 protein_id gnl|my_center|LOCUS_21460 2085 2570 gene locus_tag LOCUS_21470 2085 2570 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence379 1367 225 gene locus_tag LOCUS_21480 1367 225 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 protein_id gnl|my_center|LOCUS_21480 2049 1372 gene locus_tag LOCUS_21490 2049 1372 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522956.1 protein_id gnl|my_center|LOCUS_21490 <2836 2052 gene locus_tag LOCUS_21500 <2836 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815952.1:acetyl-CoA C-acetyltransferase >Feature sequence380 <1 1139 gene locus_tag LOCUS_21510 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550019.1:3-deoxy-7-phosphoheptulonate synthase AroG 2393 1110 gene locus_tag LOCUS_21520 2393 1110 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_21520 2743 2390 gene locus_tag LOCUS_21530 2743 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence381 >Feature sequence382 238 813 gene locus_tag LOCUS_21540 238 813 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_21540 810 1250 gene locus_tag LOCUS_21550 810 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1247 1822 gene locus_tag LOCUS_21560 1247 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1822 2319 gene locus_tag LOCUS_21570 1822 2319 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065147.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence383 123 1796 gene locus_tag LOCUS_21580 123 1796 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_21580 1865 2803 gene locus_tag LOCUS_21590 1865 2803 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence384 <1 720 gene locus_tag LOCUS_21600 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003410042.1:NAD(P)/FAD-dependent oxidoreductase 841 1728 gene locus_tag LOCUS_21610 841 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1860 2486 gene locus_tag LOCUS_21620 1860 2486 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971922.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence385 <1 907 gene locus_tag LOCUS_21630 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522420.1:CDP-diacylglycerol--serine O-phosphatidyltransferase 964 1746 gene locus_tag LOCUS_21640 gene tpiA 964 1746 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186004.1 protein_id gnl|my_center|LOCUS_21640 1798 2268 gene locus_tag LOCUS_21650 1798 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2298 2382 gene locus_tag LOCUS_t00210 2298 2382 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence386 <2751 448 gene locus_tag LOCUS_21660 <2751 448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879871.1:molybdopterin-dependent oxidoreductase >Feature sequence387 3 1514 gene locus_tag LOCUS_21670 3 1514 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_21670 1660 2172 gene locus_tag LOCUS_21680 gene ptsN 1660 2172 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence388 3 1079 gene locus_tag LOCUS_21690 3 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 1084 2715 gene locus_tag LOCUS_21700 1084 2715 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528369.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence389 <1 775 gene locus_tag LOCUS_21710 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188924.1:branched-chain amino acid transaminase 799 1020 gene locus_tag LOCUS_21720 799 1020 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197553.1 protein_id gnl|my_center|LOCUS_21720 1210 1767 gene locus_tag LOCUS_21730 1210 1767 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence390 514 2553 gene locus_tag LOCUS_21740 gene tkt 514 2553 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930131.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence391 786 421 gene locus_tag LOCUS_21750 786 421 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072361.1 protein_id gnl|my_center|LOCUS_21750 1692 874 gene locus_tag LOCUS_21760 1692 874 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892000.1 protein_id gnl|my_center|LOCUS_21760 <2723 1732 gene locus_tag LOCUS_21770 <2723 1732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937320.1:TRAP transporter large permease >Feature sequence392 110 1189 gene locus_tag LOCUS_21780 gene serC 110 1189 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189993.1 protein_id gnl|my_center|LOCUS_21780 1199 2383 gene locus_tag LOCUS_21790 1199 2383 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence393 >Feature sequence394 332 1282 gene locus_tag LOCUS_21800 332 1282 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525156.1 protein_id gnl|my_center|LOCUS_21800 1358 2476 gene locus_tag LOCUS_21810 1358 2476 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence395 483 2591 gene locus_tag LOCUS_21820 gene malQ 483 2591 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480181.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence396 225 1424 gene locus_tag LOCUS_21830 225 1424 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence397 291 1469 gene locus_tag LOCUS_21840 gene hadC 291 1469 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence398 <1 683 gene locus_tag LOCUS_21850 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941843.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase 737 1678 gene locus_tag LOCUS_21860 gene metA 737 1678 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence399 469 146 gene locus_tag LOCUS_21870 469 146 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932679.1 protein_id gnl|my_center|LOCUS_21870 675 466 gene locus_tag LOCUS_21880 675 466 CDS product antitoxin MazE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388652.1 protein_id gnl|my_center|LOCUS_21880 2100 820 gene locus_tag LOCUS_21890 2100 820 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_21890 <2667 2105 gene locus_tag LOCUS_21900 <2667 2105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004534003.1:aspartate carbamoyltransferase catalytic subunit >Feature sequence400 1030 173 gene locus_tag LOCUS_21910 gene serB 1030 173 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_21910 <2665 1068 gene locus_tag LOCUS_21920 <2665 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521239.1:transcription-repair coupling factor >Feature sequence401 401 1255 gene locus_tag LOCUS_21930 401 1255 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090581.1 protein_id gnl|my_center|LOCUS_21930 1273 2436 gene locus_tag LOCUS_21940 1273 2436 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence402 1005 316 gene locus_tag LOCUS_21950 1005 316 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929777.1 protein_id gnl|my_center|LOCUS_21950 1940 1029 gene locus_tag LOCUS_21960 gene argB 1940 1029 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence403 1074 589 gene locus_tag LOCUS_21970 gene ybaK 1074 589 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 protein_id gnl|my_center|LOCUS_21970 2080 1079 gene locus_tag LOCUS_21980 2080 1079 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535938.1 protein_id gnl|my_center|LOCUS_21980 2573 2190 gene locus_tag LOCUS_21990 gene mnhG 2573 2190 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394062.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence404 374 1636 gene locus_tag LOCUS_22000 374 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173200.1 protein_id gnl|my_center|LOCUS_22000 1656 2537 gene locus_tag LOCUS_22010 1656 2537 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314319.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence405 263 1345 gene locus_tag LOCUS_22020 263 1345 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938358.1 protein_id gnl|my_center|LOCUS_22020 1518 1778 gene locus_tag LOCUS_22030 gene rpsP 1518 1778 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189402.1 protein_id gnl|my_center|LOCUS_22030 1898 2404 gene locus_tag LOCUS_22040 gene rimM 1898 2404 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063944.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence406 <1 1079 gene locus_tag LOCUS_22050 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_135202727.1:nitrogen regulation protein NR(II) >Feature sequence407 1128 136 gene locus_tag LOCUS_22060 1128 136 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966817.1 protein_id gnl|my_center|LOCUS_22060 1313 2374 gene locus_tag LOCUS_22070 1313 2374 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086978.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence408 <1 1139 gene locus_tag LOCUS_22080 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259232.1:acetoacetate--CoA ligase 2088 1162 gene locus_tag LOCUS_22090 2088 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence409 <1 762 gene locus_tag LOCUS_22100 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040543.1:glutamate--tRNA ligase 877 1110 gene locus_tag LOCUS_22110 877 1110 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_22110 1128 1526 gene locus_tag LOCUS_22120 1128 1526 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence410 1741 581 gene locus_tag LOCUS_22130 gene extI 1741 581 CDS product selenite/tellurite reduction operon porin ExtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943570.1 protein_id gnl|my_center|LOCUS_22130 2273 1761 gene locus_tag LOCUS_22140 2273 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2548 2270 gene locus_tag LOCUS_22150 2548 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence411 2412 1417 gene locus_tag LOCUS_22160 gene nagZ 2412 1417 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence412 1525 101 gene locus_tag LOCUS_22170 gene ccoG 1525 101 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_22170 2463 1522 gene locus_tag LOCUS_22180 2463 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence413 2199 130 gene locus_tag LOCUS_22190 2199 130 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209062.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence414 1746 136 gene locus_tag LOCUS_22200 1746 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 1708 2574 gene locus_tag LOCUS_22210 1708 2574 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065123.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence415 >Feature sequence416 1742 1062 gene locus_tag LOCUS_22220 1742 1062 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence417 1205 27 gene locus_tag LOCUS_22230 1205 27 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189839.1 protein_id gnl|my_center|LOCUS_22230 1540 1220 gene locus_tag LOCUS_22240 1540 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 <2569 1596 gene locus_tag LOCUS_22250 <2569 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522067.1:type I glyceraldehyde-3-phosphate dehydrogenase >Feature sequence418 346 738 gene locus_tag LOCUS_22260 gene rpsI 346 738 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_22260 858 1919 gene locus_tag LOCUS_22270 gene argC 858 1919 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820599.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence419 2064 1045 gene locus_tag LOCUS_22280 gene hrcA 2064 1045 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence420 <1 905 gene locus_tag LOCUS_22290 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390685.1:PAS domain-containing protein 2133 928 gene locus_tag LOCUS_22300 2133 928 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence421 1388 1047 gene locus_tag LOCUS_22310 1388 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 1791 1432 gene locus_tag LOCUS_22320 1791 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2136 1795 gene locus_tag LOCUS_22330 2136 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence422 >Feature sequence423 1352 357 gene locus_tag LOCUS_22340 1352 357 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_22340 2223 1357 gene locus_tag LOCUS_22350 2223 1357 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence424 <2522 1679 gene locus_tag LOCUS_22360 <2522 1679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390710.1:MDR family oxidoreductase >Feature sequence425 1173 136 gene locus_tag LOCUS_22370 1173 136 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 protein_id gnl|my_center|LOCUS_22370 1751 1185 gene locus_tag LOCUS_22380 1751 1185 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967626.1 protein_id gnl|my_center|LOCUS_22380 <2509 1748 gene locus_tag LOCUS_22390 <2509 1748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967625.1:ABC transporter permease >Feature sequence426 <1 849 gene locus_tag LOCUS_22400 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009940953.1:succinate dehydrogenase flavoprotein subunit 884 1642 gene locus_tag LOCUS_22410 884 1642 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_22410 1672 1944 gene locus_tag LOCUS_22420 1672 1944 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528990.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence427 1075 74 gene locus_tag LOCUS_22430 1075 74 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_22430 2383 1106 gene locus_tag LOCUS_22440 2383 1106 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003516526.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence428 616 326 gene locus_tag LOCUS_22450 616 326 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739893.1 protein_id gnl|my_center|LOCUS_22450 818 642 gene locus_tag LOCUS_22460 818 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1421 981 gene locus_tag LOCUS_22470 1421 981 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 protein_id gnl|my_center|LOCUS_22470 1678 1418 gene locus_tag LOCUS_22480 1678 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 <2486 1784 gene locus_tag LOCUS_22490 <2486 1784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814996.1:AMP-binding protein >Feature sequence429 9 95 gene locus_tag LOCUS_t00220 9 95 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 619 113 gene locus_tag LOCUS_22500 619 113 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063925.1 protein_id gnl|my_center|LOCUS_22500 1918 626 gene locus_tag LOCUS_22510 1918 626 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852902.1 protein_id gnl|my_center|LOCUS_22510 <2485 1957 gene locus_tag LOCUS_22520 <2485 1957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063927.1:ATP phosphoribosyltransferase regulatory subunit >Feature sequence430 <2476 1225 gene locus_tag LOCUS_22530 <2476 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086195.1:indolepyruvate ferredoxin oxidoreductase subunit alpha >Feature sequence431 <2472 290 gene locus_tag LOCUS_22540 <2472 290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535505.1:outer membrane protein assembly factor BamA >Feature sequence432 539 1096 gene locus_tag LOCUS_22550 539 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 1485 1123 gene locus_tag LOCUS_22560 1485 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1909 1475 gene locus_tag LOCUS_22570 1909 1475 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_22570 2000 2452 gene locus_tag LOCUS_22580 gene smpB 2000 2452 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence433 <1 578 gene locus_tag LOCUS_22590 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004555739.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha 674 1600 gene locus_tag LOCUS_22600 674 1600 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_22600 1597 1845 gene locus_tag LOCUS_22610 1597 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence434 2098 800 gene locus_tag LOCUS_22620 2098 800 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence435 754 92 gene locus_tag LOCUS_22630 gene cmk 754 92 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813361.1 protein_id gnl|my_center|LOCUS_22630 2091 766 gene locus_tag LOCUS_22640 2091 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2157 2453 gene locus_tag LOCUS_22650 2157 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence436 <1 711 gene locus_tag LOCUS_22660 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013724.1:PEP-utilizing enzyme 723 1850 gene locus_tag LOCUS_22670 723 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence437 796 65 gene locus_tag LOCUS_22680 796 65 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688556.1 protein_id gnl|my_center|LOCUS_22680 1368 823 gene locus_tag LOCUS_22690 1368 823 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037433.1 protein_id gnl|my_center|LOCUS_22690 1880 1377 gene locus_tag LOCUS_22700 1880 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence438 1953 1027 gene locus_tag LOCUS_22710 1953 1027 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_22710 <2455 1950 gene locus_tag LOCUS_22720 <2455 1950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390879.1:HlyD family efflux transporter periplasmic adaptor subunit >Feature sequence439 1891 326 gene locus_tag LOCUS_22730 1891 326 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529357.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence440 1739 870 gene locus_tag LOCUS_22740 1739 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22740 2215 2139 gene locus_tag LOCUS_t00230 2215 2139 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence441 <1 867 gene locus_tag LOCUS_22750 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003118564.1:aminopeptidase >Feature sequence442 <1 546 gene locus_tag LOCUS_22760 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_077173108.1:Hpt domain-containing protein 1987 512 gene locus_tag LOCUS_22770 1987 512 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence443 <1 819 gene locus_tag LOCUS_22780 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550116.1:cysteine synthase CysM 841 1722 gene locus_tag LOCUS_22790 841 1722 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_22790 <2434 1748 gene locus_tag LOCUS_22800 <2434 1748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003399773.1:lytic murein transglycosylase B >Feature sequence444 1249 299 gene locus_tag LOCUS_22810 1249 299 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_22810 <2423 1260 gene locus_tag LOCUS_22820 <2423 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532947.1:hydrogenase 4 subunit B >Feature sequence445 365 183 gene locus_tag LOCUS_22830 365 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence446 >Feature sequence447 <1 1005 gene locus_tag LOCUS_22840 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521939.1:Do family serine endopeptidase 1943 1095 gene locus_tag LOCUS_22850 gene tatC 1943 1095 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199900.1 protein_id gnl|my_center|LOCUS_22850 2414 2007 gene locus_tag LOCUS_22860 2414 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence448 1797 853 gene locus_tag LOCUS_22870 1797 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence449 1959 907 gene locus_tag LOCUS_22880 gene hflX 1959 907 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447752.1 protein_id gnl|my_center|LOCUS_22880 2330 2094 gene locus_tag LOCUS_22890 gene hfq 2330 2094 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810707.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence450 1631 270 gene locus_tag LOCUS_22900 gene rseP 1631 270 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205137.1 protein_id gnl|my_center|LOCUS_22900 <2398 1628 gene locus_tag LOCUS_22910 <2398 1628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063745.1:1-deoxy-D-xylulose-5-phosphate reductoisomerase >Feature sequence451 990 211 gene locus_tag LOCUS_22920 gene xth 990 211 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546769.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence452 <1 589 gene locus_tag LOCUS_22930 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002244166.1:lipid A biosynthesis lauroyl acyltransferase 601 1497 gene locus_tag LOCUS_22940 gene dapF 601 1497 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199067.1 protein_id gnl|my_center|LOCUS_22940 1494 2168 gene locus_tag LOCUS_22950 1494 2168 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199066.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence453 3 593 gene locus_tag LOCUS_22960 3 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 607 2061 gene locus_tag LOCUS_22970 gene lpdA 607 2061 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534933.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence454 500 186 gene locus_tag LOCUS_22980 500 186 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_22980 1642 509 gene locus_tag LOCUS_22990 1642 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence455 800 18 gene locus_tag LOCUS_23000 800 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1174 926 gene locus_tag LOCUS_23010 1174 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 2097 1171 gene locus_tag LOCUS_23020 2097 1171 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence456 <1 1268 gene locus_tag LOCUS_23030 <1 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189668.1:cyclopropane-fatty-acyl-phospholipid synthase family protein 2114 1311 gene locus_tag LOCUS_23040 2114 1311 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence457 201 680 gene locus_tag LOCUS_23050 gene infC 201 680 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_23050 766 963 gene locus_tag LOCUS_23060 gene rpmI 766 963 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_23060 974 1336 gene locus_tag LOCUS_23070 gene rplT 974 1336 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812832.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence458 1809 334 gene locus_tag LOCUS_23080 1809 334 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_23080 2308 1868 gene locus_tag LOCUS_23090 2308 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 >Feature sequence459 784 1992 gene locus_tag LOCUS_23100 784 1992 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816819.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence460 <1 1481 gene locus_tag LOCUS_23110 <1 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193454.1:endopeptidase La 1673 1945 gene locus_tag LOCUS_23120 1673 1945 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_23120 2086 2161 gene locus_tag LOCUS_t00240 2086 2161 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2254 2330 gene locus_tag LOCUS_t00250 2254 2330 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence461 1 1047 gene locus_tag LOCUS_23130 gene dctM 1 1047 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_23130 2195 1044 gene locus_tag LOCUS_23140 2195 1044 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence462 >Feature sequence463 >Feature sequence464 833 2074 gene locus_tag LOCUS_23150 833 2074 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111886.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence465 996 346 gene locus_tag LOCUS_23160 996 346 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463747.1 protein_id gnl|my_center|LOCUS_23160 1069 1647 gene locus_tag LOCUS_23170 gene folE 1069 1647 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015316.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence466 <1 1961 gene locus_tag LOCUS_23180 <1 1961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083146.1:NosR/NirI family protein >Feature sequence467 1242 814 gene locus_tag LOCUS_23190 1242 814 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 protein_id gnl|my_center|LOCUS_23190 <2319 1296 gene locus_tag LOCUS_23200 <2319 1296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526219.1:lipopolysaccharide heptosyltransferase II >Feature sequence468 1443 28 gene locus_tag LOCUS_23210 1443 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2080 1661 gene locus_tag LOCUS_23220 2080 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence469 177 1160 gene locus_tag LOCUS_23230 177 1160 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065034.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence470 179 436 gene locus_tag LOCUS_23240 179 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 578 1798 gene locus_tag LOCUS_23250 578 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence471 >Feature sequence472 294 1025 gene locus_tag LOCUS_23260 294 1025 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187972.1 protein_id gnl|my_center|LOCUS_23260 1037 2017 gene locus_tag LOCUS_23270 1037 2017 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188558.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence473 >Feature sequence474 <2266 341 gene locus_tag LOCUS_23280 <2266 341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186393.1:NADH-quinone oxidoreductase subunit NuoG >Feature sequence475 <1 660 gene locus_tag LOCUS_23290 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196774.1:protein-methionine-sulfoxide reductase catalytic subunit MsrP 701 1357 gene locus_tag LOCUS_23300 gene msrQ 701 1357 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527905.1 protein_id gnl|my_center|LOCUS_23300 <2261 1325 gene locus_tag LOCUS_23310 <2261 1325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196768.1:diaminopimelate decarboxylase >Feature sequence476 1407 829 gene locus_tag LOCUS_23320 1407 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 <2254 1404 gene locus_tag LOCUS_23330 <2254 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201245837.1:TolC family protein >Feature sequence477 751 1776 gene locus_tag LOCUS_23340 751 1776 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence478 318 1604 gene locus_tag LOCUS_23350 318 1604 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064468.1 protein_id gnl|my_center|LOCUS_23350 <2239 1507 gene locus_tag LOCUS_23360 <2239 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810574.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase >Feature sequence479 1051 206 gene locus_tag LOCUS_23370 1051 206 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 protein_id gnl|my_center|LOCUS_23370 1857 1048 gene locus_tag LOCUS_23380 1857 1048 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence480 1741 1418 gene locus_tag LOCUS_23390 1741 1418 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813757.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence481 217 2070 gene locus_tag LOCUS_23400 gene glmS 217 2070 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035815.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence482 <1 735 gene locus_tag LOCUS_23410 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552444.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB 1441 749 gene locus_tag LOCUS_23420 gene pyrE 1441 749 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929769.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence483 103 1410 gene locus_tag LOCUS_23430 103 1410 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence484 241 414 gene locus_tag LOCUS_23440 241 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 953 510 gene locus_tag LOCUS_23450 953 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 1030 1989 gene locus_tag LOCUS_23460 1030 1989 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814565.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence485 1653 508 gene locus_tag LOCUS_23470 gene obgE 1653 508 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_23470 1996 1736 gene locus_tag LOCUS_23480 gene rpmA 1996 1736 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807460.1 protein_id gnl|my_center|LOCUS_23480 2203 2009 gene locus_tag LOCUS_23490 2203 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence486 1465 422 gene locus_tag LOCUS_23500 1465 422 CDS product DUF6352 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970358.1 protein_id gnl|my_center|LOCUS_23500 <2203 1509 gene locus_tag LOCUS_23510 <2203 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192752.1:cysteine--tRNA ligase >Feature sequence487 1385 435 gene locus_tag LOCUS_23520 1385 435 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence488 >Feature sequence489 1260 16 gene locus_tag LOCUS_23530 1260 16 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392300.1 protein_id gnl|my_center|LOCUS_23530 2051 1257 gene locus_tag LOCUS_23540 2051 1257 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113029.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence490 430 978 gene locus_tag LOCUS_23550 430 978 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932702.1 protein_id gnl|my_center|LOCUS_23550 975 1478 gene locus_tag LOCUS_23560 975 1478 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974701.1 protein_id gnl|my_center|LOCUS_23560 1480 1629 gene locus_tag LOCUS_23570 1480 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence491 184 1683 gene locus_tag LOCUS_23580 184 1683 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899567.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence492 >Feature sequence493 485 1381 gene locus_tag LOCUS_23590 485 1381 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994149.1 protein_id gnl|my_center|LOCUS_23590 <2190 1394 gene locus_tag LOCUS_23600 <2190 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037396100.1:formate--tetrahydrofolate ligase >Feature sequence494 1486 977 gene locus_tag LOCUS_23610 gene nuoE 1486 977 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813932.1 protein_id gnl|my_center|LOCUS_23610 <2189 1539 gene locus_tag LOCUS_23620 <2189 1539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813935.1:NADH-quinone oxidoreductase subunit D >Feature sequence495 394 38 gene locus_tag LOCUS_23630 394 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 <2186 445 gene locus_tag LOCUS_23640 <2186 445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065671.1:DNA/RNA non-specific endonuclease >Feature sequence496 <1 1862 gene locus_tag LOCUS_23650 <1 1862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522336.1:aminopeptidase N >Feature sequence497 >Feature sequence498 1 963 gene locus_tag LOCUS_23660 1 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 <2162 978 gene locus_tag LOCUS_23670 <2162 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114325.1:acyl-CoA dehydrogenase family protein >Feature sequence499 >Feature sequence500 576 130 gene locus_tag LOCUS_23680 576 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 759 1298 gene locus_tag LOCUS_23690 759 1298 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 protein_id gnl|my_center|LOCUS_23690 1295 2065 gene locus_tag LOCUS_23700 1295 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence501 1447 251 gene locus_tag LOCUS_23710 1447 251 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391277.1 protein_id gnl|my_center|LOCUS_23710 <2143 1515 gene locus_tag LOCUS_23720 <2143 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839831.1:ATP-binding protein >Feature sequence502 <1 1505 gene locus_tag LOCUS_23730 <1 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527208.1:phosphoribosylformylglycinamidine synthase >Feature sequence503 <1 1956 gene locus_tag LOCUS_23740 <1 1956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083807.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence504 >Feature sequence505 622 203 gene locus_tag LOCUS_23750 622 203 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_23750 1304 1092 gene locus_tag LOCUS_23760 1304 1092 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_23760 1731 1426 gene locus_tag LOCUS_23770 1731 1426 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252128.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence506 <2118 1095 gene locus_tag LOCUS_23780 <2118 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010977989.1:UbiD family decarboxylase >Feature sequence507 28 1671 gene locus_tag LOCUS_23790 28 1671 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932359.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence508 <1 605 gene locus_tag LOCUS_23800 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100940.1:chemotaxis chemoreceptor PilJ >Feature sequence509 >Feature sequence510 729 1298 gene locus_tag LOCUS_23810 729 1298 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence511 576 175 gene locus_tag LOCUS_23820 576 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 810 595 gene locus_tag LOCUS_23830 810 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1184 807 gene locus_tag LOCUS_23840 1184 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence512 308 2023 gene locus_tag LOCUS_23850 gene polX 308 2023 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence513 <1 1262 gene locus_tag LOCUS_23860 <1 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544562.1:efflux transporter outer membrane subunit <2095 1272 gene locus_tag LOCUS_23870 <2095 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070951.1:ATP-binding protein >Feature sequence514 1986 364 gene locus_tag LOCUS_23880 gene groL 1986 364 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087406.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence515 <1 792 gene locus_tag LOCUS_23890 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528921.1:glucan 1,4-alpha-glucosidase 1531 704 gene locus_tag LOCUS_23900 1531 704 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence516 182 1564 gene locus_tag LOCUS_23910 182 1564 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence517 <1 539 gene locus_tag LOCUS_23920 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929976.1:oligosaccharide flippase family protein 536 1147 gene locus_tag LOCUS_23930 gene hisH 536 1147 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113422.1 protein_id gnl|my_center|LOCUS_23930 1147 1902 gene locus_tag LOCUS_23940 1147 1902 CDS product AglZ/HisF2 family acetamidino modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113421.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence518 <1 633 gene locus_tag LOCUS_23950 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196422.1:enoyl-CoA hydratase 662 1762 gene locus_tag LOCUS_23960 662 1762 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence519 >Feature sequence520 351 1283 gene locus_tag LOCUS_23970 351 1283 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532449.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence521 >Feature sequence522 956 429 gene locus_tag LOCUS_23980 956 429 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064337.1 protein_id gnl|my_center|LOCUS_23980 <2056 1127 gene locus_tag LOCUS_23990 <2056 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194380.1:cell division protein FtsZ >Feature sequence523 606 4 gene locus_tag LOCUS_24000 606 4 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190125.1 protein_id gnl|my_center|LOCUS_24000 1189 656 gene locus_tag LOCUS_24010 gene msrA 1189 656 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870242.1 protein_id gnl|my_center|LOCUS_24010 <2054 1221 gene locus_tag LOCUS_24020 <2054 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815004.1:bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase >Feature sequence524 1112 342 gene locus_tag LOCUS_24030 1112 342 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 protein_id gnl|my_center|LOCUS_24030 1912 1253 gene locus_tag LOCUS_24040 1912 1253 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027478.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence525 1151 798 gene locus_tag LOCUS_24050 1151 798 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_24050 <2038 1173 gene locus_tag LOCUS_24060 <2038 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814620.1:NAD(P)-dependent oxidoreductase >Feature sequence526 491 228 gene locus_tag LOCUS_24070 491 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1195 566 gene locus_tag LOCUS_24080 1195 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 1481 1200 gene locus_tag LOCUS_24090 1481 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence527 1600 356 gene locus_tag LOCUS_24100 gene fabB 1600 356 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534376.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence528 1205 669 gene locus_tag LOCUS_24110 gene ybgC 1205 669 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 protein_id gnl|my_center|LOCUS_24110 <2024 1288 gene locus_tag LOCUS_24120 <2024 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194268.1:Holliday junction branch migration DNA helicase RuvB >Feature sequence529 <1 1023 gene locus_tag LOCUS_24130 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106035.1:acetylornithine deacetylase >Feature sequence530 >Feature sequence531 <1 1830 gene locus_tag LOCUS_24140 <1 1830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194063.1:NADP-dependent malic enzyme >Feature sequence532 164 856 gene locus_tag LOCUS_24150 164 856 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969007.1 protein_id gnl|my_center|LOCUS_24150 908 984 gene locus_tag LOCUS_t00260 908 984 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence533 <2010 1130 gene locus_tag LOCUS_24160 <2010 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258127.1:hydantoinase/oxoprolinase family protein >Feature sequence534 888 262 gene locus_tag LOCUS_24170 888 262 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807035.1 protein_id gnl|my_center|LOCUS_24170 1269 913 gene locus_tag LOCUS_24180 1269 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 <2009 1382 gene locus_tag LOCUS_24190 <2009 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116438.1:bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH >Feature sequence535 309 947 gene locus_tag LOCUS_24200 309 947 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence536 1764 193 gene locus_tag LOCUS_24210 1764 193 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200059.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence537 1540 401 gene locus_tag LOCUS_24220 1540 401 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041937294.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence538 1411 638 gene locus_tag LOCUS_24230 1411 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 <1994 1408 gene locus_tag LOCUS_24240 <1994 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083885.1:branched-chain amino acid ABC transporter permease >Feature sequence539 1473 547 gene locus_tag LOCUS_24250 1473 547 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence540 114 1406 gene locus_tag LOCUS_24260 114 1406 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852902.1 protein_id gnl|my_center|LOCUS_24260 1413 1919 gene locus_tag LOCUS_24270 1413 1919 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063925.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence541 1282 965 gene locus_tag LOCUS_24280 1282 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1635 1468 gene locus_tag LOCUS_24290 1635 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence542 109 717 gene locus_tag LOCUS_24300 109 717 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393403.1 protein_id gnl|my_center|LOCUS_24300 714 1907 gene locus_tag LOCUS_24310 714 1907 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932892.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence543 691 209 gene locus_tag LOCUS_24320 gene lysM 691 209 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096210.1 protein_id gnl|my_center|LOCUS_24320 873 1454 gene locus_tag LOCUS_24330 gene grpE 873 1454 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence544 <1 759 gene locus_tag LOCUS_24340 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064203.1:branched-chain amino acid ABC transporter permease 772 1767 gene locus_tag LOCUS_24350 772 1767 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence545 415 83 gene locus_tag LOCUS_24360 415 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 1459 482 gene locus_tag LOCUS_24370 1459 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence546 456 1352 gene locus_tag LOCUS_24380 gene rpoH 456 1352 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522872.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence547 1742 342 gene locus_tag LOCUS_24390 gene amt 1742 342 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence548 1107 46 gene locus_tag LOCUS_24400 1107 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 <1964 1123 gene locus_tag LOCUS_24410 <1964 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526169.1:nicotinate phosphoribosyltransferase >Feature sequence549 786 340 gene locus_tag LOCUS_24420 786 340 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930675.1 protein_id gnl|my_center|LOCUS_24420 1178 864 gene locus_tag LOCUS_24430 gene soxZ 1178 864 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932697.1 protein_id gnl|my_center|LOCUS_24430 1681 1211 gene locus_tag LOCUS_24440 gene soxY 1681 1211 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083833.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence550 <1 1094 gene locus_tag LOCUS_24450 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041937173.1:pseudouridine synthase note possible pseudo, frameshifted 1343 1948 gene locus_tag LOCUS_24460 gene rimP 1343 1948 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193908.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence551 <1957 232 gene locus_tag LOCUS_24470 <1957 232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529369.1:cobaltochelatase subunit CobT >Feature sequence552 489 1238 gene locus_tag LOCUS_24480 gene lolD 489 1238 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence553 >Feature sequence554 <1 882 gene locus_tag LOCUS_24490 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926570.1:translation elongation factor Ts 968 1729 gene locus_tag LOCUS_24500 gene pyrH 968 1729 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926571.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence555 964 1500 gene locus_tag LOCUS_24510 964 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence556 <1928 846 gene locus_tag LOCUS_24520 <1928 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404082.1:FtsX-like permease family protein >Feature sequence557 >Feature sequence558 1568 399 gene locus_tag LOCUS_24530 1568 399 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085918.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence559 310 1539 gene locus_tag LOCUS_24540 310 1539 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242790.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence560 <1 505 gene locus_tag LOCUS_24550 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040557.1:thiamine phosphate synthase 1057 632 gene locus_tag LOCUS_24560 1057 632 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444381.1 protein_id gnl|my_center|LOCUS_24560 1402 1701 gene locus_tag LOCUS_24570 1402 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence561 1308 292 gene locus_tag LOCUS_24580 1308 292 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815063.1 protein_id gnl|my_center|LOCUS_24580 <1906 1340 gene locus_tag LOCUS_24590 <1906 1340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004204969.1:CaiB/BaiF CoA-transferase family protein >Feature sequence562 125 661 gene locus_tag LOCUS_24600 125 661 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927242.1 protein_id gnl|my_center|LOCUS_24600 717 1340 gene locus_tag LOCUS_24610 gene dsbA 717 1340 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence563 174 1553 gene locus_tag LOCUS_24620 174 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence564 582 818 gene locus_tag LOCUS_24630 582 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 1042 815 gene locus_tag LOCUS_24640 1042 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 1887 1168 gene locus_tag LOCUS_24650 1887 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence565 657 205 gene locus_tag LOCUS_24660 657 205 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_24660 968 756 gene locus_tag LOCUS_24670 gene rpsU 968 756 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence566 <1 1391 gene locus_tag LOCUS_24680 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036209.1:DUF3488 and transglutaminase-like domain-containing protein >Feature sequence567 54 812 gene locus_tag LOCUS_24690 54 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 907 1173 gene locus_tag LOCUS_24700 907 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence568 <1 630 gene locus_tag LOCUS_24710 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275358.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence569 >Feature sequence570 <1 1110 gene locus_tag LOCUS_24720 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000862049.1:acetate--CoA ligase >Feature sequence571 1615 677 gene locus_tag LOCUS_24730 1615 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 1859 1683 gene locus_tag LOCUS_24740 1859 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence572 1459 326 gene locus_tag LOCUS_24750 gene dauA 1459 326 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113780.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence573 <1 639 gene locus_tag LOCUS_24760 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275299.1:DUF3014 domain-containing protein 795 1415 gene locus_tag LOCUS_24770 795 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 1488 1751 gene locus_tag LOCUS_24780 1488 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1830 1755 gene locus_tag LOCUS_t00270 1830 1755 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence574 1082 1303 gene locus_tag LOCUS_24790 1082 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790422.1 protein_id gnl|my_center|LOCUS_24790 1293 1718 gene locus_tag LOCUS_24800 1293 1718 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653660.1 protein_id gnl|my_center|LOCUS_24800 >Feature sequence575 >Feature sequence576 >Feature sequence577 741 902 gene locus_tag LOCUS_24810 741 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 1265 945 gene locus_tag LOCUS_24820 gene trxA 1265 945 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191795.1 protein_id gnl|my_center|LOCUS_24820 >Feature sequence578 >Feature sequence579 343 1740 gene locus_tag LOCUS_24830 gene rimO 343 1740 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521351.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence580 1304 123 gene locus_tag LOCUS_24840 1304 123 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337692.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence581 <1823 949 gene locus_tag LOCUS_24850 <1823 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929839.1:DNA polymerase III subunit beta >Feature sequence582 1317 544 gene locus_tag LOCUS_24860 gene uppS 1317 544 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence583 >Feature sequence584 <1816 1035 gene locus_tag LOCUS_24870 <1816 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083901.1:benzoyl-CoA 2,3-epoxidase subunit BoxB >Feature sequence585 895 242 gene locus_tag LOCUS_24880 gene petA 895 242 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815815.1 protein_id gnl|my_center|LOCUS_24880 1109 1543 gene locus_tag LOCUS_24890 gene mscL 1109 1543 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207584.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence586 1076 1756 gene locus_tag LOCUS_24900 1076 1756 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186239.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence587 741 1691 gene locus_tag LOCUS_24910 741 1691 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258060.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence588 74 1117 gene locus_tag LOCUS_24920 74 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence589 <1 560 gene locus_tag LOCUS_24930 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194193.1:polyamine aminopropyltransferase 590 1339 gene locus_tag LOCUS_24940 590 1339 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930130.1 protein_id gnl|my_center|LOCUS_24940 1790 1356 gene locus_tag LOCUS_24950 1790 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence590 1205 168 gene locus_tag LOCUS_24960 1205 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 1701 1258 gene locus_tag LOCUS_24970 gene tolR 1701 1258 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522197.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence591 74 1 gene locus_tag LOCUS_t00280 74 1 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1010 153 gene locus_tag LOCUS_24980 1010 153 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966748.1 protein_id gnl|my_center|LOCUS_24980 1729 989 gene locus_tag LOCUS_24990 1729 989 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence592 1311 160 gene locus_tag LOCUS_25000 1311 160 CDS product 5-methylthioribulose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence593 1180 575 gene locus_tag LOCUS_25010 1180 575 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461975.1 protein_id gnl|my_center|LOCUS_25010 1793 1236 gene locus_tag LOCUS_25020 1793 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence594 887 537 gene locus_tag LOCUS_25030 gene sdhD 887 537 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_25030 1417 902 gene locus_tag LOCUS_25040 gene sdhC 1417 902 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536542.1 protein_id gnl|my_center|LOCUS_25040 1789 1457 gene locus_tag LOCUS_25050 1789 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence595 <1 581 gene locus_tag LOCUS_25060 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114106.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase 620 1183 gene locus_tag LOCUS_25070 620 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence596 251 1693 gene locus_tag LOCUS_25080 251 1693 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143598.1 protein_id gnl|my_center|LOCUS_25080 >Feature sequence597 <1784 225 gene locus_tag LOCUS_25090 <1784 225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117924.1:phospholipase D-like domain-containing protein >Feature sequence598 674 300 gene locus_tag LOCUS_25100 674 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 1480 707 gene locus_tag LOCUS_25110 1480 707 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence599 <1 1591 gene locus_tag LOCUS_25120 <1 1591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038764.1:phosphomethylpyrimidine synthase ThiC >Feature sequence600 224 514 gene locus_tag LOCUS_25130 224 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence601 170 769 gene locus_tag LOCUS_25140 170 769 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_25140 779 955 gene locus_tag LOCUS_25150 779 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence602 1155 232 gene locus_tag LOCUS_25160 1155 232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083149.1 protein_id gnl|my_center|LOCUS_25160 <1756 1152 gene locus_tag LOCUS_25170 <1756 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966688.1:nitrous oxide reductase family maturation protein NosD >Feature sequence603 >Feature sequence604 194 1228 gene locus_tag LOCUS_25180 194 1228 CDS product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 protein_id gnl|my_center|LOCUS_25180 >Feature sequence605 430 675 gene locus_tag LOCUS_25190 430 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 675 1097 gene locus_tag LOCUS_25200 675 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1747 1094 gene locus_tag LOCUS_25210 1747 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence606 >Feature sequence607 >Feature sequence608 1448 42 gene locus_tag LOCUS_25220 1448 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence609 25 1107 gene locus_tag LOCUS_25230 25 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 1356 1520 gene locus_tag LOCUS_25240 1356 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence610 <1 1116 gene locus_tag LOCUS_25250 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056378.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence611 <1728 1099 gene locus_tag LOCUS_25260 <1728 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052667156.1:TIGR02680 family protein >Feature sequence612 772 14 gene locus_tag LOCUS_25270 772 14 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 protein_id gnl|my_center|LOCUS_25270 1530 811 gene locus_tag LOCUS_25280 gene recO 1530 811 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192953.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence613 1715 6 gene locus_tag LOCUS_25290 1715 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence614 1517 888 gene locus_tag LOCUS_25300 1517 888 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence615 1084 176 gene locus_tag LOCUS_25310 1084 176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434190.1 protein_id gnl|my_center|LOCUS_25310 <1709 1112 gene locus_tag LOCUS_25320 <1709 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970061.1:ABC transporter substrate-binding protein >Feature sequence616 <1705 358 gene locus_tag LOCUS_25330 <1705 358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190165.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence617 625 263 gene locus_tag LOCUS_25340 gene gspI 625 263 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204729.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25340 1092 625 gene locus_tag LOCUS_25350 1092 625 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535320.1 protein_id gnl|my_center|LOCUS_25350 1592 1140 gene locus_tag LOCUS_25360 gene gspG 1592 1140 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085349.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence618 507 103 gene locus_tag LOCUS_25370 507 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 778 521 gene locus_tag LOCUS_25380 778 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence619 <1 602 gene locus_tag LOCUS_25390 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167378693.1:pitrilysin family protein >Feature sequence620 >Feature sequence621 <1688 1127 gene locus_tag LOCUS_25400 <1688 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584134.1:FHA domain-containing protein >Feature sequence622 <1 645 gene locus_tag LOCUS_25410 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814895.1:metalloprotease PmbA 893 675 gene locus_tag LOCUS_25420 893 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 1009 1569 gene locus_tag LOCUS_25430 gene greB 1009 1569 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence623 <1 1169 gene locus_tag LOCUS_25440 <1 1169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812368.1:IMP dehydrogenase >Feature sequence624 <1679 667 gene locus_tag LOCUS_25450 <1679 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974271.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence625 441 1139 gene locus_tag LOCUS_25460 441 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence626 964 440 gene locus_tag LOCUS_25470 964 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1335 967 gene locus_tag LOCUS_25480 gene pilH 1335 967 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_25480 >Feature sequence627 592 32 gene locus_tag LOCUS_25490 592 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 <1671 608 gene locus_tag LOCUS_25500 <1671 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_150625513.1:ParB family protein >Feature sequence628 1061 312 gene locus_tag LOCUS_25510 1061 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706121.1 protein_id gnl|my_center|LOCUS_25510 1164 1658 gene locus_tag LOCUS_25520 1164 1658 CDS product TAT leader-containing periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071170.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence629 774 187 gene locus_tag LOCUS_25530 774 187 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217107.1 protein_id gnl|my_center|LOCUS_25530 <1661 840 gene locus_tag LOCUS_25540 <1661 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930539.1:membrane protein >Feature sequence630 <1 698 gene locus_tag LOCUS_25550 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198636.1:RNA polymerase sigma factor FliA 1146 781 gene locus_tag LOCUS_25560 1146 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 1463 1143 gene locus_tag LOCUS_25570 1463 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 >Feature sequence631 3 386 gene locus_tag LOCUS_25580 3 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 416 820 gene locus_tag LOCUS_25590 416 820 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061778.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence632 <1 686 gene locus_tag LOCUS_25600 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228668.1:sulfur oxidation c-type cytochrome SoxA 712 1329 gene locus_tag LOCUS_25610 gene soxX 712 1329 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228665.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence633 373 1341 gene locus_tag LOCUS_25620 373 1341 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence634 874 5 gene locus_tag LOCUS_25630 874 5 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930098.1 protein_id gnl|my_center|LOCUS_25630 <1645 876 gene locus_tag LOCUS_25640 <1645 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115433.1:histidinol-phosphate transaminase >Feature sequence635 469 194 gene locus_tag LOCUS_25650 469 194 CDS product polyhydroxyalkanoic acid system family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095874.1 protein_id gnl|my_center|LOCUS_25650 1449 484 gene locus_tag LOCUS_25660 1449 484 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203830.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence636 1219 233 gene locus_tag LOCUS_25670 1219 233 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403426.1 protein_id gnl|my_center|LOCUS_25670 >Feature sequence637 813 19 gene locus_tag LOCUS_25680 gene ccmC 813 19 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_25680 1502 810 gene locus_tag LOCUS_25690 gene ccmB 1502 810 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928682.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence638 326 763 gene locus_tag LOCUS_25700 326 763 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193409.1 protein_id gnl|my_center|LOCUS_25700 774 1628 gene locus_tag LOCUS_25710 gene purU 774 1628 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522850.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence639 72 647 gene locus_tag LOCUS_25720 72 647 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence640 >Feature sequence641 1233 766 gene locus_tag LOCUS_25730 gene ccmE 1233 766 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_25730 1421 1230 gene locus_tag LOCUS_25740 1421 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence642 1140 88 gene locus_tag LOCUS_25750 gene hflX 1140 88 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447752.1 protein_id gnl|my_center|LOCUS_25750 1511 1275 gene locus_tag LOCUS_25760 gene hfq 1511 1275 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810707.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence643 >Feature sequence644 <1615 969 gene locus_tag LOCUS_25770 <1615 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706654.1:HD-GYP domain-containing protein >Feature sequence645 <1 930 gene locus_tag LOCUS_25780 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198363.1:DNA helicase RecQ <1614 899 gene locus_tag LOCUS_25790 <1614 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197309.1:DEAD/DEAH box helicase note possible pseudo, internal stop codon >Feature sequence646 152 817 gene locus_tag LOCUS_25800 gene carR 152 817 CDS product two-component system response regulator CarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090494.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence647 <1609 686 gene locus_tag LOCUS_25810 <1609 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531840.1:excinuclease ABC subunit UvrA >Feature sequence648 <1 1199 gene locus_tag LOCUS_25820 <1 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141609.1:TonB-dependent receptor >Feature sequence649 327 1133 gene locus_tag LOCUS_25830 327 1133 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence650 1209 253 gene locus_tag LOCUS_25840 1209 253 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929922.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence651 <1 762 gene locus_tag LOCUS_25850 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188704.1:tryptophan synthase subunit beta 762 1580 gene locus_tag LOCUS_25860 gene trpA 762 1580 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence652 814 581 gene locus_tag LOCUS_25870 814 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 1488 835 gene locus_tag LOCUS_25880 1488 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25880 >Feature sequence653 <1 637 gene locus_tag LOCUS_25890 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729028.1:thiamine pyrophosphate-binding protein 703 1389 gene locus_tag LOCUS_25900 703 1389 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence654 <1 1128 gene locus_tag LOCUS_25910 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189326.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence655 <1 516 gene locus_tag LOCUS_25920 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038705.1:GTP-binding protein 601 1029 gene locus_tag LOCUS_25930 gene dksA 601 1029 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198318.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence656 >Feature sequence657 <1 761 gene locus_tag LOCUS_25940 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073097.1:flagellar biosynthesis protein FlhF 754 1479 gene locus_tag LOCUS_25950 754 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence658 >Feature sequence659 >Feature sequence660 >Feature sequence661 1191 451 gene locus_tag LOCUS_25960 gene ubiE 1191 451 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence662 >Feature sequence663 <1 768 gene locus_tag LOCUS_25970 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104225.1:IS21-like element ISPsy14 family helper ATPase IstB 1078 797 gene locus_tag LOCUS_25980 1078 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25980 1305 1060 gene locus_tag LOCUS_25990 1305 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25990 >Feature sequence664 1215 463 gene locus_tag LOCUS_26000 1215 463 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257230.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence665 505 251 gene locus_tag LOCUS_26010 505 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence666 775 848 gene locus_tag LOCUS_t00290 775 848 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence667 994 74 gene locus_tag LOCUS_26020 994 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 <1569 994 gene locus_tag LOCUS_26030 <1569 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965213.1:long-chain fatty acid--CoA ligase >Feature sequence668 <1 1183 gene locus_tag LOCUS_26040 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929970.1:putative Na+/H+ antiporter >Feature sequence669 >Feature sequence670 1566 607 gene locus_tag LOCUS_26050 1566 607 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411849.1 protein_id gnl|my_center|LOCUS_26050 >Feature sequence671 <1 799 gene locus_tag LOCUS_26060 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930516.1:enoyl-CoA hydratase/isomerase family protein >Feature sequence672 1258 251 gene locus_tag LOCUS_26070 1258 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence673 531 1055 gene locus_tag LOCUS_26080 531 1055 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 protein_id gnl|my_center|LOCUS_26080 1048 1461 gene locus_tag LOCUS_26090 1048 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 1485 1560 gene locus_tag LOCUS_t00300 1485 1560 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence674 <1560 746 gene locus_tag LOCUS_26100 <1560 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384689.1:amino acid ABC transporter substrate-binding protein >Feature sequence675 >Feature sequence676 <1 695 gene locus_tag LOCUS_26110 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965213.1:long-chain fatty acid--CoA ligase >Feature sequence677 1186 647 gene locus_tag LOCUS_26120 gene cbaB 1186 647 CDS product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 protein_id gnl|my_center|LOCUS_26120 1394 1206 gene locus_tag LOCUS_26130 1394 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence678 1279 410 gene locus_tag LOCUS_26140 1279 410 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence679 1303 191 gene locus_tag LOCUS_26150 1303 191 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972527.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence680 <1535 157 gene locus_tag LOCUS_26160 <1535 157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458967.1:aldehyde dehydrogenase family protein >Feature sequence681 >Feature sequence682 <1 741 gene locus_tag LOCUS_26170 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187967.1:2-methylcitrate synthase >Feature sequence683 <1529 23 gene locus_tag LOCUS_26180 <1529 23 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812608.1:threonine--tRNA ligase >Feature sequence684 >Feature sequence685 502 203 gene locus_tag LOCUS_26190 502 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1524 655 gene locus_tag LOCUS_26200 gene recA 1524 655 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812760.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence686 >Feature sequence687 514 269 gene locus_tag LOCUS_26210 514 269 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_26210 618 1175 gene locus_tag LOCUS_26220 618 1175 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence688 750 52 gene locus_tag LOCUS_26230 750 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1016 747 gene locus_tag LOCUS_26240 1016 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 1204 1013 gene locus_tag LOCUS_26250 1204 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1434 1207 gene locus_tag LOCUS_26260 1434 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence689 113 481 gene locus_tag LOCUS_26270 113 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 1500 508 gene locus_tag LOCUS_26280 gene cysK 1500 508 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267110.1 protein_id gnl|my_center|LOCUS_26280