>Feature sequence01 230 556 gene locus_tag LOCUS_00010 gene trxA 230 556 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_00010 600 1334 gene locus_tag LOCUS_00020 600 1334 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927242.1 protein_id gnl|my_center|LOCUS_00020 2243 1320 gene locus_tag LOCUS_00030 2243 1320 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700645.1 protein_id gnl|my_center|LOCUS_00030 4011 2449 gene locus_tag LOCUS_00040 4011 2449 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071653.1 protein_id gnl|my_center|LOCUS_00040 4765 4016 gene locus_tag LOCUS_00050 4765 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00050 5954 4650 gene locus_tag LOCUS_00060 5954 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00060 6989 8167 gene locus_tag LOCUS_00070 gene carA 6989 8167 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_00070 8169 11387 gene locus_tag LOCUS_00080 gene carB 8169 11387 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257643.1 protein_id gnl|my_center|LOCUS_00080 12115 11366 gene locus_tag LOCUS_00090 12115 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12249 12926 gene locus_tag LOCUS_00100 12249 12926 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976477.1 protein_id gnl|my_center|LOCUS_00100 13385 12876 gene locus_tag LOCUS_00110 13385 12876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13873 13382 gene locus_tag LOCUS_00120 13873 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14405 13896 gene locus_tag LOCUS_00130 14405 13896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15934 14765 gene locus_tag LOCUS_00140 15934 14765 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_00140 16327 15938 gene locus_tag LOCUS_00150 16327 15938 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879904.1 protein_id gnl|my_center|LOCUS_00150 17325 16330 gene locus_tag LOCUS_00160 17325 16330 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868484.1 protein_id gnl|my_center|LOCUS_00160 17459 19069 gene locus_tag LOCUS_00170 17459 19069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20005 19049 gene locus_tag LOCUS_00180 20005 19049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20342 20689 gene locus_tag LOCUS_00190 20342 20689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00190 22061 20781 gene locus_tag LOCUS_00200 gene purB 22061 20781 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462315.1 protein_id gnl|my_center|LOCUS_00200 23260 22058 gene locus_tag LOCUS_00210 23260 22058 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_00210 24267 23302 gene locus_tag LOCUS_00220 24267 23302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008194003.1 protein_id gnl|my_center|LOCUS_00220 25139 24264 gene locus_tag LOCUS_00230 25139 24264 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082725.1 protein_id gnl|my_center|LOCUS_00230 25812 25141 gene locus_tag LOCUS_00240 25812 25141 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082723.1 protein_id gnl|my_center|LOCUS_00240 25980 26738 gene locus_tag LOCUS_00250 25980 26738 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_00250 26806 27327 gene locus_tag LOCUS_00260 26806 27327 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461828.1 protein_id gnl|my_center|LOCUS_00260 27324 28667 gene locus_tag LOCUS_00270 27324 28667 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812847.1 protein_id gnl|my_center|LOCUS_00270 28671 30893 gene locus_tag LOCUS_00280 gene acsB 28671 30893 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392716.1 protein_id gnl|my_center|LOCUS_00280 30905 32242 gene locus_tag LOCUS_00290 gene acsC 30905 32242 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392715.1 protein_id gnl|my_center|LOCUS_00290 32328 34247 gene locus_tag LOCUS_00300 32328 34247 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392714.1 protein_id gnl|my_center|LOCUS_00300 34232 35017 gene locus_tag LOCUS_00310 34232 35017 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_00310 35018 35998 gene locus_tag LOCUS_00320 gene cdhD 35018 35998 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_00320 35995 36798 gene locus_tag LOCUS_00330 35995 36798 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944231.1 protein_id gnl|my_center|LOCUS_00330 36821 38728 gene locus_tag LOCUS_00340 gene cooS 36821 38728 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_00340 38804 39442 gene locus_tag LOCUS_00350 38804 39442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 39467 40909 gene locus_tag LOCUS_00360 39467 40909 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_00360 40947 42098 gene locus_tag LOCUS_00370 40947 42098 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_00370 42115 44520 gene locus_tag LOCUS_00380 42115 44520 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243831.1 protein_id gnl|my_center|LOCUS_00380 44628 44996 gene locus_tag LOCUS_00390 44628 44996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 44948 45310 gene locus_tag LOCUS_00400 44948 45310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 45360 46460 gene locus_tag LOCUS_00410 45360 46460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 46571 46801 gene locus_tag LOCUS_00420 46571 46801 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546684.1 protein_id gnl|my_center|LOCUS_00420 47359 47787 gene locus_tag LOCUS_00430 gene nuoE 47359 47787 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_00430 47780 50857 gene locus_tag LOCUS_00440 47780 50857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 50854 53589 gene locus_tag LOCUS_00450 gene fdhF 50854 53589 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_00450 54089 53859 gene locus_tag LOCUS_00460 54089 53859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54382 54089 gene locus_tag LOCUS_00470 54382 54089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 54567 54740 gene locus_tag LOCUS_00480 54567 54740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 54783 56390 gene locus_tag LOCUS_00490 54783 56390 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_00490 56400 57188 gene locus_tag LOCUS_00500 56400 57188 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_00500 57136 58695 gene locus_tag LOCUS_00510 57136 58695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 58692 59249 gene locus_tag LOCUS_00520 58692 59249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 59246 60151 gene locus_tag LOCUS_00530 59246 60151 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947556.1 protein_id gnl|my_center|LOCUS_00530 60212 61426 gene locus_tag LOCUS_00540 gene tyrS 60212 61426 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583842.1 protein_id gnl|my_center|LOCUS_00540 61423 61836 gene locus_tag LOCUS_00550 61423 61836 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_00550 61904 62839 gene locus_tag LOCUS_00560 61904 62839 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_00560 62887 63591 gene locus_tag LOCUS_00570 62887 63591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63654 64205 gene locus_tag LOCUS_00580 gene pth 63654 64205 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880175.1 protein_id gnl|my_center|LOCUS_00580 64341 64490 gene locus_tag LOCUS_00590 64341 64490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 64494 64739 gene locus_tag LOCUS_00600 64494 64739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 65183 66265 gene locus_tag LOCUS_00610 65183 66265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 66279 67370 gene locus_tag LOCUS_00620 gene recF 66279 67370 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475454.1 protein_id gnl|my_center|LOCUS_00620 67367 67891 gene locus_tag LOCUS_00630 67367 67891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 67888 69042 gene locus_tag LOCUS_00640 67888 69042 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080975.1 protein_id gnl|my_center|LOCUS_00640 69074 70072 gene locus_tag LOCUS_00650 69074 70072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 70095 70649 gene locus_tag LOCUS_00660 gene hslV 70095 70649 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_00660 70654 72054 gene locus_tag LOCUS_00670 gene hslU 70654 72054 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081401.1 protein_id gnl|my_center|LOCUS_00670 72162 72479 gene locus_tag LOCUS_00680 gene rplU 72162 72479 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938226.1 protein_id gnl|my_center|LOCUS_00680 72476 72817 gene locus_tag LOCUS_00690 72476 72817 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392095.1 protein_id gnl|my_center|LOCUS_00690 72804 73073 gene locus_tag LOCUS_00700 gene rpmA 72804 73073 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228914.1 protein_id gnl|my_center|LOCUS_00700 73131 74420 gene locus_tag LOCUS_00710 gene obgE 73131 74420 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_00710 74721 74461 gene locus_tag LOCUS_00720 74721 74461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 74890 74714 gene locus_tag LOCUS_00730 74890 74714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 75851 74907 gene locus_tag LOCUS_00740 75851 74907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 77658 76396 gene locus_tag LOCUS_00750 77658 76396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 78112 77843 gene locus_tag LOCUS_00760 78112 77843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 78395 78090 gene locus_tag LOCUS_00770 78395 78090 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_00770 78721 78392 gene locus_tag LOCUS_00780 78721 78392 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_00780 79367 78729 gene locus_tag LOCUS_00790 79367 78729 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337086.1 protein_id gnl|my_center|LOCUS_00790 79488 82331 gene locus_tag LOCUS_00800 79488 82331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 82400 82915 gene locus_tag LOCUS_00810 82400 82915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 83018 83500 gene locus_tag LOCUS_00820 83018 83500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 83936 83526 gene locus_tag LOCUS_00830 83936 83526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 84606 83941 gene locus_tag LOCUS_00840 84606 83941 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707347.1 protein_id gnl|my_center|LOCUS_00840 84702 85682 gene locus_tag LOCUS_00850 84702 85682 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_00850 85738 86313 gene locus_tag LOCUS_00860 gene yhdA 85738 86313 CDS product FMN-dependent NADPH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244703.1 protein_id gnl|my_center|LOCUS_00860 86479 89079 gene locus_tag LOCUS_00870 86479 89079 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840071.1 protein_id gnl|my_center|LOCUS_00870 89169 89246 gene locus_tag LOCUS_t00010 89169 89246 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 89317 89390 gene locus_tag LOCUS_t00020 89317 89390 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 89458 90561 gene locus_tag LOCUS_00880 89458 90561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 91347 90763 gene locus_tag LOCUS_00890 91347 90763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 91580 91344 gene locus_tag LOCUS_00900 91580 91344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 93720 91723 gene locus_tag LOCUS_00910 gene uvrB 93720 91723 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_00910 94072 93704 gene locus_tag LOCUS_00920 94072 93704 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_00920 94131 94763 gene locus_tag LOCUS_00930 94131 94763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 95225 94707 gene locus_tag LOCUS_00940 gene coaD 95225 94707 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080981.1 protein_id gnl|my_center|LOCUS_00940 95655 95374 gene locus_tag LOCUS_00950 95655 95374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 96413 95688 gene locus_tag LOCUS_00960 96413 95688 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081260.1 protein_id gnl|my_center|LOCUS_00960 97177 96410 gene locus_tag LOCUS_00970 97177 96410 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_00970 97853 97161 gene locus_tag LOCUS_00980 97853 97161 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_00980 98848 97952 gene locus_tag LOCUS_00990 98848 97952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 99008 99265 gene locus_tag LOCUS_01000 99008 99265 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545042.1 protein_id gnl|my_center|LOCUS_01000 99258 99668 gene locus_tag LOCUS_01010 99258 99668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 99696 101072 gene locus_tag LOCUS_01020 gene lysC 99696 101072 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_01020 101069 101818 gene locus_tag LOCUS_01030 gene dapB 101069 101818 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_01030 101815 102705 gene locus_tag LOCUS_01040 gene dapA 101815 102705 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933288.1 protein_id gnl|my_center|LOCUS_01040 102815 103651 gene locus_tag LOCUS_01050 102815 103651 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_01050 103709 103936 gene locus_tag LOCUS_01060 103709 103936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 103938 105179 gene locus_tag LOCUS_01070 103938 105179 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_01070 105261 108746 gene locus_tag LOCUS_01080 105261 108746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 108795 109493 gene locus_tag LOCUS_01090 108795 109493 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420966.1 protein_id gnl|my_center|LOCUS_01090 109490 109744 gene locus_tag LOCUS_01100 gene purS 109490 109744 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058019.1 protein_id gnl|my_center|LOCUS_01100 109744 110463 gene locus_tag LOCUS_01110 gene purQ 109744 110463 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666779.1 protein_id gnl|my_center|LOCUS_01110 110478 112763 gene locus_tag LOCUS_01120 gene purL 110478 112763 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_01120 112760 114157 gene locus_tag LOCUS_01130 gene purF 112760 114157 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546301.1 protein_id gnl|my_center|LOCUS_01130 114164 115180 gene locus_tag LOCUS_01140 gene purM 114164 115180 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_01140 115690 115187 gene locus_tag LOCUS_01150 gene ruvC 115690 115187 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_01150 116187 115693 gene locus_tag LOCUS_01160 116187 115693 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583304.1 protein_id gnl|my_center|LOCUS_01160 117820 116213 gene locus_tag LOCUS_01170 117820 116213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 118667 117807 gene locus_tag LOCUS_01180 gene folP 118667 117807 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_01180 118824 119294 gene locus_tag LOCUS_01190 gene rplI 118824 119294 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391680.1 protein_id gnl|my_center|LOCUS_01190 119327 120970 gene locus_tag LOCUS_01200 119327 120970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 120976 122505 gene locus_tag LOCUS_01210 gene murJ 120976 122505 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_01210 122587 123426 gene locus_tag LOCUS_01220 122587 123426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 123464 123709 gene locus_tag LOCUS_01230 123464 123709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 124465 123737 gene locus_tag LOCUS_01240 124465 123737 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250957.1 protein_id gnl|my_center|LOCUS_01240 124875 124471 gene locus_tag LOCUS_01250 gene hypA 124875 124471 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867705.1 protein_id gnl|my_center|LOCUS_01250 126772 124886 gene locus_tag LOCUS_01260 126772 124886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 127265 129640 gene locus_tag LOCUS_01270 gene lon 127265 129640 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_01270 129624 130397 gene locus_tag LOCUS_01280 129624 130397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 130434 131126 gene locus_tag LOCUS_01290 gene thyX 130434 131126 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081517.1 protein_id gnl|my_center|LOCUS_01290 131292 134489 gene locus_tag LOCUS_01300 131292 134489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01300 135290 134532 gene locus_tag LOCUS_01310 135290 134532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 135721 135437 gene locus_tag LOCUS_01320 135721 135437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 137670 135829 gene locus_tag LOCUS_01330 137670 135829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 137795 138046 gene locus_tag LOCUS_01340 137795 138046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 138036 138485 gene locus_tag LOCUS_01350 138036 138485 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_01350 140478 138709 gene locus_tag LOCUS_01360 140478 138709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 140728 140970 gene locus_tag LOCUS_01370 140728 140970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 140967 141398 gene locus_tag LOCUS_01380 140967 141398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 141509 141745 gene locus_tag LOCUS_01390 141509 141745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 141742 142128 gene locus_tag LOCUS_01400 141742 142128 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_01400 142258 145563 gene locus_tag LOCUS_01410 142258 145563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 146672 145587 gene locus_tag LOCUS_01420 gene hypD 146672 145587 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_01420 146914 146669 gene locus_tag LOCUS_01430 146914 146669 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_01430 149369 146919 gene locus_tag LOCUS_01440 gene hypF 149369 146919 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_01440 149519 151258 gene locus_tag LOCUS_01450 149519 151258 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990744.1 protein_id gnl|my_center|LOCUS_01450 151372 151566 gene locus_tag LOCUS_01460 151372 151566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 152338 151892 gene locus_tag LOCUS_01470 152338 151892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 152590 152351 gene locus_tag LOCUS_01480 152590 152351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 154064 152727 gene locus_tag LOCUS_01490 154064 152727 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_01490 156298 154367 gene locus_tag LOCUS_01500 156298 154367 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_01500 157475 156324 gene locus_tag LOCUS_01510 gene sucC 157475 156324 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_01510 157861 157607 gene locus_tag LOCUS_01520 157861 157607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 158672 157905 gene locus_tag LOCUS_01530 158672 157905 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578368.1 protein_id gnl|my_center|LOCUS_01530 158779 161358 gene locus_tag LOCUS_01540 gene mutS 158779 161358 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774369.1 protein_id gnl|my_center|LOCUS_01540 161409 161633 gene locus_tag LOCUS_01550 161409 161633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 161623 162015 gene locus_tag LOCUS_01560 161623 162015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 163883 162201 gene locus_tag LOCUS_01570 163883 162201 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545979.1 protein_id gnl|my_center|LOCUS_01570 164321 163890 gene locus_tag LOCUS_01580 164321 163890 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_01580 165047 164331 gene locus_tag LOCUS_01590 165047 164331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 166282 165119 gene locus_tag LOCUS_01600 166282 165119 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066039.1 protein_id gnl|my_center|LOCUS_01600 167961 166288 gene locus_tag LOCUS_01610 167961 166288 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_01610 168237 167968 gene locus_tag LOCUS_01620 168237 167968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 168420 170327 gene locus_tag LOCUS_01630 168420 170327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 170359 170640 gene locus_tag LOCUS_01640 170359 170640 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_01640 170720 170645 gene locus_tag LOCUS_t00030 170720 170645 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 170931 170728 gene locus_tag LOCUS_01650 170931 170728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 170981 171496 gene locus_tag LOCUS_01660 170981 171496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 171917 172159 gene locus_tag LOCUS_01670 171917 172159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 172489 172950 gene locus_tag LOCUS_01680 gene rimP 172489 172950 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986793.1 protein_id gnl|my_center|LOCUS_01680 172989 173966 gene locus_tag LOCUS_01690 gene nusA 172989 173966 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583567.1 protein_id gnl|my_center|LOCUS_01690 173986 176850 gene locus_tag LOCUS_01700 173986 176850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 177023 178582 gene locus_tag LOCUS_01710 gene rny 177023 178582 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_01710 178601 178876 gene locus_tag LOCUS_01720 178601 178876 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404796.1 protein_id gnl|my_center|LOCUS_01720 181461 178897 gene locus_tag LOCUS_01730 gene secA 181461 178897 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_01730 183715 181574 gene locus_tag LOCUS_01740 183715 181574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 184476 183787 gene locus_tag LOCUS_01750 184476 183787 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942362.1 protein_id gnl|my_center|LOCUS_01750 185794 184553 gene locus_tag LOCUS_01760 185794 184553 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_01760 186759 185791 gene locus_tag LOCUS_01770 186759 185791 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251204.1 protein_id gnl|my_center|LOCUS_01770 189742 186875 gene locus_tag LOCUS_01780 189742 186875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 192151 189785 gene locus_tag LOCUS_01790 192151 189785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 192582 192169 gene locus_tag LOCUS_01800 192582 192169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 192978 192595 gene locus_tag LOCUS_01810 192978 192595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 194598 193024 gene locus_tag LOCUS_01820 194598 193024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015840.1 protein_id gnl|my_center|LOCUS_01820 195381 194971 gene locus_tag LOCUS_01830 195381 194971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 195587 195381 gene locus_tag LOCUS_01840 195587 195381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 195955 196287 gene locus_tag LOCUS_01850 195955 196287 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_01850 197151 196894 gene locus_tag LOCUS_01860 197151 196894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 197541 197317 gene locus_tag LOCUS_01870 197541 197317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 198197 198000 gene locus_tag LOCUS_01880 198197 198000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 199431 198208 gene locus_tag LOCUS_01890 gene pglJ 199431 198208 CDS product N-acetylgalactosamine-N,N'-diacetylbacillosaminyl-diphospho-undecaprenol 4-alpha-N-acetylgalactosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852870.1 protein_id gnl|my_center|LOCUS_01890 204446 199437 gene locus_tag LOCUS_01900 204446 199437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 205435 204464 gene locus_tag LOCUS_01910 205435 204464 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_01910 206755 205451 gene locus_tag LOCUS_01920 206755 205451 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545193.1 protein_id gnl|my_center|LOCUS_01920 207739 206768 gene locus_tag LOCUS_01930 207739 206768 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880856.1 protein_id gnl|my_center|LOCUS_01930 208315 207851 gene locus_tag LOCUS_01940 208315 207851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 209595 208753 gene locus_tag LOCUS_01950 209595 208753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 209965 209609 gene locus_tag LOCUS_01960 209965 209609 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119361310.1 protein_id gnl|my_center|LOCUS_01960 210804 209962 gene locus_tag LOCUS_01970 210804 209962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 211595 210804 gene locus_tag LOCUS_01980 211595 210804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 212598 211588 gene locus_tag LOCUS_01990 212598 211588 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_01990 213719 212595 gene locus_tag LOCUS_02000 213719 212595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 214109 213756 gene locus_tag LOCUS_02010 214109 213756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02010 214289 214164 gene locus_tag LOCUS_02020 214289 214164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 216790 214457 gene locus_tag LOCUS_02030 216790 214457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 217142 216933 gene locus_tag LOCUS_02040 217142 216933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 217353 217171 gene locus_tag LOCUS_02050 217353 217171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 217623 217399 gene locus_tag LOCUS_02060 217623 217399 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_02060 217950 217696 gene locus_tag LOCUS_02070 217950 217696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 219371 218223 gene locus_tag LOCUS_02080 219371 218223 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_02080 220176 219433 gene locus_tag LOCUS_02090 220176 219433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266511.1 protein_id gnl|my_center|LOCUS_02090 220486 220202 gene locus_tag LOCUS_02100 220486 220202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 220707 220483 gene locus_tag LOCUS_02110 220707 220483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 221544 220756 gene locus_tag LOCUS_02120 221544 220756 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_02120 221636 222019 gene locus_tag LOCUS_02130 221636 222019 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227927.1 protein_id gnl|my_center|LOCUS_02130 221976 222347 gene locus_tag LOCUS_02140 221976 222347 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227926.1 protein_id gnl|my_center|LOCUS_02140 222341 222739 gene locus_tag LOCUS_02150 gene mce 222341 222739 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867372.1 protein_id gnl|my_center|LOCUS_02150 222962 222753 gene locus_tag LOCUS_02160 222962 222753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 223238 227260 gene locus_tag LOCUS_02170 223238 227260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 227323 227817 gene locus_tag LOCUS_02180 227323 227817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 227814 229121 gene locus_tag LOCUS_02190 227814 229121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 229335 230582 gene locus_tag LOCUS_02200 gene xseA 229335 230582 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958100.1 protein_id gnl|my_center|LOCUS_02200 230563 230787 gene locus_tag LOCUS_02210 230563 230787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 230794 233595 gene locus_tag LOCUS_02220 230794 233595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 233614 234549 gene locus_tag LOCUS_02230 gene sppA 233614 234549 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_02230 234652 235062 gene locus_tag LOCUS_02240 234652 235062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 235055 235297 gene locus_tag LOCUS_02250 235055 235297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 235294 236358 gene locus_tag LOCUS_02260 235294 236358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 237002 237259 gene locus_tag LOCUS_02270 237002 237259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 237969 237265 gene locus_tag LOCUS_02280 237969 237265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 238677 237976 gene locus_tag LOCUS_02290 238677 237976 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938748.1 protein_id gnl|my_center|LOCUS_02290 238790 238865 gene locus_tag LOCUS_t00040 238790 238865 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 239319 239071 gene locus_tag LOCUS_02300 239319 239071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 241388 239883 gene locus_tag LOCUS_02310 241388 239883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 241932 241402 gene locus_tag LOCUS_02320 241932 241402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 245705 243024 gene locus_tag LOCUS_02330 245705 243024 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_02330 250666 245711 gene locus_tag LOCUS_02340 gene rpoC 250666 245711 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869935.1 protein_id gnl|my_center|LOCUS_02340 250936 250700 gene locus_tag LOCUS_02350 250936 250700 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082747.1 protein_id gnl|my_center|LOCUS_02350 251540 251136 gene locus_tag LOCUS_02360 251540 251136 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142893.1 protein_id gnl|my_center|LOCUS_02360 251736 251533 gene locus_tag LOCUS_02370 251736 251533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 251852 253792 gene locus_tag LOCUS_02380 251852 253792 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_02380 254208 253915 gene locus_tag LOCUS_02390 254208 253915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 255293 254328 gene locus_tag LOCUS_02400 255293 254328 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_02400 256075 255449 gene locus_tag LOCUS_02410 256075 255449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 256499 256155 gene locus_tag LOCUS_02420 256499 256155 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_02420 256779 256486 gene locus_tag LOCUS_02430 256779 256486 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066199.1 protein_id gnl|my_center|LOCUS_02430 256842 257036 gene locus_tag LOCUS_02440 256842 257036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 257059 258735 gene locus_tag LOCUS_02450 257059 258735 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_02450 260129 259215 gene locus_tag LOCUS_02460 260129 259215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 260647 260363 gene locus_tag LOCUS_02470 260647 260363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 260955 260644 gene locus_tag LOCUS_02480 260955 260644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 263883 260998 gene locus_tag LOCUS_02490 gene uvrA 263883 260998 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_02490 264127 263894 gene locus_tag LOCUS_02500 264127 263894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 265741 264296 gene locus_tag LOCUS_02510 gene proS 265741 264296 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_02510 266547 265825 gene locus_tag LOCUS_02520 266547 265825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 266951 266613 gene locus_tag LOCUS_02530 266951 266613 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_02530 267241 266948 gene locus_tag LOCUS_02540 267241 266948 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_02540 268060 267491 gene locus_tag LOCUS_02550 268060 267491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 269238 268150 gene locus_tag LOCUS_02560 269238 268150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 269847 269308 gene locus_tag LOCUS_02570 269847 269308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 270150 271139 gene locus_tag LOCUS_02580 270150 271139 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615893.1 protein_id gnl|my_center|LOCUS_02580 271576 272229 gene locus_tag LOCUS_02590 271576 272229 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_02590 272987 272217 gene locus_tag LOCUS_02600 272987 272217 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289227.1 protein_id gnl|my_center|LOCUS_02600 273520 272990 gene locus_tag LOCUS_02610 273520 272990 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_02610 273834 273526 gene locus_tag LOCUS_02620 273834 273526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 273914 274441 gene locus_tag LOCUS_02630 273914 274441 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_02630 275018 274470 gene locus_tag LOCUS_02640 275018 274470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 275939 275331 gene locus_tag LOCUS_02650 gene coaE 275939 275331 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_02650 276756 275962 gene locus_tag LOCUS_02660 276756 275962 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_02660 276890 277540 gene locus_tag LOCUS_02670 276890 277540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 277537 278961 gene locus_tag LOCUS_02680 277537 278961 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546737.1 protein_id gnl|my_center|LOCUS_02680 278928 280061 gene locus_tag LOCUS_02690 278928 280061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 280127 280399 gene locus_tag LOCUS_02700 280127 280399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 281513 280560 gene locus_tag LOCUS_02710 281513 280560 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_02710 281896 281513 gene locus_tag LOCUS_02720 gene nusB 281896 281513 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082311.1 protein_id gnl|my_center|LOCUS_02720 282095 281901 gene locus_tag LOCUS_02730 282095 281901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 282667 282092 gene locus_tag LOCUS_02740 282667 282092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 283113 282664 gene locus_tag LOCUS_02750 283113 282664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 283685 283125 gene locus_tag LOCUS_02760 gene efp 283685 283125 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545338.1 protein_id gnl|my_center|LOCUS_02760 284555 283701 gene locus_tag LOCUS_02770 gene tatC 284555 283701 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_02770 285752 284697 gene locus_tag LOCUS_02780 285752 284697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 286074 285736 gene locus_tag LOCUS_02790 286074 285736 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172987.1 protein_id gnl|my_center|LOCUS_02790 286743 286252 gene locus_tag LOCUS_02800 286743 286252 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_02800 286987 286736 gene locus_tag LOCUS_02810 286987 286736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 289637 287046 gene locus_tag LOCUS_02820 289637 287046 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877404.1 protein_id gnl|my_center|LOCUS_02820 289975 289619 gene locus_tag LOCUS_02830 289975 289619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 291385 290105 gene locus_tag LOCUS_02840 gene tgt 291385 290105 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878982.1 protein_id gnl|my_center|LOCUS_02840 291896 291405 gene locus_tag LOCUS_02850 291896 291405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 292523 292098 gene locus_tag LOCUS_02860 292523 292098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 295149 292585 gene locus_tag LOCUS_02870 295149 292585 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_02870 296864 295146 gene locus_tag LOCUS_02880 296864 295146 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121419.1 protein_id gnl|my_center|LOCUS_02880 297772 296861 gene locus_tag LOCUS_02890 297772 296861 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_02890 298739 297753 gene locus_tag LOCUS_02900 298739 297753 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_02900 299739 298795 gene locus_tag LOCUS_02910 299739 298795 CDS product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295918.1 protein_id gnl|my_center|LOCUS_02910 300174 299782 gene locus_tag LOCUS_02920 300174 299782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 300702 300220 gene locus_tag LOCUS_02930 300702 300220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 301794 300727 gene locus_tag LOCUS_02940 301794 300727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 303218 301791 gene locus_tag LOCUS_02950 303218 301791 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_02950 303508 304407 gene locus_tag LOCUS_02960 gene ctaA 303508 304407 CDS product heme A synthase CtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245869.1 protein_id gnl|my_center|LOCUS_02960 304400 305287 gene locus_tag LOCUS_02970 304400 305287 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142163.1 protein_id gnl|my_center|LOCUS_02970 305284 305697 gene locus_tag LOCUS_02980 305284 305697 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880044.1 protein_id gnl|my_center|LOCUS_02980 306941 305685 gene locus_tag LOCUS_02990 306941 305685 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868819.1 protein_id gnl|my_center|LOCUS_02990 308297 307041 gene locus_tag LOCUS_03000 gene hutI 308297 307041 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203599.1 protein_id gnl|my_center|LOCUS_03000 308810 308376 gene locus_tag LOCUS_03010 308810 308376 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286612.1 protein_id gnl|my_center|LOCUS_03010 309445 308888 gene locus_tag LOCUS_03020 309445 308888 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405473.1 protein_id gnl|my_center|LOCUS_03020 309568 310116 gene locus_tag LOCUS_03030 309568 310116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 310116 310646 gene locus_tag LOCUS_03040 310116 310646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 311337 310630 gene locus_tag LOCUS_03050 gene ntcA 311337 310630 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920910.1 protein_id gnl|my_center|LOCUS_03050 311471 311644 gene locus_tag LOCUS_03060 311471 311644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 312240 311641 gene locus_tag LOCUS_03070 312240 311641 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_03070 312352 312798 gene locus_tag LOCUS_03080 gene ruvX 312352 312798 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_03080 312975 313292 gene locus_tag LOCUS_03090 312975 313292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 313282 313575 gene locus_tag LOCUS_03100 313282 313575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 314866 313616 gene locus_tag LOCUS_03110 314866 313616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 315898 314990 gene locus_tag LOCUS_03120 315898 314990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 316127 315918 gene locus_tag LOCUS_03130 gene yidD 316127 315918 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_03130 316434 316186 gene locus_tag LOCUS_03140 316434 316186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 316876 316442 gene locus_tag LOCUS_03150 316876 316442 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268889.1 protein_id gnl|my_center|LOCUS_03150 316945 318192 gene locus_tag LOCUS_03160 316945 318192 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_03160 318258 318713 gene locus_tag LOCUS_03170 gene rpsI 318258 318713 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_03170 318786 318995 gene locus_tag LOCUS_03180 gene rpmE 318786 318995 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632496.1 protein_id gnl|my_center|LOCUS_03180 319000 320124 gene locus_tag LOCUS_03190 319000 320124 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958610.1 protein_id gnl|my_center|LOCUS_03190 320176 321138 gene locus_tag LOCUS_03200 320176 321138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 321111 321698 gene locus_tag LOCUS_03210 321111 321698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 322408 321710 gene locus_tag LOCUS_03220 gene radC 322408 321710 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938489.1 protein_id gnl|my_center|LOCUS_03220 324628 322487 gene locus_tag LOCUS_03230 324628 322487 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076961.1 protein_id gnl|my_center|LOCUS_03230 325485 324625 gene locus_tag LOCUS_03240 325485 324625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 325926 327929 gene locus_tag LOCUS_03250 325926 327929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 327975 330551 gene locus_tag LOCUS_03260 327975 330551 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762664.1 protein_id gnl|my_center|LOCUS_03260 330562 331611 gene locus_tag LOCUS_03270 330562 331611 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762663.1 protein_id gnl|my_center|LOCUS_03270 331737 333143 gene locus_tag LOCUS_03280 331737 333143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240320.1 protein_id gnl|my_center|LOCUS_03280 333148 334161 gene locus_tag LOCUS_03290 333148 334161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_03290 334158 335183 gene locus_tag LOCUS_03300 334158 335183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762316.1 protein_id gnl|my_center|LOCUS_03300 336497 335196 gene locus_tag LOCUS_03310 gene hisS 336497 335196 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425978.1 protein_id gnl|my_center|LOCUS_03310 336766 336596 gene locus_tag LOCUS_03320 336766 336596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 336768 337247 gene locus_tag LOCUS_03330 336768 337247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 339272 337278 gene locus_tag LOCUS_03340 339272 337278 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_03340 341263 339293 gene locus_tag LOCUS_03350 341263 339293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 341579 341391 gene locus_tag LOCUS_03360 341579 341391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 343194 342241 gene locus_tag LOCUS_03370 gene nadA 343194 342241 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228349.1 protein_id gnl|my_center|LOCUS_03370 344039 343191 gene locus_tag LOCUS_03380 gene nadC 344039 343191 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 protein_id gnl|my_center|LOCUS_03380 346399 344042 gene locus_tag LOCUS_03390 346399 344042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 346555 346628 gene locus_tag LOCUS_t00050 346555 346628 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 346631 347566 gene locus_tag LOCUS_03400 gene meaB 346631 347566 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_03400 348293 347595 gene locus_tag LOCUS_03410 348293 347595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 348434 349381 gene locus_tag LOCUS_03420 348434 349381 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258947.1 protein_id gnl|my_center|LOCUS_03420 350695 349403 gene locus_tag LOCUS_03430 350695 349403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 350899 351429 gene locus_tag LOCUS_03440 350899 351429 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256718.1 protein_id gnl|my_center|LOCUS_03440 351496 352110 gene locus_tag LOCUS_03450 351496 352110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 352114 353613 gene locus_tag LOCUS_03460 352114 353613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 353610 354095 gene locus_tag LOCUS_03470 353610 354095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 354122 354628 gene locus_tag LOCUS_03480 354122 354628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 354625 356976 gene locus_tag LOCUS_03490 354625 356976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 357006 357857 gene locus_tag LOCUS_03500 357006 357857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 357879 358766 gene locus_tag LOCUS_03510 357879 358766 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_03510 360031 358763 gene locus_tag LOCUS_03520 360031 358763 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174245.1 protein_id gnl|my_center|LOCUS_03520 361605 360139 gene locus_tag LOCUS_03530 361605 360139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 362782 361709 gene locus_tag LOCUS_03540 362782 361709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 364328 362796 gene locus_tag LOCUS_03550 364328 362796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 365250 364333 gene locus_tag LOCUS_03560 365250 364333 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921634.1 protein_id gnl|my_center|LOCUS_03560 365843 365346 gene locus_tag LOCUS_03570 gene moaC 365843 365346 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639855.1 protein_id gnl|my_center|LOCUS_03570 366186 365935 gene locus_tag LOCUS_03580 gene acpP 366186 365935 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545237.1 protein_id gnl|my_center|LOCUS_03580 366987 366247 gene locus_tag LOCUS_03590 gene fabG 366987 366247 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_03590 367927 367046 gene locus_tag LOCUS_03600 367927 367046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 368084 368009 gene locus_tag LOCUS_t00060 368084 368009 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 368251 370434 gene locus_tag LOCUS_03610 368251 370434 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812978.1 protein_id gnl|my_center|LOCUS_03610 370927 370424 gene locus_tag LOCUS_03620 370927 370424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 371140 370931 gene locus_tag LOCUS_03630 371140 370931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 371635 371168 gene locus_tag LOCUS_03640 371635 371168 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088276.1 protein_id gnl|my_center|LOCUS_03640 372991 371675 gene locus_tag LOCUS_03650 372991 371675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 373272 373922 gene locus_tag LOCUS_03660 373272 373922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 373922 374812 gene locus_tag LOCUS_03670 gene dprA 373922 374812 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_03670 374805 375617 gene locus_tag LOCUS_03680 374805 375617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 375748 376032 gene locus_tag LOCUS_03690 375748 376032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 376029 376334 gene locus_tag LOCUS_03700 376029 376334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 377006 376350 gene locus_tag LOCUS_03710 377006 376350 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_03710 377349 377050 gene locus_tag LOCUS_03720 377349 377050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 379911 377620 gene locus_tag LOCUS_03730 379911 377620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 380832 380086 gene locus_tag LOCUS_03740 380832 380086 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_03740 382043 380844 gene locus_tag LOCUS_03750 382043 380844 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_03750 383214 382048 gene locus_tag LOCUS_03760 383214 382048 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259080.1 protein_id gnl|my_center|LOCUS_03760 384324 383284 gene locus_tag LOCUS_03770 384324 383284 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_03770 384523 385383 gene locus_tag LOCUS_03780 384523 385383 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615409.1 protein_id gnl|my_center|LOCUS_03780 386614 385715 gene locus_tag LOCUS_03790 386614 385715 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_03790 386843 386628 gene locus_tag LOCUS_03800 386843 386628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 387915 386881 gene locus_tag LOCUS_03810 387915 386881 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931000.1 protein_id gnl|my_center|LOCUS_03810 388643 387972 gene locus_tag LOCUS_03820 388643 387972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 388967 388659 gene locus_tag LOCUS_03830 388967 388659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 390505 389102 gene locus_tag LOCUS_03840 390505 389102 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_03840 391274 390489 gene locus_tag LOCUS_03850 391274 390489 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_03850 392214 391276 gene locus_tag LOCUS_03860 392214 391276 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_03860 392659 392198 gene locus_tag LOCUS_03870 392659 392198 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_03870 393789 392659 gene locus_tag LOCUS_03880 393789 392659 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_03880 394006 395529 gene locus_tag LOCUS_03890 394006 395529 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_03890 395592 397085 gene locus_tag LOCUS_03900 gene dop 395592 397085 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_03900 397110 397277 gene locus_tag LOCUS_03910 397110 397277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 397316 398092 gene locus_tag LOCUS_03920 gene prcB 397316 398092 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_03920 398101 398832 gene locus_tag LOCUS_03930 398101 398832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 398838 400298 gene locus_tag LOCUS_03940 gene dop 398838 400298 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_03940 401392 400301 gene locus_tag LOCUS_03950 401392 400301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 402812 401496 gene locus_tag LOCUS_03960 402812 401496 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_03960 403056 405770 gene locus_tag LOCUS_03970 gene acnA 403056 405770 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_03970 409905 405790 gene locus_tag LOCUS_03980 409905 405790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 410777 409938 gene locus_tag LOCUS_03990 410777 409938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 412843 410786 gene locus_tag LOCUS_04000 412843 410786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 413251 414381 gene locus_tag LOCUS_04010 413251 414381 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_04010 414502 414957 gene locus_tag LOCUS_04020 414502 414957 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_04020 415726 417087 gene locus_tag LOCUS_04030 415726 417087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 417428 417775 gene locus_tag LOCUS_04040 417428 417775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 417762 418805 gene locus_tag LOCUS_04050 417762 418805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 418802 419770 gene locus_tag LOCUS_04060 418802 419770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 420023 420235 gene locus_tag LOCUS_04070 420023 420235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 420346 420828 gene locus_tag LOCUS_04080 420346 420828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 420948 422873 gene locus_tag LOCUS_04090 gene thrS 420948 422873 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_04090 425460 423208 gene locus_tag LOCUS_04100 425460 423208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 426709 425531 gene locus_tag LOCUS_04110 gene metK 426709 425531 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_04110 426810 427601 gene locus_tag LOCUS_04120 426810 427601 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977503.1 protein_id gnl|my_center|LOCUS_04120 427808 428590 gene locus_tag LOCUS_04130 427808 428590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 protein_id gnl|my_center|LOCUS_04130 428577 429365 gene locus_tag LOCUS_04140 428577 429365 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256332.1 protein_id gnl|my_center|LOCUS_04140 429428 430432 gene locus_tag LOCUS_04150 429428 430432 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705475.1 protein_id gnl|my_center|LOCUS_04150 430433 431134 gene locus_tag LOCUS_04160 430433 431134 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940624.1 protein_id gnl|my_center|LOCUS_04160 431127 432197 gene locus_tag LOCUS_04170 431127 432197 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846612.1 protein_id gnl|my_center|LOCUS_04170 432197 432856 gene locus_tag LOCUS_04180 gene thiE 432197 432856 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244128.1 protein_id gnl|my_center|LOCUS_04180 432864 434237 gene locus_tag LOCUS_04190 432864 434237 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_04190 434398 434748 gene locus_tag LOCUS_04200 434398 434748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 434766 436595 gene locus_tag LOCUS_04210 434766 436595 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228564.1 protein_id gnl|my_center|LOCUS_04210 436615 436920 gene locus_tag LOCUS_04220 436615 436920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 436950 437531 gene locus_tag LOCUS_04230 436950 437531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 437543 438595 gene locus_tag LOCUS_04240 437543 438595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 438592 438897 gene locus_tag LOCUS_04250 438592 438897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 438901 440649 gene locus_tag LOCUS_04260 438901 440649 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_04260 440646 442046 gene locus_tag LOCUS_04270 440646 442046 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173333.1 protein_id gnl|my_center|LOCUS_04270 442143 443330 gene locus_tag LOCUS_04280 442143 443330 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512886.1 protein_id gnl|my_center|LOCUS_04280 443308 444108 gene locus_tag LOCUS_04290 443308 444108 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_04290 444080 444739 gene locus_tag LOCUS_04300 444080 444739 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903575.1 protein_id gnl|my_center|LOCUS_04300 445283 444714 gene locus_tag LOCUS_04310 445283 444714 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880755.1 protein_id gnl|my_center|LOCUS_04310 447270 445339 gene locus_tag LOCUS_04320 gene gyrB 447270 445339 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_04320 447531 448538 gene locus_tag LOCUS_04330 gene corA 447531 448538 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_04330 449170 448541 gene locus_tag LOCUS_04340 449170 448541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 450246 449179 gene locus_tag LOCUS_04350 gene pdhA 450246 449179 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_04350 450420 451217 gene locus_tag LOCUS_04360 gene sufC 450420 451217 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_04360 451219 452679 gene locus_tag LOCUS_04370 gene sufB 451219 452679 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888737.1 protein_id gnl|my_center|LOCUS_04370 452686 453966 gene locus_tag LOCUS_04380 gene sufD 452686 453966 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_04380 453966 454358 gene locus_tag LOCUS_04390 453966 454358 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_04390 454355 454663 gene locus_tag LOCUS_04400 454355 454663 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_04400 454678 455928 gene locus_tag LOCUS_04410 454678 455928 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_04410 456980 455925 gene locus_tag LOCUS_04420 456980 455925 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288096.1 protein_id gnl|my_center|LOCUS_04420 458312 457023 gene locus_tag LOCUS_04430 gene fabF 458312 457023 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_04430 458374 459072 gene locus_tag LOCUS_04440 458374 459072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 459134 459646 gene locus_tag LOCUS_04450 459134 459646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 460014 459733 gene locus_tag LOCUS_04460 460014 459733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 460327 460004 gene locus_tag LOCUS_04470 460327 460004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 460467 461669 gene locus_tag LOCUS_04480 460467 461669 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114530.1 protein_id gnl|my_center|LOCUS_04480 461734 462183 gene locus_tag LOCUS_04490 gene lspA 461734 462183 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_04490 462185 462796 gene locus_tag LOCUS_04500 gene tmk 462185 462796 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932982.1 protein_id gnl|my_center|LOCUS_04500 462809 463951 gene locus_tag LOCUS_04510 gene dnaN 462809 463951 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725616.1 protein_id gnl|my_center|LOCUS_04510 464111 465127 gene locus_tag LOCUS_04520 464111 465127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 465144 466082 gene locus_tag LOCUS_04530 465144 466082 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530028.1 protein_id gnl|my_center|LOCUS_04530 466086 466838 gene locus_tag LOCUS_04540 466086 466838 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_04540 466848 468380 gene locus_tag LOCUS_04550 466848 468380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 468450 468863 gene locus_tag LOCUS_04560 468450 468863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 468882 469328 gene locus_tag LOCUS_04570 gene mntR 468882 469328 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725831.1 protein_id gnl|my_center|LOCUS_04570 469429 469548 gene locus_tag LOCUS_04580 469429 469548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 472106 469545 gene locus_tag LOCUS_04590 gene alaS 472106 469545 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_04590 472238 472957 gene locus_tag LOCUS_04600 472238 472957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 473086 473448 gene locus_tag LOCUS_04610 473086 473448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 474630 473566 gene locus_tag LOCUS_04620 474630 473566 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080744.1 protein_id gnl|my_center|LOCUS_04620 476132 474627 gene locus_tag LOCUS_04630 476132 474627 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903377.1 protein_id gnl|my_center|LOCUS_04630 476773 476174 gene locus_tag LOCUS_04640 476773 476174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 477144 476815 gene locus_tag LOCUS_04650 477144 476815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 477364 477122 gene locus_tag LOCUS_04660 477364 477122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 477951 477544 gene locus_tag LOCUS_04670 477951 477544 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_04670 478186 477944 gene locus_tag LOCUS_04680 478186 477944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 478345 479616 gene locus_tag LOCUS_04690 gene eno 478345 479616 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880276.1 protein_id gnl|my_center|LOCUS_04690 479613 479951 gene locus_tag LOCUS_04700 479613 479951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 479948 483388 gene locus_tag LOCUS_04710 479948 483388 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_04710 483385 484692 gene locus_tag LOCUS_04720 483385 484692 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462178.1 protein_id gnl|my_center|LOCUS_04720 484751 485914 gene locus_tag LOCUS_04730 484751 485914 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 protein_id gnl|my_center|LOCUS_04730 486947 485880 gene locus_tag LOCUS_04740 486947 485880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 488092 487019 gene locus_tag LOCUS_04750 488092 487019 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_04750 488571 488149 gene locus_tag LOCUS_04760 488571 488149 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_04760 489136 488573 gene locus_tag LOCUS_04770 gene thpR 489136 488573 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_04770 489601 489140 gene locus_tag LOCUS_04780 gene pyrI 489601 489140 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_04780 490521 489607 gene locus_tag LOCUS_04790 gene pyrB 490521 489607 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_04790 490853 491671 gene locus_tag LOCUS_04800 490853 491671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 491730 492239 gene locus_tag LOCUS_04810 491730 492239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 492306 492734 gene locus_tag LOCUS_04820 492306 492734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 493312 492743 gene locus_tag LOCUS_04830 493312 492743 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199702189.1 protein_id gnl|my_center|LOCUS_04830 493579 493385 gene locus_tag LOCUS_04840 493579 493385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 494048 493734 gene locus_tag LOCUS_04850 494048 493734 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626089.1 protein_id gnl|my_center|LOCUS_04850 494849 494424 gene locus_tag LOCUS_04860 494849 494424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 495037 495795 gene locus_tag LOCUS_04870 495037 495795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 495792 497156 gene locus_tag LOCUS_04880 495792 497156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 498059 497169 gene locus_tag LOCUS_04890 gene fabD 498059 497169 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172505.1 protein_id gnl|my_center|LOCUS_04890 499039 498053 gene locus_tag LOCUS_04900 499039 498053 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583306.1 protein_id gnl|my_center|LOCUS_04900 500061 499036 gene locus_tag LOCUS_04910 gene plsX 500061 499036 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080328.1 protein_id gnl|my_center|LOCUS_04910 500784 500077 gene locus_tag LOCUS_04920 500784 500077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 501855 500818 gene locus_tag LOCUS_04930 501855 500818 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_04930 502520 501966 gene locus_tag LOCUS_04940 gene cobO 502520 501966 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442279.1 protein_id gnl|my_center|LOCUS_04940 503438 502530 gene locus_tag LOCUS_04950 503438 502530 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_04950 504115 503435 gene locus_tag LOCUS_04960 504115 503435 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_04960 504884 504108 gene locus_tag LOCUS_04970 gene fecE 504884 504108 CDS product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477430.1 protein_id gnl|my_center|LOCUS_04970 505900 504881 gene locus_tag LOCUS_04980 505900 504881 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_04980 506893 506003 gene locus_tag LOCUS_04990 506893 506003 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228165.1 protein_id gnl|my_center|LOCUS_04990 507497 506916 gene locus_tag LOCUS_05000 507497 506916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 507607 508281 gene locus_tag LOCUS_05010 507607 508281 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 protein_id gnl|my_center|LOCUS_05010 508586 510901 gene locus_tag LOCUS_05020 508586 510901 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545329.1 protein_id gnl|my_center|LOCUS_05020 510903 511562 gene locus_tag LOCUS_05030 510903 511562 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763553.1 protein_id gnl|my_center|LOCUS_05030 511586 513550 gene locus_tag LOCUS_05040 511586 513550 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392124.1 protein_id gnl|my_center|LOCUS_05040 514072 513686 gene locus_tag LOCUS_05050 514072 513686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 514269 514135 gene locus_tag LOCUS_05060 514269 514135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 514767 514555 gene locus_tag LOCUS_05070 514767 514555 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_05070 515003 515257 gene locus_tag LOCUS_05080 515003 515257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 516406 515432 gene locus_tag LOCUS_05090 516406 515432 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_05090 516682 516422 gene locus_tag LOCUS_05100 516682 516422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 516908 516805 gene locus_tag LOCUS_r00010 516908 516805 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 520648 516963 gene locus_tag LOCUS_r00020 520648 516963 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 521703 520945 gene locus_tag LOCUS_05110 521703 520945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 523172 521715 gene locus_tag LOCUS_05120 523172 521715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 523744 523262 gene locus_tag LOCUS_05130 523744 523262 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706874.1 protein_id gnl|my_center|LOCUS_05130 524274 523903 gene locus_tag LOCUS_05140 gene rsfS 524274 523903 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926804.1 protein_id gnl|my_center|LOCUS_05140 525456 524284 gene locus_tag LOCUS_05150 525456 524284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 525784 527844 gene locus_tag LOCUS_05160 525784 527844 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228238.1 protein_id gnl|my_center|LOCUS_05160 527958 529070 gene locus_tag LOCUS_05170 527958 529070 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_05170 529074 530702 gene locus_tag LOCUS_05180 529074 530702 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_05180 530706 531806 gene locus_tag LOCUS_05190 530706 531806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 532085 531819 gene locus_tag LOCUS_05200 532085 531819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 532352 532095 gene locus_tag LOCUS_05210 532352 532095 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942689.1 protein_id gnl|my_center|LOCUS_05210 532750 532397 gene locus_tag LOCUS_05220 532750 532397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 533583 532792 gene locus_tag LOCUS_05230 533583 532792 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639351.1 protein_id gnl|my_center|LOCUS_05230 534369 533584 gene locus_tag LOCUS_05240 534369 533584 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521519.1 protein_id gnl|my_center|LOCUS_05240 535375 534308 gene locus_tag LOCUS_05250 535375 534308 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843667.1 protein_id gnl|my_center|LOCUS_05250 536841 535498 gene locus_tag LOCUS_05260 536841 535498 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083337.1 protein_id gnl|my_center|LOCUS_05260 537858 537139 gene locus_tag LOCUS_05270 537858 537139 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855810.1 protein_id gnl|my_center|LOCUS_05270 538035 538448 gene locus_tag LOCUS_05280 538035 538448 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015709088.1 protein_id gnl|my_center|LOCUS_05280 538445 539014 gene locus_tag LOCUS_05290 538445 539014 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817206.1 protein_id gnl|my_center|LOCUS_05290 539781 538954 gene locus_tag LOCUS_05300 gene trpA 539781 538954 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_05300 540967 539747 gene locus_tag LOCUS_05310 gene trpB 540967 539747 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_05310 542496 541033 gene locus_tag LOCUS_05320 542496 541033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 542715 543125 gene locus_tag LOCUS_05330 542715 543125 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880969.1 protein_id gnl|my_center|LOCUS_05330 543234 544643 gene locus_tag LOCUS_05340 543234 544643 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039280.1 protein_id gnl|my_center|LOCUS_05340 544787 545941 gene locus_tag LOCUS_05350 544787 545941 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064772.1 protein_id gnl|my_center|LOCUS_05350 546513 545944 gene locus_tag LOCUS_05360 546513 545944 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_05360 547603 546575 gene locus_tag LOCUS_05370 547603 546575 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_05370 548619 547621 gene locus_tag LOCUS_05380 548619 547621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584052.1 protein_id gnl|my_center|LOCUS_05380 548880 548626 gene locus_tag LOCUS_05390 548880 548626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 549608 548937 gene locus_tag LOCUS_05400 549608 548937 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_05400 551278 549605 gene locus_tag LOCUS_05410 551278 549605 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_05410 551655 554108 gene locus_tag LOCUS_05420 551655 554108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 554325 555761 gene locus_tag LOCUS_05430 554325 555761 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 protein_id gnl|my_center|LOCUS_05430 555758 556723 gene locus_tag LOCUS_05440 555758 556723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 557203 556787 gene locus_tag LOCUS_05450 gene ybgC 557203 556787 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384895.1 protein_id gnl|my_center|LOCUS_05450 558446 557463 gene locus_tag LOCUS_05460 558446 557463 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530704.1 protein_id gnl|my_center|LOCUS_05460 560786 558453 gene locus_tag LOCUS_05470 560786 558453 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_05470 561320 560790 gene locus_tag LOCUS_05480 561320 560790 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869169.1 protein_id gnl|my_center|LOCUS_05480 562814 561405 gene locus_tag LOCUS_05490 562814 561405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 563722 563396 gene locus_tag LOCUS_05500 563722 563396 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_05500 563906 565594 gene locus_tag LOCUS_05510 563906 565594 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228601.1 protein_id gnl|my_center|LOCUS_05510 565591 566676 gene locus_tag LOCUS_05520 gene pheS 565591 566676 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_05520 566709 567662 gene locus_tag LOCUS_05530 gene speB 566709 567662 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_05530 567677 568225 gene locus_tag LOCUS_05540 567677 568225 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_05540 569020 568229 gene locus_tag LOCUS_05550 569020 568229 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_05550 569126 569198 gene locus_tag LOCUS_t00070 569126 569198 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 569204 569277 gene locus_tag LOCUS_t00080 569204 569277 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 569364 569699 gene locus_tag LOCUS_05560 569364 569699 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020159.1 protein_id gnl|my_center|LOCUS_05560 569696 570067 gene locus_tag LOCUS_05570 569696 570067 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_05570 570256 571116 gene locus_tag LOCUS_05580 570256 571116 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_05580 571124 571723 gene locus_tag LOCUS_05590 gene gmk 571124 571723 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691634.1 protein_id gnl|my_center|LOCUS_05590 571799 571723 gene locus_tag LOCUS_t00090 571799 571723 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 573542 571935 gene locus_tag LOCUS_05600 573542 571935 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_05600 574709 573609 gene locus_tag LOCUS_05610 gene ribD 574709 573609 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_05610 577184 574827 gene locus_tag LOCUS_05620 577184 574827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence02 360 1601 gene locus_tag LOCUS_05630 360 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 1708 2175 gene locus_tag LOCUS_05640 1708 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 2150 2560 gene locus_tag LOCUS_05650 2150 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2664 4904 gene locus_tag LOCUS_05660 2664 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 5183 6415 gene locus_tag LOCUS_05670 5183 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 6459 7502 gene locus_tag LOCUS_05680 6459 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 7520 8692 gene locus_tag LOCUS_05690 7520 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 8696 10051 gene locus_tag LOCUS_05700 8696 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 10051 10536 gene locus_tag LOCUS_05710 10051 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 10533 10943 gene locus_tag LOCUS_05720 10533 10943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 11462 10950 gene locus_tag LOCUS_05730 11462 10950 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_05730 11715 11437 gene locus_tag LOCUS_05740 11715 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 12394 11726 gene locus_tag LOCUS_05750 gene mazG 12394 11726 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_05750 15933 12400 gene locus_tag LOCUS_05760 15933 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 16008 16622 gene locus_tag LOCUS_05770 16008 16622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 17262 17537 gene locus_tag LOCUS_05780 17262 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 18432 17749 gene locus_tag LOCUS_05790 18432 17749 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584674.1 protein_id gnl|my_center|LOCUS_05790 20366 18600 gene locus_tag LOCUS_05800 20366 18600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 20919 20533 gene locus_tag LOCUS_05810 20919 20533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 21955 20957 gene locus_tag LOCUS_05820 21955 20957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 22561 22007 gene locus_tag LOCUS_05830 22561 22007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 22645 23595 gene locus_tag LOCUS_05840 22645 23595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 24055 23717 gene locus_tag LOCUS_05850 24055 23717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 25065 24079 gene locus_tag LOCUS_05860 gene hypE 25065 24079 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_05860 25265 25189 gene locus_tag LOCUS_t00100 25265 25189 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27242 25755 gene locus_tag LOCUS_05870 27242 25755 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928419.1 protein_id gnl|my_center|LOCUS_05870 27750 27487 gene locus_tag LOCUS_05880 27750 27487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 27935 27747 gene locus_tag LOCUS_05890 27935 27747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 28617 28123 gene locus_tag LOCUS_05900 28617 28123 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479804.1 protein_id gnl|my_center|LOCUS_05900 28807 29082 gene locus_tag LOCUS_05910 gene groES 28807 29082 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103730.1 protein_id gnl|my_center|LOCUS_05910 29112 30734 gene locus_tag LOCUS_05920 gene groL 29112 30734 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583321.1 protein_id gnl|my_center|LOCUS_05920 30820 31689 gene locus_tag LOCUS_05930 30820 31689 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662590.1 protein_id gnl|my_center|LOCUS_05930 31699 32487 gene locus_tag LOCUS_05940 31699 32487 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_05940 33174 32491 gene locus_tag LOCUS_05950 33174 32491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 33265 34371 gene locus_tag LOCUS_05960 gene mnmA 33265 34371 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_05960 35241 34318 gene locus_tag LOCUS_05970 35241 34318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 36353 35253 gene locus_tag LOCUS_05980 36353 35253 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_05980 37107 36325 gene locus_tag LOCUS_05990 37107 36325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 37106 37426 gene locus_tag LOCUS_06000 37106 37426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 37423 37659 gene locus_tag LOCUS_06010 37423 37659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 38627 37662 gene locus_tag LOCUS_06020 38627 37662 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_06020 39979 38627 gene locus_tag LOCUS_06030 39979 38627 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_06030 41619 39979 gene locus_tag LOCUS_06040 41619 39979 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_06040 42565 41621 gene locus_tag LOCUS_06050 42565 41621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 43358 42588 gene locus_tag LOCUS_06060 43358 42588 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244751.1 protein_id gnl|my_center|LOCUS_06060 44212 43355 gene locus_tag LOCUS_06070 44212 43355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891149.1 protein_id gnl|my_center|LOCUS_06070 44566 44222 gene locus_tag LOCUS_06080 44566 44222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 45261 44596 gene locus_tag LOCUS_06090 45261 44596 CDS product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890722.1 protein_id gnl|my_center|LOCUS_06090 45539 45342 gene locus_tag LOCUS_06100 45539 45342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 46347 45697 gene locus_tag LOCUS_06110 gene rpe 46347 45697 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_06110 47099 46413 gene locus_tag LOCUS_06120 47099 46413 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_06120 47209 47282 gene locus_tag LOCUS_t00110 47209 47282 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 47382 48065 gene locus_tag LOCUS_06130 gene rnc 47382 48065 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080335.1 protein_id gnl|my_center|LOCUS_06130 48173 48919 gene locus_tag LOCUS_06140 gene fabL 48173 48919 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723876.1 protein_id gnl|my_center|LOCUS_06140 48916 51282 gene locus_tag LOCUS_06150 48916 51282 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458990.1 protein_id gnl|my_center|LOCUS_06150 51375 52574 gene locus_tag LOCUS_06160 51375 52574 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020137.1 protein_id gnl|my_center|LOCUS_06160 52589 55342 gene locus_tag LOCUS_06170 52589 55342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 55764 55339 gene locus_tag LOCUS_06180 55764 55339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 57705 56071 gene locus_tag LOCUS_06190 57705 56071 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_06190 57813 58787 gene locus_tag LOCUS_06200 57813 58787 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_06200 58784 60061 gene locus_tag LOCUS_06210 58784 60061 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990698.1 protein_id gnl|my_center|LOCUS_06210 60945 60058 gene locus_tag LOCUS_06220 gene rsmH 60945 60058 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_06220 62048 60942 gene locus_tag LOCUS_06230 gene csaB 62048 60942 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181502.1 protein_id gnl|my_center|LOCUS_06230 63652 62027 gene locus_tag LOCUS_06240 63652 62027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 64729 63758 gene locus_tag LOCUS_06250 gene secF 64729 63758 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943254.1 protein_id gnl|my_center|LOCUS_06250 66157 64748 gene locus_tag LOCUS_06260 gene secD 66157 64748 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_06260 66483 66154 gene locus_tag LOCUS_06270 gene yajC 66483 66154 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402802.1 protein_id gnl|my_center|LOCUS_06270 67099 66521 gene locus_tag LOCUS_06280 gene dcd 67099 66521 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546770.1 protein_id gnl|my_center|LOCUS_06280 67232 67528 gene locus_tag LOCUS_06290 67232 67528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 67599 68600 gene locus_tag LOCUS_06300 67599 68600 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_06300 68720 69628 gene locus_tag LOCUS_06310 68720 69628 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903522.1 protein_id gnl|my_center|LOCUS_06310 69775 72213 gene locus_tag LOCUS_06320 69775 72213 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082850.1 protein_id gnl|my_center|LOCUS_06320 72217 73536 gene locus_tag LOCUS_06330 gene radA 72217 73536 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_06330 73536 74597 gene locus_tag LOCUS_06340 gene disA 73536 74597 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393302.1 protein_id gnl|my_center|LOCUS_06340 74624 75442 gene locus_tag LOCUS_06350 74624 75442 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306772.1 protein_id gnl|my_center|LOCUS_06350 75765 76007 gene locus_tag LOCUS_06360 gene moaD 75765 76007 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257741.1 protein_id gnl|my_center|LOCUS_06360 76013 76405 gene locus_tag LOCUS_06370 76013 76405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 76457 76828 gene locus_tag LOCUS_06380 76457 76828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 76876 77433 gene locus_tag LOCUS_06390 76876 77433 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_06390 77639 77445 gene locus_tag LOCUS_06400 77639 77445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 79292 78168 gene locus_tag LOCUS_06410 gene htpX 79292 78168 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989629.1 protein_id gnl|my_center|LOCUS_06410 79821 79636 gene locus_tag LOCUS_06420 79821 79636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 79900 80799 gene locus_tag LOCUS_06430 gene htpX 79900 80799 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985953.1 protein_id gnl|my_center|LOCUS_06430 81782 80796 gene locus_tag LOCUS_06440 81782 80796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 82060 82995 gene locus_tag LOCUS_06450 82060 82995 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_06450 84387 82984 gene locus_tag LOCUS_06460 gene hemY 84387 82984 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046128539.1 protein_id gnl|my_center|LOCUS_06460 85310 84384 gene locus_tag LOCUS_06470 gene hemH 85310 84384 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726791.1 protein_id gnl|my_center|LOCUS_06470 86362 85307 gene locus_tag LOCUS_06480 gene hemE 86362 85307 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228059.1 protein_id gnl|my_center|LOCUS_06480 87169 86381 gene locus_tag LOCUS_06490 87169 86381 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256233.1 protein_id gnl|my_center|LOCUS_06490 88452 87166 gene locus_tag LOCUS_06500 gene hemL 88452 87166 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_06500 89564 88449 gene locus_tag LOCUS_06510 89564 88449 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_06510 90260 89583 gene locus_tag LOCUS_06520 90260 89583 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_06520 91099 90263 gene locus_tag LOCUS_06530 gene hemB 91099 90263 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_06530 92030 91248 gene locus_tag LOCUS_06540 92030 91248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 94216 92027 gene locus_tag LOCUS_06550 94216 92027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 94429 95049 gene locus_tag LOCUS_06560 94429 95049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 95056 96018 gene locus_tag LOCUS_06570 95056 96018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 96090 98690 gene locus_tag LOCUS_06580 96090 98690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 98703 99677 gene locus_tag LOCUS_06590 98703 99677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 100035 99685 gene locus_tag LOCUS_06600 gene rplQ 100035 99685 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421117.1 protein_id gnl|my_center|LOCUS_06600 100967 100044 gene locus_tag LOCUS_06610 100967 100044 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_06610 101613 100993 gene locus_tag LOCUS_06620 gene rpsD 101613 100993 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_06620 101970 101629 gene locus_tag LOCUS_06630 gene rpsK 101970 101629 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288714.1 protein_id gnl|my_center|LOCUS_06630 102358 101981 gene locus_tag LOCUS_06640 gene rpsM 102358 101981 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583368.1 protein_id gnl|my_center|LOCUS_06640 102688 102506 gene locus_tag LOCUS_06650 gene infA 102688 102506 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829792.1 protein_id gnl|my_center|LOCUS_06650 103529 102732 gene locus_tag LOCUS_06660 gene map 103529 102732 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_06660 104156 103533 gene locus_tag LOCUS_06670 104156 103533 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583365.1 protein_id gnl|my_center|LOCUS_06670 105517 104156 gene locus_tag LOCUS_06680 gene secY 105517 104156 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081795.1 protein_id gnl|my_center|LOCUS_06680 106133 105522 gene locus_tag LOCUS_06690 106133 105522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 106693 106130 gene locus_tag LOCUS_06700 gene rpsE 106693 106130 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896437.1 protein_id gnl|my_center|LOCUS_06700 107067 106711 gene locus_tag LOCUS_06710 gene rplR 107067 106711 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_06710 107645 107073 gene locus_tag LOCUS_06720 gene rplF 107645 107073 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357306.1 protein_id gnl|my_center|LOCUS_06720 108060 107665 gene locus_tag LOCUS_06730 gene rpsH 108060 107665 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943472.1 protein_id gnl|my_center|LOCUS_06730 108821 108291 gene locus_tag LOCUS_06740 gene rplE 108821 108291 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583357.1 protein_id gnl|my_center|LOCUS_06740 109147 108833 gene locus_tag LOCUS_06750 gene rplX 109147 108833 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_06750 109515 109147 gene locus_tag LOCUS_06760 gene rplN 109515 109147 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545550.1 protein_id gnl|my_center|LOCUS_06760 109785 109528 gene locus_tag LOCUS_06770 gene rpsQ 109785 109528 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081818.1 protein_id gnl|my_center|LOCUS_06770 110004 109795 gene locus_tag LOCUS_06780 gene rpmC 110004 109795 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_06780 110441 110010 gene locus_tag LOCUS_06790 gene rplP 110441 110010 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_06790 111087 110407 gene locus_tag LOCUS_06800 gene rpsC 111087 110407 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938604.1 protein_id gnl|my_center|LOCUS_06800 111473 111093 gene locus_tag LOCUS_06810 gene rplV 111473 111093 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_06810 111772 111488 gene locus_tag LOCUS_06820 gene rpsS 111772 111488 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993369.1 protein_id gnl|my_center|LOCUS_06820 112616 111777 gene locus_tag LOCUS_06830 gene rplB 112616 111777 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081830.1 protein_id gnl|my_center|LOCUS_06830 112911 112630 gene locus_tag LOCUS_06840 gene rplW 112911 112630 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_06840 113598 112918 gene locus_tag LOCUS_06850 gene rplD 113598 112918 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583346.1 protein_id gnl|my_center|LOCUS_06850 114253 113606 gene locus_tag LOCUS_06860 gene rplC 114253 113606 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869928.1 protein_id gnl|my_center|LOCUS_06860 114561 114253 gene locus_tag LOCUS_06870 gene rpsJ 114561 114253 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_06870 116653 114563 gene locus_tag LOCUS_06880 gene fusA 116653 114563 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081841.1 protein_id gnl|my_center|LOCUS_06880 117146 116667 gene locus_tag LOCUS_06890 gene rpsG 117146 116667 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545233.1 protein_id gnl|my_center|LOCUS_06890 117602 117207 gene locus_tag LOCUS_06900 gene rpsL 117602 117207 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933847.1 protein_id gnl|my_center|LOCUS_06900 117906 118349 gene locus_tag LOCUS_06910 gene rplM 117906 118349 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_06910 118510 118680 gene locus_tag LOCUS_06920 118510 118680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 118724 118903 gene locus_tag LOCUS_06930 118724 118903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 119068 119811 gene locus_tag LOCUS_06940 gene arsM 119068 119811 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_06940 120404 120748 gene locus_tag LOCUS_06950 120404 120748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 121042 120755 gene locus_tag LOCUS_06960 121042 120755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 121757 120999 gene locus_tag LOCUS_06970 121757 120999 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_06970 121897 123009 gene locus_tag LOCUS_06980 gene alr 121897 123009 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_06980 123164 123006 gene locus_tag LOCUS_06990 123164 123006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 123268 124554 gene locus_tag LOCUS_07000 123268 124554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 124729 126417 gene locus_tag LOCUS_07010 gene hutU 124729 126417 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 protein_id gnl|my_center|LOCUS_07010 126422 126688 gene locus_tag LOCUS_07020 126422 126688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 127870 126773 gene locus_tag LOCUS_07030 127870 126773 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_07030 129395 128184 gene locus_tag LOCUS_07040 129395 128184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 130649 129744 gene locus_tag LOCUS_07050 gene xerC 130649 129744 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872581.1 protein_id gnl|my_center|LOCUS_07050 130888 131718 gene locus_tag LOCUS_07060 130888 131718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 132146 131760 gene locus_tag LOCUS_07070 132146 131760 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_07070 133346 132204 gene locus_tag LOCUS_07080 133346 132204 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 protein_id gnl|my_center|LOCUS_07080 134022 133372 gene locus_tag LOCUS_07090 134022 133372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 135455 134088 gene locus_tag LOCUS_07100 135455 134088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 138044 135621 gene locus_tag LOCUS_07110 138044 135621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 139134 138115 gene locus_tag LOCUS_07120 gene ruvB 139134 138115 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_07120 139518 140804 gene locus_tag LOCUS_07130 139518 140804 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057897531.1 protein_id gnl|my_center|LOCUS_07130 140801 142165 gene locus_tag LOCUS_07140 gene argH 140801 142165 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082327.1 protein_id gnl|my_center|LOCUS_07140 142171 142341 gene locus_tag LOCUS_07150 gene lysW 142171 142341 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256239.1 protein_id gnl|my_center|LOCUS_07150 142394 143269 gene locus_tag LOCUS_07160 gene lysX 142394 143269 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_07160 143262 144104 gene locus_tag LOCUS_07170 gene lysX 143262 144104 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_07170 144097 145134 gene locus_tag LOCUS_07180 gene argC 144097 145134 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_07180 145134 145928 gene locus_tag LOCUS_07190 145134 145928 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_07190 145944 147122 gene locus_tag LOCUS_07200 145944 147122 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228893.1 protein_id gnl|my_center|LOCUS_07200 147115 148170 gene locus_tag LOCUS_07210 147115 148170 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_07210 149402 148227 gene locus_tag LOCUS_07220 149402 148227 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530104.1 protein_id gnl|my_center|LOCUS_07220 149476 149552 gene locus_tag LOCUS_t00120 149476 149552 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 151575 149572 gene locus_tag LOCUS_07230 gene fusA 151575 149572 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082156.1 protein_id gnl|my_center|LOCUS_07230 155147 151647 gene locus_tag LOCUS_07240 155147 151647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 156323 155220 gene locus_tag LOCUS_07250 gene ftsZ 156323 155220 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_07250 157621 156353 gene locus_tag LOCUS_07260 gene ftsA 157621 156353 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_07260 158331 157636 gene locus_tag LOCUS_07270 158331 157636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 159237 158338 gene locus_tag LOCUS_07280 gene murB 159237 158338 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_07280 160616 159234 gene locus_tag LOCUS_07290 gene murC 160616 159234 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_07290 161712 160594 gene locus_tag LOCUS_07300 gene murG 161712 160594 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_07300 162787 161633 gene locus_tag LOCUS_07310 gene ftsW 162787 161633 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_07310 164361 162946 gene locus_tag LOCUS_07320 gene murD 164361 162946 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476140.1 protein_id gnl|my_center|LOCUS_07320 164799 164491 gene locus_tag LOCUS_07330 164799 164491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 165665 164832 gene locus_tag LOCUS_07340 165665 164832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 166361 165687 gene locus_tag LOCUS_07350 166361 165687 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986193.1 protein_id gnl|my_center|LOCUS_07350 167570 166659 gene locus_tag LOCUS_07360 gene ftcD 167570 166659 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_07360 168002 167577 gene locus_tag LOCUS_07370 gene fabZ 168002 167577 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870033.1 protein_id gnl|my_center|LOCUS_07370 168580 168023 gene locus_tag LOCUS_07380 168580 168023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 170880 168616 gene locus_tag LOCUS_07390 gene bamA 170880 168616 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880828.1 protein_id gnl|my_center|LOCUS_07390 172427 170877 gene locus_tag LOCUS_07400 172427 170877 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_07400 172564 173796 gene locus_tag LOCUS_07410 172564 173796 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_07410 173741 175171 gene locus_tag LOCUS_07420 173741 175171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021434.1 protein_id gnl|my_center|LOCUS_07420 176637 175183 gene locus_tag LOCUS_07430 176637 175183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 176811 177809 gene locus_tag LOCUS_07440 176811 177809 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_07440 177813 178901 gene locus_tag LOCUS_07450 gene gcvT 177813 178901 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_07450 178898 179620 gene locus_tag LOCUS_07460 gene lipB 178898 179620 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_07460 179653 181752 gene locus_tag LOCUS_07470 179653 181752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 181870 182637 gene locus_tag LOCUS_07480 181870 182637 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_07480 184374 182623 gene locus_tag LOCUS_07490 184374 182623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 184546 184382 gene locus_tag LOCUS_07500 184546 184382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 184760 185251 gene locus_tag LOCUS_07510 184760 185251 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943963.1 protein_id gnl|my_center|LOCUS_07510 185248 185904 gene locus_tag LOCUS_07520 185248 185904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 185930 186127 gene locus_tag LOCUS_07530 185930 186127 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140566.1 protein_id gnl|my_center|LOCUS_07530 188313 186220 gene locus_tag LOCUS_07540 188313 186220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 189785 188316 gene locus_tag LOCUS_07550 189785 188316 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227832.1 protein_id gnl|my_center|LOCUS_07550 190841 189855 gene locus_tag LOCUS_07560 190841 189855 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_07560 190979 191959 gene locus_tag LOCUS_07570 190979 191959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 192728 191970 gene locus_tag LOCUS_07580 gene hpaI 192728 191970 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113007.1 protein_id gnl|my_center|LOCUS_07580 194006 192735 gene locus_tag LOCUS_07590 194006 192735 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810724.1 protein_id gnl|my_center|LOCUS_07590 194498 194031 gene locus_tag LOCUS_07600 gene nrfH 194498 194031 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_07600 194648 197347 gene locus_tag LOCUS_07610 gene polA 194648 197347 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945860.1 protein_id gnl|my_center|LOCUS_07610 197866 197654 gene locus_tag LOCUS_07620 197866 197654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 197945 198229 gene locus_tag LOCUS_07630 197945 198229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 198226 198765 gene locus_tag LOCUS_07640 198226 198765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 199026 198760 gene locus_tag LOCUS_07650 199026 198760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 199460 201454 gene locus_tag LOCUS_07660 199460 201454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 201774 201466 gene locus_tag LOCUS_07670 201774 201466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 204651 201916 gene locus_tag LOCUS_07680 204651 201916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 205667 204675 gene locus_tag LOCUS_07690 205667 204675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 206059 205727 gene locus_tag LOCUS_07700 206059 205727 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546712.1 protein_id gnl|my_center|LOCUS_07700 208867 206183 gene locus_tag LOCUS_07710 208867 206183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 209110 209412 gene locus_tag LOCUS_07720 209110 209412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 209391 209732 gene locus_tag LOCUS_07730 209391 209732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 209909 210130 gene locus_tag LOCUS_07740 209909 210130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 210130 210531 gene locus_tag LOCUS_07750 210130 210531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 211527 210673 gene locus_tag LOCUS_07760 211527 210673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 212357 211515 gene locus_tag LOCUS_07770 212357 211515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257554.1 protein_id gnl|my_center|LOCUS_07770 213435 212347 gene locus_tag LOCUS_07780 213435 212347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_07780 213892 213518 gene locus_tag LOCUS_07790 213892 213518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 215220 213889 gene locus_tag LOCUS_07800 215220 213889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 216311 215337 gene locus_tag LOCUS_07810 216311 215337 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_07810 217062 216313 gene locus_tag LOCUS_07820 217062 216313 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_07820 217760 217095 gene locus_tag LOCUS_07830 gene tsaB 217760 217095 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_07830 217874 218104 gene locus_tag LOCUS_07840 217874 218104 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_07840 218178 220073 gene locus_tag LOCUS_07850 218178 220073 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_07850 220074 221048 gene locus_tag LOCUS_07860 220074 221048 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227794.1 protein_id gnl|my_center|LOCUS_07860 221259 222518 gene locus_tag LOCUS_07870 gene pdhC 221259 222518 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863427.1 protein_id gnl|my_center|LOCUS_07870 223549 222521 gene locus_tag LOCUS_07880 223549 222521 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_07880 225762 223771 gene locus_tag LOCUS_07890 225762 223771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07890 226546 225698 gene locus_tag LOCUS_07900 226546 225698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07900 226897 226655 gene locus_tag LOCUS_07910 226897 226655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 227181 226882 gene locus_tag LOCUS_07920 227181 226882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 230306 227286 gene locus_tag LOCUS_07930 230306 227286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 231946 230417 gene locus_tag LOCUS_07940 231946 230417 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_07940 232041 233999 gene locus_tag LOCUS_07950 232041 233999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 234031 234519 gene locus_tag LOCUS_07960 234031 234519 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence03 256 792 gene locus_tag LOCUS_07970 256 792 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_07970 3090 805 gene locus_tag LOCUS_07980 gene topA 3090 805 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_07980 3238 3320 gene locus_tag LOCUS_t00130 3238 3320 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3369 4157 gene locus_tag LOCUS_07990 3369 4157 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024199.1 protein_id gnl|my_center|LOCUS_07990 4154 5584 gene locus_tag LOCUS_08000 4154 5584 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_08000 5670 6770 gene locus_tag LOCUS_08010 gene fbp 5670 6770 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228346.1 protein_id gnl|my_center|LOCUS_08010 6771 7334 gene locus_tag LOCUS_08020 gene hpt 6771 7334 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_08020 7413 7667 gene locus_tag LOCUS_08030 7413 7667 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902385.1 protein_id gnl|my_center|LOCUS_08030 7754 8902 gene locus_tag LOCUS_08040 7754 8902 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228126.1 protein_id gnl|my_center|LOCUS_08040 8991 11513 gene locus_tag LOCUS_08050 8991 11513 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_08050 11537 11836 gene locus_tag LOCUS_08060 11537 11836 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660478.1 protein_id gnl|my_center|LOCUS_08060 12672 11830 gene locus_tag LOCUS_08070 12672 11830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 13511 12660 gene locus_tag LOCUS_08080 13511 12660 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889019.1 protein_id gnl|my_center|LOCUS_08080 15514 13598 gene locus_tag LOCUS_08090 15514 13598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 16829 15651 gene locus_tag LOCUS_08100 16829 15651 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_08100 16960 17952 gene locus_tag LOCUS_08110 16960 17952 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_08110 19656 17947 gene locus_tag LOCUS_08120 19656 17947 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_08120 21258 19669 gene locus_tag LOCUS_08130 gene metG 21258 19669 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762101.1 protein_id gnl|my_center|LOCUS_08130 22600 21479 gene locus_tag LOCUS_08140 22600 21479 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_08140 22711 24021 gene locus_tag LOCUS_08150 22711 24021 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 protein_id gnl|my_center|LOCUS_08150 24015 25028 gene locus_tag LOCUS_08160 24015 25028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_08160 25122 26180 gene locus_tag LOCUS_08170 25122 26180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 27463 26201 gene locus_tag LOCUS_08180 27463 26201 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 protein_id gnl|my_center|LOCUS_08180 29409 27517 gene locus_tag LOCUS_08190 29409 27517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 31176 29845 gene locus_tag LOCUS_08200 gene accC 31176 29845 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 protein_id gnl|my_center|LOCUS_08200 31609 31187 gene locus_tag LOCUS_08210 gene accB 31609 31187 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555370.1 protein_id gnl|my_center|LOCUS_08210 31833 32849 gene locus_tag LOCUS_08220 31833 32849 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678735.1 protein_id gnl|my_center|LOCUS_08220 32870 35680 gene locus_tag LOCUS_08230 32870 35680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 35652 38069 gene locus_tag LOCUS_08240 gene pheT 35652 38069 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_08240 38071 38925 gene locus_tag LOCUS_08250 gene panC 38071 38925 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_08250 39255 40466 gene locus_tag LOCUS_08260 39255 40466 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256134.1 protein_id gnl|my_center|LOCUS_08260 40563 40808 gene locus_tag LOCUS_08270 40563 40808 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256135.1 protein_id gnl|my_center|LOCUS_08270 40818 41393 gene locus_tag LOCUS_08280 40818 41393 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256136.1 protein_id gnl|my_center|LOCUS_08280 41405 42544 gene locus_tag LOCUS_08290 41405 42544 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937434.1 protein_id gnl|my_center|LOCUS_08290 42556 42852 gene locus_tag LOCUS_08300 42556 42852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 42893 43108 gene locus_tag LOCUS_08310 42893 43108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 43199 43699 gene locus_tag LOCUS_08320 43199 43699 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_08320 44210 43731 gene locus_tag LOCUS_08330 gene bfr 44210 43731 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_08330 44326 44829 gene locus_tag LOCUS_08340 44326 44829 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259748.1 protein_id gnl|my_center|LOCUS_08340 45949 44840 gene locus_tag LOCUS_08350 45949 44840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256230.1 protein_id gnl|my_center|LOCUS_08350 47510 45954 gene locus_tag LOCUS_08360 47510 45954 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256231.1 protein_id gnl|my_center|LOCUS_08360 48635 47625 gene locus_tag LOCUS_08370 48635 47625 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256232.1 protein_id gnl|my_center|LOCUS_08370 49757 48843 gene locus_tag LOCUS_08380 49757 48843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 50702 49824 gene locus_tag LOCUS_08390 gene folD 50702 49824 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_08390 50905 52665 gene locus_tag LOCUS_08400 50905 52665 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_08400 52715 53665 gene locus_tag LOCUS_08410 52715 53665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 protein_id gnl|my_center|LOCUS_08410 53747 53929 gene locus_tag LOCUS_08420 53747 53929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 53939 54175 gene locus_tag LOCUS_08430 53939 54175 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391712.1 protein_id gnl|my_center|LOCUS_08430 54172 54381 gene locus_tag LOCUS_08440 54172 54381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 54407 55291 gene locus_tag LOCUS_08450 gene panB 54407 55291 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_08450 56184 55240 gene locus_tag LOCUS_08460 56184 55240 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 protein_id gnl|my_center|LOCUS_08460 57041 56184 gene locus_tag LOCUS_08470 57041 56184 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528443.1 protein_id gnl|my_center|LOCUS_08470 58368 57112 gene locus_tag LOCUS_08480 58368 57112 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025324024.1 protein_id gnl|my_center|LOCUS_08480 59076 58459 gene locus_tag LOCUS_08490 59076 58459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 60324 59161 gene locus_tag LOCUS_08500 60324 59161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 60434 61759 gene locus_tag LOCUS_08510 60434 61759 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229240.1 protein_id gnl|my_center|LOCUS_08510 61885 62505 gene locus_tag LOCUS_08520 61885 62505 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_08520 64235 62631 gene locus_tag LOCUS_08530 64235 62631 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_08530 65078 64248 gene locus_tag LOCUS_08540 gene cdsA 65078 64248 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922435.1 protein_id gnl|my_center|LOCUS_08540 66424 65075 gene locus_tag LOCUS_08550 66424 65075 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272524.1 protein_id gnl|my_center|LOCUS_08550 69135 66433 gene locus_tag LOCUS_08560 69135 66433 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_08560 69450 69659 gene locus_tag LOCUS_08570 69450 69659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 69778 69851 gene locus_tag LOCUS_t00140 69778 69851 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 69926 70001 gene locus_tag LOCUS_t00150 69926 70001 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 70014 70088 gene locus_tag LOCUS_t00160 70014 70088 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 70171 70461 gene locus_tag LOCUS_08580 gene rpsF 70171 70461 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462318.1 protein_id gnl|my_center|LOCUS_08580 70471 70893 gene locus_tag LOCUS_08590 gene ssb 70471 70893 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815182.1 protein_id gnl|my_center|LOCUS_08590 70912 71178 gene locus_tag LOCUS_08600 gene rpsR 70912 71178 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669347.1 protein_id gnl|my_center|LOCUS_08600 72156 71242 gene locus_tag LOCUS_08610 72156 71242 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903034.1 protein_id gnl|my_center|LOCUS_08610 72272 74044 gene locus_tag LOCUS_08620 72272 74044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 74046 75755 gene locus_tag LOCUS_08630 74046 75755 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909443.1 protein_id gnl|my_center|LOCUS_08630 75799 78354 gene locus_tag LOCUS_08640 75799 78354 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_08640 78451 79044 gene locus_tag LOCUS_08650 78451 79044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 79691 79056 gene locus_tag LOCUS_08660 79691 79056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 81336 79711 gene locus_tag LOCUS_08670 gene pruA 81336 79711 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_08670 81850 81383 gene locus_tag LOCUS_08680 gene greA 81850 81383 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_08680 81995 83461 gene locus_tag LOCUS_08690 gene betB 81995 83461 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114436.1 protein_id gnl|my_center|LOCUS_08690 83557 84678 gene locus_tag LOCUS_08700 83557 84678 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257534.1 protein_id gnl|my_center|LOCUS_08700 84742 84969 gene locus_tag LOCUS_08710 84742 84969 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_08710 84953 85150 gene locus_tag LOCUS_08720 84953 85150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 85150 85554 gene locus_tag LOCUS_08730 85150 85554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 85693 86370 gene locus_tag LOCUS_08740 85693 86370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08740 86252 86818 gene locus_tag LOCUS_08750 86252 86818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08750 86913 88355 gene locus_tag LOCUS_08760 86913 88355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 88405 89316 gene locus_tag LOCUS_08770 88405 89316 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089183.1 protein_id gnl|my_center|LOCUS_08770 89313 90311 gene locus_tag LOCUS_08780 89313 90311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 90313 91071 gene locus_tag LOCUS_08790 90313 91071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944003.1 protein_id gnl|my_center|LOCUS_08790 91079 91780 gene locus_tag LOCUS_08800 91079 91780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_08800 92543 91782 gene locus_tag LOCUS_08810 92543 91782 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420864.1 protein_id gnl|my_center|LOCUS_08810 93280 92540 gene locus_tag LOCUS_08820 93280 92540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 95481 93277 gene locus_tag LOCUS_08830 95481 93277 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_08830 95866 95474 gene locus_tag LOCUS_08840 95866 95474 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948232.1 protein_id gnl|my_center|LOCUS_08840 96271 96540 gene locus_tag LOCUS_08850 96271 96540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 97144 96557 gene locus_tag LOCUS_08860 97144 96557 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021338.1 protein_id gnl|my_center|LOCUS_08860 98151 97159 gene locus_tag LOCUS_08870 98151 97159 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023900.1 protein_id gnl|my_center|LOCUS_08870 98882 98244 gene locus_tag LOCUS_08880 98882 98244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 99675 98938 gene locus_tag LOCUS_08890 99675 98938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 100302 99694 gene locus_tag LOCUS_08900 100302 99694 CDS product DOMON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583999.1 protein_id gnl|my_center|LOCUS_08900 100789 100451 gene locus_tag LOCUS_08910 100789 100451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 101978 100782 gene locus_tag LOCUS_08920 101978 100782 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_08920 102672 101965 gene locus_tag LOCUS_08930 102672 101965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_08930 103349 102756 gene locus_tag LOCUS_08940 103349 102756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 103841 103488 gene locus_tag LOCUS_08950 103841 103488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 104229 103945 gene locus_tag LOCUS_08960 104229 103945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 104876 104319 gene locus_tag LOCUS_08970 104876 104319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 106103 104976 gene locus_tag LOCUS_08980 106103 104976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 106723 106166 gene locus_tag LOCUS_08990 106723 106166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 108122 106935 gene locus_tag LOCUS_09000 gene hybB 108122 106935 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941443.1 protein_id gnl|my_center|LOCUS_09000 108997 108197 gene locus_tag LOCUS_09010 108997 108197 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815883.1 protein_id gnl|my_center|LOCUS_09010 109370 109008 gene locus_tag LOCUS_09020 109370 109008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 109659 110390 gene locus_tag LOCUS_09030 109659 110390 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112109.1 protein_id gnl|my_center|LOCUS_09030 111481 110531 gene locus_tag LOCUS_09040 111481 110531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 112572 111481 gene locus_tag LOCUS_09050 112572 111481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 113455 112565 gene locus_tag LOCUS_09060 gene ccsB 113455 112565 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_09060 115252 113468 gene locus_tag LOCUS_09070 115252 113468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 115921 115322 gene locus_tag LOCUS_09080 115921 115322 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733163.1 protein_id gnl|my_center|LOCUS_09080 116552 116145 gene locus_tag LOCUS_09090 116552 116145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 116842 116549 gene locus_tag LOCUS_09100 116842 116549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 117448 116900 gene locus_tag LOCUS_09110 117448 116900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 118051 117839 gene locus_tag LOCUS_09120 118051 117839 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_09120 119544 118102 gene locus_tag LOCUS_09130 gene lpdA 119544 118102 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_09130 120628 119657 gene locus_tag LOCUS_09140 120628 119657 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289463.1 protein_id gnl|my_center|LOCUS_09140 121619 120642 gene locus_tag LOCUS_09150 121619 120642 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943294.1 protein_id gnl|my_center|LOCUS_09150 122820 121690 gene locus_tag LOCUS_09160 gene pdhA 122820 121690 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_09160 123865 122804 gene locus_tag LOCUS_09170 gene lipA 123865 122804 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903644.1 protein_id gnl|my_center|LOCUS_09170 123991 126708 gene locus_tag LOCUS_09180 gene leuS 123991 126708 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015646.1 protein_id gnl|my_center|LOCUS_09180 126799 126709 gene locus_tag LOCUS_t00170 126799 126709 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 126899 127678 gene locus_tag LOCUS_09190 126899 127678 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583263.1 protein_id gnl|my_center|LOCUS_09190 127689 129011 gene locus_tag LOCUS_09200 gene asnS 127689 129011 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228137.1 protein_id gnl|my_center|LOCUS_09200 129859 129071 gene locus_tag LOCUS_09210 129859 129071 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_09210 131139 129865 gene locus_tag LOCUS_09220 131139 129865 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257569.1 protein_id gnl|my_center|LOCUS_09220 131660 131130 gene locus_tag LOCUS_09230 131660 131130 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_09230 132208 131663 gene locus_tag LOCUS_09240 132208 131663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 132970 132278 gene locus_tag LOCUS_09250 132970 132278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 133439 133188 gene locus_tag LOCUS_09260 133439 133188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 133329 134438 gene locus_tag LOCUS_09270 133329 134438 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_09270 134446 135957 gene locus_tag LOCUS_09280 134446 135957 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_09280 135954 137165 gene locus_tag LOCUS_09290 135954 137165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 137162 137827 gene locus_tag LOCUS_09300 137162 137827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 137831 139594 gene locus_tag LOCUS_09310 gene aspS 137831 139594 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546812.1 protein_id gnl|my_center|LOCUS_09310 139599 140489 gene locus_tag LOCUS_09320 139599 140489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 140486 141085 gene locus_tag LOCUS_09330 140486 141085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 141051 142004 gene locus_tag LOCUS_09340 141051 142004 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_09340 142870 142001 gene locus_tag LOCUS_09350 gene sucD 142870 142001 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 protein_id gnl|my_center|LOCUS_09350 142973 143551 gene locus_tag LOCUS_09360 142973 143551 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907636.1 protein_id gnl|my_center|LOCUS_09360 143538 143738 gene locus_tag LOCUS_09370 143538 143738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 143726 144178 gene locus_tag LOCUS_09380 143726 144178 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392208.1 protein_id gnl|my_center|LOCUS_09380 146126 144165 gene locus_tag LOCUS_09390 146126 144165 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978008.1 protein_id gnl|my_center|LOCUS_09390 147775 146291 gene locus_tag LOCUS_09400 147775 146291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 149874 148111 gene locus_tag LOCUS_09410 149874 148111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 151031 149871 gene locus_tag LOCUS_09420 151031 149871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 152068 151028 gene locus_tag LOCUS_09430 152068 151028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 152451 152065 gene locus_tag LOCUS_09440 152451 152065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 153209 152622 gene locus_tag LOCUS_09450 153209 152622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 153354 154082 gene locus_tag LOCUS_09460 153354 154082 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 protein_id gnl|my_center|LOCUS_09460 154317 154673 gene locus_tag LOCUS_09470 154317 154673 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583889.1 protein_id gnl|my_center|LOCUS_09470 154675 155982 gene locus_tag LOCUS_09480 154675 155982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 156012 156488 gene locus_tag LOCUS_09490 156012 156488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 156631 158271 gene locus_tag LOCUS_09500 156631 158271 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941025.1 protein_id gnl|my_center|LOCUS_09500 158493 159149 gene locus_tag LOCUS_09510 158493 159149 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228770.1 protein_id gnl|my_center|LOCUS_09510 161124 159232 gene locus_tag LOCUS_09520 161124 159232 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896800.1 protein_id gnl|my_center|LOCUS_09520 161211 161582 gene locus_tag LOCUS_09530 161211 161582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 161545 161769 gene locus_tag LOCUS_09540 161545 161769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 162064 163233 gene locus_tag LOCUS_09550 162064 163233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 163398 163640 gene locus_tag LOCUS_09560 163398 163640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 163842 165659 gene locus_tag LOCUS_09570 gene pepF 163842 165659 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256129.1 protein_id gnl|my_center|LOCUS_09570 165656 165901 gene locus_tag LOCUS_09580 165656 165901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 166032 168089 gene locus_tag LOCUS_09590 gene fdhF 166032 168089 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_09590 168193 169605 gene locus_tag LOCUS_09600 gene tilS 168193 169605 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_09600 169602 170915 gene locus_tag LOCUS_09610 gene rseP 169602 170915 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931818.1 protein_id gnl|my_center|LOCUS_09610 171375 170893 gene locus_tag LOCUS_09620 gene ispF 171375 170893 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393963.1 protein_id gnl|my_center|LOCUS_09620 171642 172634 gene locus_tag LOCUS_09630 gene mraY 171642 172634 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_09630 173998 172766 gene locus_tag LOCUS_09640 173998 172766 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929354.1 protein_id gnl|my_center|LOCUS_09640 175528 174011 gene locus_tag LOCUS_09650 175528 174011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 176190 175525 gene locus_tag LOCUS_09660 176190 175525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 177899 176187 gene locus_tag LOCUS_09670 177899 176187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 178350 177892 gene locus_tag LOCUS_09680 178350 177892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 179088 178402 gene locus_tag LOCUS_09690 179088 178402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 179921 179103 gene locus_tag LOCUS_09700 179921 179103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 180023 181576 gene locus_tag LOCUS_09710 gene guaA 180023 181576 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_09710 181567 182601 gene locus_tag LOCUS_09720 181567 182601 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 protein_id gnl|my_center|LOCUS_09720 182603 183634 gene locus_tag LOCUS_09730 182603 183634 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 protein_id gnl|my_center|LOCUS_09730 183631 184383 gene locus_tag LOCUS_09740 183631 184383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 184403 186037 gene locus_tag LOCUS_09750 184403 186037 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_09750 186053 187105 gene locus_tag LOCUS_09760 186053 187105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 187211 188650 gene locus_tag LOCUS_09770 187211 188650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 188796 189839 gene locus_tag LOCUS_09780 gene hrcA 188796 189839 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954941.1 protein_id gnl|my_center|LOCUS_09780 189842 190369 gene locus_tag LOCUS_09790 189842 190369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 190424 192280 gene locus_tag LOCUS_09800 gene dnaK 190424 192280 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357980.1 protein_id gnl|my_center|LOCUS_09800 192305 193399 gene locus_tag LOCUS_09810 gene dnaJ 192305 193399 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_09810 193482 194360 gene locus_tag LOCUS_09820 193482 194360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 194364 195863 gene locus_tag LOCUS_09830 gene lnt 194364 195863 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_09830 197055 195808 gene locus_tag LOCUS_09840 197055 195808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 198201 197188 gene locus_tag LOCUS_09850 198201 197188 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence04 727 2040 gene locus_tag LOCUS_09860 727 2040 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532975.1 protein_id gnl|my_center|LOCUS_09860 3295 2087 gene locus_tag LOCUS_09870 3295 2087 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_09870 4206 3295 gene locus_tag LOCUS_09880 4206 3295 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_09880 4914 4210 gene locus_tag LOCUS_09890 4914 4210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_09890 5711 4917 gene locus_tag LOCUS_09900 5711 4917 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 protein_id gnl|my_center|LOCUS_09900 7198 5780 gene locus_tag LOCUS_09910 gene dnaB 7198 5780 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082256.1 protein_id gnl|my_center|LOCUS_09910 7387 8175 gene locus_tag LOCUS_09920 gene rpsB 7387 8175 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_09920 8172 8765 gene locus_tag LOCUS_09930 gene tsf 8172 8765 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_09930 8769 9461 gene locus_tag LOCUS_09940 gene pyrH 8769 9461 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958192.1 protein_id gnl|my_center|LOCUS_09940 9497 11125 gene locus_tag LOCUS_09950 9497 11125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 11455 11165 gene locus_tag LOCUS_09960 gene gatC 11455 11165 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404034.1 protein_id gnl|my_center|LOCUS_09960 13791 11464 gene locus_tag LOCUS_09970 gene recG 13791 11464 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_09970 16091 13893 gene locus_tag LOCUS_09980 16091 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 16536 17156 gene locus_tag LOCUS_09990 16536 17156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 18339 17179 gene locus_tag LOCUS_10000 18339 17179 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941337.1 protein_id gnl|my_center|LOCUS_10000 19001 18450 gene locus_tag LOCUS_10010 19001 18450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 22242 19039 gene locus_tag LOCUS_10020 22242 19039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 23618 22314 gene locus_tag LOCUS_10030 23618 22314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 25600 23690 gene locus_tag LOCUS_10040 25600 23690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 26959 25700 gene locus_tag LOCUS_10050 26959 25700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 28107 27070 gene locus_tag LOCUS_10060 gene ltaE 28107 27070 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_10060 28798 28127 gene locus_tag LOCUS_10070 28798 28127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 29568 28891 gene locus_tag LOCUS_10080 29568 28891 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583746.1 protein_id gnl|my_center|LOCUS_10080 30044 29640 gene locus_tag LOCUS_10090 30044 29640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 30531 30049 gene locus_tag LOCUS_10100 30531 30049 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_10100 31168 30578 gene locus_tag LOCUS_10110 gene trmY 31168 30578 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_10110 32647 31172 gene locus_tag LOCUS_10120 32647 31172 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878342.1 protein_id gnl|my_center|LOCUS_10120 33954 32644 gene locus_tag LOCUS_10130 gene trkA 33954 32644 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_10130 34059 34949 gene locus_tag LOCUS_10140 34059 34949 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_10140 34959 35699 gene locus_tag LOCUS_10150 34959 35699 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_10150 35718 36536 gene locus_tag LOCUS_10160 gene pyrF 35718 36536 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_10160 36543 38195 gene locus_tag LOCUS_10170 36543 38195 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258986.1 protein_id gnl|my_center|LOCUS_10170 38508 38305 gene locus_tag LOCUS_10180 38508 38305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 39308 38862 gene locus_tag LOCUS_10190 39308 38862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 40755 39298 gene locus_tag LOCUS_10200 gene guaB 40755 39298 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583116.1 protein_id gnl|my_center|LOCUS_10200 40875 42557 gene locus_tag LOCUS_10210 40875 42557 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_10210 42597 43076 gene locus_tag LOCUS_10220 42597 43076 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_10220 43633 43073 gene locus_tag LOCUS_10230 43633 43073 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_10230 46223 43731 gene locus_tag LOCUS_10240 46223 43731 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_10240 46636 47313 gene locus_tag LOCUS_10250 46636 47313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 47502 49169 gene locus_tag LOCUS_10260 47502 49169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 49210 50739 gene locus_tag LOCUS_10270 49210 50739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 50781 52262 gene locus_tag LOCUS_10280 50781 52262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 52381 52800 gene locus_tag LOCUS_10290 52381 52800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 52812 53375 gene locus_tag LOCUS_10300 52812 53375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 53792 53403 gene locus_tag LOCUS_10310 53792 53403 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968855.1 protein_id gnl|my_center|LOCUS_10310 54436 53843 gene locus_tag LOCUS_10320 gene clpP 54436 53843 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_10320 55639 54461 gene locus_tag LOCUS_10330 gene tig 55639 54461 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_10330 56672 55755 gene locus_tag LOCUS_10340 56672 55755 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948817.1 protein_id gnl|my_center|LOCUS_10340 57547 56693 gene locus_tag LOCUS_10350 gene panB 57547 56693 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356105.1 protein_id gnl|my_center|LOCUS_10350 57646 58098 gene locus_tag LOCUS_10360 57646 58098 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197463606.1 protein_id gnl|my_center|LOCUS_10360 58180 58854 gene locus_tag LOCUS_10370 58180 58854 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228681.1 protein_id gnl|my_center|LOCUS_10370 58950 60782 gene locus_tag LOCUS_10380 58950 60782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 60801 61232 gene locus_tag LOCUS_10390 60801 61232 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 protein_id gnl|my_center|LOCUS_10390 61594 61433 gene locus_tag LOCUS_10400 61594 61433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 62096 61845 gene locus_tag LOCUS_10410 62096 61845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 62259 62065 gene locus_tag LOCUS_10420 62259 62065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 62510 62656 gene locus_tag LOCUS_10430 62510 62656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 62758 64068 gene locus_tag LOCUS_10440 62758 64068 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459114.1 protein_id gnl|my_center|LOCUS_10440 64041 64589 gene locus_tag LOCUS_10450 64041 64589 CDS product DUF5317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459113.1 protein_id gnl|my_center|LOCUS_10450 64947 64591 gene locus_tag LOCUS_10460 64947 64591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 65206 64949 gene locus_tag LOCUS_10470 65206 64949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 65312 66202 gene locus_tag LOCUS_10480 gene thiL 65312 66202 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_10480 66276 66971 gene locus_tag LOCUS_10490 66276 66971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 67624 67064 gene locus_tag LOCUS_10500 gene folE 67624 67064 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258500.1 protein_id gnl|my_center|LOCUS_10500 67791 69737 gene locus_tag LOCUS_10510 67791 69737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 69833 70771 gene locus_tag LOCUS_10520 69833 70771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_10520 70764 71660 gene locus_tag LOCUS_10530 70764 71660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 73102 71657 gene locus_tag LOCUS_10540 73102 71657 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_10540 73192 74001 gene locus_tag LOCUS_10550 gene mutM 73192 74001 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640272.1 protein_id gnl|my_center|LOCUS_10550 74144 75448 gene locus_tag LOCUS_10560 74144 75448 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_10560 75462 75731 gene locus_tag LOCUS_10570 gene rpsO 75462 75731 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583506.1 protein_id gnl|my_center|LOCUS_10570 75743 78094 gene locus_tag LOCUS_10580 gene pnp 75743 78094 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081541.1 protein_id gnl|my_center|LOCUS_10580 78102 78926 gene locus_tag LOCUS_10590 78102 78926 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_10590 79414 78944 gene locus_tag LOCUS_10600 79414 78944 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_10600 79525 79941 gene locus_tag LOCUS_10610 79525 79941 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564091.1 protein_id gnl|my_center|LOCUS_10610 80018 80806 gene locus_tag LOCUS_10620 80018 80806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 80957 81574 gene locus_tag LOCUS_10630 80957 81574 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941819.1 protein_id gnl|my_center|LOCUS_10630 81650 83581 gene locus_tag LOCUS_10640 81650 83581 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229043.1 protein_id gnl|my_center|LOCUS_10640 83571 85673 gene locus_tag LOCUS_10650 83571 85673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 85776 87254 gene locus_tag LOCUS_10660 85776 87254 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153932.1 protein_id gnl|my_center|LOCUS_10660 87432 89894 gene locus_tag LOCUS_10670 87432 89894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 89994 92180 gene locus_tag LOCUS_10680 89994 92180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 92329 92565 gene locus_tag LOCUS_10690 92329 92565 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_10690 92568 92801 gene locus_tag LOCUS_10700 92568 92801 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545521.1 protein_id gnl|my_center|LOCUS_10700 92879 93835 gene locus_tag LOCUS_10710 92879 93835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 94056 96224 gene locus_tag LOCUS_10720 94056 96224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 96400 97269 gene locus_tag LOCUS_10730 96400 97269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 97402 98250 gene locus_tag LOCUS_10740 97402 98250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 98666 99439 gene locus_tag LOCUS_10750 98666 99439 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338726.1 protein_id gnl|my_center|LOCUS_10750 99601 100890 gene locus_tag LOCUS_10760 99601 100890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 100909 101859 gene locus_tag LOCUS_10770 100909 101859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 101957 103057 gene locus_tag LOCUS_10780 101957 103057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 103068 104213 gene locus_tag LOCUS_10790 103068 104213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 104500 105210 gene locus_tag LOCUS_10800 104500 105210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 105236 105910 gene locus_tag LOCUS_10810 105236 105910 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228227.1 protein_id gnl|my_center|LOCUS_10810 107169 105916 gene locus_tag LOCUS_10820 107169 105916 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_10820 109258 107279 gene locus_tag LOCUS_10830 gene acs 109258 107279 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_10830 109382 110500 gene locus_tag LOCUS_10840 gene speY 109382 110500 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_10840 113992 110507 gene locus_tag LOCUS_10850 113992 110507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 114544 114068 gene locus_tag LOCUS_10860 114544 114068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 115491 114787 gene locus_tag LOCUS_10870 115491 114787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 115939 115718 gene locus_tag LOCUS_10880 115939 115718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 117083 115974 gene locus_tag LOCUS_10890 gene menC 117083 115974 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_10890 118081 117080 gene locus_tag LOCUS_10900 118081 117080 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042382595.1 protein_id gnl|my_center|LOCUS_10900 119997 118078 gene locus_tag LOCUS_10910 119997 118078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 120894 120007 gene locus_tag LOCUS_10920 gene era 120894 120007 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_10920 122371 120884 gene locus_tag LOCUS_10930 gene hutH 122371 120884 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681759.1 protein_id gnl|my_center|LOCUS_10930 122516 122986 gene locus_tag LOCUS_10940 122516 122986 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927009.1 protein_id gnl|my_center|LOCUS_10940 124397 122991 gene locus_tag LOCUS_10950 gene gatB 124397 122991 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_10950 126912 124426 gene locus_tag LOCUS_10960 gene gyrA 126912 124426 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_10960 128249 127008 gene locus_tag LOCUS_10970 128249 127008 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080422.1 protein_id gnl|my_center|LOCUS_10970 129423 128284 gene locus_tag LOCUS_10980 129423 128284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 129570 129926 gene locus_tag LOCUS_10990 129570 129926 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404162.1 protein_id gnl|my_center|LOCUS_10990 130401 129991 gene locus_tag LOCUS_11000 130401 129991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 130664 130374 gene locus_tag LOCUS_11010 130664 130374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 131569 130718 gene locus_tag LOCUS_11020 gene rnz 131569 130718 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080741.1 protein_id gnl|my_center|LOCUS_11020 132859 131579 gene locus_tag LOCUS_11030 132859 131579 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937466.1 protein_id gnl|my_center|LOCUS_11030 132928 133530 gene locus_tag LOCUS_11040 gene rnhB 132928 133530 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 protein_id gnl|my_center|LOCUS_11040 134313 133570 gene locus_tag LOCUS_11050 134313 133570 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_11050 136244 134310 gene locus_tag LOCUS_11060 136244 134310 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_11060 136930 136241 gene locus_tag LOCUS_11070 136930 136241 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_11070 137064 138464 gene locus_tag LOCUS_11080 gene pyk 137064 138464 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_11080 138585 139538 gene locus_tag LOCUS_11090 gene arcC 138585 139538 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_11090 140449 139511 gene locus_tag LOCUS_11100 140449 139511 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_11100 140732 140469 gene locus_tag LOCUS_11110 140732 140469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 141107 140823 gene locus_tag LOCUS_11120 141107 140823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 141421 141203 gene locus_tag LOCUS_11130 141421 141203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 141744 141424 gene locus_tag LOCUS_11140 141744 141424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 142340 141858 gene locus_tag LOCUS_11150 142340 141858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 142573 142337 gene locus_tag LOCUS_11160 142573 142337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 142875 143300 gene locus_tag LOCUS_11170 142875 143300 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_11170 143363 144532 gene locus_tag LOCUS_11180 143363 144532 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_11180 144555 145214 gene locus_tag LOCUS_11190 144555 145214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 146006 145221 gene locus_tag LOCUS_11200 146006 145221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 146962 146003 gene locus_tag LOCUS_11210 146962 146003 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_11210 147195 147401 gene locus_tag LOCUS_11220 147195 147401 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_11220 148808 147444 gene locus_tag LOCUS_11230 148808 147444 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_11230 148884 150686 gene locus_tag LOCUS_11240 gene uvrC 148884 150686 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_11240 150766 151209 gene locus_tag LOCUS_11250 150766 151209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 151255 151692 gene locus_tag LOCUS_11260 151255 151692 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459789.1 protein_id gnl|my_center|LOCUS_11260 152320 151853 gene locus_tag LOCUS_11270 152320 151853 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_11270 152532 153872 gene locus_tag LOCUS_11280 gene purD 152532 153872 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796998.1 protein_id gnl|my_center|LOCUS_11280 153922 155577 gene locus_tag LOCUS_11290 153922 155577 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878783.1 protein_id gnl|my_center|LOCUS_11290 155639 156052 gene locus_tag LOCUS_11300 155639 156052 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_11300 156184 158547 gene locus_tag LOCUS_11310 156184 158547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 158713 159078 gene locus_tag LOCUS_11320 158713 159078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 159145 159450 gene locus_tag LOCUS_11330 159145 159450 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545961.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence05 210 1436 gene locus_tag LOCUS_11340 210 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2872 1433 gene locus_tag LOCUS_11350 gene fpoN 2872 1433 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_11350 4329 2869 gene locus_tag LOCUS_11360 4329 2869 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 protein_id gnl|my_center|LOCUS_11360 6433 4424 gene locus_tag LOCUS_11370 gene fpoL 6433 4424 CDS product F420H2 dehydrogenase subunit FpoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021518.1 protein_id gnl|my_center|LOCUS_11370 6742 6440 gene locus_tag LOCUS_11380 gene nuoK 6742 6440 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100078.1 protein_id gnl|my_center|LOCUS_11380 6996 6739 gene locus_tag LOCUS_11390 6996 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 7235 6993 gene locus_tag LOCUS_11400 7235 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11400 7741 7232 gene locus_tag LOCUS_11410 gene nuoI 7741 7232 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258756.1 protein_id gnl|my_center|LOCUS_11410 8721 7744 gene locus_tag LOCUS_11420 gene nuoH 8721 7744 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_11420 9857 8718 gene locus_tag LOCUS_11430 9857 8718 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142368.1 protein_id gnl|my_center|LOCUS_11430 10362 9859 gene locus_tag LOCUS_11440 10362 9859 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392494.1 protein_id gnl|my_center|LOCUS_11440 10853 10359 gene locus_tag LOCUS_11450 10853 10359 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109092.1 protein_id gnl|my_center|LOCUS_11450 11200 10841 gene locus_tag LOCUS_11460 gene ndhC 11200 10841 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_11460 12786 11197 gene locus_tag LOCUS_11470 12786 11197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 12966 13895 gene locus_tag LOCUS_11480 12966 13895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 14926 14054 gene locus_tag LOCUS_11490 14926 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 16030 14987 gene locus_tag LOCUS_11500 16030 14987 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 protein_id gnl|my_center|LOCUS_11500 16617 16027 gene locus_tag LOCUS_11510 16617 16027 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033837886.1 protein_id gnl|my_center|LOCUS_11510 18098 16614 gene locus_tag LOCUS_11520 gene lysS 18098 16614 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_11520 18640 18152 gene locus_tag LOCUS_11530 gene greA 18640 18152 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_11530 19079 18717 gene locus_tag LOCUS_11540 gene rnpA 19079 18717 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582539.1 protein_id gnl|my_center|LOCUS_11540 19439 19089 gene locus_tag LOCUS_11550 19439 19089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 19981 19439 gene locus_tag LOCUS_11560 19981 19439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 20712 20032 gene locus_tag LOCUS_11570 20712 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 23678 20778 gene locus_tag LOCUS_11580 23678 20778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 24582 23761 gene locus_tag LOCUS_11590 24582 23761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228189.1 protein_id gnl|my_center|LOCUS_11590 25535 24600 gene locus_tag LOCUS_11600 25535 24600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 26150 25611 gene locus_tag LOCUS_11610 26150 25611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 26783 26229 gene locus_tag LOCUS_11620 26783 26229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 27319 26804 gene locus_tag LOCUS_11630 27319 26804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 29367 27430 gene locus_tag LOCUS_11640 29367 27430 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_11640 31342 29510 gene locus_tag LOCUS_11650 gene glmS 31342 29510 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228994.1 protein_id gnl|my_center|LOCUS_11650 31511 32008 gene locus_tag LOCUS_11660 31511 32008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 32058 33254 gene locus_tag LOCUS_11670 32058 33254 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_11670 34738 33251 gene locus_tag LOCUS_11680 gene thiI 34738 33251 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762723.1 protein_id gnl|my_center|LOCUS_11680 34809 34881 gene locus_tag LOCUS_t00180 34809 34881 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 35728 34886 gene locus_tag LOCUS_11690 35728 34886 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392660.1 protein_id gnl|my_center|LOCUS_11690 35824 35750 gene locus_tag LOCUS_t00190 35824 35750 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 36161 37459 gene locus_tag LOCUS_11700 gene aspS 36161 37459 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948698.1 protein_id gnl|my_center|LOCUS_11700 38422 37469 gene locus_tag LOCUS_11710 38422 37469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 38677 38591 gene locus_tag LOCUS_t00200 38677 38591 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38836 39288 gene locus_tag LOCUS_11720 38836 39288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 39288 39941 gene locus_tag LOCUS_11730 39288 39941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 39970 40599 gene locus_tag LOCUS_11740 39970 40599 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_11740 40649 40723 gene locus_tag LOCUS_t00210 40649 40723 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 40788 41729 gene locus_tag LOCUS_11750 gene xerD 40788 41729 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_11750 42472 41795 gene locus_tag LOCUS_11760 42472 41795 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_11760 43031 42477 gene locus_tag LOCUS_11770 43031 42477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 43225 43028 gene locus_tag LOCUS_11780 43225 43028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 44256 43222 gene locus_tag LOCUS_11790 44256 43222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 44591 44319 gene locus_tag LOCUS_11800 44591 44319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 44881 44594 gene locus_tag LOCUS_11810 44881 44594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 45242 44979 gene locus_tag LOCUS_11820 45242 44979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 45466 45266 gene locus_tag LOCUS_11830 45466 45266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 45789 45478 gene locus_tag LOCUS_11840 45789 45478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 45983 45792 gene locus_tag LOCUS_11850 45983 45792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 46550 46134 gene locus_tag LOCUS_11860 46550 46134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 46729 46547 gene locus_tag LOCUS_11870 46729 46547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 46916 46740 gene locus_tag LOCUS_11880 46916 46740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 47308 46970 gene locus_tag LOCUS_11890 47308 46970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 47796 47362 gene locus_tag LOCUS_11900 47796 47362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 48197 47859 gene locus_tag LOCUS_11910 48197 47859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 48450 48199 gene locus_tag LOCUS_11920 48450 48199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 50153 48693 gene locus_tag LOCUS_11930 50153 48693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 50506 50321 gene locus_tag LOCUS_11940 50506 50321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 51294 50641 gene locus_tag LOCUS_11950 51294 50641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 51638 51372 gene locus_tag LOCUS_11960 51638 51372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 52423 51635 gene locus_tag LOCUS_11970 52423 51635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 52605 52673 gene locus_tag LOCUS_t00220 52605 52673 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 52964 54496 gene locus_tag LOCUS_11980 52964 54496 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143420.1 protein_id gnl|my_center|LOCUS_11980 54710 54516 gene locus_tag LOCUS_11990 54710 54516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 55081 54746 gene locus_tag LOCUS_12000 55081 54746 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394315.1 protein_id gnl|my_center|LOCUS_12000 55752 55096 gene locus_tag LOCUS_12010 55752 55096 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394318.1 protein_id gnl|my_center|LOCUS_12010 56443 55841 gene locus_tag LOCUS_12020 56443 55841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 58164 56440 gene locus_tag LOCUS_12030 58164 56440 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086565.1 protein_id gnl|my_center|LOCUS_12030 58995 58198 gene locus_tag LOCUS_12040 58995 58198 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969990.1 protein_id gnl|my_center|LOCUS_12040 59496 59191 gene locus_tag LOCUS_12050 59496 59191 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_12050 59795 59514 gene locus_tag LOCUS_12060 59795 59514 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_12060 61368 59905 gene locus_tag LOCUS_12070 61368 59905 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_12070 62417 61365 gene locus_tag LOCUS_12080 62417 61365 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_12080 63013 62414 gene locus_tag LOCUS_12090 63013 62414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 66464 63006 gene locus_tag LOCUS_12100 66464 63006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 67356 66457 gene locus_tag LOCUS_12110 67356 66457 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_12110 67982 67353 gene locus_tag LOCUS_12120 67982 67353 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392330.1 protein_id gnl|my_center|LOCUS_12120 68295 70580 gene locus_tag LOCUS_12130 68295 70580 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_12130 71054 70605 gene locus_tag LOCUS_12140 gene smpB 71054 70605 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051750.1 protein_id gnl|my_center|LOCUS_12140 71168 71092 gene locus_tag LOCUS_t00230 71168 71092 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 71317 71242 gene locus_tag LOCUS_t00240 71317 71242 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 72235 71549 gene locus_tag LOCUS_12150 72235 71549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 73201 72320 gene locus_tag LOCUS_12160 73201 72320 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 protein_id gnl|my_center|LOCUS_12160 73894 73457 gene locus_tag LOCUS_12170 73894 73457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 74388 73891 gene locus_tag LOCUS_12180 74388 73891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 75161 74415 gene locus_tag LOCUS_12190 75161 74415 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_12190 75475 76812 gene locus_tag LOCUS_12200 gene glnA 75475 76812 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_12200 78317 76815 gene locus_tag LOCUS_12210 78317 76815 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_12210 78495 78977 gene locus_tag LOCUS_12220 78495 78977 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930802.1 protein_id gnl|my_center|LOCUS_12220 78980 80074 gene locus_tag LOCUS_12230 gene khtU 78980 80074 CDS product K(+)/H(+) antiporter subunit KhtU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233272.1 protein_id gnl|my_center|LOCUS_12230 80074 81834 gene locus_tag LOCUS_12240 80074 81834 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_12240 82937 81831 gene locus_tag LOCUS_12250 82937 81831 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 protein_id gnl|my_center|LOCUS_12250 84540 82945 gene locus_tag LOCUS_12260 gene asnB 84540 82945 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962690.1 protein_id gnl|my_center|LOCUS_12260 86185 84551 gene locus_tag LOCUS_12270 86185 84551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 86387 86311 gene locus_tag LOCUS_t00250 86387 86311 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 86515 87909 gene locus_tag LOCUS_12280 86515 87909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 87935 88243 gene locus_tag LOCUS_12290 87935 88243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 88833 88249 gene locus_tag LOCUS_12300 88833 88249 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_12300 89708 88941 gene locus_tag LOCUS_12310 89708 88941 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080600.1 protein_id gnl|my_center|LOCUS_12310 90445 89705 gene locus_tag LOCUS_12320 90445 89705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 91885 90503 gene locus_tag LOCUS_12330 91885 90503 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_12330 92057 93460 gene locus_tag LOCUS_12340 92057 93460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 93672 93457 gene locus_tag LOCUS_12350 93672 93457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 93962 93702 gene locus_tag LOCUS_12360 93962 93702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 95176 94109 gene locus_tag LOCUS_12370 95176 94109 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257568.1 protein_id gnl|my_center|LOCUS_12370 95502 95840 gene locus_tag LOCUS_12380 95502 95840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 97170 95911 gene locus_tag LOCUS_12390 97170 95911 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_12390 98626 97184 gene locus_tag LOCUS_12400 98626 97184 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196631.1 protein_id gnl|my_center|LOCUS_12400 99287 98736 gene locus_tag LOCUS_12410 99287 98736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 100312 99350 gene locus_tag LOCUS_12420 100312 99350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 101175 100309 gene locus_tag LOCUS_12430 101175 100309 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979652.1 protein_id gnl|my_center|LOCUS_12430 101268 101639 gene locus_tag LOCUS_12440 101268 101639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 101658 102551 gene locus_tag LOCUS_12450 101658 102551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 102548 103708 gene locus_tag LOCUS_12460 102548 103708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 103804 105564 gene locus_tag LOCUS_12470 103804 105564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 105665 107800 gene locus_tag LOCUS_12480 105665 107800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 107989 109086 gene locus_tag LOCUS_12490 107989 109086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 109100 109918 gene locus_tag LOCUS_12500 109100 109918 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002663.1 protein_id gnl|my_center|LOCUS_12500 111275 109926 gene locus_tag LOCUS_12510 111275 109926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 111885 111385 gene locus_tag LOCUS_12520 111885 111385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 111967 113991 gene locus_tag LOCUS_12530 111967 113991 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421608.1 protein_id gnl|my_center|LOCUS_12530 114045 115322 gene locus_tag LOCUS_12540 114045 115322 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_12540 115330 116874 gene locus_tag LOCUS_12550 115330 116874 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_12550 117332 116859 gene locus_tag LOCUS_12560 gene tsaE 117332 116859 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257860.1 protein_id gnl|my_center|LOCUS_12560 117862 117332 gene locus_tag LOCUS_12570 117862 117332 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546838.1 protein_id gnl|my_center|LOCUS_12570 118512 118288 gene locus_tag LOCUS_12580 118512 118288 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_12580 119284 118595 gene locus_tag LOCUS_12590 119284 118595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 120159 119281 gene locus_tag LOCUS_12600 120159 119281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 122528 120717 gene locus_tag LOCUS_12610 122528 120717 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_12610 122664 124142 gene locus_tag LOCUS_12620 gene cysS 122664 124142 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_12620 125910 124111 gene locus_tag LOCUS_12630 125910 124111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 126735 125917 gene locus_tag LOCUS_12640 126735 125917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 127157 126732 gene locus_tag LOCUS_12650 127157 126732 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_12650 127591 127277 gene locus_tag LOCUS_12660 127591 127277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 128386 127628 gene locus_tag LOCUS_12670 128386 127628 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878917.1 protein_id gnl|my_center|LOCUS_12670 128600 129364 gene locus_tag LOCUS_12680 gene tpiA 128600 129364 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583495.1 protein_id gnl|my_center|LOCUS_12680 131034 129361 gene locus_tag LOCUS_12690 131034 129361 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_12690 132487 131036 gene locus_tag LOCUS_12700 gene gltX 132487 131036 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_12700 133361 132480 gene locus_tag LOCUS_12710 gene ilvE 133361 132480 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_12710 133470 134378 gene locus_tag LOCUS_12720 gene argF 133470 134378 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_12720 134380 135282 gene locus_tag LOCUS_12730 134380 135282 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948045.1 protein_id gnl|my_center|LOCUS_12730 135361 136626 gene locus_tag LOCUS_12740 135361 136626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 136666 138057 gene locus_tag LOCUS_12750 136666 138057 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928748.1 protein_id gnl|my_center|LOCUS_12750 138122 139507 gene locus_tag LOCUS_12760 138122 139507 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148202592.1 protein_id gnl|my_center|LOCUS_12760 139625 139553 gene locus_tag LOCUS_t00260 139625 139553 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 140801 139668 gene locus_tag LOCUS_12770 gene rng 140801 139668 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_12770 141348 140851 gene locus_tag LOCUS_12780 gene folK 141348 140851 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_12780 141713 141348 gene locus_tag LOCUS_12790 gene folB 141713 141348 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853806.1 protein_id gnl|my_center|LOCUS_12790 142988 141720 gene locus_tag LOCUS_12800 142988 141720 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_12800 143787 142990 gene locus_tag LOCUS_12810 143787 142990 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877405.1 protein_id gnl|my_center|LOCUS_12810 144271 143816 gene locus_tag LOCUS_12820 144271 143816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 144422 144330 gene locus_tag LOCUS_t00270 144422 144330 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 145623 144586 gene locus_tag LOCUS_12830 145623 144586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence06 602 177 gene locus_tag LOCUS_12840 602 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 840 625 gene locus_tag LOCUS_12850 840 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1798 863 gene locus_tag LOCUS_12860 gene mdh 1798 863 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153230.1 protein_id gnl|my_center|LOCUS_12860 2803 2033 gene locus_tag LOCUS_12870 2803 2033 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842212.1 protein_id gnl|my_center|LOCUS_12870 4305 2803 gene locus_tag LOCUS_12880 4305 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4683 4366 gene locus_tag LOCUS_12890 4683 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4922 4683 gene locus_tag LOCUS_12900 4922 4683 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928916.1 protein_id gnl|my_center|LOCUS_12900 5738 4938 gene locus_tag LOCUS_12910 5738 4938 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_12910 6718 5735 gene locus_tag LOCUS_12920 6718 5735 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389332.1 protein_id gnl|my_center|LOCUS_12920 6810 7382 gene locus_tag LOCUS_12930 6810 7382 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_12930 7379 8134 gene locus_tag LOCUS_12940 7379 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 8220 9830 gene locus_tag LOCUS_12950 8220 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 9895 10764 gene locus_tag LOCUS_12960 9895 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 10764 11675 gene locus_tag LOCUS_12970 10764 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 11730 12662 gene locus_tag LOCUS_12980 11730 12662 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958139.1 protein_id gnl|my_center|LOCUS_12980 13570 12710 gene locus_tag LOCUS_12990 13570 12710 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082369.1 protein_id gnl|my_center|LOCUS_12990 14598 13567 gene locus_tag LOCUS_13000 gene hflK 14598 13567 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082368.1 protein_id gnl|my_center|LOCUS_13000 14691 15536 gene locus_tag LOCUS_13010 14691 15536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 15624 16598 gene locus_tag LOCUS_13020 15624 16598 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_13020 16576 17484 gene locus_tag LOCUS_13030 16576 17484 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937757.1 protein_id gnl|my_center|LOCUS_13030 18388 17537 gene locus_tag LOCUS_13040 18388 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 18537 19703 gene locus_tag LOCUS_13050 18537 19703 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_13050 19981 20928 gene locus_tag LOCUS_13060 19981 20928 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_13060 21067 23217 gene locus_tag LOCUS_13070 21067 23217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 23219 24439 gene locus_tag LOCUS_13080 23219 24439 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460412.1 protein_id gnl|my_center|LOCUS_13080 24467 25756 gene locus_tag LOCUS_13090 24467 25756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 25865 26368 gene locus_tag LOCUS_13100 25865 26368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 28479 26464 gene locus_tag LOCUS_13110 gene ligA 28479 26464 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_13110 28684 28487 gene locus_tag LOCUS_13120 28684 28487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 29712 28750 gene locus_tag LOCUS_13130 29712 28750 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081850.1 protein_id gnl|my_center|LOCUS_13130 29952 29734 gene locus_tag LOCUS_13140 29952 29734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 30030 30221 gene locus_tag LOCUS_13150 30030 30221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 30813 30373 gene locus_tag LOCUS_13160 30813 30373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 31787 31969 gene locus_tag LOCUS_13170 31787 31969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 32191 31895 gene locus_tag LOCUS_13180 32191 31895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 32354 32485 gene locus_tag LOCUS_13190 32354 32485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 33055 32855 gene locus_tag LOCUS_13200 33055 32855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 34793 34350 gene locus_tag LOCUS_13210 34793 34350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 35392 34883 gene locus_tag LOCUS_13220 35392 34883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 36065 35838 gene locus_tag LOCUS_13230 36065 35838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 36334 36071 gene locus_tag LOCUS_13240 36334 36071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 36575 36273 gene locus_tag LOCUS_13250 36575 36273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 38600 36711 gene locus_tag LOCUS_13260 38600 36711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 38806 38618 gene locus_tag LOCUS_13270 38806 38618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 38717 39835 gene locus_tag LOCUS_13280 38717 39835 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228181.1 protein_id gnl|my_center|LOCUS_13280 39919 40377 gene locus_tag LOCUS_13290 39919 40377 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245175.1 protein_id gnl|my_center|LOCUS_13290 40382 42490 gene locus_tag LOCUS_13300 40382 42490 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_13300 42499 43083 gene locus_tag LOCUS_13310 42499 43083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 43100 44140 gene locus_tag LOCUS_13320 gene recA 43100 44140 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314063.1 protein_id gnl|my_center|LOCUS_13320 44150 44647 gene locus_tag LOCUS_13330 44150 44647 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545289.1 protein_id gnl|my_center|LOCUS_13330 48454 44735 gene locus_tag LOCUS_13340 48454 44735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 48539 49327 gene locus_tag LOCUS_13350 48539 49327 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_13350 49546 50241 gene locus_tag LOCUS_13360 49546 50241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 50222 51067 gene locus_tag LOCUS_13370 50222 51067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 51064 51828 gene locus_tag LOCUS_13380 51064 51828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 51831 52976 gene locus_tag LOCUS_13390 gene hadC 51831 52976 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_13390 52987 54297 gene locus_tag LOCUS_13400 52987 54297 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_13400 54294 55073 gene locus_tag LOCUS_13410 54294 55073 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_13410 55078 55977 gene locus_tag LOCUS_13420 55078 55977 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_13420 57021 56011 gene locus_tag LOCUS_13430 gene mtnA 57021 56011 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 protein_id gnl|my_center|LOCUS_13430 57117 57416 gene locus_tag LOCUS_13440 57117 57416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 57426 58520 gene locus_tag LOCUS_13450 57426 58520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 58586 59353 gene locus_tag LOCUS_13460 58586 59353 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_13460 59373 60509 gene locus_tag LOCUS_13470 59373 60509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 60496 61083 gene locus_tag LOCUS_13480 60496 61083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 62159 61050 gene locus_tag LOCUS_13490 gene mutY 62159 61050 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_13490 62508 62140 gene locus_tag LOCUS_13500 62508 62140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 62617 64101 gene locus_tag LOCUS_13510 62617 64101 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920973.1 protein_id gnl|my_center|LOCUS_13510 64113 64355 gene locus_tag LOCUS_13520 64113 64355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 64384 65172 gene locus_tag LOCUS_13530 64384 65172 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_13530 65176 65655 gene locus_tag LOCUS_13540 65176 65655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 66654 65665 gene locus_tag LOCUS_13550 gene tsaD 66654 65665 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082750.1 protein_id gnl|my_center|LOCUS_13550 66760 67317 gene locus_tag LOCUS_13560 gene frr 66760 67317 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 protein_id gnl|my_center|LOCUS_13560 67529 67846 gene locus_tag LOCUS_13570 67529 67846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 67843 70011 gene locus_tag LOCUS_13580 67843 70011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 70036 70536 gene locus_tag LOCUS_13590 70036 70536 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869602.1 protein_id gnl|my_center|LOCUS_13590 70540 71136 gene locus_tag LOCUS_13600 70540 71136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 71133 72167 gene locus_tag LOCUS_13610 71133 72167 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986935.1 protein_id gnl|my_center|LOCUS_13610 72160 72483 gene locus_tag LOCUS_13620 72160 72483 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869605.1 protein_id gnl|my_center|LOCUS_13620 72541 74325 gene locus_tag LOCUS_13630 72541 74325 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_13630 74306 75697 gene locus_tag LOCUS_13640 74306 75697 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869607.1 protein_id gnl|my_center|LOCUS_13640 75721 76353 gene locus_tag LOCUS_13650 75721 76353 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_13650 76444 76356 gene locus_tag LOCUS_t00280 76444 76356 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 76519 76445 gene locus_tag LOCUS_t00290 76519 76445 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 76609 77271 gene locus_tag LOCUS_13660 76609 77271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 77948 77268 gene locus_tag LOCUS_13670 77948 77268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966750.1 protein_id gnl|my_center|LOCUS_13670 78677 77961 gene locus_tag LOCUS_13680 78677 77961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528445.1 protein_id gnl|my_center|LOCUS_13680 79933 78872 gene locus_tag LOCUS_13690 79933 78872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 80014 81258 gene locus_tag LOCUS_13700 80014 81258 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_13700 83021 81426 gene locus_tag LOCUS_13710 83021 81426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 83236 83991 gene locus_tag LOCUS_13720 83236 83991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 83988 84770 gene locus_tag LOCUS_13730 83988 84770 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256332.1 protein_id gnl|my_center|LOCUS_13730 84778 85890 gene locus_tag LOCUS_13740 84778 85890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_13740 85883 86563 gene locus_tag LOCUS_13750 85883 86563 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 protein_id gnl|my_center|LOCUS_13750 87386 86541 gene locus_tag LOCUS_13760 87386 86541 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034812.1 protein_id gnl|my_center|LOCUS_13760 88482 87460 gene locus_tag LOCUS_13770 88482 87460 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_13770 89432 88533 gene locus_tag LOCUS_13780 gene rocF 89432 88533 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_13780 89930 89463 gene locus_tag LOCUS_13790 89930 89463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 90521 89949 gene locus_tag LOCUS_13800 90521 89949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 91074 90541 gene locus_tag LOCUS_13810 91074 90541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 91760 91182 gene locus_tag LOCUS_13820 91760 91182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 92320 91832 gene locus_tag LOCUS_13830 92320 91832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 92710 92351 gene locus_tag LOCUS_13840 92710 92351 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921253.1 protein_id gnl|my_center|LOCUS_13840 93218 92739 gene locus_tag LOCUS_13850 93218 92739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 94486 93350 gene locus_tag LOCUS_13860 gene recA 94486 93350 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_13860 95120 94461 gene locus_tag LOCUS_13870 gene lexA 95120 94461 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_13870 95480 95220 gene locus_tag LOCUS_13880 95480 95220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 95767 95510 gene locus_tag LOCUS_13890 95767 95510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 95958 95764 gene locus_tag LOCUS_13900 95958 95764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 97052 96183 gene locus_tag LOCUS_13910 gene rsmI 97052 96183 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_13910 97297 98274 gene locus_tag LOCUS_13920 gene prfB 97297 98274 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869561.1 protein_id gnl|my_center|LOCUS_13920 98277 99059 gene locus_tag LOCUS_13930 98277 99059 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868648.1 protein_id gnl|my_center|LOCUS_13930 99077 99709 gene locus_tag LOCUS_13940 gene cmk 99077 99709 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869528.1 protein_id gnl|my_center|LOCUS_13940 99706 100353 gene locus_tag LOCUS_13950 99706 100353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 100350 101273 gene locus_tag LOCUS_13960 gene ispH 100350 101273 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881128.1 protein_id gnl|my_center|LOCUS_13960 101288 102982 gene locus_tag LOCUS_13970 101288 102982 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_13970 102972 103583 gene locus_tag LOCUS_13980 gene plsY 102972 103583 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390940.1 protein_id gnl|my_center|LOCUS_13980 103673 104830 gene locus_tag LOCUS_13990 103673 104830 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_13990 104835 105029 gene locus_tag LOCUS_14000 104835 105029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 105745 105026 gene locus_tag LOCUS_14010 105745 105026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 105830 106318 gene locus_tag LOCUS_14020 105830 106318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 107620 106352 gene locus_tag LOCUS_14030 107620 106352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 108420 107701 gene locus_tag LOCUS_14040 108420 107701 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899523.1 protein_id gnl|my_center|LOCUS_14040 108989 108423 gene locus_tag LOCUS_14050 108989 108423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 109092 109286 gene locus_tag LOCUS_14060 109092 109286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 109710 109336 gene locus_tag LOCUS_14070 gene vapC 109710 109336 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651560.1 protein_id gnl|my_center|LOCUS_14070 109942 109715 gene locus_tag LOCUS_14080 109942 109715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 110546 110067 gene locus_tag LOCUS_14090 110546 110067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 110966 110691 gene locus_tag LOCUS_14100 110966 110691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 111229 110930 gene locus_tag LOCUS_14110 111229 110930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 111936 111382 gene locus_tag LOCUS_14120 111936 111382 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970795.1 protein_id gnl|my_center|LOCUS_14120 113251 112073 gene locus_tag LOCUS_14130 113251 112073 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142321.1 protein_id gnl|my_center|LOCUS_14130 113359 113757 gene locus_tag LOCUS_14140 113359 113757 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594462.1 protein_id gnl|my_center|LOCUS_14140 113767 114336 gene locus_tag LOCUS_14150 113767 114336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 114867 114487 gene locus_tag LOCUS_14160 114867 114487 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546106.1 protein_id gnl|my_center|LOCUS_14160 115126 114860 gene locus_tag LOCUS_14170 115126 114860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 115470 116486 gene locus_tag LOCUS_14180 115470 116486 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_14180 116486 117310 gene locus_tag LOCUS_14190 116486 117310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582436.1 protein_id gnl|my_center|LOCUS_14190 117365 118237 gene locus_tag LOCUS_14200 117365 118237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 118281 118595 gene locus_tag LOCUS_14210 118281 118595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 118592 118951 gene locus_tag LOCUS_14220 118592 118951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 118957 120678 gene locus_tag LOCUS_14230 118957 120678 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_14230 120831 122207 gene locus_tag LOCUS_14240 120831 122207 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_14240 122204 124360 gene locus_tag LOCUS_14250 122204 124360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 124446 125033 gene locus_tag LOCUS_14260 gene ruvA 124446 125033 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_14260 125123 126328 gene locus_tag LOCUS_14270 125123 126328 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_14270 127631 126363 gene locus_tag LOCUS_14280 127631 126363 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257569.1 protein_id gnl|my_center|LOCUS_14280 128211 127657 gene locus_tag LOCUS_14290 128211 127657 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_14290 129002 128187 gene locus_tag LOCUS_14300 129002 128187 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870041.1 protein_id gnl|my_center|LOCUS_14300 130137 129019 gene locus_tag LOCUS_14310 130137 129019 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250076.1 protein_id gnl|my_center|LOCUS_14310 130406 130146 gene locus_tag LOCUS_14320 130406 130146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 131343 130393 gene locus_tag LOCUS_14330 131343 130393 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582674.1 protein_id gnl|my_center|LOCUS_14330 132537 131350 gene locus_tag LOCUS_14340 gene porA 132537 131350 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082460.1 protein_id gnl|my_center|LOCUS_14340 132873 132571 gene locus_tag LOCUS_14350 gene porD 132873 132571 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082458.1 protein_id gnl|my_center|LOCUS_14350 133457 132867 gene locus_tag LOCUS_14360 133457 132867 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545865.1 protein_id gnl|my_center|LOCUS_14360 134800 133454 gene locus_tag LOCUS_14370 gene gltA 134800 133454 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082125.1 protein_id gnl|my_center|LOCUS_14370 135276 135088 gene locus_tag LOCUS_14380 135276 135088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 136660 135341 gene locus_tag LOCUS_14390 136660 135341 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404565.1 protein_id gnl|my_center|LOCUS_14390 137394 136639 gene locus_tag LOCUS_14400 137394 136639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 140651 137391 gene locus_tag LOCUS_14410 gene ileS 140651 137391 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_14410 140794 141660 gene locus_tag LOCUS_14420 gene ispE 140794 141660 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_14420 142673 141705 gene locus_tag LOCUS_14430 gene moaA 142673 141705 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence07 175 1449 gene locus_tag LOCUS_14440 gene serS 175 1449 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458807.1 protein_id gnl|my_center|LOCUS_14440 1452 2714 gene locus_tag LOCUS_14450 1452 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 3496 2843 gene locus_tag LOCUS_14460 3496 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3652 4680 gene locus_tag LOCUS_14470 3652 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4766 5545 gene locus_tag LOCUS_14480 gene phnC 4766 5545 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832011.1 protein_id gnl|my_center|LOCUS_14480 5523 7100 gene locus_tag LOCUS_14490 gene phnE 5523 7100 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727091.1 protein_id gnl|my_center|LOCUS_14490 7708 7265 gene locus_tag LOCUS_14500 7708 7265 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048201672.1 protein_id gnl|my_center|LOCUS_14500 8021 7671 gene locus_tag LOCUS_14510 8021 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 8335 9897 gene locus_tag LOCUS_14520 8335 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 9945 10718 gene locus_tag LOCUS_14530 9945 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 10728 11144 gene locus_tag LOCUS_14540 10728 11144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 11151 11681 gene locus_tag LOCUS_14550 11151 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 11669 14914 gene locus_tag LOCUS_14560 11669 14914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 15336 14920 gene locus_tag LOCUS_14570 15336 14920 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393269.1 protein_id gnl|my_center|LOCUS_14570 15574 15326 gene locus_tag LOCUS_14580 15574 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 15533 15706 gene locus_tag LOCUS_14590 15533 15706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 15735 16019 gene locus_tag LOCUS_14600 15735 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 16101 16280 gene locus_tag LOCUS_14610 16101 16280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 16425 17627 gene locus_tag LOCUS_14620 16425 17627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 17999 21898 gene locus_tag LOCUS_14630 17999 21898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 22372 22025 gene locus_tag LOCUS_14640 22372 22025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 22683 22369 gene locus_tag LOCUS_14650 22683 22369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 23898 23059 gene locus_tag LOCUS_14660 23898 23059 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_14660 24029 25396 gene locus_tag LOCUS_14670 24029 25396 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_14670 25753 26544 gene locus_tag LOCUS_14680 25753 26544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 27810 26554 gene locus_tag LOCUS_14690 27810 26554 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785364.1 protein_id gnl|my_center|LOCUS_14690 29045 27807 gene locus_tag LOCUS_14700 29045 27807 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_14700 29515 29042 gene locus_tag LOCUS_14710 29515 29042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 29615 29884 gene locus_tag LOCUS_14720 29615 29884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 29868 30278 gene locus_tag LOCUS_14730 29868 30278 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392211.1 protein_id gnl|my_center|LOCUS_14730 31438 30317 gene locus_tag LOCUS_14740 31438 30317 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_14740 32434 31475 gene locus_tag LOCUS_14750 32434 31475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 33864 32434 gene locus_tag LOCUS_14760 33864 32434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 34943 34029 gene locus_tag LOCUS_14770 gene fmt 34943 34029 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_14770 35458 34940 gene locus_tag LOCUS_14780 gene def 35458 34940 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694639.1 protein_id gnl|my_center|LOCUS_14780 35878 35492 gene locus_tag LOCUS_14790 35878 35492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 37061 35979 gene locus_tag LOCUS_14800 gene ispG 37061 35979 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965103.1 protein_id gnl|my_center|LOCUS_14800 37492 37058 gene locus_tag LOCUS_14810 37492 37058 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869573.1 protein_id gnl|my_center|LOCUS_14810 38433 37489 gene locus_tag LOCUS_14820 gene pfkB 38433 37489 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640844.1 protein_id gnl|my_center|LOCUS_14820 39884 38451 gene locus_tag LOCUS_14830 gene miaB 39884 38451 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005404.1 protein_id gnl|my_center|LOCUS_14830 39948 40376 gene locus_tag LOCUS_14840 39948 40376 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_14840 40399 41454 gene locus_tag LOCUS_14850 40399 41454 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_14850 41451 41756 gene locus_tag LOCUS_14860 41451 41756 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081479.1 protein_id gnl|my_center|LOCUS_14860 41790 42419 gene locus_tag LOCUS_14870 41790 42419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 42508 44331 gene locus_tag LOCUS_14880 42508 44331 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_14880 44996 44328 gene locus_tag LOCUS_14890 44996 44328 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990006.1 protein_id gnl|my_center|LOCUS_14890 46536 44977 gene locus_tag LOCUS_14900 46536 44977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 46927 47754 gene locus_tag LOCUS_14910 46927 47754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 48560 47751 gene locus_tag LOCUS_14920 48560 47751 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_14920 49387 48605 gene locus_tag LOCUS_14930 49387 48605 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285593.1 protein_id gnl|my_center|LOCUS_14930 50529 49390 gene locus_tag LOCUS_14940 50529 49390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 51681 50581 gene locus_tag LOCUS_14950 51681 50581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 51889 53280 gene locus_tag LOCUS_14960 51889 53280 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_14960 53778 53578 gene locus_tag LOCUS_14970 53778 53578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 53902 54186 gene locus_tag LOCUS_14980 53902 54186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 55777 56709 gene locus_tag LOCUS_14990 55777 56709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 56908 57411 gene locus_tag LOCUS_15000 56908 57411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 58534 57671 gene locus_tag LOCUS_15010 58534 57671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 58718 58804 gene locus_tag LOCUS_t00300 58718 58804 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 58875 58949 gene locus_tag LOCUS_t00310 58875 58949 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 59000 60208 gene locus_tag LOCUS_15020 gene tuf 59000 60208 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_15020 60251 60400 gene locus_tag LOCUS_15030 gene rpmG 60251 60400 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881260.1 protein_id gnl|my_center|LOCUS_15030 60404 60479 gene locus_tag LOCUS_t00320 60404 60479 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 60498 60683 gene locus_tag LOCUS_15040 60498 60683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 60702 61781 gene locus_tag LOCUS_15050 gene nusG 60702 61781 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081513.1 protein_id gnl|my_center|LOCUS_15050 61798 62244 gene locus_tag LOCUS_15060 gene rplK 61798 62244 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_15060 62251 62964 gene locus_tag LOCUS_15070 gene rplA 62251 62964 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081511.1 protein_id gnl|my_center|LOCUS_15070 62981 63508 gene locus_tag LOCUS_15080 gene rplJ 62981 63508 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356426.1 protein_id gnl|my_center|LOCUS_15080 63521 63907 gene locus_tag LOCUS_15090 gene rplL 63521 63907 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_15090 64009 67386 gene locus_tag LOCUS_15100 gene rpoB 64009 67386 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869936.1 protein_id gnl|my_center|LOCUS_15100 67393 67821 gene locus_tag LOCUS_15110 67393 67821 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_15110 68962 67823 gene locus_tag LOCUS_15120 68962 67823 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479989.1 protein_id gnl|my_center|LOCUS_15120 70467 68959 gene locus_tag LOCUS_15130 gene pckA 70467 68959 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_15130 72873 70693 gene locus_tag LOCUS_15140 72873 70693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 73091 73007 gene locus_tag LOCUS_t00330 73091 73007 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 73236 73161 gene locus_tag LOCUS_t00340 73236 73161 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 73342 74646 gene locus_tag LOCUS_15150 73342 74646 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_15150 75309 74851 gene locus_tag LOCUS_15160 75309 74851 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880818.1 protein_id gnl|my_center|LOCUS_15160 75503 77677 gene locus_tag LOCUS_15170 75503 77677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 77709 78380 gene locus_tag LOCUS_15180 77709 78380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 78431 79747 gene locus_tag LOCUS_15190 78431 79747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 79747 80703 gene locus_tag LOCUS_15200 79747 80703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 80761 81726 gene locus_tag LOCUS_15210 80761 81726 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_15210 81726 82475 gene locus_tag LOCUS_15220 81726 82475 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660412.1 protein_id gnl|my_center|LOCUS_15220 82480 83325 gene locus_tag LOCUS_15230 gene rsmA 82480 83325 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986025.1 protein_id gnl|my_center|LOCUS_15230 83454 86438 gene locus_tag LOCUS_15240 83454 86438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 86435 86869 gene locus_tag LOCUS_15250 86435 86869 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392707.1 protein_id gnl|my_center|LOCUS_15250 86856 87533 gene locus_tag LOCUS_15260 86856 87533 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_15260 87541 88479 gene locus_tag LOCUS_15270 87541 88479 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_15270 88806 88570 gene locus_tag LOCUS_15280 88806 88570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 89117 89353 gene locus_tag LOCUS_15290 89117 89353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 89645 90160 gene locus_tag LOCUS_15300 89645 90160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 90234 90812 gene locus_tag LOCUS_15310 gene rimI 90234 90812 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251164.1 protein_id gnl|my_center|LOCUS_15310 91269 90748 gene locus_tag LOCUS_15320 91269 90748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 92596 91367 gene locus_tag LOCUS_15330 92596 91367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 92731 93255 gene locus_tag LOCUS_15340 gene yjjX 92731 93255 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250698.1 protein_id gnl|my_center|LOCUS_15340 93245 94213 gene locus_tag LOCUS_15350 93245 94213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 94271 94462 gene locus_tag LOCUS_15360 94271 94462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 94520 94735 gene locus_tag LOCUS_15370 94520 94735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 95178 94948 gene locus_tag LOCUS_15380 95178 94948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 95793 98381 gene locus_tag LOCUS_15390 95793 98381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 98447 98805 gene locus_tag LOCUS_tm00010 98447 98805 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 98853 100184 gene locus_tag LOCUS_15400 98853 100184 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_15400 100232 100684 gene locus_tag LOCUS_15410 100232 100684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 100767 103505 gene locus_tag LOCUS_15420 100767 103505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 103567 104853 gene locus_tag LOCUS_15430 103567 104853 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_15430 104906 105655 gene locus_tag LOCUS_15440 104906 105655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 105698 106342 gene locus_tag LOCUS_15450 105698 106342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 106462 107037 gene locus_tag LOCUS_15460 106462 107037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 108322 107150 gene locus_tag LOCUS_15470 108322 107150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 108521 111976 gene locus_tag LOCUS_15480 108521 111976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 111983 113110 gene locus_tag LOCUS_15490 111983 113110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 113122 114105 gene locus_tag LOCUS_15500 113122 114105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 114160 114741 gene locus_tag LOCUS_15510 114160 114741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 116246 114738 gene locus_tag LOCUS_15520 116246 114738 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021977.1 protein_id gnl|my_center|LOCUS_15520 117512 116289 gene locus_tag LOCUS_15530 117512 116289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 117511 119115 gene locus_tag LOCUS_15540 gene mmdA 117511 119115 CDS product methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879706.1 protein_id gnl|my_center|LOCUS_15540 119290 119442 gene locus_tag LOCUS_15550 119290 119442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 123284 119544 gene locus_tag LOCUS_15560 123284 119544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 123997 123656 gene locus_tag LOCUS_15570 123997 123656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 124308 123994 gene locus_tag LOCUS_15580 124308 123994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 124461 124682 gene locus_tag LOCUS_15590 124461 124682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 125815 124679 gene locus_tag LOCUS_15600 125815 124679 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259270.1 protein_id gnl|my_center|LOCUS_15600 127113 125950 gene locus_tag LOCUS_15610 127113 125950 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_15610 127992 127117 gene locus_tag LOCUS_15620 127992 127117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 128415 128005 gene locus_tag LOCUS_15630 128415 128005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 129351 128518 gene locus_tag LOCUS_15640 129351 128518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 130032 129397 gene locus_tag LOCUS_15650 130032 129397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 130683 130147 gene locus_tag LOCUS_15660 130683 130147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 131728 130799 gene locus_tag LOCUS_15670 131728 130799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 131849 131936 gene locus_tag LOCUS_t00350 131849 131936 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 135202 131975 gene locus_tag LOCUS_15680 135202 131975 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_15680 135557 135393 gene locus_tag LOCUS_15690 135557 135393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 136558 135551 gene locus_tag LOCUS_15700 136558 135551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 136802 137239 gene locus_tag LOCUS_15710 136802 137239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 137419 138354 gene locus_tag LOCUS_15720 137419 138354 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence08 200 622 gene locus_tag LOCUS_15730 200 622 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_15730 687 1580 gene locus_tag LOCUS_15740 687 1580 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458890.1 protein_id gnl|my_center|LOCUS_15740 1588 2418 gene locus_tag LOCUS_15750 1588 2418 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_15750 2438 3238 gene locus_tag LOCUS_15760 2438 3238 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_15760 5306 3318 gene locus_tag LOCUS_15770 5306 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 6055 5468 gene locus_tag LOCUS_15780 6055 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 6220 7524 gene locus_tag LOCUS_15790 gene gabT 6220 7524 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_15790 9500 7536 gene locus_tag LOCUS_15800 gene pcrA 9500 7536 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_15800 10583 9510 gene locus_tag LOCUS_15810 10583 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_15810 11188 10652 gene locus_tag LOCUS_15820 gene raiA 11188 10652 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_15820 11342 12877 gene locus_tag LOCUS_15830 11342 12877 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_15830 12997 13500 gene locus_tag LOCUS_15840 12997 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 13604 15169 gene locus_tag LOCUS_15850 13604 15169 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296689.1 protein_id gnl|my_center|LOCUS_15850 15176 15673 gene locus_tag LOCUS_15860 15176 15673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 15673 16566 gene locus_tag LOCUS_15870 15673 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 16996 16628 gene locus_tag LOCUS_15880 16996 16628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 17127 18077 gene locus_tag LOCUS_15890 17127 18077 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_15890 18089 19000 gene locus_tag LOCUS_15900 18089 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 18997 19908 gene locus_tag LOCUS_15910 18997 19908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_15910 19950 20666 gene locus_tag LOCUS_15920 19950 20666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 20864 22150 gene locus_tag LOCUS_15930 20864 22150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 22277 23518 gene locus_tag LOCUS_15940 22277 23518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 23787 23491 gene locus_tag LOCUS_15950 23787 23491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 25048 23780 gene locus_tag LOCUS_15960 25048 23780 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257569.1 protein_id gnl|my_center|LOCUS_15960 27463 25061 gene locus_tag LOCUS_15970 27463 25061 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_15970 28238 27528 gene locus_tag LOCUS_15980 28238 27528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 30186 28276 gene locus_tag LOCUS_15990 30186 28276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 32383 30254 gene locus_tag LOCUS_16000 32383 30254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 32725 33582 gene locus_tag LOCUS_16010 32725 33582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 33606 33884 gene locus_tag LOCUS_16020 33606 33884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 34505 33939 gene locus_tag LOCUS_16030 34505 33939 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_16030 35580 34549 gene locus_tag LOCUS_16040 35580 34549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 35842 35582 gene locus_tag LOCUS_16050 35842 35582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 36621 35839 gene locus_tag LOCUS_16060 36621 35839 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870446.1 protein_id gnl|my_center|LOCUS_16060 37894 36719 gene locus_tag LOCUS_16070 gene larC 37894 36719 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_16070 38544 37891 gene locus_tag LOCUS_16080 gene larB 38544 37891 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_16080 39328 38513 gene locus_tag LOCUS_16090 gene larE 39328 38513 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_16090 39430 41238 gene locus_tag LOCUS_16100 39430 41238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 41289 41801 gene locus_tag LOCUS_16110 41289 41801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 44013 41779 gene locus_tag LOCUS_16120 44013 41779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 45897 44038 gene locus_tag LOCUS_16130 45897 44038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 47482 46460 gene locus_tag LOCUS_16140 47482 46460 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_16140 48116 47511 gene locus_tag LOCUS_16150 gene recR 48116 47511 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_16150 48555 48223 gene locus_tag LOCUS_16160 48555 48223 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546807.1 protein_id gnl|my_center|LOCUS_16160 50094 48577 gene locus_tag LOCUS_16170 gene dnaX 50094 48577 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081077.1 protein_id gnl|my_center|LOCUS_16170 50173 50099 gene locus_tag LOCUS_t00360 50173 50099 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 50679 50446 gene locus_tag LOCUS_16180 50679 50446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 51624 51121 gene locus_tag LOCUS_16190 51624 51121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 51853 51626 gene locus_tag LOCUS_16200 51853 51626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 52080 52967 gene locus_tag LOCUS_16210 52080 52967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 54238 52910 gene locus_tag LOCUS_16220 54238 52910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065859.1 protein_id gnl|my_center|LOCUS_16220 54927 54235 gene locus_tag LOCUS_16230 54927 54235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023853.1 protein_id gnl|my_center|LOCUS_16230 55717 54929 gene locus_tag LOCUS_16240 55717 54929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 55848 56735 gene locus_tag LOCUS_16250 gene pdxS 55848 56735 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583836.1 protein_id gnl|my_center|LOCUS_16250 57852 56764 gene locus_tag LOCUS_16260 57852 56764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 58077 58646 gene locus_tag LOCUS_16270 gene pdxT 58077 58646 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 protein_id gnl|my_center|LOCUS_16270 58693 59685 gene locus_tag LOCUS_16280 gene gap 58693 59685 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_16280 59682 60074 gene locus_tag LOCUS_16290 59682 60074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 60064 60828 gene locus_tag LOCUS_16300 60064 60828 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_16300 60832 61461 gene locus_tag LOCUS_16310 60832 61461 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_16310 61461 63185 gene locus_tag LOCUS_16320 61461 63185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 63182 64162 gene locus_tag LOCUS_16330 gene rpoD 63182 64162 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280530.1 protein_id gnl|my_center|LOCUS_16330 64152 65060 gene locus_tag LOCUS_16340 gene miaA 64152 65060 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081395.1 protein_id gnl|my_center|LOCUS_16340 66248 65052 gene locus_tag LOCUS_16350 gene coaBC 66248 65052 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911762.1 protein_id gnl|my_center|LOCUS_16350 66407 66928 gene locus_tag LOCUS_16360 gene purE 66407 66928 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_16360 67012 68109 gene locus_tag LOCUS_16370 67012 68109 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 protein_id gnl|my_center|LOCUS_16370 69059 68094 gene locus_tag LOCUS_16380 69059 68094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 70464 69196 gene locus_tag LOCUS_16390 70464 69196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 71182 70679 gene locus_tag LOCUS_16400 71182 70679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 72402 71179 gene locus_tag LOCUS_16410 72402 71179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 73314 72463 gene locus_tag LOCUS_16420 73314 72463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 74981 73395 gene locus_tag LOCUS_16430 74981 73395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 77300 75069 gene locus_tag LOCUS_16440 77300 75069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 78770 77373 gene locus_tag LOCUS_16450 78770 77373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 79843 78824 gene locus_tag LOCUS_16460 79843 78824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 82937 80949 gene locus_tag LOCUS_16470 82937 80949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 83206 83054 gene locus_tag LOCUS_16480 83206 83054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 83694 83404 gene locus_tag LOCUS_16490 83694 83404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 84564 83701 gene locus_tag LOCUS_16500 84564 83701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16500 85232 84825 gene locus_tag LOCUS_16510 85232 84825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 85457 85248 gene locus_tag LOCUS_16520 85457 85248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 87405 85597 gene locus_tag LOCUS_16530 87405 85597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 88538 87543 gene locus_tag LOCUS_16540 88538 87543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 89857 88991 gene locus_tag LOCUS_16550 89857 88991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16550 91066 90026 gene locus_tag LOCUS_16560 91066 90026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 91542 91234 gene locus_tag LOCUS_16570 91542 91234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 93169 91706 gene locus_tag LOCUS_16580 93169 91706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 93553 97167 gene locus_tag LOCUS_16590 93553 97167 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928763.1 protein_id gnl|my_center|LOCUS_16590 97334 97657 gene locus_tag LOCUS_16600 97334 97657 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701976.1 protein_id gnl|my_center|LOCUS_16600 98141 100294 gene locus_tag LOCUS_16610 98141 100294 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_16610 100306 101289 gene locus_tag LOCUS_16620 100306 101289 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350706.1 protein_id gnl|my_center|LOCUS_16620 101335 102081 gene locus_tag LOCUS_16630 101335 102081 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_16630 103030 102029 gene locus_tag LOCUS_16640 103030 102029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 104290 103160 gene locus_tag LOCUS_16650 gene wecB 104290 103160 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546846.1 protein_id gnl|my_center|LOCUS_16650 104411 104869 gene locus_tag LOCUS_16660 104411 104869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 104912 106207 gene locus_tag LOCUS_16670 104912 106207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 106241 107854 gene locus_tag LOCUS_16680 106241 107854 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_16680 108360 108127 gene locus_tag LOCUS_16690 108360 108127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 108465 110207 gene locus_tag LOCUS_16700 108465 110207 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_16700 110311 112410 gene locus_tag LOCUS_16710 110311 112410 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583043.1 protein_id gnl|my_center|LOCUS_16710 113341 112478 gene locus_tag LOCUS_16720 113341 112478 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_16720 113721 113356 gene locus_tag LOCUS_16730 113721 113356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 117581 113718 gene locus_tag LOCUS_16740 117581 113718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16740 118009 117611 gene locus_tag LOCUS_16750 118009 117611 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_16750 118227 118006 gene locus_tag LOCUS_16760 118227 118006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 118944 118408 gene locus_tag LOCUS_16770 118944 118408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 119677 119081 gene locus_tag LOCUS_16780 119677 119081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 120383 119712 gene locus_tag LOCUS_16790 120383 119712 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929702.1 protein_id gnl|my_center|LOCUS_16790 120641 121798 gene locus_tag LOCUS_16800 120641 121798 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173509.1 protein_id gnl|my_center|LOCUS_16800 121804 122766 gene locus_tag LOCUS_16810 121804 122766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_16810 122772 123734 gene locus_tag LOCUS_16820 122772 123734 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258330.1 protein_id gnl|my_center|LOCUS_16820 123922 124626 gene locus_tag LOCUS_16830 123922 124626 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546542.1 protein_id gnl|my_center|LOCUS_16830 125478 124693 gene locus_tag LOCUS_16840 125478 124693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 126175 125747 gene locus_tag LOCUS_16850 126175 125747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 127562 126378 gene locus_tag LOCUS_16860 127562 126378 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390637.1 protein_id gnl|my_center|LOCUS_16860 128808 127567 gene locus_tag LOCUS_16870 128808 127567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 130471 129140 gene locus_tag LOCUS_16880 130471 129140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence09 196 1188 gene locus_tag LOCUS_16890 196 1188 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902294.1 protein_id gnl|my_center|LOCUS_16890 1456 1202 gene locus_tag LOCUS_16900 1456 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 2405 1467 gene locus_tag LOCUS_16910 2405 1467 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902489.1 protein_id gnl|my_center|LOCUS_16910 2505 2720 gene locus_tag LOCUS_16920 2505 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2911 3660 gene locus_tag LOCUS_16930 2911 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 3737 4078 gene locus_tag LOCUS_16940 3737 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4189 5229 gene locus_tag LOCUS_16950 4189 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 5233 6399 gene locus_tag LOCUS_16960 5233 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 6786 6466 gene locus_tag LOCUS_16970 6786 6466 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043905.1 protein_id gnl|my_center|LOCUS_16970 7017 7538 gene locus_tag LOCUS_16980 7017 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 7589 10441 gene locus_tag LOCUS_16990 7589 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 10958 10425 gene locus_tag LOCUS_17000 gene pgsA 10958 10425 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904217.1 protein_id gnl|my_center|LOCUS_17000 11718 10963 gene locus_tag LOCUS_17010 11718 10963 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_17010 12101 11754 gene locus_tag LOCUS_17020 gene rplT 12101 11754 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880587.1 protein_id gnl|my_center|LOCUS_17020 12355 12167 gene locus_tag LOCUS_17030 12355 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 12822 12352 gene locus_tag LOCUS_17040 gene infC 12822 12352 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583670.1 protein_id gnl|my_center|LOCUS_17040 13041 12969 gene locus_tag LOCUS_t00370 13041 12969 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13143 14144 gene locus_tag LOCUS_17050 13143 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 15300 14119 gene locus_tag LOCUS_17060 gene hflX 15300 14119 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_17060 16601 15300 gene locus_tag LOCUS_17070 gene murA 16601 15300 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869686.1 protein_id gnl|my_center|LOCUS_17070 17485 16598 gene locus_tag LOCUS_17080 17485 16598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 18761 17478 gene locus_tag LOCUS_17090 gene rho 18761 17478 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_17090 20211 18922 gene locus_tag LOCUS_17100 20211 18922 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_17100 20649 20215 gene locus_tag LOCUS_17110 gene rpiB 20649 20215 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_17110 21398 20739 gene locus_tag LOCUS_17120 21398 20739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 21398 22312 gene locus_tag LOCUS_17130 gene proC 21398 22312 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_17130 22309 23292 gene locus_tag LOCUS_17140 gene lgt 22309 23292 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 protein_id gnl|my_center|LOCUS_17140 24002 23283 gene locus_tag LOCUS_17150 gene lptB 24002 23283 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938918.1 protein_id gnl|my_center|LOCUS_17150 24547 23999 gene locus_tag LOCUS_17160 24547 23999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 26112 24517 gene locus_tag LOCUS_17170 gene pyrG 26112 24517 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867477.1 protein_id gnl|my_center|LOCUS_17170 26280 26984 gene locus_tag LOCUS_17180 26280 26984 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813002.1 protein_id gnl|my_center|LOCUS_17180 27041 28381 gene locus_tag LOCUS_17190 27041 28381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 28457 28843 gene locus_tag LOCUS_17200 gene gcvH 28457 28843 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_17200 28852 30195 gene locus_tag LOCUS_17210 gene gcvPA 28852 30195 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_17210 30198 31685 gene locus_tag LOCUS_17220 gene gcvPB 30198 31685 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_17220 32148 31753 gene locus_tag LOCUS_17230 32148 31753 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_17230 32393 33547 gene locus_tag LOCUS_17240 32393 33547 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920994.1 protein_id gnl|my_center|LOCUS_17240 33762 34688 gene locus_tag LOCUS_17250 gene pstC 33762 34688 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941759.1 protein_id gnl|my_center|LOCUS_17250 34688 36148 gene locus_tag LOCUS_17260 34688 36148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 36151 36966 gene locus_tag LOCUS_17270 gene pstB 36151 36966 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227814.1 protein_id gnl|my_center|LOCUS_17270 36979 37680 gene locus_tag LOCUS_17280 gene phoU 36979 37680 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892486.1 protein_id gnl|my_center|LOCUS_17280 37664 38476 gene locus_tag LOCUS_17290 37664 38476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 38473 38901 gene locus_tag LOCUS_17300 38473 38901 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880408.1 protein_id gnl|my_center|LOCUS_17300 39891 39058 gene locus_tag LOCUS_17310 39891 39058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 40115 39888 gene locus_tag LOCUS_17320 40115 39888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 40250 44110 gene locus_tag LOCUS_17330 40250 44110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 44460 44107 gene locus_tag LOCUS_17340 44460 44107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 45397 44447 gene locus_tag LOCUS_17350 gene paaA 45397 44447 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191077.1 protein_id gnl|my_center|LOCUS_17350 45572 48136 gene locus_tag LOCUS_17360 45572 48136 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_17360 48248 50335 gene locus_tag LOCUS_17370 48248 50335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 50483 50671 gene locus_tag LOCUS_17380 gene rpmB 50483 50671 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_17380 50671 52473 gene locus_tag LOCUS_17390 gene lepA 50671 52473 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_17390 52563 54962 gene locus_tag LOCUS_17400 52563 54962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 54999 57641 gene locus_tag LOCUS_17410 54999 57641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 57712 58890 gene locus_tag LOCUS_17420 57712 58890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584054.1 protein_id gnl|my_center|LOCUS_17420 58883 60124 gene locus_tag LOCUS_17430 58883 60124 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082547.1 protein_id gnl|my_center|LOCUS_17430 60570 60136 gene locus_tag LOCUS_17440 60570 60136 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876102.1 protein_id gnl|my_center|LOCUS_17440 60985 60563 gene locus_tag LOCUS_17450 60985 60563 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279139.1 protein_id gnl|my_center|LOCUS_17450 62051 61026 gene locus_tag LOCUS_17460 gene trpS 62051 61026 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694505.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence10 172 1158 gene locus_tag LOCUS_17470 172 1158 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258012.1 protein_id gnl|my_center|LOCUS_17470 1155 2312 gene locus_tag LOCUS_17480 1155 2312 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 protein_id gnl|my_center|LOCUS_17480 2518 2309 gene locus_tag LOCUS_17490 2518 2309 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_17490 2777 2505 gene locus_tag LOCUS_17500 2777 2505 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_17500 2914 3690 gene locus_tag LOCUS_17510 2914 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3769 4962 gene locus_tag LOCUS_17520 gene chrA 3769 4962 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174403731.1 protein_id gnl|my_center|LOCUS_17520 5021 6772 gene locus_tag LOCUS_17530 5021 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 6820 7857 gene locus_tag LOCUS_17540 gene mre11 6820 7857 CDS product DNA double-strand break repair protein Mre11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902340.1 protein_id gnl|my_center|LOCUS_17540 7857 10724 gene locus_tag LOCUS_17550 gene rad50 7857 10724 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902341.1 protein_id gnl|my_center|LOCUS_17550 10727 11974 gene locus_tag LOCUS_17560 10727 11974 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020753.1 protein_id gnl|my_center|LOCUS_17560 11971 12486 gene locus_tag LOCUS_17570 11971 12486 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117124.1 protein_id gnl|my_center|LOCUS_17570 12530 13081 gene locus_tag LOCUS_17580 12530 13081 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_17580 13829 13023 gene locus_tag LOCUS_17590 13829 13023 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_17590 14303 13890 gene locus_tag LOCUS_17600 14303 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 14511 14287 gene locus_tag LOCUS_17610 14511 14287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 17804 14664 gene locus_tag LOCUS_17620 17804 14664 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_17620 18139 17792 gene locus_tag LOCUS_17630 18139 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17630 18324 18079 gene locus_tag LOCUS_17640 18324 18079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 19964 18321 gene locus_tag LOCUS_17650 19964 18321 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257684.1 protein_id gnl|my_center|LOCUS_17650 20379 19957 gene locus_tag LOCUS_17660 20379 19957 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957957.1 protein_id gnl|my_center|LOCUS_17660 21990 20404 gene locus_tag LOCUS_17670 21990 20404 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_17670 22895 22197 gene locus_tag LOCUS_17680 22895 22197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 23062 24048 gene locus_tag LOCUS_17690 23062 24048 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_17690 25444 24014 gene locus_tag LOCUS_17700 25444 24014 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932914.1 protein_id gnl|my_center|LOCUS_17700 26844 25546 gene locus_tag LOCUS_17710 26844 25546 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_17710 27929 27036 gene locus_tag LOCUS_17720 27929 27036 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_17720 29113 27926 gene locus_tag LOCUS_17730 29113 27926 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250930.1 protein_id gnl|my_center|LOCUS_17730 30786 29110 gene locus_tag LOCUS_17740 30786 29110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 31395 30802 gene locus_tag LOCUS_17750 31395 30802 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_17750 32039 31707 gene locus_tag LOCUS_17760 32039 31707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 32220 32017 gene locus_tag LOCUS_17770 32220 32017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 33081 32464 gene locus_tag LOCUS_17780 33081 32464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 33244 33453 gene locus_tag LOCUS_17790 33244 33453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 33520 34389 gene locus_tag LOCUS_17800 gene ada 33520 34389 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553740.1 protein_id gnl|my_center|LOCUS_17800 34386 35279 gene locus_tag LOCUS_17810 gene yedA 34386 35279 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168169.1 protein_id gnl|my_center|LOCUS_17810 35856 35650 gene locus_tag LOCUS_17820 35856 35650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 36661 35927 gene locus_tag LOCUS_17830 36661 35927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 36711 37523 gene locus_tag LOCUS_17840 gene fadH 36711 37523 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987267.1 protein_id gnl|my_center|LOCUS_17840 38010 37528 gene locus_tag LOCUS_17850 38010 37528 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_17850 38504 38058 gene locus_tag LOCUS_17860 38504 38058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 40161 38485 gene locus_tag LOCUS_17870 gene yidC 40161 38485 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_17870 41315 40284 gene locus_tag LOCUS_17880 41315 40284 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349826.1 protein_id gnl|my_center|LOCUS_17880 42271 41561 gene locus_tag LOCUS_17890 42271 41561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 43326 42268 gene locus_tag LOCUS_17900 43326 42268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 43476 44330 gene locus_tag LOCUS_17910 gene prmC 43476 44330 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_17910 44343 45041 gene locus_tag LOCUS_17920 44343 45041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 45047 45847 gene locus_tag LOCUS_17930 45047 45847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 46232 45849 gene locus_tag LOCUS_17940 46232 45849 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932868.1 protein_id gnl|my_center|LOCUS_17940 47027 46278 gene locus_tag LOCUS_17950 47027 46278 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081476.1 protein_id gnl|my_center|LOCUS_17950 47813 47049 gene locus_tag LOCUS_17960 gene udp 47813 47049 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045178.1 protein_id gnl|my_center|LOCUS_17960 48578 47835 gene locus_tag LOCUS_17970 48578 47835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 50026 48575 gene locus_tag LOCUS_17980 50026 48575 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256694.1 protein_id gnl|my_center|LOCUS_17980 50215 50580 gene locus_tag LOCUS_17990 50215 50580 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036180.1 protein_id gnl|my_center|LOCUS_17990 50577 50903 gene locus_tag LOCUS_18000 50577 50903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 50908 51465 gene locus_tag LOCUS_18010 50908 51465 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 protein_id gnl|my_center|LOCUS_18010 51458 53464 gene locus_tag LOCUS_18020 51458 53464 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_18020 53611 53766 gene locus_tag LOCUS_18030 53611 53766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence11 1033 521 gene locus_tag LOCUS_18040 1033 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1906 1604 gene locus_tag LOCUS_18050 1906 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 2655 1879 gene locus_tag LOCUS_18060 2655 1879 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870446.1 protein_id gnl|my_center|LOCUS_18060 3491 2904 gene locus_tag LOCUS_18070 3491 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4021 3488 gene locus_tag LOCUS_18080 4021 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 4516 4031 gene locus_tag LOCUS_18090 4516 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4658 5074 gene locus_tag LOCUS_18100 4658 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 5077 7182 gene locus_tag LOCUS_18110 5077 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 7179 7562 gene locus_tag LOCUS_18120 7179 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 7559 7816 gene locus_tag LOCUS_18130 7559 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 9329 9637 gene locus_tag LOCUS_18140 9329 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 10375 9650 gene locus_tag LOCUS_18150 10375 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 10822 12066 gene locus_tag LOCUS_18160 10822 12066 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980245.1 protein_id gnl|my_center|LOCUS_18160 12150 12419 gene locus_tag LOCUS_18170 12150 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 12434 12865 gene locus_tag LOCUS_18180 12434 12865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 13322 12960 gene locus_tag LOCUS_18190 13322 12960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 13579 13334 gene locus_tag LOCUS_18200 13579 13334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 14166 13777 gene locus_tag LOCUS_18210 14166 13777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 14316 14444 gene locus_tag LOCUS_18220 14316 14444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 14781 14578 gene locus_tag LOCUS_18230 14781 14578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 15473 14772 gene locus_tag LOCUS_18240 15473 14772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 16364 15549 gene locus_tag LOCUS_18250 16364 15549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 16946 16377 gene locus_tag LOCUS_18260 16946 16377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 17091 16867 gene locus_tag LOCUS_18270 17091 16867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 19201 17141 gene locus_tag LOCUS_18280 19201 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 19745 19167 gene locus_tag LOCUS_18290 19745 19167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 19948 20145 gene locus_tag LOCUS_18300 19948 20145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 21749 20364 gene locus_tag LOCUS_18310 21749 20364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 21823 21993 gene locus_tag LOCUS_18320 21823 21993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 22490 22002 gene locus_tag LOCUS_18330 22490 22002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 23557 22514 gene locus_tag LOCUS_18340 23557 22514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 24004 24270 gene locus_tag LOCUS_18350 24004 24270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 24275 24775 gene locus_tag LOCUS_18360 24275 24775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 25222 24890 gene locus_tag LOCUS_18370 25222 24890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 25103 25531 gene locus_tag LOCUS_18380 25103 25531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 25659 25856 gene locus_tag LOCUS_18390 25659 25856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 25892 26074 gene locus_tag LOCUS_18400 25892 26074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 26071 26235 gene locus_tag LOCUS_18410 26071 26235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18410 34029 26596 gene locus_tag LOCUS_18420 34029 26596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 34936 34388 gene locus_tag LOCUS_18430 34936 34388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18430 35178 34930 gene locus_tag LOCUS_18440 35178 34930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 35255 35452 gene locus_tag LOCUS_18450 35255 35452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 35440 36126 gene locus_tag LOCUS_18460 35440 36126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 36719 36213 gene locus_tag LOCUS_18470 36719 36213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18470 37204 36707 gene locus_tag LOCUS_18480 37204 36707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 37824 37600 gene locus_tag LOCUS_18490 37824 37600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 38087 37821 gene locus_tag LOCUS_18500 38087 37821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 38549 38307 gene locus_tag LOCUS_18510 38549 38307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 38754 39212 gene locus_tag LOCUS_18520 38754 39212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 39218 39406 gene locus_tag LOCUS_18530 39218 39406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 40267 39599 gene locus_tag LOCUS_18540 40267 39599 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_18540 40765 40406 gene locus_tag LOCUS_18550 40765 40406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 41609 40887 gene locus_tag LOCUS_18560 41609 40887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 41705 41938 gene locus_tag LOCUS_18570 41705 41938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 42415 42260 gene locus_tag LOCUS_18580 42415 42260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 42624 42412 gene locus_tag LOCUS_18590 42624 42412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 44112 42883 gene locus_tag LOCUS_18600 gene dinB 44112 42883 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_18600 44388 44116 gene locus_tag LOCUS_18610 44388 44116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 44981 44388 gene locus_tag LOCUS_18620 gene lexA 44981 44388 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_18620 45144 45446 gene locus_tag LOCUS_18630 45144 45446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 45447 46052 gene locus_tag LOCUS_18640 45447 46052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 46119 46349 gene locus_tag LOCUS_18650 46119 46349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 48578 48787 gene locus_tag LOCUS_18660 48578 48787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 49258 49596 gene locus_tag LOCUS_18670 49258 49596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 49997 49608 gene locus_tag LOCUS_18680 49997 49608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 50635 50183 gene locus_tag LOCUS_18690 50635 50183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence12 1284 127 gene locus_tag LOCUS_18700 1284 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2450 1362 gene locus_tag LOCUS_18710 gene ychF 2450 1362 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_18710 3136 2453 gene locus_tag LOCUS_18720 3136 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 3470 3559 gene locus_tag LOCUS_t00380 3470 3559 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3843 5051 gene locus_tag LOCUS_18730 3843 5051 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358889.1 protein_id gnl|my_center|LOCUS_18730 5061 6626 gene locus_tag LOCUS_18740 5061 6626 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_18740 6670 7434 gene locus_tag LOCUS_18750 gene cas6 6670 7434 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082360.1 protein_id gnl|my_center|LOCUS_18750 7449 9203 gene locus_tag LOCUS_18760 7449 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 9227 10342 gene locus_tag LOCUS_18770 gene cas7i 9227 10342 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258799.1 protein_id gnl|my_center|LOCUS_18770 10339 11016 gene locus_tag LOCUS_18780 10339 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 11030 13282 gene locus_tag LOCUS_18790 11030 13282 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065767.1 protein_id gnl|my_center|LOCUS_18790 13501 13728 gene locus_tag LOCUS_18800 13501 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 13841 14344 gene locus_tag LOCUS_18810 gene cas4 13841 14344 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879923.1 protein_id gnl|my_center|LOCUS_18810 14354 15361 gene locus_tag LOCUS_18820 gene cas1b 14354 15361 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545291.1 protein_id gnl|my_center|LOCUS_18820 15446 15676 gene locus_tag LOCUS_18830 15446 15676 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631141.1 protein_id gnl|my_center|LOCUS_18830 15673 16149 gene locus_tag LOCUS_18840 15673 16149 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037032.1 protein_id gnl|my_center|LOCUS_18840 16146 16415 gene locus_tag LOCUS_18850 gene cas2 16146 16415 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064580.1 protein_id gnl|my_center|LOCUS_18850 16514 16666 gene locus_tag LOCUS_18860 16514 16666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 16720 18100 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttaattggaccagagtggtattgaaac 19539 18643 gene locus_tag LOCUS_18870 19539 18643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 20852 19536 gene locus_tag LOCUS_18880 20852 19536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 22017 20905 gene locus_tag LOCUS_18890 22017 20905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 22923 22057 gene locus_tag LOCUS_18900 22923 22057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 24893 22941 gene locus_tag LOCUS_18910 24893 22941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 25107 26057 gene locus_tag LOCUS_18920 gene trxB 25107 26057 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_18920 26080 27693 gene locus_tag LOCUS_18930 26080 27693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 27730 28368 gene locus_tag LOCUS_18940 27730 28368 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925379.1 protein_id gnl|my_center|LOCUS_18940 28337 28819 gene locus_tag LOCUS_18950 28337 28819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 29577 28840 gene locus_tag LOCUS_18960 gene fabG 29577 28840 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_18960 29756 31390 gene locus_tag LOCUS_18970 29756 31390 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868685.1 protein_id gnl|my_center|LOCUS_18970 31472 31398 gene locus_tag LOCUS_t00390 31472 31398 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 31924 31484 gene locus_tag LOCUS_18980 31924 31484 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022482.1 protein_id gnl|my_center|LOCUS_18980 32717 31950 gene locus_tag LOCUS_18990 32717 31950 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_18990 33423 32767 gene locus_tag LOCUS_19000 33423 32767 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228681.1 protein_id gnl|my_center|LOCUS_19000 34817 33567 gene locus_tag LOCUS_19010 34817 33567 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806995.1 protein_id gnl|my_center|LOCUS_19010 35067 38390 gene locus_tag LOCUS_19020 35067 38390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 38416 39597 gene locus_tag LOCUS_19030 38416 39597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 39714 39908 gene locus_tag LOCUS_19040 39714 39908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 39937 41037 gene locus_tag LOCUS_19050 39937 41037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 41262 42074 gene locus_tag LOCUS_19060 41262 42074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 43263 42121 gene locus_tag LOCUS_19070 43263 42121 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_19070 47468 43287 gene locus_tag LOCUS_19080 47468 43287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 48356 47496 gene locus_tag LOCUS_19090 48356 47496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 49057 48359 gene locus_tag LOCUS_19100 49057 48359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 49575 49054 gene locus_tag LOCUS_19110 49575 49054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 50119 49562 gene locus_tag LOCUS_19120 50119 49562 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence13 338 1072 gene locus_tag LOCUS_19130 338 1072 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_19130 1060 1641 gene locus_tag LOCUS_19140 gene rsmD 1060 1641 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_19140 1719 2057 gene locus_tag LOCUS_19150 1719 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2059 2808 gene locus_tag LOCUS_19160 2059 2808 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858053.1 protein_id gnl|my_center|LOCUS_19160 4286 2859 gene locus_tag LOCUS_19170 4286 2859 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_19170 4668 4318 gene locus_tag LOCUS_19180 4668 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 4579 4788 gene locus_tag LOCUS_19190 4579 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 4890 5831 gene locus_tag LOCUS_19200 4890 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5965 6927 gene locus_tag LOCUS_19210 5965 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 7389 7093 gene locus_tag LOCUS_19220 7389 7093 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390183.1 protein_id gnl|my_center|LOCUS_19220 7683 7405 gene locus_tag LOCUS_19230 7683 7405 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626377.1 protein_id gnl|my_center|LOCUS_19230 8614 7820 gene locus_tag LOCUS_19240 8614 7820 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886850.1 protein_id gnl|my_center|LOCUS_19240 9413 8616 gene locus_tag LOCUS_19250 9413 8616 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161617863.1 protein_id gnl|my_center|LOCUS_19250 9922 9413 gene locus_tag LOCUS_19260 9922 9413 CDS product DUF2299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877022.1 protein_id gnl|my_center|LOCUS_19260 9967 10512 gene locus_tag LOCUS_19270 9967 10512 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494663.1 protein_id gnl|my_center|LOCUS_19270 10627 10833 gene locus_tag LOCUS_19280 10627 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 11863 11216 gene locus_tag LOCUS_19290 11863 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 12995 12069 gene locus_tag LOCUS_19300 12995 12069 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081440.1 protein_id gnl|my_center|LOCUS_19300 14131 12992 gene locus_tag LOCUS_19310 14131 12992 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081437.1 protein_id gnl|my_center|LOCUS_19310 16245 14200 gene locus_tag LOCUS_19320 16245 14200 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081506.1 protein_id gnl|my_center|LOCUS_19320 17938 16390 gene locus_tag LOCUS_r00030 17938 16390 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 18160 18831 gene locus_tag LOCUS_19330 18160 18831 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 protein_id gnl|my_center|LOCUS_19330 18941 19252 gene locus_tag LOCUS_19340 18941 19252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 19419 19345 gene locus_tag LOCUS_t00400 19419 19345 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 19511 19437 gene locus_tag LOCUS_t00410 19511 19437 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 19640 21019 gene locus_tag LOCUS_19350 19640 21019 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_19350 21019 21300 gene locus_tag LOCUS_19360 21019 21300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 21352 22854 gene locus_tag LOCUS_19370 21352 22854 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_19370 25456 23039 gene locus_tag LOCUS_19380 gene ppsA 25456 23039 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_19380 25733 26266 gene locus_tag LOCUS_19390 25733 26266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 26336 27058 gene locus_tag LOCUS_19400 26336 27058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 28256 27114 gene locus_tag LOCUS_19410 28256 27114 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 protein_id gnl|my_center|LOCUS_19410 29835 28441 gene locus_tag LOCUS_19420 29835 28441 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_19420 30128 29835 gene locus_tag LOCUS_19430 30128 29835 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_19430 31225 30125 gene locus_tag LOCUS_19440 31225 30125 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_19440 32010 31387 gene locus_tag LOCUS_19450 32010 31387 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081900.1 protein_id gnl|my_center|LOCUS_19450 32900 32007 gene locus_tag LOCUS_19460 gene menA 32900 32007 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_19460 33283 32897 gene locus_tag LOCUS_19470 33283 32897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 33394 33999 gene locus_tag LOCUS_19480 33394 33999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 33990 35750 gene locus_tag LOCUS_19490 gene argS 33990 35750 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403746.1 protein_id gnl|my_center|LOCUS_19490 35766 36683 gene locus_tag LOCUS_19500 gene ftsY 35766 36683 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546073.1 protein_id gnl|my_center|LOCUS_19500 36680 38227 gene locus_tag LOCUS_19510 36680 38227 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_19510 38255 38437 gene locus_tag LOCUS_19520 38255 38437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 38559 39356 gene locus_tag LOCUS_19530 38559 39356 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_19530 39353 40231 gene locus_tag LOCUS_19540 39353 40231 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_19540 40307 40951 gene locus_tag LOCUS_19550 gene fsa 40307 40951 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_19550 41106 42035 gene locus_tag LOCUS_19560 41106 42035 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_19560 42556 45798 gene locus_tag LOCUS_19570 42556 45798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 45877 46812 gene locus_tag LOCUS_19580 45877 46812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence14 279 352 gene locus_tag LOCUS_t00420 279 352 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 354 815 gene locus_tag LOCUS_19590 354 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 832 1365 gene locus_tag LOCUS_19600 832 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1392 2984 gene locus_tag LOCUS_19610 1392 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 3643 2957 gene locus_tag LOCUS_19620 gene ubiE 3643 2957 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_19620 4001 3645 gene locus_tag LOCUS_19630 4001 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 5526 4006 gene locus_tag LOCUS_19640 gene gpmI 5526 4006 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022631.1 protein_id gnl|my_center|LOCUS_19640 5596 6066 gene locus_tag LOCUS_19650 gene dtd 5596 6066 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941193.1 protein_id gnl|my_center|LOCUS_19650 6114 6326 gene locus_tag LOCUS_19660 gene rpmF 6114 6326 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_19660 6331 6651 gene locus_tag LOCUS_19670 6331 6651 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 protein_id gnl|my_center|LOCUS_19670 6699 6773 gene locus_tag LOCUS_t00430 6699 6773 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6837 7769 gene locus_tag LOCUS_19680 gene xerC 6837 7769 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141123.1 protein_id gnl|my_center|LOCUS_19680 8807 8220 gene locus_tag LOCUS_19690 8807 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 9779 9297 gene locus_tag LOCUS_19700 9779 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 10168 9776 gene locus_tag LOCUS_19710 10168 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 10592 10353 gene locus_tag LOCUS_19720 10592 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 10751 11140 gene locus_tag LOCUS_19730 10751 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 11292 11366 gene locus_tag LOCUS_t00440 11292 11366 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11449 13587 gene locus_tag LOCUS_19740 11449 13587 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_19740 15086 13584 gene locus_tag LOCUS_19750 gene nadB 15086 13584 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257285.1 protein_id gnl|my_center|LOCUS_19750 15207 16289 gene locus_tag LOCUS_19760 gene prfA 15207 16289 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880532.1 protein_id gnl|my_center|LOCUS_19760 16407 17312 gene locus_tag LOCUS_19770 gene accD 16407 17312 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583742.1 protein_id gnl|my_center|LOCUS_19770 17309 18283 gene locus_tag LOCUS_19780 17309 18283 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_19780 18322 19050 gene locus_tag LOCUS_19790 18322 19050 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855810.1 protein_id gnl|my_center|LOCUS_19790 20363 19074 gene locus_tag LOCUS_19800 20363 19074 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460968.1 protein_id gnl|my_center|LOCUS_19800 22216 20456 gene locus_tag LOCUS_19810 gene mutL 22216 20456 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090225.1 protein_id gnl|my_center|LOCUS_19810 22260 22790 gene locus_tag LOCUS_19820 22260 22790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 24631 22787 gene locus_tag LOCUS_19830 24631 22787 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903956.1 protein_id gnl|my_center|LOCUS_19830 25064 24624 gene locus_tag LOCUS_19840 25064 24624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 26568 25135 gene locus_tag LOCUS_19850 gene gatA 26568 25135 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_19850 26666 26582 gene locus_tag LOCUS_t00450 26666 26582 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28238 26775 gene locus_tag LOCUS_19860 28238 26775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 28333 28800 gene locus_tag LOCUS_19870 28333 28800 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_19870 28794 30869 gene locus_tag LOCUS_19880 28794 30869 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_19880 31239 30829 gene locus_tag LOCUS_19890 31239 30829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 31363 31438 gene locus_tag LOCUS_t00460 31363 31438 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 31673 31449 gene locus_tag LOCUS_19900 31673 31449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 32658 31804 gene locus_tag LOCUS_19910 32658 31804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence15 1458 217 gene locus_tag LOCUS_19920 1458 217 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_19920 2143 1475 gene locus_tag LOCUS_19930 2143 1475 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493859.1 protein_id gnl|my_center|LOCUS_19930 2256 2822 gene locus_tag LOCUS_19940 2256 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2819 3577 gene locus_tag LOCUS_19950 2819 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 3579 5015 gene locus_tag LOCUS_19960 gene rsxC 3579 5015 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082948.1 protein_id gnl|my_center|LOCUS_19960 5015 6172 gene locus_tag LOCUS_19970 5015 6172 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082949.1 protein_id gnl|my_center|LOCUS_19970 6174 6875 gene locus_tag LOCUS_19980 6174 6875 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_19980 6961 7659 gene locus_tag LOCUS_19990 6961 7659 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761246.1 protein_id gnl|my_center|LOCUS_19990 7663 8262 gene locus_tag LOCUS_20000 gene rsxA 7663 8262 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_20000 8275 8916 gene locus_tag LOCUS_20010 8275 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 8940 9992 gene locus_tag LOCUS_20020 8940 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 11367 9976 gene locus_tag LOCUS_20030 11367 9976 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_20030 12275 11373 gene locus_tag LOCUS_20040 12275 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 13062 12325 gene locus_tag LOCUS_20050 13062 12325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 14354 13110 gene locus_tag LOCUS_20060 14354 13110 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890369.1 protein_id gnl|my_center|LOCUS_20060 14772 14347 gene locus_tag LOCUS_20070 14772 14347 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029036.1 protein_id gnl|my_center|LOCUS_20070 15491 14823 gene locus_tag LOCUS_20080 15491 14823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_20080 16840 15581 gene locus_tag LOCUS_20090 16840 15581 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259268.1 protein_id gnl|my_center|LOCUS_20090 17563 16877 gene locus_tag LOCUS_20100 gene lepB 17563 16877 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_20100 18007 17672 gene locus_tag LOCUS_20110 gene rplS 18007 17672 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_20110 18570 18004 gene locus_tag LOCUS_20120 18570 18004 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813203.1 protein_id gnl|my_center|LOCUS_20120 19298 18603 gene locus_tag LOCUS_20130 gene trmD 19298 18603 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_20130 19643 19305 gene locus_tag LOCUS_20140 19643 19305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 19915 19640 gene locus_tag LOCUS_20150 gene rpsP 19915 19640 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564756.1 protein_id gnl|my_center|LOCUS_20150 21240 19942 gene locus_tag LOCUS_20160 gene ffh 21240 19942 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081977.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence16 296 30 gene locus_tag LOCUS_20170 296 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 391 316 gene locus_tag LOCUS_t00470 391 316 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1659 730 gene locus_tag LOCUS_20180 1659 730 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031688.1 protein_id gnl|my_center|LOCUS_20180 2224 2024 gene locus_tag LOCUS_20190 2224 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530089.1 protein_id gnl|my_center|LOCUS_20190 3451 2399 gene locus_tag LOCUS_20200 gene asd 3451 2399 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_20200 3901 3482 gene locus_tag LOCUS_20210 gene ndk 3901 3482 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_20210 5120 3969 gene locus_tag LOCUS_20220 gene dprA 5120 3969 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_20220 6579 5095 gene locus_tag LOCUS_20230 6579 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 6662 6588 gene locus_tag LOCUS_t00480 6662 6588 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6783 7709 gene locus_tag LOCUS_20240 6783 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence17 <1 592 gene locus_tag LOCUS_20250 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066190.1:PGF-pre-PGF domain-containing protein 776 1021 gene locus_tag LOCUS_20260 776 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 1018 1395 gene locus_tag LOCUS_20270 1018 1395 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200901620.1 protein_id gnl|my_center|LOCUS_20270 1455 1586 gene locus_tag LOCUS_20280 1455 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1689 2252 gene locus_tag LOCUS_20290 1689 2252 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880755.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence18 277 480 gene locus_tag LOCUS_20300 277 480 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463371.1 protein_id gnl|my_center|LOCUS_20300 591 2309 gene locus_tag LOCUS_20310 gene arc 591 2309 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_20310 2336 2644 gene locus_tag LOCUS_20320 2336 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2632 2985 gene locus_tag LOCUS_20330 2632 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 3425 2979 gene locus_tag LOCUS_20340 gene ribH 3425 2979 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101407.1 protein_id gnl|my_center|LOCUS_20340