>Feature sequence1 742 1821 gene locus_tag LOCUS_00010 742 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1818 2420 gene locus_tag LOCUS_00020 1818 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2613 2822 gene locus_tag LOCUS_00030 2613 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2826 5345 gene locus_tag LOCUS_00040 2826 5345 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935282.1 protein_id gnl|my_center|LOCUS_00040 5338 6063 gene locus_tag LOCUS_00050 5338 6063 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902581.1 protein_id gnl|my_center|LOCUS_00050 6060 7253 gene locus_tag LOCUS_00060 gene nrfD 6060 7253 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272584.1 protein_id gnl|my_center|LOCUS_00060 7315 8229 gene locus_tag LOCUS_00070 7315 8229 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392998.1 protein_id gnl|my_center|LOCUS_00070 8241 8579 gene locus_tag LOCUS_00080 gene glnB 8241 8579 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414756.1 protein_id gnl|my_center|LOCUS_00080 8580 11069 gene locus_tag LOCUS_00090 gene glnD 8580 11069 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938529.1 protein_id gnl|my_center|LOCUS_00090 11809 11066 gene locus_tag LOCUS_00100 11809 11066 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_00100 11831 12493 gene locus_tag LOCUS_00110 11831 12493 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_00110 12493 12765 gene locus_tag LOCUS_00120 12493 12765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_00120 12821 13177 gene locus_tag LOCUS_00130 12821 13177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13174 13881 gene locus_tag LOCUS_00140 gene cobC 13174 13881 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_00140 13878 14258 gene locus_tag LOCUS_00150 13878 14258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14423 15511 gene locus_tag LOCUS_00160 14423 15511 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_00160 15526 17064 gene locus_tag LOCUS_00170 15526 17064 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865052.1 protein_id gnl|my_center|LOCUS_00170 17061 18239 gene locus_tag LOCUS_00180 17061 18239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583515.1 protein_id gnl|my_center|LOCUS_00180 18241 19209 gene locus_tag LOCUS_00190 18241 19209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289200.1 protein_id gnl|my_center|LOCUS_00190 19451 19215 gene locus_tag LOCUS_00200 19451 19215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00200 20104 21144 gene locus_tag LOCUS_00210 gene aroF 20104 21144 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_00210 21996 21145 gene locus_tag LOCUS_00220 21996 21145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23126 21975 gene locus_tag LOCUS_00230 23126 21975 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_00230 23161 23589 gene locus_tag LOCUS_00240 23161 23589 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899923.1 protein_id gnl|my_center|LOCUS_00240 25105 25467 gene locus_tag LOCUS_00250 25105 25467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00250 25853 26869 gene locus_tag LOCUS_00260 25853 26869 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_00260 27393 29732 gene locus_tag LOCUS_00270 27393 29732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00270 31368 29722 gene locus_tag LOCUS_00280 31368 29722 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384516.1 protein_id gnl|my_center|LOCUS_00280 31441 31515 gene locus_tag LOCUS_t00010 31441 31515 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 32417 31503 gene locus_tag LOCUS_00290 32417 31503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32476 33834 gene locus_tag LOCUS_00300 32476 33834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33917 34351 gene locus_tag LOCUS_00310 33917 34351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34356 35123 gene locus_tag LOCUS_00320 gene pcaD 34356 35123 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_00320 35116 36033 gene locus_tag LOCUS_00330 35116 36033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38051 36042 gene locus_tag LOCUS_00340 gene ftsH 38051 36042 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_00340 38107 38712 gene locus_tag LOCUS_00350 38107 38712 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046255947.1 protein_id gnl|my_center|LOCUS_00350 38699 38956 gene locus_tag LOCUS_00360 38699 38956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38962 39690 gene locus_tag LOCUS_00370 gene mshB 38962 39690 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_00370 39690 40859 gene locus_tag LOCUS_00380 39690 40859 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_00380 40856 41596 gene locus_tag LOCUS_00390 40856 41596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41606 42265 gene locus_tag LOCUS_00400 gene nth 41606 42265 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583053.1 protein_id gnl|my_center|LOCUS_00400 42572 42270 gene locus_tag LOCUS_00410 42572 42270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 42678 43097 gene locus_tag LOCUS_00420 42678 43097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 43111 43791 gene locus_tag LOCUS_00430 43111 43791 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111006.1 protein_id gnl|my_center|LOCUS_00430 43795 44586 gene locus_tag LOCUS_00440 43795 44586 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_00440 44562 46526 gene locus_tag LOCUS_00450 44562 46526 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_00450 47285 46542 gene locus_tag LOCUS_00460 47285 46542 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113785.1 protein_id gnl|my_center|LOCUS_00460 47358 47795 gene locus_tag LOCUS_00470 47358 47795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 47842 48135 gene locus_tag LOCUS_00480 47842 48135 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973656.1 protein_id gnl|my_center|LOCUS_00480 48122 50734 gene locus_tag LOCUS_00490 48122 50734 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528150.1 protein_id gnl|my_center|LOCUS_00490 50727 51170 gene locus_tag LOCUS_00500 50727 51170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 51167 52378 gene locus_tag LOCUS_00510 51167 52378 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267522.1 protein_id gnl|my_center|LOCUS_00510 53501 52395 gene locus_tag LOCUS_00520 gene solA 53501 52395 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_00520 53382 54035 gene locus_tag LOCUS_00530 53382 54035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 54096 54809 gene locus_tag LOCUS_00540 54096 54809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 55221 54841 gene locus_tag LOCUS_00550 55221 54841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 56813 55218 gene locus_tag LOCUS_00560 gene ctaD 56813 55218 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229476.1 protein_id gnl|my_center|LOCUS_00560 57535 56810 gene locus_tag LOCUS_00570 57535 56810 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466782.1 protein_id gnl|my_center|LOCUS_00570 58920 57532 gene locus_tag LOCUS_00580 58920 57532 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110998.1 protein_id gnl|my_center|LOCUS_00580 59750 58917 gene locus_tag LOCUS_00590 59750 58917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 60514 59747 gene locus_tag LOCUS_00600 60514 59747 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_00600 61080 60514 gene locus_tag LOCUS_00610 61080 60514 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729685.1 protein_id gnl|my_center|LOCUS_00610 61205 62017 gene locus_tag LOCUS_00620 61205 62017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 62529 62014 gene locus_tag LOCUS_00630 gene pyrE 62529 62014 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868222.1 protein_id gnl|my_center|LOCUS_00630 62562 63545 gene locus_tag LOCUS_00640 62562 63545 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 protein_id gnl|my_center|LOCUS_00640 63612 64739 gene locus_tag LOCUS_00650 63612 64739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286312.1 protein_id gnl|my_center|LOCUS_00650 64754 65980 gene locus_tag LOCUS_00660 64754 65980 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969813.1 protein_id gnl|my_center|LOCUS_00660 66053 66997 gene locus_tag LOCUS_00670 66053 66997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210183137.1 protein_id gnl|my_center|LOCUS_00670 66994 67800 gene locus_tag LOCUS_00680 66994 67800 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397078.1 protein_id gnl|my_center|LOCUS_00680 68344 67847 gene locus_tag LOCUS_00690 68344 67847 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084031.1 protein_id gnl|my_center|LOCUS_00690 69707 68370 gene locus_tag LOCUS_00700 69707 68370 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805011.1 protein_id gnl|my_center|LOCUS_00700 70372 69728 gene locus_tag LOCUS_00710 gene pdxH 70372 69728 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_00710 70701 70471 gene locus_tag LOCUS_00720 70701 70471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 70825 71712 gene locus_tag LOCUS_00730 70825 71712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 72694 71732 gene locus_tag LOCUS_00740 72694 71732 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_00740 72794 73600 gene locus_tag LOCUS_00750 72794 73600 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229251.1 protein_id gnl|my_center|LOCUS_00750 74361 73597 gene locus_tag LOCUS_00760 gene heR 74361 73597 CDS product heliorhodopsin HeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296133.1 protein_id gnl|my_center|LOCUS_00760 75271 74390 gene locus_tag LOCUS_00770 75271 74390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 76340 75420 gene locus_tag LOCUS_00780 76340 75420 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776450.1 protein_id gnl|my_center|LOCUS_00780 77529 76330 gene locus_tag LOCUS_00790 77529 76330 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836479.1 protein_id gnl|my_center|LOCUS_00790 78696 77785 gene locus_tag LOCUS_00800 78696 77785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 79569 79033 gene locus_tag LOCUS_00810 79569 79033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 79872 79801 gene locus_tag LOCUS_t00020 79872 79801 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 79934 80182 gene locus_tag LOCUS_00820 79934 80182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00820 80304 81977 gene locus_tag LOCUS_00830 gene argS 80304 81977 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_00830 81970 83841 gene locus_tag LOCUS_00840 81970 83841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 83838 85130 gene locus_tag LOCUS_00850 83838 85130 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_00850 85127 86206 gene locus_tag LOCUS_00860 gene thrC 85127 86206 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_00860 86228 87094 gene locus_tag LOCUS_00870 gene thrB 86228 87094 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775957.1 protein_id gnl|my_center|LOCUS_00870 88249 87104 gene locus_tag LOCUS_00880 gene marP 88249 87104 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083527.1 protein_id gnl|my_center|LOCUS_00880 88326 89111 gene locus_tag LOCUS_00890 88326 89111 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225354.1 protein_id gnl|my_center|LOCUS_00890 89147 89935 gene locus_tag LOCUS_00900 89147 89935 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990915.1 protein_id gnl|my_center|LOCUS_00900 89997 91328 gene locus_tag LOCUS_00910 89997 91328 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060774.1 protein_id gnl|my_center|LOCUS_00910 91334 92314 gene locus_tag LOCUS_00920 91334 92314 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877485.1 protein_id gnl|my_center|LOCUS_00920 92311 92982 gene locus_tag LOCUS_00930 gene fsa 92311 92982 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_00930 92979 94598 gene locus_tag LOCUS_00940 92979 94598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 94631 94855 gene locus_tag LOCUS_00950 gene rpmE 94631 94855 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_00950 94861 95763 gene locus_tag LOCUS_00960 94861 95763 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_00960 95844 96614 gene locus_tag LOCUS_00970 95844 96614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 96699 97787 gene locus_tag LOCUS_00980 gene prfA 96699 97787 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_00980 97784 98620 gene locus_tag LOCUS_00990 gene prmC 97784 98620 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730206.1 protein_id gnl|my_center|LOCUS_00990 98617 99249 gene locus_tag LOCUS_01000 98617 99249 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084624.1 protein_id gnl|my_center|LOCUS_01000 99246 99839 gene locus_tag LOCUS_01010 99246 99839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 99840 100289 gene locus_tag LOCUS_01020 gene rpiB 99840 100289 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_01020 100286 101551 gene locus_tag LOCUS_01030 100286 101551 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_01030 101560 102693 gene locus_tag LOCUS_01040 101560 102693 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229530.1 protein_id gnl|my_center|LOCUS_01040 102836 103963 gene locus_tag LOCUS_01050 102836 103963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973357.1 protein_id gnl|my_center|LOCUS_01050 103960 105261 gene locus_tag LOCUS_01060 103960 105261 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030369.1 protein_id gnl|my_center|LOCUS_01060 105272 106234 gene locus_tag LOCUS_01070 105272 106234 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_01070 106231 107100 gene locus_tag LOCUS_01080 106231 107100 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894682.1 protein_id gnl|my_center|LOCUS_01080 107207 107428 gene locus_tag LOCUS_01090 107207 107428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 107439 107864 gene locus_tag LOCUS_01100 107439 107864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 107861 108685 gene locus_tag LOCUS_01110 gene atpB 107861 108685 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_01110 108704 108952 gene locus_tag LOCUS_01120 108704 108952 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 protein_id gnl|my_center|LOCUS_01120 108963 109535 gene locus_tag LOCUS_01130 108963 109535 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_01130 109535 110098 gene locus_tag LOCUS_01140 109535 110098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 110102 111748 gene locus_tag LOCUS_01150 gene atpA 110102 111748 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896330.1 protein_id gnl|my_center|LOCUS_01150 111752 112648 gene locus_tag LOCUS_01160 111752 112648 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896329.1 protein_id gnl|my_center|LOCUS_01160 112652 114076 gene locus_tag LOCUS_01170 gene atpD 112652 114076 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120484.1 protein_id gnl|my_center|LOCUS_01170 114073 114489 gene locus_tag LOCUS_01180 114073 114489 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_01180 114525 115814 gene locus_tag LOCUS_01190 gene murA 114525 115814 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 protein_id gnl|my_center|LOCUS_01190 115931 116650 gene locus_tag LOCUS_01200 115931 116650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 116655 117074 gene locus_tag LOCUS_01210 116655 117074 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172491.1 protein_id gnl|my_center|LOCUS_01210 117078 118115 gene locus_tag LOCUS_01220 117078 118115 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242620.1 protein_id gnl|my_center|LOCUS_01220 118116 118505 gene locus_tag LOCUS_01230 118116 118505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 118535 119485 gene locus_tag LOCUS_01240 gene meaB 118535 119485 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223478.1 protein_id gnl|my_center|LOCUS_01240 119594 120286 gene locus_tag LOCUS_01250 119594 120286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01250 120291 120668 gene locus_tag LOCUS_01260 120291 120668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01260 120665 121432 gene locus_tag LOCUS_01270 gene cbiQ 120665 121432 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_01270 121429 122217 gene locus_tag LOCUS_01280 121429 122217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_01280 122617 122156 gene locus_tag LOCUS_01290 122617 122156 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_01290 122706 123593 gene locus_tag LOCUS_01300 122706 123593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 123896 123753 gene locus_tag LOCUS_01310 123896 123753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 124597 125004 gene locus_tag LOCUS_01320 124597 125004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 125019 125822 gene locus_tag LOCUS_01330 125019 125822 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_01330 125969 126181 gene locus_tag LOCUS_01340 125969 126181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 126289 126471 gene locus_tag LOCUS_01350 126289 126471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 128274 126508 gene locus_tag LOCUS_01360 gene pabB 128274 126508 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_01360 128288 129415 gene locus_tag LOCUS_01370 gene mnmA 128288 129415 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_01370 129412 130092 gene locus_tag LOCUS_01380 129412 130092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 130089 132128 gene locus_tag LOCUS_01390 gene ligA 130089 132128 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_01390 132125 133042 gene locus_tag LOCUS_01400 132125 133042 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259122.1 protein_id gnl|my_center|LOCUS_01400 133054 133344 gene locus_tag LOCUS_01410 gene gatC 133054 133344 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_01410 133341 134825 gene locus_tag LOCUS_01420 gene gatA 133341 134825 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_01420 135740 134766 gene locus_tag LOCUS_01430 gene yedA 135740 134766 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_01430 135793 137211 gene locus_tag LOCUS_01440 gene gatB 135793 137211 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_01440 137216 138496 gene locus_tag LOCUS_01450 137216 138496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 138537 138848 gene locus_tag LOCUS_01460 138537 138848 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892849.1 protein_id gnl|my_center|LOCUS_01460 138856 140091 gene locus_tag LOCUS_01470 138856 140091 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 protein_id gnl|my_center|LOCUS_01470 140120 141313 gene locus_tag LOCUS_01480 140120 141313 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_01480 141317 142915 gene locus_tag LOCUS_01490 gene serA 141317 142915 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_01490 143010 144611 gene locus_tag LOCUS_01500 143010 144611 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_01500 144614 145777 gene locus_tag LOCUS_01510 144614 145777 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_01510 145805 146347 gene locus_tag LOCUS_01520 145805 146347 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_01520 147948 146359 gene locus_tag LOCUS_01530 147948 146359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 148065 149000 gene locus_tag LOCUS_01540 148065 149000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01540 149365 150297 gene locus_tag LOCUS_01550 149365 150297 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_01550 150302 152311 gene locus_tag LOCUS_01560 150302 152311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01560 152232 152873 gene locus_tag LOCUS_01570 152232 152873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 153001 153651 gene locus_tag LOCUS_01580 153001 153651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 154726 153707 gene locus_tag LOCUS_01590 154726 153707 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 protein_id gnl|my_center|LOCUS_01590 154820 156283 gene locus_tag LOCUS_01600 154820 156283 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_01600 156288 157184 gene locus_tag LOCUS_01610 156288 157184 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523563.1 protein_id gnl|my_center|LOCUS_01610 157733 157197 gene locus_tag LOCUS_01620 157733 157197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 159185 157746 gene locus_tag LOCUS_01630 159185 157746 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205479.1 protein_id gnl|my_center|LOCUS_01630 159303 160754 gene locus_tag LOCUS_01640 159303 160754 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532193.1 protein_id gnl|my_center|LOCUS_01640 160751 161275 gene locus_tag LOCUS_01650 gene ywaE 160751 161275 CDS product tyrZ transcriptional regulator YwaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243598.1 protein_id gnl|my_center|LOCUS_01650 162232 161297 gene locus_tag LOCUS_01660 162232 161297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 163485 162238 gene locus_tag LOCUS_01670 163485 162238 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_01670 164352 163543 gene locus_tag LOCUS_01680 164352 163543 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198379.1 protein_id gnl|my_center|LOCUS_01680 165681 164374 gene locus_tag LOCUS_01690 gene glnA 165681 164374 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259233.1 protein_id gnl|my_center|LOCUS_01690 166643 165789 gene locus_tag LOCUS_01700 166643 165789 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459931.1 protein_id gnl|my_center|LOCUS_01700 166665 167450 gene locus_tag LOCUS_01710 166665 167450 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943037.1 protein_id gnl|my_center|LOCUS_01710 167481 168245 gene locus_tag LOCUS_01720 167481 168245 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_01720 168314 169663 gene locus_tag LOCUS_01730 gene gltX 168314 169663 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_01730 169660 170427 gene locus_tag LOCUS_01740 169660 170427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 171413 170436 gene locus_tag LOCUS_01750 171413 170436 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026824.1 protein_id gnl|my_center|LOCUS_01750 173131 171422 gene locus_tag LOCUS_01760 173131 171422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 173207 173689 gene locus_tag LOCUS_01770 173207 173689 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927067.1 protein_id gnl|my_center|LOCUS_01770 174699 173644 gene locus_tag LOCUS_01780 174699 173644 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 protein_id gnl|my_center|LOCUS_01780 174877 175464 gene locus_tag LOCUS_01790 174877 175464 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941226.1 protein_id gnl|my_center|LOCUS_01790 175508 176452 gene locus_tag LOCUS_01800 175508 176452 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966735.1 protein_id gnl|my_center|LOCUS_01800 176587 176514 gene locus_tag LOCUS_t00030 176587 176514 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 177663 176641 gene locus_tag LOCUS_01810 177663 176641 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_01810 177726 179798 gene locus_tag LOCUS_01820 177726 179798 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893757.1 protein_id gnl|my_center|LOCUS_01820 179795 180664 gene locus_tag LOCUS_01830 179795 180664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 180661 181623 gene locus_tag LOCUS_01840 180661 181623 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_01840 183217 181763 gene locus_tag LOCUS_01850 183217 181763 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228743.1 protein_id gnl|my_center|LOCUS_01850 183348 183273 gene locus_tag LOCUS_t00040 183348 183273 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 183459 183755 gene locus_tag LOCUS_01860 183459 183755 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143413.1 protein_id gnl|my_center|LOCUS_01860 183951 183742 gene locus_tag LOCUS_01870 183951 183742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 184605 183955 gene locus_tag LOCUS_01880 gene cofC 184605 183955 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_01880 184716 185348 gene locus_tag LOCUS_01890 184716 185348 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909445.1 protein_id gnl|my_center|LOCUS_01890 185360 186037 gene locus_tag LOCUS_01900 185360 186037 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775880.1 protein_id gnl|my_center|LOCUS_01900 186047 187195 gene locus_tag LOCUS_01910 186047 187195 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_01910 187403 187170 gene locus_tag LOCUS_01920 187403 187170 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_01920 187531 188160 gene locus_tag LOCUS_01930 187531 188160 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729648.1 protein_id gnl|my_center|LOCUS_01930 188157 188513 gene locus_tag LOCUS_01940 188157 188513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 190026 188527 gene locus_tag LOCUS_01950 190026 188527 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383059.1 protein_id gnl|my_center|LOCUS_01950 190173 191126 gene locus_tag LOCUS_01960 gene thiL 190173 191126 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_01960 191097 191185 gene locus_tag LOCUS_t00050 191097 191185 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 191397 191200 gene locus_tag LOCUS_01970 gene rpmB 191397 191200 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_01970 191482 193680 gene locus_tag LOCUS_01980 gene recG 191482 193680 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256170.1 protein_id gnl|my_center|LOCUS_01980 193754 194341 gene locus_tag LOCUS_01990 gene rsmD 193754 194341 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 protein_id gnl|my_center|LOCUS_01990 194332 194817 gene locus_tag LOCUS_02000 gene coaD 194332 194817 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_02000 194818 195381 gene locus_tag LOCUS_02010 194818 195381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 195378 195902 gene locus_tag LOCUS_02020 195378 195902 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284376.1 protein_id gnl|my_center|LOCUS_02020 195940 196116 gene locus_tag LOCUS_02030 gene rpmF 195940 196116 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_02030 196121 196849 gene locus_tag LOCUS_02040 gene rnc 196121 196849 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742189.1 protein_id gnl|my_center|LOCUS_02040 196855 197697 gene locus_tag LOCUS_02050 gene mutM 196855 197697 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_02050 198064 197702 gene locus_tag LOCUS_02060 198064 197702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02060 198362 198652 gene locus_tag LOCUS_02070 198362 198652 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_02070 198715 202092 gene locus_tag LOCUS_02080 198715 202092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 202104 203084 gene locus_tag LOCUS_02090 202104 203084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 203090 203482 gene locus_tag LOCUS_02100 203090 203482 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942859.1 protein_id gnl|my_center|LOCUS_02100 203678 203430 gene locus_tag LOCUS_02110 203678 203430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02110 205106 205363 gene locus_tag LOCUS_02120 205106 205363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02120 205775 206653 gene locus_tag LOCUS_02130 205775 206653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 206900 207415 gene locus_tag LOCUS_02140 206900 207415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 207527 207688 gene locus_tag LOCUS_02150 207527 207688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02150 207688 207855 gene locus_tag LOCUS_02160 207688 207855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02160 207872 208135 gene locus_tag LOCUS_02170 207872 208135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02170 208165 208689 gene locus_tag LOCUS_02180 208165 208689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 208695 209357 gene locus_tag LOCUS_02190 208695 209357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 209342 209800 gene locus_tag LOCUS_02200 209342 209800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02200 209751 209990 gene locus_tag LOCUS_02210 209751 209990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02210 209995 210312 gene locus_tag LOCUS_02220 209995 210312 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893809.1 protein_id gnl|my_center|LOCUS_02220 210347 210727 gene locus_tag LOCUS_02230 210347 210727 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_02230 212256 210742 gene locus_tag LOCUS_02240 212256 210742 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_02240 212373 213917 gene locus_tag LOCUS_02250 212373 213917 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_02250 213907 217269 gene locus_tag LOCUS_02260 213907 217269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 217343 217849 gene locus_tag LOCUS_02270 217343 217849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02270 218101 219564 gene locus_tag LOCUS_02280 218101 219564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 219561 220532 gene locus_tag LOCUS_02290 219561 220532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 220684 221589 gene locus_tag LOCUS_02300 gene rpsB 220684 221589 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_02300 221589 222194 gene locus_tag LOCUS_02310 gene tsf 221589 222194 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_02310 222229 222966 gene locus_tag LOCUS_02320 gene pyrH 222229 222966 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223864.1 protein_id gnl|my_center|LOCUS_02320 222963 223523 gene locus_tag LOCUS_02330 gene frr 222963 223523 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_02330 223533 225119 gene locus_tag LOCUS_02340 223533 225119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 225157 226314 gene locus_tag LOCUS_02350 225157 226314 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_02350 226318 227433 gene locus_tag LOCUS_02360 226318 227433 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 protein_id gnl|my_center|LOCUS_02360 227518 228210 gene locus_tag LOCUS_02370 227518 228210 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 protein_id gnl|my_center|LOCUS_02370 228215 229633 gene locus_tag LOCUS_02380 228215 229633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 229630 230079 gene locus_tag LOCUS_02390 229630 230079 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248966.1 protein_id gnl|my_center|LOCUS_02390 230083 231249 gene locus_tag LOCUS_02400 gene ispG 230083 231249 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 protein_id gnl|my_center|LOCUS_02400 232416 231250 gene locus_tag LOCUS_02410 232416 231250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 233006 232413 gene locus_tag LOCUS_02420 233006 232413 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933229.1 protein_id gnl|my_center|LOCUS_02420 234543 233032 gene locus_tag LOCUS_02430 gene trpE 234543 233032 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392855.1 protein_id gnl|my_center|LOCUS_02430 234651 236351 gene locus_tag LOCUS_02440 234651 236351 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_02440 236725 236979 gene locus_tag LOCUS_02450 236725 236979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02450 237550 238143 gene locus_tag LOCUS_02460 237550 238143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02460 238145 238441 gene locus_tag LOCUS_02470 238145 238441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 238438 239499 gene locus_tag LOCUS_02480 238438 239499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02480 239402 240586 gene locus_tag LOCUS_02490 239402 240586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02490 240583 240888 gene locus_tag LOCUS_02500 240583 240888 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_02500 240909 241274 gene locus_tag LOCUS_02510 240909 241274 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942234.1 protein_id gnl|my_center|LOCUS_02510 241271 242272 gene locus_tag LOCUS_02520 241271 242272 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296638.1 protein_id gnl|my_center|LOCUS_02520 242269 243135 gene locus_tag LOCUS_02530 gene truB 242269 243135 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414147.1 protein_id gnl|my_center|LOCUS_02530 243148 244092 gene locus_tag LOCUS_02540 243148 244092 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728505.1 protein_id gnl|my_center|LOCUS_02540 244139 244408 gene locus_tag LOCUS_02550 gene rpsO 244139 244408 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052997.1 protein_id gnl|my_center|LOCUS_02550 244613 246889 gene locus_tag LOCUS_02560 244613 246889 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414124.1 protein_id gnl|my_center|LOCUS_02560 246900 248174 gene locus_tag LOCUS_02570 246900 248174 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_02570 248171 248938 gene locus_tag LOCUS_02580 gene dapB 248171 248938 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414099.1 protein_id gnl|my_center|LOCUS_02580 248935 250185 gene locus_tag LOCUS_02590 248935 250185 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106275831.1 protein_id gnl|my_center|LOCUS_02590 250233 250712 gene locus_tag LOCUS_02600 250233 250712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 251268 250723 gene locus_tag LOCUS_02610 251268 250723 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_02610 251370 252257 gene locus_tag LOCUS_02620 gene dapA 251370 252257 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_02620 252238 253914 gene locus_tag LOCUS_02630 252238 253914 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_02630 253936 256377 gene locus_tag LOCUS_02640 253936 256377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 256701 256381 gene locus_tag LOCUS_02650 256701 256381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 256931 257689 gene locus_tag LOCUS_02660 256931 257689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 257696 258958 gene locus_tag LOCUS_02670 257696 258958 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_02670 258958 259542 gene locus_tag LOCUS_02680 gene thpR 258958 259542 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_02680 259576 260454 gene locus_tag LOCUS_02690 259576 260454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 260534 260803 gene locus_tag LOCUS_02700 260534 260803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 260966 261451 gene locus_tag LOCUS_02710 260966 261451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 261458 261955 gene locus_tag LOCUS_02720 261458 261955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 261957 262445 gene locus_tag LOCUS_02730 261957 262445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02730 262637 263860 gene locus_tag LOCUS_02740 262637 263860 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225403.1 protein_id gnl|my_center|LOCUS_02740 264041 265129 gene locus_tag LOCUS_02750 gene recA 264041 265129 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_02750 265136 265615 gene locus_tag LOCUS_02760 265136 265615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 265900 267444 gene locus_tag LOCUS_02770 gene rny 265900 267444 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_02770 267676 268635 gene locus_tag LOCUS_02780 267676 268635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 268645 269007 gene locus_tag LOCUS_02790 268645 269007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 269102 270442 gene locus_tag LOCUS_02800 gene miaB 269102 270442 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414001.1 protein_id gnl|my_center|LOCUS_02800 270447 271370 gene locus_tag LOCUS_02810 gene miaA 270447 271370 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_02810 271367 272218 gene locus_tag LOCUS_02820 gene dapF 271367 272218 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546632.1 protein_id gnl|my_center|LOCUS_02820 272215 273336 gene locus_tag LOCUS_02830 gene dapE 272215 273336 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092984.1 protein_id gnl|my_center|LOCUS_02830 273333 274505 gene locus_tag LOCUS_02840 273333 274505 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938944.1 protein_id gnl|my_center|LOCUS_02840 274502 275365 gene locus_tag LOCUS_02850 274502 275365 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_02850 275362 276759 gene locus_tag LOCUS_02860 gene hflX 275362 276759 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_02860 275676 275598 gene locus_tag LOCUS_t00060 275676 275598 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 277600 276704 gene locus_tag LOCUS_02870 277600 276704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 278422 277790 gene locus_tag LOCUS_02880 gene lexA 278422 277790 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899448.1 protein_id gnl|my_center|LOCUS_02880 278566 278874 gene locus_tag LOCUS_02890 278566 278874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 278982 279458 gene locus_tag LOCUS_02900 gene nrdR 278982 279458 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_02900 279681 282401 gene locus_tag LOCUS_02910 279681 282401 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_02910 282419 282883 gene locus_tag LOCUS_02920 282419 282883 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971062.1 protein_id gnl|my_center|LOCUS_02920 282888 283322 gene locus_tag LOCUS_02930 282888 283322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 283319 283885 gene locus_tag LOCUS_02940 283319 283885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 283898 283973 gene locus_tag LOCUS_t00070 283898 283973 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 284188 284562 gene locus_tag LOCUS_02950 284188 284562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 284678 284750 gene locus_tag LOCUS_t00080 284678 284750 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 284792 284865 gene locus_tag LOCUS_t00090 284792 284865 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 285025 286149 gene locus_tag LOCUS_02960 285025 286149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 286146 287246 gene locus_tag LOCUS_02970 286146 287246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990019.1 protein_id gnl|my_center|LOCUS_02970 287249 287920 gene locus_tag LOCUS_02980 287249 287920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723280.1 protein_id gnl|my_center|LOCUS_02980 288173 288967 gene locus_tag LOCUS_02990 288173 288967 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093952664.1 protein_id gnl|my_center|LOCUS_02990 289113 288994 gene locus_tag LOCUS_03000 289113 288994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 289359 289432 gene locus_tag LOCUS_t00100 289359 289432 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 289491 290231 gene locus_tag LOCUS_03010 289491 290231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_03010 290234 292783 gene locus_tag LOCUS_03020 290234 292783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_03020 292860 294788 gene locus_tag LOCUS_03030 gene thrS 292860 294788 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_03030 294795 295286 gene locus_tag LOCUS_03040 294795 295286 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_03040 297389 295302 gene locus_tag LOCUS_03050 gene fusA 297389 295302 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_03050 297449 298003 gene locus_tag LOCUS_03060 297449 298003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 298000 298920 gene locus_tag LOCUS_03070 298000 298920 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_03070 298917 300092 gene locus_tag LOCUS_03080 298917 300092 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_03080 300182 301054 gene locus_tag LOCUS_03090 300182 301054 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249628.1 protein_id gnl|my_center|LOCUS_03090 301186 302232 gene locus_tag LOCUS_03100 301186 302232 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_03100 302919 303251 gene locus_tag LOCUS_03110 302919 303251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03110 303268 303834 gene locus_tag LOCUS_03120 gene pdxT 303268 303834 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 protein_id gnl|my_center|LOCUS_03120 303841 304593 gene locus_tag LOCUS_03130 303841 304593 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894318.1 protein_id gnl|my_center|LOCUS_03130 304648 305160 gene locus_tag LOCUS_03140 304648 305160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 305157 305723 gene locus_tag LOCUS_03150 gene ruvA 305157 305723 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_03150 305720 306787 gene locus_tag LOCUS_03160 gene ruvB 305720 306787 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_03160 306821 307156 gene locus_tag LOCUS_03170 gene yajC 306821 307156 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316308.1 protein_id gnl|my_center|LOCUS_03170 307153 307923 gene locus_tag LOCUS_03180 307153 307923 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_03180 307920 310064 gene locus_tag LOCUS_03190 307920 310064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 310061 311143 gene locus_tag LOCUS_03200 gene secF 310061 311143 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_03200 311148 311669 gene locus_tag LOCUS_03210 311148 311669 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_03210 311735 313993 gene locus_tag LOCUS_03220 gene relA 311735 313993 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_03220 314379 313972 gene locus_tag LOCUS_03230 314379 313972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 314646 315116 gene locus_tag LOCUS_03240 314646 315116 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228812.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03240 315177 316379 gene locus_tag LOCUS_03250 gene hisS 315177 316379 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_03250 316376 318181 gene locus_tag LOCUS_03260 gene aspS 316376 318181 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_03260 318382 318957 gene locus_tag LOCUS_03270 318382 318957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03270 319157 319831 gene locus_tag LOCUS_03280 319157 319831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03280 321894 321553 gene locus_tag LOCUS_03290 321894 321553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 324504 325421 gene locus_tag LOCUS_03300 324504 325421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03300 326289 326531 gene locus_tag LOCUS_03310 326289 326531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 327291 327533 gene locus_tag LOCUS_03320 327291 327533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03320 327948 327514 gene locus_tag LOCUS_03330 327948 327514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 328133 328267 gene locus_tag LOCUS_03340 328133 328267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 328301 328696 gene locus_tag LOCUS_03350 328301 328696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03350 328776 329438 gene locus_tag LOCUS_03360 328776 329438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03360 329459 330004 gene locus_tag LOCUS_03370 329459 330004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03370 330507 330674 gene locus_tag LOCUS_03380 330507 330674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03380 330802 331287 gene locus_tag LOCUS_03390 330802 331287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 331410 331904 gene locus_tag LOCUS_03400 331410 331904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 331948 332685 gene locus_tag LOCUS_03410 331948 332685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 333563 334651 gene locus_tag LOCUS_03420 333563 334651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 334685 335473 gene locus_tag LOCUS_03430 334685 335473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 335545 335883 gene locus_tag LOCUS_03440 335545 335883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 335883 336950 gene locus_tag LOCUS_03450 gene pilM 335883 336950 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228636.1 protein_id gnl|my_center|LOCUS_03450 336947 337567 gene locus_tag LOCUS_03460 336947 337567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 337564 338169 gene locus_tag LOCUS_03470 337564 338169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 338520 338729 gene locus_tag LOCUS_03480 338520 338729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 338870 340021 gene locus_tag LOCUS_03490 gene aroC 338870 340021 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_03490 340018 340515 gene locus_tag LOCUS_03500 gene aroL 340018 340515 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938191.1 protein_id gnl|my_center|LOCUS_03500 340503 341588 gene locus_tag LOCUS_03510 gene aroB 340503 341588 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257969.1 protein_id gnl|my_center|LOCUS_03510 341585 342019 gene locus_tag LOCUS_03520 gene aroQ 341585 342019 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173409.1 protein_id gnl|my_center|LOCUS_03520 342004 343077 gene locus_tag LOCUS_03530 342004 343077 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_03530 343100 343666 gene locus_tag LOCUS_03540 gene efp 343100 343666 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_03540 343663 344151 gene locus_tag LOCUS_03550 gene nusB 343663 344151 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111369.1 protein_id gnl|my_center|LOCUS_03550 344369 344118 gene locus_tag LOCUS_03560 344369 344118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 344587 345117 gene locus_tag LOCUS_03570 gene pyrR 344587 345117 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_03570 345117 346040 gene locus_tag LOCUS_03580 345117 346040 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_03580 346037 347344 gene locus_tag LOCUS_03590 346037 347344 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_03590 347341 348486 gene locus_tag LOCUS_03600 gene carA 347341 348486 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_03600 348486 351773 gene locus_tag LOCUS_03610 gene carB 348486 351773 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224620.1 protein_id gnl|my_center|LOCUS_03610 351770 352591 gene locus_tag LOCUS_03620 351770 352591 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_03620 353291 353554 gene locus_tag LOCUS_03630 353291 353554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 353551 354231 gene locus_tag LOCUS_03640 gene pyrF 353551 354231 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_03640 354353 354667 gene locus_tag LOCUS_03650 gene mihF 354353 354667 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224622.1 protein_id gnl|my_center|LOCUS_03650 354776 355303 gene locus_tag LOCUS_03660 354776 355303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03660 355300 355545 gene locus_tag LOCUS_03670 gene rpoZ 355300 355545 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_03670 355565 356782 gene locus_tag LOCUS_03680 gene coaBC 355565 356782 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_03680 356822 358015 gene locus_tag LOCUS_03690 gene metK 356822 358015 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057696.1 protein_id gnl|my_center|LOCUS_03690 358041 359819 gene locus_tag LOCUS_03700 358041 359819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 359855 360370 gene locus_tag LOCUS_03710 gene def 359855 360370 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948295.1 protein_id gnl|my_center|LOCUS_03710 360390 361331 gene locus_tag LOCUS_03720 gene fmt 360390 361331 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_03720 361328 362638 gene locus_tag LOCUS_03730 361328 362638 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296596.1 protein_id gnl|my_center|LOCUS_03730 362648 363310 gene locus_tag LOCUS_03740 gene rpe 362648 363310 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811794.1 protein_id gnl|my_center|LOCUS_03740 363307 364239 gene locus_tag LOCUS_03750 363307 364239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 364479 365588 gene locus_tag LOCUS_03760 gene ribD 364479 365588 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_03760 365569 366153 gene locus_tag LOCUS_03770 365569 366153 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392433.1 protein_id gnl|my_center|LOCUS_03770 366150 367421 gene locus_tag LOCUS_03780 366150 367421 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_03780 367418 367897 gene locus_tag LOCUS_03790 gene ribE 367418 367897 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258065.1 protein_id gnl|my_center|LOCUS_03790 367894 368244 gene locus_tag LOCUS_03800 367894 368244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 368678 368304 gene locus_tag LOCUS_03810 368678 368304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 368565 369011 gene locus_tag LOCUS_03820 368565 369011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03820 369019 369216 gene locus_tag LOCUS_03830 gene rpmI 369019 369216 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057993.1 protein_id gnl|my_center|LOCUS_03830 369217 369573 gene locus_tag LOCUS_03840 gene rplT 369217 369573 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559056.1 protein_id gnl|my_center|LOCUS_03840 369629 371080 gene locus_tag LOCUS_03850 369629 371080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 371094 372149 gene locus_tag LOCUS_03860 gene pheS 371094 372149 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458978.1 protein_id gnl|my_center|LOCUS_03860 372146 374527 gene locus_tag LOCUS_03870 gene pheT 372146 374527 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_03870 374582 375502 gene locus_tag LOCUS_03880 gene argF 374582 375502 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_03880 375516 376175 gene locus_tag LOCUS_03890 375516 376175 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037459.1 protein_id gnl|my_center|LOCUS_03890 378406 376172 gene locus_tag LOCUS_03900 378406 376172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 378459 379712 gene locus_tag LOCUS_03910 gene tyrS 378459 379712 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583842.1 protein_id gnl|my_center|LOCUS_03910 380029 381548 gene locus_tag LOCUS_r00010 380029 381548 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 381735 384829 gene locus_tag LOCUS_r00020 381735 384829 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 384927 385037 gene locus_tag LOCUS_r00030 384927 385037 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 385107 385793 gene locus_tag LOCUS_03920 385107 385793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 386808 385783 gene locus_tag LOCUS_03930 386808 385783 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257434.1 protein_id gnl|my_center|LOCUS_03930 386856 387053 gene locus_tag LOCUS_03940 386856 387053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 388408 387143 gene locus_tag LOCUS_03950 388408 387143 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_03950 388393 388794 gene locus_tag LOCUS_03960 388393 388794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 388799 389587 gene locus_tag LOCUS_03970 388799 389587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03970 390155 389592 gene locus_tag LOCUS_03980 390155 389592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03980 390434 390829 gene locus_tag LOCUS_03990 390434 390829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 390844 391635 gene locus_tag LOCUS_04000 gene tlyA 390844 391635 CDS product 16S/23S rRNA (cytidine-2'-O)-methyltransferase TlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408382.1 protein_id gnl|my_center|LOCUS_04000 391632 392456 gene locus_tag LOCUS_04010 391632 392456 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_04010 392468 394126 gene locus_tag LOCUS_04020 gene recN 392468 394126 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110859.1 protein_id gnl|my_center|LOCUS_04020 394273 394608 gene locus_tag LOCUS_04030 394273 394608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04030 394952 395329 gene locus_tag LOCUS_04040 394952 395329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04040 395826 396356 gene locus_tag LOCUS_04050 395826 396356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 396393 397514 gene locus_tag LOCUS_04060 gene ald 396393 397514 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894041.1 protein_id gnl|my_center|LOCUS_04060 397528 398463 gene locus_tag LOCUS_04070 gene xerD 397528 398463 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286377.1 protein_id gnl|my_center|LOCUS_04070 398465 398824 gene locus_tag LOCUS_04080 398465 398824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 398821 400017 gene locus_tag LOCUS_04090 398821 400017 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_04090 400121 401434 gene locus_tag LOCUS_04100 400121 401434 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_04100 401431 402099 gene locus_tag LOCUS_04110 401431 402099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 402188 403162 gene locus_tag LOCUS_04120 gene trpS 402188 403162 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_04120 403173 403913 gene locus_tag LOCUS_04130 403173 403913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 403901 404503 gene locus_tag LOCUS_04140 gene scpB 403901 404503 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_04140 404509 405231 gene locus_tag LOCUS_04150 404509 405231 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227785.1 protein_id gnl|my_center|LOCUS_04150 405295 405663 gene locus_tag LOCUS_04160 gene aroH 405295 405663 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172959.1 protein_id gnl|my_center|LOCUS_04160 405647 406750 gene locus_tag LOCUS_04170 405647 406750 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_04170 407060 408145 gene locus_tag LOCUS_04180 gene aroA 407060 408145 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227950.1 protein_id gnl|my_center|LOCUS_04180 408175 408816 gene locus_tag LOCUS_04190 gene cmk 408175 408816 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786468.1 protein_id gnl|my_center|LOCUS_04190 408813 410285 gene locus_tag LOCUS_04200 408813 410285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 410140 410217 gene locus_tag LOCUS_t00110 410140 410217 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 410219 410845 gene locus_tag LOCUS_04210 410219 410845 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_04210 410842 411252 gene locus_tag LOCUS_04220 gene gcvH 410842 411252 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228002.1 protein_id gnl|my_center|LOCUS_04220 411477 411935 gene locus_tag LOCUS_04230 411477 411935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 411942 412679 gene locus_tag LOCUS_04240 411942 412679 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027756.1 protein_id gnl|my_center|LOCUS_04240 412676 413941 gene locus_tag LOCUS_04250 412676 413941 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_04250 413977 414552 gene locus_tag LOCUS_04260 gene hpt 413977 414552 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_04260 414560 415072 gene locus_tag LOCUS_04270 414560 415072 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_04270 415589 415104 gene locus_tag LOCUS_04280 415589 415104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 415758 416210 gene locus_tag LOCUS_04290 415758 416210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 416207 416572 gene locus_tag LOCUS_04300 416207 416572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 416665 417945 gene locus_tag LOCUS_04310 gene gcvPA 416665 417945 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_04310 417942 419456 gene locus_tag LOCUS_04320 gene gcvPB 417942 419456 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393440.1 protein_id gnl|my_center|LOCUS_04320 421789 419537 gene locus_tag LOCUS_04330 421789 419537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04330 422139 421786 gene locus_tag LOCUS_04340 422139 421786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 423725 422211 gene locus_tag LOCUS_04350 423725 422211 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 protein_id gnl|my_center|LOCUS_04350 424453 423722 gene locus_tag LOCUS_04360 424453 423722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 424618 425061 gene locus_tag LOCUS_04370 424618 425061 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_04370 425207 425872 gene locus_tag LOCUS_04380 425207 425872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 425869 428286 gene locus_tag LOCUS_04390 425869 428286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 428332 429723 gene locus_tag LOCUS_04400 gene cysS 428332 429723 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237701980.1 protein_id gnl|my_center|LOCUS_04400 430824 429727 gene locus_tag LOCUS_04410 430824 429727 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030634.1 protein_id gnl|my_center|LOCUS_04410 431777 430833 gene locus_tag LOCUS_04420 431777 430833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 434443 431783 gene locus_tag LOCUS_04430 434443 431783 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_04430 435215 434475 gene locus_tag LOCUS_04440 435215 434475 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228880.1 protein_id gnl|my_center|LOCUS_04440 436126 435212 gene locus_tag LOCUS_04450 436126 435212 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 protein_id gnl|my_center|LOCUS_04450 436874 436137 gene locus_tag LOCUS_04460 436874 436137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 437698 436877 gene locus_tag LOCUS_04470 gene tatC 437698 436877 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729395.1 protein_id gnl|my_center|LOCUS_04470 438055 437711 gene locus_tag LOCUS_04480 438055 437711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 438304 438086 gene locus_tag LOCUS_04490 438304 438086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 438648 438340 gene locus_tag LOCUS_04500 438648 438340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 439743 438754 gene locus_tag LOCUS_04510 439743 438754 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_04510 440701 439736 gene locus_tag LOCUS_04520 440701 439736 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 protein_id gnl|my_center|LOCUS_04520 440748 441374 gene locus_tag LOCUS_04530 440748 441374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 442746 441382 gene locus_tag LOCUS_04540 gene pafA 442746 441382 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_04540 443472 442786 gene locus_tag LOCUS_04550 gene prcA 443472 442786 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_04550 444272 443469 gene locus_tag LOCUS_04560 gene prcB 444272 443469 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_04560 444469 444269 gene locus_tag LOCUS_04570 444469 444269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 446015 444504 gene locus_tag LOCUS_04580 gene dop 446015 444504 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_04580 447758 446025 gene locus_tag LOCUS_04590 gene arc 447758 446025 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_04590 448688 447909 gene locus_tag LOCUS_04600 448688 447909 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226739.1 protein_id gnl|my_center|LOCUS_04600 449656 448685 gene locus_tag LOCUS_04610 449656 448685 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227962.1 protein_id gnl|my_center|LOCUS_04610 449871 449683 gene locus_tag LOCUS_04620 449871 449683 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172562.1 protein_id gnl|my_center|LOCUS_04620 451055 449925 gene locus_tag LOCUS_04630 451055 449925 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_04630 452321 451131 gene locus_tag LOCUS_04640 452321 451131 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_04640 453606 452446 gene locus_tag LOCUS_04650 453606 452446 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_04650 455366 453693 gene locus_tag LOCUS_04660 455366 453693 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726949.1 protein_id gnl|my_center|LOCUS_04660 455503 456480 gene locus_tag LOCUS_04670 455503 456480 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058003.1 protein_id gnl|my_center|LOCUS_04670 456573 457208 gene locus_tag LOCUS_04680 456573 457208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 458141 457551 gene locus_tag LOCUS_04690 458141 457551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04690 458554 458865 gene locus_tag LOCUS_04700 458554 458865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 460385 460002 gene locus_tag LOCUS_04710 460385 460002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04710 461129 460542 gene locus_tag LOCUS_04720 461129 460542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 461070 461690 gene locus_tag LOCUS_04730 461070 461690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 462401 461802 gene locus_tag LOCUS_04740 462401 461802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 463671 462514 gene locus_tag LOCUS_04750 463671 462514 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869354.1 protein_id gnl|my_center|LOCUS_04750 464241 463783 gene locus_tag LOCUS_04760 464241 463783 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_04760 465079 464252 gene locus_tag LOCUS_04770 465079 464252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 465750 465076 gene locus_tag LOCUS_04780 465750 465076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002260033.1 protein_id gnl|my_center|LOCUS_04780 467209 465734 gene locus_tag LOCUS_04790 467209 465734 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_04790 467877 467221 gene locus_tag LOCUS_04800 467877 467221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 468354 467899 gene locus_tag LOCUS_04810 468354 467899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 470420 468390 gene locus_tag LOCUS_04820 gene nosZ 470420 468390 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_04820 471858 470578 gene locus_tag LOCUS_04830 471858 470578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 472373 472969 gene locus_tag LOCUS_04840 472373 472969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04840 473558 473740 gene locus_tag LOCUS_04850 473558 473740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04850 473894 474289 gene locus_tag LOCUS_04860 473894 474289 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889330.1 protein_id gnl|my_center|LOCUS_04860 474289 475179 gene locus_tag LOCUS_04870 474289 475179 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_04870 475271 475696 gene locus_tag LOCUS_04880 475271 475696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 475745 477667 gene locus_tag LOCUS_04890 475745 477667 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946745.1 protein_id gnl|my_center|LOCUS_04890 477867 478529 gene locus_tag LOCUS_04900 477867 478529 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401643.1 protein_id gnl|my_center|LOCUS_04900 478884 478546 gene locus_tag LOCUS_04910 478884 478546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 479224 479021 gene locus_tag LOCUS_04920 479224 479021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 479633 479229 gene locus_tag LOCUS_04930 479633 479229 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393697.1 protein_id gnl|my_center|LOCUS_04930 480069 479683 gene locus_tag LOCUS_04940 480069 479683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 480500 480069 gene locus_tag LOCUS_04950 480500 480069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 481213 480527 gene locus_tag LOCUS_04960 481213 480527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 481803 481210 gene locus_tag LOCUS_04970 481803 481210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 483155 481800 gene locus_tag LOCUS_04980 483155 481800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 484237 483152 gene locus_tag LOCUS_04990 484237 483152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 484918 484523 gene locus_tag LOCUS_05000 484918 484523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 485624 485031 gene locus_tag LOCUS_05010 485624 485031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 485931 486860 gene locus_tag LOCUS_05020 485931 486860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 486888 487316 gene locus_tag LOCUS_05030 486888 487316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 487384 487297 gene locus_tag LOCUS_t00120 487384 487297 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 487651 487424 gene locus_tag LOCUS_05040 487651 487424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 489774 487657 gene locus_tag LOCUS_05050 489774 487657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_05050 490742 489771 gene locus_tag LOCUS_05060 490742 489771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_05060 492695 490809 gene locus_tag LOCUS_05070 492695 490809 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_05070 493806 492772 gene locus_tag LOCUS_05080 493806 492772 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_05080 494682 493951 gene locus_tag LOCUS_05090 gene tpiA 494682 493951 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_05090 495926 494724 gene locus_tag LOCUS_05100 495926 494724 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_05100 496941 495934 gene locus_tag LOCUS_05110 gene gap 496941 495934 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_05110 497897 497004 gene locus_tag LOCUS_05120 gene rapZ 497897 497004 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_05120 499774 497894 gene locus_tag LOCUS_05130 gene uvrC 499774 497894 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_05130 501480 499831 gene locus_tag LOCUS_05140 501480 499831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 504395 501537 gene locus_tag LOCUS_05150 gene uvrA 504395 501537 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_05150 504516 504788 gene locus_tag LOCUS_05160 504516 504788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 504796 505215 gene locus_tag LOCUS_05170 504796 505215 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398989.1 protein_id gnl|my_center|LOCUS_05170 506232 505228 gene locus_tag LOCUS_05180 506232 505228 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_05180 508335 506311 gene locus_tag LOCUS_05190 gene uvrB 508335 506311 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958334.1 protein_id gnl|my_center|LOCUS_05190 509105 508359 gene locus_tag LOCUS_05200 509105 508359 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724779.1 protein_id gnl|my_center|LOCUS_05200 510004 509102 gene locus_tag LOCUS_05210 510004 509102 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 protein_id gnl|my_center|LOCUS_05210 510902 510018 gene locus_tag LOCUS_05220 510902 510018 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_05220 511764 510997 gene locus_tag LOCUS_05230 511764 510997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225489.1 protein_id gnl|my_center|LOCUS_05230 512666 511761 gene locus_tag LOCUS_05240 512666 511761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_05240 513105 512698 gene locus_tag LOCUS_05250 513105 512698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 513813 513115 gene locus_tag LOCUS_05260 513813 513115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 514503 513880 gene locus_tag LOCUS_05270 gene coaE 514503 513880 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_05270 515926 514541 gene locus_tag LOCUS_05280 515926 514541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 518725 516065 gene locus_tag LOCUS_05290 gene polA 518725 516065 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_05290 518886 519917 gene locus_tag LOCUS_05300 518886 519917 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_05300 519914 521530 gene locus_tag LOCUS_05310 519914 521530 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141015.1 protein_id gnl|my_center|LOCUS_05310 521527 522540 gene locus_tag LOCUS_05320 521527 522540 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228819.1 protein_id gnl|my_center|LOCUS_05320 523569 522802 gene locus_tag LOCUS_05330 gene yecC 523569 522802 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245567.1 protein_id gnl|my_center|LOCUS_05330 524903 523581 gene locus_tag LOCUS_05340 524903 523581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 525864 524965 gene locus_tag LOCUS_05350 525864 524965 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525194.1 protein_id gnl|my_center|LOCUS_05350 526961 525978 gene locus_tag LOCUS_05360 526961 525978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 527015 527100 gene locus_tag LOCUS_t00130 527015 527100 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 528017 527112 gene locus_tag LOCUS_05370 528017 527112 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_05370 528788 528027 gene locus_tag LOCUS_05380 528788 528027 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812846.1 protein_id gnl|my_center|LOCUS_05380 529576 528785 gene locus_tag LOCUS_05390 529576 528785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937856.1 protein_id gnl|my_center|LOCUS_05390 531390 529573 gene locus_tag LOCUS_05400 531390 529573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 532547 531387 gene locus_tag LOCUS_05410 532547 531387 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028093.1 protein_id gnl|my_center|LOCUS_05410 533887 532565 gene locus_tag LOCUS_05420 533887 532565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 534800 534033 gene locus_tag LOCUS_05430 gene trpA 534800 534033 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_05430 535999 534800 gene locus_tag LOCUS_05440 gene trpB 535999 534800 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058306.1 protein_id gnl|my_center|LOCUS_05440 536778 535996 gene locus_tag LOCUS_05450 gene trpC 536778 535996 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057938.1 protein_id gnl|my_center|LOCUS_05450 537600 536878 gene locus_tag LOCUS_05460 gene hisA 537600 536878 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_05460 541220 537648 gene locus_tag LOCUS_05470 541220 537648 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_05470 542232 541333 gene locus_tag LOCUS_05480 542232 541333 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224836.1 protein_id gnl|my_center|LOCUS_05480 542707 542225 gene locus_tag LOCUS_05490 gene lspA 542707 542225 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082236.1 protein_id gnl|my_center|LOCUS_05490 543219 542710 gene locus_tag LOCUS_05500 543219 542710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 543241 546147 gene locus_tag LOCUS_05510 gene ileS 543241 546147 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_05510 546083 546400 gene locus_tag LOCUS_05520 546083 546400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 547136 546441 gene locus_tag LOCUS_05530 547136 546441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 547404 547147 gene locus_tag LOCUS_05540 547404 547147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 548716 548060 gene locus_tag LOCUS_05550 548716 548060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 549276 548881 gene locus_tag LOCUS_05560 549276 548881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05560 549342 549677 gene locus_tag LOCUS_05570 549342 549677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 550048 549659 gene locus_tag LOCUS_05580 550048 549659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05580 550937 550233 gene locus_tag LOCUS_05590 550937 550233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 551862 550927 gene locus_tag LOCUS_05600 gene murB 551862 550927 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_05600 553285 551852 gene locus_tag LOCUS_05610 gene murC 553285 551852 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939773.1 protein_id gnl|my_center|LOCUS_05610 554376 553282 gene locus_tag LOCUS_05620 gene murG 554376 553282 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_05620 555659 554382 gene locus_tag LOCUS_05630 gene spoVE 555659 554382 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_05630 557004 555652 gene locus_tag LOCUS_05640 gene murD 557004 555652 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_05640 558062 557001 gene locus_tag LOCUS_05650 gene mraY 558062 557001 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908018.1 protein_id gnl|my_center|LOCUS_05650 559411 558059 gene locus_tag LOCUS_05660 559411 558059 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228041.1 protein_id gnl|my_center|LOCUS_05660 560178 559423 gene locus_tag LOCUS_05670 560178 559423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05670 561393 560920 gene locus_tag LOCUS_05680 561393 560920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 563044 561320 gene locus_tag LOCUS_05690 563044 561320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05690 563883 563044 gene locus_tag LOCUS_05700 gene rsmH 563883 563044 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_05700 564026 563904 gene locus_tag LOCUS_05710 564026 563904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 564481 564023 gene locus_tag LOCUS_05720 gene mraZ 564481 564023 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_05720 565227 564745 gene locus_tag LOCUS_05730 565227 564745 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_05730 565522 566496 gene locus_tag LOCUS_05740 565522 566496 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_05740 566496 567728 gene locus_tag LOCUS_05750 566496 567728 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_05750 567752 569905 gene locus_tag LOCUS_05760 567752 569905 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_05760 570401 569919 gene locus_tag LOCUS_05770 570401 569919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 570955 570602 gene locus_tag LOCUS_05780 570955 570602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 572202 571027 gene locus_tag LOCUS_05790 gene dinB 572202 571027 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_05790 575381 572199 gene locus_tag LOCUS_05800 gene dnaE 575381 572199 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_05800 575755 575510 gene locus_tag LOCUS_05810 575755 575510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 575857 576495 gene locus_tag LOCUS_05820 575857 576495 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030017.1 protein_id gnl|my_center|LOCUS_05820 576526 577482 gene locus_tag LOCUS_05830 576526 577482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 577554 578717 gene locus_tag LOCUS_05840 577554 578717 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_05840 578714 579763 gene locus_tag LOCUS_05850 578714 579763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 580511 579798 gene locus_tag LOCUS_05860 580511 579798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 580596 582455 gene locus_tag LOCUS_05870 gene pknB 580596 582455 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_05870 583083 582460 gene locus_tag LOCUS_05880 583083 582460 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_05880 584144 583083 gene locus_tag LOCUS_05890 gene ltaE 584144 583083 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943783.1 protein_id gnl|my_center|LOCUS_05890 585178 584141 gene locus_tag LOCUS_05900 585178 584141 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_05900 585248 585409 gene locus_tag LOCUS_05910 585248 585409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 586374 585406 gene locus_tag LOCUS_05920 gene arcC 586374 585406 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_05920 587696 586383 gene locus_tag LOCUS_05930 587696 586383 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_05930 589249 587822 gene locus_tag LOCUS_05940 589249 587822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 590243 589260 gene locus_tag LOCUS_05950 590243 589260 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226418.1 protein_id gnl|my_center|LOCUS_05950 592105 590240 gene locus_tag LOCUS_05960 592105 590240 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_05960 593792 592116 gene locus_tag LOCUS_05970 593792 592116 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972418.1 protein_id gnl|my_center|LOCUS_05970 594053 593805 gene locus_tag LOCUS_05980 594053 593805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05980 596026 595181 gene locus_tag LOCUS_05990 gene fdhD 596026 595181 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 protein_id gnl|my_center|LOCUS_05990 596167 597801 gene locus_tag LOCUS_06000 596167 597801 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_06000 598002 598409 gene locus_tag LOCUS_06010 598002 598409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 599103 598462 gene locus_tag LOCUS_06020 599103 598462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 600034 599126 gene locus_tag LOCUS_06030 gene ftcD 600034 599126 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869662.1 protein_id gnl|my_center|LOCUS_06030 601203 600112 gene locus_tag LOCUS_06040 gene gcvT 601203 600112 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903168.1 protein_id gnl|my_center|LOCUS_06040 602324 601230 gene locus_tag LOCUS_06050 602324 601230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 603000 602407 gene locus_tag LOCUS_06060 603000 602407 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_06060 604118 602997 gene locus_tag LOCUS_06070 604118 602997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 604060 604917 gene locus_tag LOCUS_06080 604060 604917 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229677.1 protein_id gnl|my_center|LOCUS_06080 605149 605808 gene locus_tag LOCUS_06090 605149 605808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 606149 605856 gene locus_tag LOCUS_06100 606149 605856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 607347 606178 gene locus_tag LOCUS_06110 607347 606178 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256376.1 protein_id gnl|my_center|LOCUS_06110 607812 607372 gene locus_tag LOCUS_06120 607812 607372 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_06120 608504 607824 gene locus_tag LOCUS_06130 608504 607824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 608693 608971 gene locus_tag LOCUS_06140 608693 608971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 609010 610185 gene locus_tag LOCUS_06150 609010 610185 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922544.1 protein_id gnl|my_center|LOCUS_06150 610587 610300 gene locus_tag LOCUS_06160 610587 610300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 610970 610584 gene locus_tag LOCUS_06170 610970 610584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 610969 612180 gene locus_tag LOCUS_06180 610969 612180 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 protein_id gnl|my_center|LOCUS_06180 612296 612835 gene locus_tag LOCUS_06190 612296 612835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 613609 614046 gene locus_tag LOCUS_06200 613609 614046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06200 614094 614627 gene locus_tag LOCUS_06210 614094 614627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 615241 614717 gene locus_tag LOCUS_06220 615241 614717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 616345 615356 gene locus_tag LOCUS_06230 616345 615356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 616677 616342 gene locus_tag LOCUS_06240 616677 616342 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 protein_id gnl|my_center|LOCUS_06240 616843 617844 gene locus_tag LOCUS_06250 616843 617844 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209895261.1 protein_id gnl|my_center|LOCUS_06250 618887 617850 gene locus_tag LOCUS_06260 618887 617850 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_06260 620130 618880 gene locus_tag LOCUS_06270 620130 618880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06270 620720 620295 gene locus_tag LOCUS_06280 620720 620295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06280 621313 620810 gene locus_tag LOCUS_06290 621313 620810 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084065.1 protein_id gnl|my_center|LOCUS_06290 621407 622402 gene locus_tag LOCUS_06300 621407 622402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06300 622821 625043 gene locus_tag LOCUS_06310 622821 625043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06310 625376 625059 gene locus_tag LOCUS_06320 625376 625059 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411418.1 protein_id gnl|my_center|LOCUS_06320 625911 625429 gene locus_tag LOCUS_06330 625911 625429 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_06330 627011 625908 gene locus_tag LOCUS_06340 627011 625908 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460082.1 protein_id gnl|my_center|LOCUS_06340 627117 627959 gene locus_tag LOCUS_06350 627117 627959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 628967 627969 gene locus_tag LOCUS_06360 628967 627969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 630466 628964 gene locus_tag LOCUS_06370 630466 628964 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223053.1 protein_id gnl|my_center|LOCUS_06370 630579 630881 gene locus_tag LOCUS_06380 630579 630881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 631234 630785 gene locus_tag LOCUS_06390 631234 630785 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010508.1 protein_id gnl|my_center|LOCUS_06390 632495 631245 gene locus_tag LOCUS_06400 632495 631245 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_06400 633298 632516 gene locus_tag LOCUS_06410 gene sufC 633298 632516 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929158.1 protein_id gnl|my_center|LOCUS_06410 633618 633295 gene locus_tag LOCUS_06420 633618 633295 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_06420 634924 633620 gene locus_tag LOCUS_06430 gene sufD 634924 633620 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888732.1 protein_id gnl|my_center|LOCUS_06430 636421 635009 gene locus_tag LOCUS_06440 gene sufB 636421 635009 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224697.1 protein_id gnl|my_center|LOCUS_06440 636908 636570 gene locus_tag LOCUS_06450 636908 636570 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225051.1 protein_id gnl|my_center|LOCUS_06450 637074 638036 gene locus_tag LOCUS_06460 637074 638036 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_06460 638895 638047 gene locus_tag LOCUS_06470 638895 638047 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730790.1 protein_id gnl|my_center|LOCUS_06470 639311 639153 gene locus_tag LOCUS_06480 639311 639153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06480 639612 640256 gene locus_tag LOCUS_06490 639612 640256 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_06490 640316 641512 gene locus_tag LOCUS_06500 640316 641512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 641589 642293 gene locus_tag LOCUS_06510 641589 642293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 643393 642290 gene locus_tag LOCUS_06520 gene gcvT 643393 642290 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907977.1 protein_id gnl|my_center|LOCUS_06520 643439 644821 gene locus_tag LOCUS_06530 gene lpdA 643439 644821 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_06530 644833 645891 gene locus_tag LOCUS_06540 644833 645891 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_06540 645891 646937 gene locus_tag LOCUS_06550 645891 646937 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_06550 646951 648297 gene locus_tag LOCUS_06560 gene sucB 646951 648297 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775679.1 protein_id gnl|my_center|LOCUS_06560 648297 648995 gene locus_tag LOCUS_06570 gene lipB 648297 648995 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_06570 649746 649003 gene locus_tag LOCUS_06580 649746 649003 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020355.1 protein_id gnl|my_center|LOCUS_06580 650540 649746 gene locus_tag LOCUS_06590 gene trxA 650540 649746 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917999.1 protein_id gnl|my_center|LOCUS_06590 650674 651693 gene locus_tag LOCUS_06600 650674 651693 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257564.1 protein_id gnl|my_center|LOCUS_06600 651690 652679 gene locus_tag LOCUS_06610 651690 652679 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257563.1 protein_id gnl|my_center|LOCUS_06610 652726 655491 gene locus_tag LOCUS_06620 652726 655491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 656605 655424 gene locus_tag LOCUS_06630 656605 655424 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_06630 657106 656621 gene locus_tag LOCUS_06640 657106 656621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 657065 658018 gene locus_tag LOCUS_06650 gene lipA 657065 658018 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411460.1 protein_id gnl|my_center|LOCUS_06650 658476 659135 gene locus_tag LOCUS_06660 658476 659135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 659164 659355 gene locus_tag LOCUS_06670 659164 659355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 659808 659380 gene locus_tag LOCUS_06680 659808 659380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06680 660512 659805 gene locus_tag LOCUS_06690 660512 659805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 660767 660582 gene locus_tag LOCUS_06700 660767 660582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 660884 661609 gene locus_tag LOCUS_06710 660884 661609 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_06710 662895 661606 gene locus_tag LOCUS_06720 662895 661606 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259226.1 protein_id gnl|my_center|LOCUS_06720 664407 662950 gene locus_tag LOCUS_06730 664407 662950 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06730 665084 664584 gene locus_tag LOCUS_06740 665084 664584 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250949.1 protein_id gnl|my_center|LOCUS_06740 665519 665112 gene locus_tag LOCUS_06750 665519 665112 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_06750 665641 666270 gene locus_tag LOCUS_06760 665641 666270 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035439.1 protein_id gnl|my_center|LOCUS_06760 666314 666790 gene locus_tag LOCUS_06770 666314 666790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 666783 667400 gene locus_tag LOCUS_06780 666783 667400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 667488 667414 gene locus_tag LOCUS_t00140 667488 667414 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 668433 667513 gene locus_tag LOCUS_06790 668433 667513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 668774 668511 gene locus_tag LOCUS_06800 668774 668511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 668929 668792 gene locus_tag LOCUS_06810 668929 668792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 669036 673439 gene locus_tag LOCUS_06820 669036 673439 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_06820 673436 674230 gene locus_tag LOCUS_06830 673436 674230 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_06830 674227 675798 gene locus_tag LOCUS_06840 674227 675798 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727774.1 protein_id gnl|my_center|LOCUS_06840 675844 678156 gene locus_tag LOCUS_06850 675844 678156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 678450 678160 gene locus_tag LOCUS_06860 678450 678160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 678536 679330 gene locus_tag LOCUS_06870 678536 679330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 679624 679388 gene locus_tag LOCUS_06880 679624 679388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 679524 679997 gene locus_tag LOCUS_06890 679524 679997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226298.1 protein_id gnl|my_center|LOCUS_06890 680105 680503 gene locus_tag LOCUS_06900 680105 680503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 680500 682011 gene locus_tag LOCUS_06910 680500 682011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 682772 682041 gene locus_tag LOCUS_06920 682772 682041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06920 684431 682971 gene locus_tag LOCUS_06930 684431 682971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06930 684718 684428 gene locus_tag LOCUS_06940 684718 684428 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401147.1 protein_id gnl|my_center|LOCUS_06940 684796 687516 gene locus_tag LOCUS_06950 684796 687516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 688158 687520 gene locus_tag LOCUS_06960 688158 687520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 688239 688631 gene locus_tag LOCUS_06970 688239 688631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 689908 688835 gene locus_tag LOCUS_06980 689908 688835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_06980 690696 689905 gene locus_tag LOCUS_06990 690696 689905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_06990 691444 690677 gene locus_tag LOCUS_07000 gene modA 691444 690677 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_07000 691830 691441 gene locus_tag LOCUS_07010 691830 691441 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975235.1 protein_id gnl|my_center|LOCUS_07010 692681 691947 gene locus_tag LOCUS_07020 692681 691947 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_07020 693505 692846 gene locus_tag LOCUS_07030 693505 692846 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258583.1 protein_id gnl|my_center|LOCUS_07030 695343 693502 gene locus_tag LOCUS_07040 695343 693502 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258582.1 protein_id gnl|my_center|LOCUS_07040 695520 696167 gene locus_tag LOCUS_07050 695520 696167 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_07050 697131 697352 gene locus_tag LOCUS_07060 697131 697352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 697850 697398 gene locus_tag LOCUS_07070 697850 697398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 698476 697862 gene locus_tag LOCUS_07080 698476 697862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 699208 699675 gene locus_tag LOCUS_07090 699208 699675 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393982.1 protein_id gnl|my_center|LOCUS_07090 699787 700179 gene locus_tag LOCUS_07100 699787 700179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 700253 700642 gene locus_tag LOCUS_07110 700253 700642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 700650 701183 gene locus_tag LOCUS_07120 700650 701183 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582541.1 protein_id gnl|my_center|LOCUS_07120 702462 701242 gene locus_tag LOCUS_07130 702462 701242 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727108.1 protein_id gnl|my_center|LOCUS_07130 703281 702646 gene locus_tag LOCUS_07140 703281 702646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 703406 703332 gene locus_tag LOCUS_t00150 703406 703332 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 703811 703419 gene locus_tag LOCUS_07150 703811 703419 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080530.1 protein_id gnl|my_center|LOCUS_07150 705124 703847 gene locus_tag LOCUS_07160 705124 703847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 705222 706616 gene locus_tag LOCUS_07170 gene fumC 705222 706616 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089259.1 protein_id gnl|my_center|LOCUS_07170 706714 707244 gene locus_tag LOCUS_07180 706714 707244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 707324 707878 gene locus_tag LOCUS_07190 707324 707878 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230856.1 protein_id gnl|my_center|LOCUS_07190 709509 708724 gene locus_tag LOCUS_07200 gene xth 709509 708724 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039115.1 protein_id gnl|my_center|LOCUS_07200 709548 710312 gene locus_tag LOCUS_07210 709548 710312 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_07210 710396 711133 gene locus_tag LOCUS_07220 710396 711133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 712346 711159 gene locus_tag LOCUS_07230 712346 711159 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973241.1 protein_id gnl|my_center|LOCUS_07230 712837 712352 gene locus_tag LOCUS_07240 712837 712352 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479612.1 protein_id gnl|my_center|LOCUS_07240 714470 712857 gene locus_tag LOCUS_07250 714470 712857 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_07250 714589 714516 gene locus_tag LOCUS_t00160 714589 714516 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 714676 714954 gene locus_tag LOCUS_07260 714676 714954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 715029 715844 gene locus_tag LOCUS_07270 715029 715844 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028181.1 protein_id gnl|my_center|LOCUS_07270 716361 715882 gene locus_tag LOCUS_07280 716361 715882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 717836 716493 gene locus_tag LOCUS_07290 717836 716493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 719729 717939 gene locus_tag LOCUS_07300 gene dnaG 719729 717939 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857029.1 protein_id gnl|my_center|LOCUS_07300 720761 719745 gene locus_tag LOCUS_07310 720761 719745 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_07310 720789 721220 gene locus_tag LOCUS_07320 720789 721220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 721410 721928 gene locus_tag LOCUS_07330 721410 721928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 722650 722042 gene locus_tag LOCUS_07340 722650 722042 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228374.1 protein_id gnl|my_center|LOCUS_07340 723668 722685 gene locus_tag LOCUS_07350 723668 722685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07350 724414 723668 gene locus_tag LOCUS_07360 724414 723668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 725373 724411 gene locus_tag LOCUS_07370 725373 724411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 725655 726158 gene locus_tag LOCUS_07380 725655 726158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 728922 726208 gene locus_tag LOCUS_07390 gene ppdK 728922 726208 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_07390 729199 729008 gene locus_tag LOCUS_07400 729199 729008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 730362 729196 gene locus_tag LOCUS_07410 730362 729196 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07410 731392 730652 gene locus_tag LOCUS_07420 731392 730652 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015010.1 protein_id gnl|my_center|LOCUS_07420 732129 731389 gene locus_tag LOCUS_07430 gene recO 732129 731389 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055411.1 protein_id gnl|my_center|LOCUS_07430 732400 732200 gene locus_tag LOCUS_07440 732400 732200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07440 733188 733544 gene locus_tag LOCUS_07450 733188 733544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 734426 733551 gene locus_tag LOCUS_07460 gene era 734426 733551 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412224.1 protein_id gnl|my_center|LOCUS_07460 734843 734433 gene locus_tag LOCUS_07470 gene cdd 734843 734433 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258058.1 protein_id gnl|my_center|LOCUS_07470 736116 734836 gene locus_tag LOCUS_07480 736116 734836 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895866.1 protein_id gnl|my_center|LOCUS_07480 736559 736113 gene locus_tag LOCUS_07490 gene ybeY 736559 736113 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775754.1 protein_id gnl|my_center|LOCUS_07490 737554 736556 gene locus_tag LOCUS_07500 737554 736556 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_07500 737998 737633 gene locus_tag LOCUS_07510 737998 737633 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816465.1 protein_id gnl|my_center|LOCUS_07510 739161 738052 gene locus_tag LOCUS_07520 gene dnaJ 739161 738052 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920758.1 protein_id gnl|my_center|LOCUS_07520 740233 739169 gene locus_tag LOCUS_07530 gene hrcA 740233 739169 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228404.1 protein_id gnl|my_center|LOCUS_07530 740926 740291 gene locus_tag LOCUS_07540 740926 740291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 741089 741604 gene locus_tag LOCUS_07550 741089 741604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 741591 742565 gene locus_tag LOCUS_07560 741591 742565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 743685 742552 gene locus_tag LOCUS_07570 gene hemW 743685 742552 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729894.1 protein_id gnl|my_center|LOCUS_07570 745481 743682 gene locus_tag LOCUS_07580 gene lepA 745481 743682 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775765.1 protein_id gnl|my_center|LOCUS_07580 745603 745869 gene locus_tag LOCUS_07590 gene rpsT 745603 745869 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_07590 746882 745947 gene locus_tag LOCUS_07600 746882 745947 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775770.1 protein_id gnl|my_center|LOCUS_07600 749354 746970 gene locus_tag LOCUS_07610 749354 746970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 749998 749351 gene locus_tag LOCUS_07620 749998 749351 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392107.1 protein_id gnl|my_center|LOCUS_07620 750196 752289 gene locus_tag LOCUS_07630 750196 752289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 754803 752302 gene locus_tag LOCUS_07640 gene leuS 754803 752302 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_07640 756171 754972 gene locus_tag LOCUS_07650 756171 754972 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731196.1 protein_id gnl|my_center|LOCUS_07650 756614 757759 gene locus_tag LOCUS_07660 756614 757759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 757928 757788 gene locus_tag LOCUS_07670 757928 757788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 758485 758412 gene locus_tag LOCUS_t00170 758485 758412 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 758918 758499 gene locus_tag LOCUS_07680 gene rsfS 758918 758499 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 protein_id gnl|my_center|LOCUS_07680 759952 758915 gene locus_tag LOCUS_07690 759952 758915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 760545 759949 gene locus_tag LOCUS_07700 gene nadD 760545 759949 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_07700 761021 760551 gene locus_tag LOCUS_07710 761021 760551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 762267 761011 gene locus_tag LOCUS_07720 gene obgE 762267 761011 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228913.1 protein_id gnl|my_center|LOCUS_07720 762323 762790 gene locus_tag LOCUS_07730 762323 762790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 763017 762769 gene locus_tag LOCUS_07740 gene rpmA 763017 762769 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_07740 763397 763035 gene locus_tag LOCUS_07750 gene rplU 763397 763035 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412578.1 protein_id gnl|my_center|LOCUS_07750 764771 763416 gene locus_tag LOCUS_07760 764771 763416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07760 765606 766787 gene locus_tag LOCUS_07770 765606 766787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 767929 766784 gene locus_tag LOCUS_07780 gene rodA 767929 766784 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_07780 769841 767931 gene locus_tag LOCUS_07790 gene mrdA 769841 767931 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_07790 770350 769841 gene locus_tag LOCUS_07800 770350 769841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 771251 770376 gene locus_tag LOCUS_07810 771251 770376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 772251 771253 gene locus_tag LOCUS_07820 772251 771253 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_07820 772435 773352 gene locus_tag LOCUS_07830 gene fabD 772435 773352 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930934.1 protein_id gnl|my_center|LOCUS_07830 773389 774399 gene locus_tag LOCUS_07840 773389 774399 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_07840 774396 775133 gene locus_tag LOCUS_07850 gene fabG 774396 775133 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_07850 775223 775474 gene locus_tag LOCUS_07860 gene acpP 775223 775474 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057709.1 protein_id gnl|my_center|LOCUS_07860 775484 776719 gene locus_tag LOCUS_07870 gene fabF 775484 776719 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_07870 778150 776741 gene locus_tag LOCUS_07880 778150 776741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 778561 778157 gene locus_tag LOCUS_07890 gene ndk 778561 778157 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_07890 779898 778609 gene locus_tag LOCUS_07900 779898 778609 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_07900 782457 779905 gene locus_tag LOCUS_07910 gene valS 782457 779905 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_07910 783300 782503 gene locus_tag LOCUS_07920 783300 782503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 784642 783401 gene locus_tag LOCUS_07930 gene clpX 784642 783401 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_07930 785140 784727 gene locus_tag LOCUS_07940 785140 784727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07940 785361 785137 gene locus_tag LOCUS_07950 785361 785137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07950 786731 785361 gene locus_tag LOCUS_07960 gene tig 786731 785361 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_07960 786804 787571 gene locus_tag LOCUS_07970 gene hisN 786804 787571 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 protein_id gnl|my_center|LOCUS_07970 788535 787564 gene locus_tag LOCUS_07980 gene eutC 788535 787564 CDS product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975301.1 protein_id gnl|my_center|LOCUS_07980 789177 788545 gene locus_tag LOCUS_07990 789177 788545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 789146 789793 gene locus_tag LOCUS_08000 789146 789793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08000 789908 790573 gene locus_tag LOCUS_08010 789908 790573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 791037 790570 gene locus_tag LOCUS_08020 791037 790570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 792530 791064 gene locus_tag LOCUS_08030 792530 791064 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727370.1 protein_id gnl|my_center|LOCUS_08030 792689 792892 gene locus_tag LOCUS_08040 792689 792892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 792889 793581 gene locus_tag LOCUS_08050 792889 793581 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793177.1 protein_id gnl|my_center|LOCUS_08050 793578 793883 gene locus_tag LOCUS_08060 793578 793883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 793926 795038 gene locus_tag LOCUS_08070 793926 795038 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727711.1 protein_id gnl|my_center|LOCUS_08070 795120 795044 gene locus_tag LOCUS_t00180 795120 795044 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 795191 795589 gene locus_tag LOCUS_08080 795191 795589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 795660 798746 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccctcaatgaagccccgaccttgcggccggggaaag 800893 799271 gene locus_tag LOCUS_08090 gene cas1 800893 799271 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_08090 801946 800939 gene locus_tag LOCUS_08100 801946 800939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 804879 801943 gene locus_tag LOCUS_08110 804879 801943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 806287 804872 gene locus_tag LOCUS_08120 806287 804872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 807464 806289 gene locus_tag LOCUS_08130 807464 806289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 807644 807715 gene locus_tag LOCUS_t00190 807644 807715 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 809350 807776 gene locus_tag LOCUS_08140 809350 807776 CDS product hydantoinase/oxoprolinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989476.1 protein_id gnl|my_center|LOCUS_08140 810410 809337 gene locus_tag LOCUS_08150 810410 809337 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_08150 810450 810527 gene locus_tag LOCUS_t00200 810450 810527 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 810623 811471 gene locus_tag LOCUS_08160 810623 811471 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974312.1 protein_id gnl|my_center|LOCUS_08160 812569 811475 gene locus_tag LOCUS_08170 812569 811475 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 protein_id gnl|my_center|LOCUS_08170 813075 812581 gene locus_tag LOCUS_08180 gene purE 813075 812581 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_08180 814542 813169 gene locus_tag LOCUS_08190 814542 813169 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_08190 815972 814596 gene locus_tag LOCUS_08200 815972 814596 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_08200 816129 816204 gene locus_tag LOCUS_t00210 816129 816204 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 816237 816311 gene locus_tag LOCUS_t00220 816237 816311 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 817494 816757 gene locus_tag LOCUS_08210 817494 816757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 818641 817397 gene locus_tag LOCUS_08220 818641 817397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 819046 818663 gene locus_tag LOCUS_08230 819046 818663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 819223 819717 gene locus_tag LOCUS_08240 819223 819717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 819714 820793 gene locus_tag LOCUS_08250 819714 820793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 821791 821045 gene locus_tag LOCUS_08260 821791 821045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08260 823682 821805 gene locus_tag LOCUS_08270 823682 821805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08270 824867 823806 gene locus_tag LOCUS_08280 824867 823806 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615893.1 protein_id gnl|my_center|LOCUS_08280 825109 827769 gene locus_tag LOCUS_08290 825109 827769 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942321.1 protein_id gnl|my_center|LOCUS_08290 828407 827802 gene locus_tag LOCUS_08300 828407 827802 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143585.1 protein_id gnl|my_center|LOCUS_08300 829011 828421 gene locus_tag LOCUS_08310 829011 828421 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256689.1 protein_id gnl|my_center|LOCUS_08310 830090 829101 gene locus_tag LOCUS_08320 gene speB 830090 829101 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_08320 830232 831392 gene locus_tag LOCUS_08330 830232 831392 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969978.1 protein_id gnl|my_center|LOCUS_08330 831382 832506 gene locus_tag LOCUS_08340 831382 832506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434020.1 protein_id gnl|my_center|LOCUS_08340 832503 833363 gene locus_tag LOCUS_08350 832503 833363 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329325.1 protein_id gnl|my_center|LOCUS_08350 833370 834185 gene locus_tag LOCUS_08360 833370 834185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066629.1 protein_id gnl|my_center|LOCUS_08360 835189 834182 gene locus_tag LOCUS_08370 835189 834182 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139584.1 protein_id gnl|my_center|LOCUS_08370 836358 835186 gene locus_tag LOCUS_08380 836358 835186 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_08380 836419 837801 gene locus_tag LOCUS_08390 836419 837801 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087076.1 protein_id gnl|my_center|LOCUS_08390 837861 839429 gene locus_tag LOCUS_08400 837861 839429 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114932.1 protein_id gnl|my_center|LOCUS_08400 840699 839455 gene locus_tag LOCUS_08410 gene rocD 840699 839455 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977608.1 protein_id gnl|my_center|LOCUS_08410 842917 840794 gene locus_tag LOCUS_08420 842917 840794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 843064 843861 gene locus_tag LOCUS_08430 843064 843861 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704666.1 protein_id gnl|my_center|LOCUS_08430 844319 843867 gene locus_tag LOCUS_08440 844319 843867 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186317.1 protein_id gnl|my_center|LOCUS_08440 844481 844566 gene locus_tag LOCUS_t00230 844481 844566 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 845627 844593 gene locus_tag LOCUS_08450 845627 844593 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_08450 845931 846374 gene locus_tag LOCUS_08460 845931 846374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 846504 847577 gene locus_tag LOCUS_08470 846504 847577 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531383.1 protein_id gnl|my_center|LOCUS_08470 847574 848428 gene locus_tag LOCUS_08480 847574 848428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531382.1 protein_id gnl|my_center|LOCUS_08480 848425 849216 gene locus_tag LOCUS_08490 848425 849216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531381.1 protein_id gnl|my_center|LOCUS_08490 849218 850294 gene locus_tag LOCUS_08500 849218 850294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531380.1 protein_id gnl|my_center|LOCUS_08500 850992 850297 gene locus_tag LOCUS_08510 850992 850297 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_08510 851417 850989 gene locus_tag LOCUS_08520 851417 850989 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528883.1 protein_id gnl|my_center|LOCUS_08520 852972 851488 gene locus_tag LOCUS_08530 852972 851488 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467505.1 protein_id gnl|my_center|LOCUS_08530 854154 853030 gene locus_tag LOCUS_08540 854154 853030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 854848 854249 gene locus_tag LOCUS_08550 gene rdgB 854848 854249 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_08550 855574 854852 gene locus_tag LOCUS_08560 gene rph 855574 854852 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392056.1 protein_id gnl|my_center|LOCUS_08560 856323 855571 gene locus_tag LOCUS_08570 856323 855571 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229453.1 protein_id gnl|my_center|LOCUS_08570 857144 856320 gene locus_tag LOCUS_08580 gene murI 857144 856320 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908178.1 protein_id gnl|my_center|LOCUS_08580 858084 857149 gene locus_tag LOCUS_08590 858084 857149 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_08590 858165 858602 gene locus_tag LOCUS_08600 858165 858602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 858892 858611 gene locus_tag LOCUS_08610 858892 858611 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059911.1 protein_id gnl|my_center|LOCUS_08610 859741 858917 gene locus_tag LOCUS_08620 859741 858917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 860139 859738 gene locus_tag LOCUS_08630 gene mec 860139 859738 CDS product CysO-cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898830.1 protein_id gnl|my_center|LOCUS_08630 861235 860186 gene locus_tag LOCUS_08640 gene selD 861235 860186 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727954.1 protein_id gnl|my_center|LOCUS_08640 862030 861254 gene locus_tag LOCUS_08650 gene fabI 862030 861254 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_08650 862330 862031 gene locus_tag LOCUS_08660 862330 862031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 862980 862378 gene locus_tag LOCUS_08670 862980 862378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 863046 864062 gene locus_tag LOCUS_08680 863046 864062 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_08680 864059 864907 gene locus_tag LOCUS_08690 864059 864907 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_08690 866358 864940 gene locus_tag LOCUS_08700 866358 864940 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_08700 866570 866355 gene locus_tag LOCUS_08710 866570 866355 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028299.1 protein_id gnl|my_center|LOCUS_08710 867621 866581 gene locus_tag LOCUS_08720 gene speB 867621 866581 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_08720 869233 867656 gene locus_tag LOCUS_08730 869233 867656 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 protein_id gnl|my_center|LOCUS_08730 870834 869233 gene locus_tag LOCUS_08740 870834 869233 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_08740 870939 872129 gene locus_tag LOCUS_08750 870939 872129 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_08750 872190 874088 gene locus_tag LOCUS_08760 872190 874088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 874093 875358 gene locus_tag LOCUS_08770 874093 875358 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530809.1 protein_id gnl|my_center|LOCUS_08770 875355 875795 gene locus_tag LOCUS_08780 875355 875795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 877231 875813 gene locus_tag LOCUS_08790 877231 875813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 877423 878031 gene locus_tag LOCUS_08800 877423 878031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 878893 878546 gene locus_tag LOCUS_tm00010 878893 878546 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 879424 878954 gene locus_tag LOCUS_08810 gene smpB 879424 878954 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056461.1 protein_id gnl|my_center|LOCUS_08810 880332 879424 gene locus_tag LOCUS_08820 gene ftsX 880332 879424 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223155.1 protein_id gnl|my_center|LOCUS_08820 881066 880332 gene locus_tag LOCUS_08830 gene ftsE 881066 880332 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_08830 881143 883512 gene locus_tag LOCUS_08840 881143 883512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 884236 883460 gene locus_tag LOCUS_08850 884236 883460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 885788 884610 gene locus_tag LOCUS_08860 885788 884610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08860 886935 886693 gene locus_tag LOCUS_08870 886935 886693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08870 887059 886877 gene locus_tag LOCUS_08880 887059 886877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08880 887350 887096 gene locus_tag LOCUS_08890 887350 887096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08890 889128 887479 gene locus_tag LOCUS_08900 889128 887479 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021953.1 protein_id gnl|my_center|LOCUS_08900 889852 889172 gene locus_tag LOCUS_08910 889852 889172 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_08910 890223 889849 gene locus_tag LOCUS_08920 890223 889849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 891061 890447 gene locus_tag LOCUS_08930 891061 890447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 891852 891238 gene locus_tag LOCUS_08940 891852 891238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 893111 891858 gene locus_tag LOCUS_08950 gene ahcY 893111 891858 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_08950 893938 893114 gene locus_tag LOCUS_08960 893938 893114 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_08960 895017 893956 gene locus_tag LOCUS_08970 895017 893956 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392147.1 protein_id gnl|my_center|LOCUS_08970 895193 895014 gene locus_tag LOCUS_08980 895193 895014 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861608.1 protein_id gnl|my_center|LOCUS_08980 896548 895190 gene locus_tag LOCUS_08990 896548 895190 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_08990 896895 896665 gene locus_tag LOCUS_09000 896895 896665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 897258 897055 gene locus_tag LOCUS_09010 897258 897055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 898444 897317 gene locus_tag LOCUS_09020 898444 897317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 899102 898566 gene locus_tag LOCUS_09030 899102 898566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 899377 899111 gene locus_tag LOCUS_09040 899377 899111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 899895 899374 gene locus_tag LOCUS_09050 899895 899374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 901363 900014 gene locus_tag LOCUS_09060 901363 900014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 904425 901360 gene locus_tag LOCUS_09070 904425 901360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 904893 904522 gene locus_tag LOCUS_09080 904893 904522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 905155 904928 gene locus_tag LOCUS_09090 905155 904928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 907855 905339 gene locus_tag LOCUS_09100 907855 905339 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029648.1 protein_id gnl|my_center|LOCUS_09100 907885 908832 gene locus_tag LOCUS_09110 gene cofD 907885 908832 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_09110 908840 910153 gene locus_tag LOCUS_09120 908840 910153 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_09120 910214 910960 gene locus_tag LOCUS_09130 910214 910960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 910968 911741 gene locus_tag LOCUS_09140 910968 911741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 913026 911755 gene locus_tag LOCUS_09150 913026 911755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 914658 913633 gene locus_tag LOCUS_09160 914658 913633 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080830.1 protein_id gnl|my_center|LOCUS_09160 915521 914655 gene locus_tag LOCUS_09170 gene wbbL 915521 914655 CDS product N-acetylglucosaminyl-diphospho-decaprenol L-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901582.1 protein_id gnl|my_center|LOCUS_09170 915892 915518 gene locus_tag LOCUS_09180 915892 915518 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944750.1 protein_id gnl|my_center|LOCUS_09180 917118 915937 gene locus_tag LOCUS_09190 917118 915937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_09190 917954 917115 gene locus_tag LOCUS_09200 917954 917115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 919337 918111 gene locus_tag LOCUS_09210 919337 918111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 920386 919337 gene locus_tag LOCUS_09220 920386 919337 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256870.1 protein_id gnl|my_center|LOCUS_09220 920751 920383 gene locus_tag LOCUS_09230 920751 920383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 921604 920783 gene locus_tag LOCUS_09240 gene rfbD 921604 920783 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664667.1 protein_id gnl|my_center|LOCUS_09240 922611 921613 gene locus_tag LOCUS_09250 gene rfbB 922611 921613 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_09250 923768 922659 gene locus_tag LOCUS_09260 923768 922659 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_09260 924920 923856 gene locus_tag LOCUS_09270 924920 923856 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_09270 926351 924930 gene locus_tag LOCUS_09280 926351 924930 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_09280 926532 927194 gene locus_tag LOCUS_09290 926532 927194 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_09290 927191 927913 gene locus_tag LOCUS_09300 927191 927913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 927965 929158 gene locus_tag LOCUS_09310 927965 929158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 930490 929162 gene locus_tag LOCUS_09320 930490 929162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 930706 931200 gene locus_tag LOCUS_09330 930706 931200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 931211 931882 gene locus_tag LOCUS_09340 931211 931882 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_09340 934607 931887 gene locus_tag LOCUS_09350 gene acnA 934607 931887 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_09350 935190 934615 gene locus_tag LOCUS_09360 935190 934615 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873063.1 protein_id gnl|my_center|LOCUS_09360 935407 935970 gene locus_tag LOCUS_09370 935407 935970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 936017 936952 gene locus_tag LOCUS_09380 936017 936952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223613.1 protein_id gnl|my_center|LOCUS_09380 936949 938685 gene locus_tag LOCUS_09390 936949 938685 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881096.1 protein_id gnl|my_center|LOCUS_09390 938697 939860 gene locus_tag LOCUS_09400 938697 939860 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223610.1 protein_id gnl|my_center|LOCUS_09400 939847 942402 gene locus_tag LOCUS_09410 939847 942402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 942571 945555 gene locus_tag LOCUS_09420 942571 945555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 946744 945566 gene locus_tag LOCUS_09430 946744 945566 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_09430 948599 946770 gene locus_tag LOCUS_09440 948599 946770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 948733 949110 gene locus_tag LOCUS_09450 948733 949110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 949107 949544 gene locus_tag LOCUS_09460 gene mce 949107 949544 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172482.1 protein_id gnl|my_center|LOCUS_09460 950782 949541 gene locus_tag LOCUS_09470 gene ccrA 950782 949541 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078168.1 protein_id gnl|my_center|LOCUS_09470 951520 950831 gene locus_tag LOCUS_09480 gene pgl 951520 950831 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_09480 952560 951526 gene locus_tag LOCUS_09490 gene gnd 952560 951526 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405880.1 protein_id gnl|my_center|LOCUS_09490 952657 954069 gene locus_tag LOCUS_09500 952657 954069 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898735.1 protein_id gnl|my_center|LOCUS_09500 955024 954074 gene locus_tag LOCUS_09510 955024 954074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 955078 955527 gene locus_tag LOCUS_09520 955078 955527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 956088 957167 gene locus_tag LOCUS_09530 956088 957167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09530 957160 957417 gene locus_tag LOCUS_09540 957160 957417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 957414 957701 gene locus_tag LOCUS_09550 957414 957701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 957698 958813 gene locus_tag LOCUS_09560 957698 958813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 958810 959823 gene locus_tag LOCUS_09570 958810 959823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 960596 959739 gene locus_tag LOCUS_09580 960596 959739 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_09580 961193 960618 gene locus_tag LOCUS_09590 961193 960618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 961248 961817 gene locus_tag LOCUS_09600 961248 961817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 961884 962561 gene locus_tag LOCUS_09610 961884 962561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 962568 963143 gene locus_tag LOCUS_09620 962568 963143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 963618 965090 gene locus_tag LOCUS_09630 963618 965090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 965087 965500 gene locus_tag LOCUS_09640 965087 965500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 965497 966096 gene locus_tag LOCUS_09650 965497 966096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 966093 967334 gene locus_tag LOCUS_09660 966093 967334 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807943.1 protein_id gnl|my_center|LOCUS_09660 967331 968110 gene locus_tag LOCUS_09670 967331 968110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 969321 968116 gene locus_tag LOCUS_09680 969321 968116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 972589 969476 gene locus_tag LOCUS_09690 972589 969476 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967237.1 protein_id gnl|my_center|LOCUS_09690 973050 972703 gene locus_tag LOCUS_09700 973050 972703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 973708 973100 gene locus_tag LOCUS_09710 973708 973100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 974498 973719 gene locus_tag LOCUS_09720 974498 973719 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_09720 974544 976274 gene locus_tag LOCUS_09730 974544 976274 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776132.1 protein_id gnl|my_center|LOCUS_09730 976954 976271 gene locus_tag LOCUS_09740 gene npdG 976954 976271 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_09740 978576 976990 gene locus_tag LOCUS_09750 978576 976990 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_09750 978630 979280 gene locus_tag LOCUS_09760 978630 979280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 979430 979834 gene locus_tag LOCUS_09770 gene sdhC 979430 979834 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222765.1 protein_id gnl|my_center|LOCUS_09770 979822 980292 gene locus_tag LOCUS_09780 979822 980292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 980299 982038 gene locus_tag LOCUS_09790 gene sdhA 980299 982038 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 protein_id gnl|my_center|LOCUS_09790 982038 982802 gene locus_tag LOCUS_09800 982038 982802 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974116.1 protein_id gnl|my_center|LOCUS_09800 982855 983922 gene locus_tag LOCUS_09810 982855 983922 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143081.1 protein_id gnl|my_center|LOCUS_09810 984002 984556 gene locus_tag LOCUS_09820 984002 984556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 985476 984553 gene locus_tag LOCUS_09830 gene mdh 985476 984553 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_09830 986765 985566 gene locus_tag LOCUS_09840 986765 985566 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_09840 987902 986814 gene locus_tag LOCUS_09850 987902 986814 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_09850 987971 989089 gene locus_tag LOCUS_09860 gene citZ 987971 989089 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_09860 990883 989096 gene locus_tag LOCUS_09870 990883 989096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 992463 990919 gene locus_tag LOCUS_09880 gene purH 992463 990919 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_09880 993079 992456 gene locus_tag LOCUS_09890 gene purN 993079 992456 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938037.1 protein_id gnl|my_center|LOCUS_09890 993180 993800 gene locus_tag LOCUS_09900 993180 993800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 994684 993797 gene locus_tag LOCUS_09910 gene sucD 994684 993797 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403441.1 protein_id gnl|my_center|LOCUS_09910 995826 994681 gene locus_tag LOCUS_09920 gene sucC 995826 994681 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031022.1 protein_id gnl|my_center|LOCUS_09920 996264 995848 gene locus_tag LOCUS_09930 996264 995848 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_09930 996695 996357 gene locus_tag LOCUS_09940 996695 996357 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_09940 997066 996692 gene locus_tag LOCUS_09950 gene crcB 997066 996692 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_09950 997170 997343 gene locus_tag LOCUS_09960 997170 997343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 997396 997776 gene locus_tag LOCUS_09970 997396 997776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 997808 999268 gene locus_tag LOCUS_09980 997808 999268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532098.1 protein_id gnl|my_center|LOCUS_09980 999940 999278 gene locus_tag LOCUS_09990 999940 999278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09990 1001537 999906 gene locus_tag LOCUS_10000 1001537 999906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10000 1001536 1002192 gene locus_tag LOCUS_10010 1001536 1002192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10010 1002226 1002744 gene locus_tag LOCUS_10020 1002226 1002744 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061267.1 protein_id gnl|my_center|LOCUS_10020 1002741 1003388 gene locus_tag LOCUS_10030 1002741 1003388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1004934 1003396 gene locus_tag LOCUS_10040 gene guaA 1004934 1003396 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_10040 1006129 1004969 gene locus_tag LOCUS_10050 1006129 1004969 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_10050 1006206 1007612 gene locus_tag LOCUS_10060 1006206 1007612 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393312.1 protein_id gnl|my_center|LOCUS_10060 1008233 1007616 gene locus_tag LOCUS_10070 1008233 1007616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1009636 1008230 gene locus_tag LOCUS_10080 1009636 1008230 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_10080 1009761 1010162 gene locus_tag LOCUS_10090 1009761 1010162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1011321 1010164 gene locus_tag LOCUS_10100 1011321 1010164 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_10100 1011817 1011329 gene locus_tag LOCUS_10110 1011817 1011329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10110 1012947 1011814 gene locus_tag LOCUS_10120 1012947 1011814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10120 1013314 1013018 gene locus_tag LOCUS_10130 gene groES 1013314 1013018 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974211.1 protein_id gnl|my_center|LOCUS_10130 1013566 1015308 gene locus_tag LOCUS_10140 1013566 1015308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1016582 1015305 gene locus_tag LOCUS_10150 1016582 1015305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1016842 1018104 gene locus_tag LOCUS_10160 1016842 1018104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1018471 1019379 gene locus_tag LOCUS_10170 1018471 1019379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1020176 1019376 gene locus_tag LOCUS_10180 1020176 1019376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1021198 1020173 gene locus_tag LOCUS_10190 1021198 1020173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1022068 1021271 gene locus_tag LOCUS_10200 1022068 1021271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1022094 1023020 gene locus_tag LOCUS_10210 1022094 1023020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1023007 1024443 gene locus_tag LOCUS_10220 1023007 1024443 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172046.1 protein_id gnl|my_center|LOCUS_10220 1024440 1025441 gene locus_tag LOCUS_10230 1024440 1025441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1026379 1025405 gene locus_tag LOCUS_10240 1026379 1025405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1026433 1027698 gene locus_tag LOCUS_10250 1026433 1027698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1028586 1027585 gene locus_tag LOCUS_10260 1028586 1027585 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140467.1 protein_id gnl|my_center|LOCUS_10260 1029542 1028583 gene locus_tag LOCUS_10270 1029542 1028583 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061504.1 protein_id gnl|my_center|LOCUS_10270 1029694 1030518 gene locus_tag LOCUS_10280 1029694 1030518 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143505.1 protein_id gnl|my_center|LOCUS_10280 1031675 1030515 gene locus_tag LOCUS_10290 1031675 1030515 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_10290 1032723 1031734 gene locus_tag LOCUS_10300 1032723 1031734 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_10300 1033550 1032720 gene locus_tag LOCUS_10310 1033550 1032720 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_10310 1035001 1033553 gene locus_tag LOCUS_10320 1035001 1033553 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259622.1 protein_id gnl|my_center|LOCUS_10320 1035913 1035248 gene locus_tag LOCUS_10330 1035913 1035248 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224637.1 protein_id gnl|my_center|LOCUS_10330 1036545 1035910 gene locus_tag LOCUS_10340 1036545 1035910 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_10340 1037488 1036547 gene locus_tag LOCUS_10350 gene galE1 1037488 1036547 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419610.1 protein_id gnl|my_center|LOCUS_10350 1038492 1037485 gene locus_tag LOCUS_10360 gene tsaD 1038492 1037485 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_10360 1038983 1038489 gene locus_tag LOCUS_10370 gene rimI 1038983 1038489 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_10370 1040203 1039700 gene locus_tag LOCUS_10380 gene tsaE 1040203 1039700 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 protein_id gnl|my_center|LOCUS_10380 1040838 1040206 gene locus_tag LOCUS_10390 1040838 1040206 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_10390 1041709 1040981 gene locus_tag LOCUS_10400 1041709 1040981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10400 1042904 1042530 gene locus_tag LOCUS_10410 1042904 1042530 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939195.1 protein_id gnl|my_center|LOCUS_10410 1042978 1043406 gene locus_tag LOCUS_10420 1042978 1043406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1045222 1043393 gene locus_tag LOCUS_10430 gene glmS 1045222 1043393 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466588.1 protein_id gnl|my_center|LOCUS_10430 1046588 1045263 gene locus_tag LOCUS_10440 gene glmM 1046588 1045263 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_10440 1046644 1046934 gene locus_tag LOCUS_10450 1046644 1046934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1047311 1046916 gene locus_tag LOCUS_10460 gene rpsI 1047311 1046916 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418308.1 protein_id gnl|my_center|LOCUS_10460 1047804 1047316 gene locus_tag LOCUS_10470 gene rplM 1047804 1047316 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_10470 1048680 1047922 gene locus_tag LOCUS_10480 1048680 1047922 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222671.1 protein_id gnl|my_center|LOCUS_10480 1049074 1048661 gene locus_tag LOCUS_10490 1049074 1048661 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112711.1 protein_id gnl|my_center|LOCUS_10490 1049803 1049153 gene locus_tag LOCUS_10500 gene truA 1049803 1049153 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_10500 1050278 1049916 gene locus_tag LOCUS_10510 1050278 1049916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1051237 1050278 gene locus_tag LOCUS_10520 1051237 1050278 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_10520 1051717 1051325 gene locus_tag LOCUS_10530 gene rpsK 1051717 1051325 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055956.1 protein_id gnl|my_center|LOCUS_10530 1052115 1051735 gene locus_tag LOCUS_10540 gene rpsM 1052115 1051735 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004571523.1 protein_id gnl|my_center|LOCUS_10540 1052474 1052256 gene locus_tag LOCUS_10550 gene infA 1052474 1052256 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583256.1 protein_id gnl|my_center|LOCUS_10550 1053910 1052633 gene locus_tag LOCUS_10560 1053910 1052633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1054778 1054017 gene locus_tag LOCUS_10570 gene map 1054778 1054017 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_10570 1055437 1054775 gene locus_tag LOCUS_10580 1055437 1054775 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869908.1 protein_id gnl|my_center|LOCUS_10580 1056736 1055459 gene locus_tag LOCUS_10590 gene secY 1056736 1055459 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_10590 1057193 1056750 gene locus_tag LOCUS_10600 gene rplO 1057193 1056750 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814543.1 protein_id gnl|my_center|LOCUS_10600 1057384 1057190 gene locus_tag LOCUS_10610 gene rpmD 1057384 1057190 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_10610 1058016 1057381 gene locus_tag LOCUS_10620 gene rpsE 1058016 1057381 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_10620 1058369 1058016 gene locus_tag LOCUS_10630 gene rplR 1058369 1058016 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 protein_id gnl|my_center|LOCUS_10630 1058920 1058369 gene locus_tag LOCUS_10640 gene rplF 1058920 1058369 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 protein_id gnl|my_center|LOCUS_10640 1059345 1058920 gene locus_tag LOCUS_10650 gene rpsH 1059345 1058920 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_10650 1059524 1059339 gene locus_tag LOCUS_10660 1059524 1059339 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633399.1 protein_id gnl|my_center|LOCUS_10660 1060114 1059539 gene locus_tag LOCUS_10670 gene rplE 1060114 1059539 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403660.1 protein_id gnl|my_center|LOCUS_10670 1060452 1060114 gene locus_tag LOCUS_10680 gene rplX 1060452 1060114 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_10680 1060826 1060455 gene locus_tag LOCUS_10690 gene rplN 1060826 1060455 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055680.1 protein_id gnl|my_center|LOCUS_10690 1061089 1060823 gene locus_tag LOCUS_10700 gene rpsQ 1061089 1060823 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_10700 1061334 1061086 gene locus_tag LOCUS_10710 1061334 1061086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1061744 1061331 gene locus_tag LOCUS_10720 gene rplP 1061744 1061331 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_10720 1062730 1061744 gene locus_tag LOCUS_10730 1062730 1061744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1063078 1062731 gene locus_tag LOCUS_10740 gene rplV 1063078 1062731 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_10740 1063361 1063080 gene locus_tag LOCUS_10750 gene rpsS 1063361 1063080 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_10750 1064191 1063361 gene locus_tag LOCUS_10760 gene rplB 1064191 1063361 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974264.1 protein_id gnl|my_center|LOCUS_10760 1064481 1064191 gene locus_tag LOCUS_10770 1064481 1064191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1065110 1064478 gene locus_tag LOCUS_10780 gene rplD 1065110 1064478 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_10780 1065766 1065110 gene locus_tag LOCUS_10790 gene rplC 1065766 1065110 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_10790 1066079 1065771 gene locus_tag LOCUS_10800 gene rpsJ 1066079 1065771 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_10800 1067276 1066092 gene locus_tag LOCUS_10810 gene tuf 1067276 1066092 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869930.1 protein_id gnl|my_center|LOCUS_10810 1069453 1067294 gene locus_tag LOCUS_10820 gene fusA 1069453 1067294 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_10820 1069988 1069518 gene locus_tag LOCUS_10830 gene rpsG 1069988 1069518 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892787.1 protein_id gnl|my_center|LOCUS_10830 1070364 1069990 gene locus_tag LOCUS_10840 gene rpsL 1070364 1069990 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_10840 1071009 1074815 gene locus_tag LOCUS_10850 1071009 1074815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1075827 1074985 gene locus_tag LOCUS_10860 1075827 1074985 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779169.1 protein_id gnl|my_center|LOCUS_10860 1076260 1076694 gene locus_tag LOCUS_10870 1076260 1076694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1076767 1076976 gene locus_tag LOCUS_10880 1076767 1076976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1077255 1078037 gene locus_tag LOCUS_10890 1077255 1078037 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_10890 1081193 1078068 gene locus_tag LOCUS_10900 1081193 1078068 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10900 1081217 1081495 gene locus_tag LOCUS_10910 1081217 1081495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1082374 1081598 gene locus_tag LOCUS_10920 1082374 1081598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10920 1082926 1082750 gene locus_tag LOCUS_10930 1082926 1082750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10930 1083647 1083114 gene locus_tag LOCUS_10940 1083647 1083114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10940 1084092 1083754 gene locus_tag LOCUS_10950 1084092 1083754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10950 1085114 1084050 gene locus_tag LOCUS_10960 1085114 1084050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10960 1085308 1085529 gene locus_tag LOCUS_10970 1085308 1085529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1086163 1085663 gene locus_tag LOCUS_10980 gene rfbC 1086163 1085663 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 protein_id gnl|my_center|LOCUS_10980 1086606 1086229 gene locus_tag LOCUS_10990 1086606 1086229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1087088 1086687 gene locus_tag LOCUS_11000 gene rplL 1087088 1086687 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112006.1 protein_id gnl|my_center|LOCUS_11000 1087636 1087088 gene locus_tag LOCUS_11010 gene rplJ 1087636 1087088 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403341.1 protein_id gnl|my_center|LOCUS_11010 1087891 1089288 gene locus_tag LOCUS_11020 1087891 1089288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1090303 1089299 gene locus_tag LOCUS_11030 1090303 1089299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11030 1091584 1090865 gene locus_tag LOCUS_11040 gene rplA 1091584 1090865 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061480.1 protein_id gnl|my_center|LOCUS_11040 1092009 1091581 gene locus_tag LOCUS_11050 gene rplK 1092009 1091581 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811655.1 protein_id gnl|my_center|LOCUS_11050 1092883 1092068 gene locus_tag LOCUS_11060 1092883 1092068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1093218 1092910 gene locus_tag LOCUS_11070 1093218 1092910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1093305 1093231 gene locus_tag LOCUS_t00240 1093305 1093231 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1093500 1094936 gene locus_tag LOCUS_11080 1093500 1094936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1095330 1094872 gene locus_tag LOCUS_11090 1095330 1094872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1095713 1095327 gene locus_tag LOCUS_11100 1095713 1095327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1095859 1096638 gene locus_tag LOCUS_11110 1095859 1096638 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_11110 1096815 1096648 gene locus_tag LOCUS_11120 gene rpmG 1096815 1096648 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_11120 1098009 1096825 gene locus_tag LOCUS_11130 gene tuf 1098009 1096825 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869930.1 protein_id gnl|my_center|LOCUS_11130 1098118 1098046 gene locus_tag LOCUS_t00250 1098118 1098046 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1098263 1098190 gene locus_tag LOCUS_t00260 1098263 1098190 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1098343 1098813 gene locus_tag LOCUS_11140 1098343 1098813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1098810 1099130 gene locus_tag LOCUS_11150 1098810 1099130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1099311 1099227 gene locus_tag LOCUS_t00270 1099311 1099227 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1099374 1099871 gene locus_tag LOCUS_11160 1099374 1099871 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_11160 1099945 1101327 gene locus_tag LOCUS_11170 1099945 1101327 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_11170 1101344 1102717 gene locus_tag LOCUS_11180 1101344 1102717 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 protein_id gnl|my_center|LOCUS_11180 1103602 1102718 gene locus_tag LOCUS_11190 gene htpX 1103602 1102718 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189409.1 protein_id gnl|my_center|LOCUS_11190 1105206 1103725 gene locus_tag LOCUS_11200 1105206 1103725 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_11200 1106751 1105210 gene locus_tag LOCUS_11210 1106751 1105210 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_11210 1108768 1106759 gene locus_tag LOCUS_11220 gene nuoL 1108768 1106759 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_11220 1109064 1108762 gene locus_tag LOCUS_11230 gene nuoK 1109064 1108762 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056517.1 protein_id gnl|my_center|LOCUS_11230 1109573 1108968 gene locus_tag LOCUS_11240 1109573 1108968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1110076 1109570 gene locus_tag LOCUS_11250 1110076 1109570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1111017 1110076 gene locus_tag LOCUS_11260 1111017 1110076 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_11260 1111589 1111074 gene locus_tag LOCUS_11270 1111589 1111074 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396799.1 protein_id gnl|my_center|LOCUS_11270 1112073 1111567 gene locus_tag LOCUS_11280 1112073 1111567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1112432 1112064 gene locus_tag LOCUS_11290 1112432 1112064 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 protein_id gnl|my_center|LOCUS_11290 1113505 1112498 gene locus_tag LOCUS_11300 1113505 1112498 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222468.1 protein_id gnl|my_center|LOCUS_11300 1114955 1113510 gene locus_tag LOCUS_11310 1114955 1113510 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_11310 1116487 1114952 gene locus_tag LOCUS_11320 1116487 1114952 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_11320 1118397 1116484 gene locus_tag LOCUS_11330 gene nuoL 1118397 1116484 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950837.1 protein_id gnl|my_center|LOCUS_11330 1118696 1118391 gene locus_tag LOCUS_11340 gene nuoK 1118696 1118391 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_11340 1119280 1118693 gene locus_tag LOCUS_11350 1119280 1118693 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_11350 1119781 1119281 gene locus_tag LOCUS_11360 1119781 1119281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1120893 1119778 gene locus_tag LOCUS_11370 gene nuoH 1120893 1119778 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_11370 1123307 1120893 gene locus_tag LOCUS_11380 1123307 1120893 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029735.1 protein_id gnl|my_center|LOCUS_11380 1124659 1123304 gene locus_tag LOCUS_11390 gene nuoF 1124659 1123304 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_11390 1125198 1124602 gene locus_tag LOCUS_11400 1125198 1124602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11400 1126481 1125195 gene locus_tag LOCUS_11410 gene nuoD 1126481 1125195 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728123.1 protein_id gnl|my_center|LOCUS_11410 1126981 1126481 gene locus_tag LOCUS_11420 1126981 1126481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1127496 1126978 gene locus_tag LOCUS_11430 1127496 1126978 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_11430 1127926 1127486 gene locus_tag LOCUS_11440 1127926 1127486 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_11440 1128664 1127939 gene locus_tag LOCUS_11450 1128664 1127939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11450 1128948 1129259 gene locus_tag LOCUS_11460 1128948 1129259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1129783 1129322 gene locus_tag LOCUS_11470 1129783 1129322 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484772.1 protein_id gnl|my_center|LOCUS_11470 1130685 1129780 gene locus_tag LOCUS_11480 1130685 1129780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1130684 1132537 gene locus_tag LOCUS_11490 1130684 1132537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1133042 1132524 gene locus_tag LOCUS_11500 1133042 1132524 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_11500 1134030 1133050 gene locus_tag LOCUS_11510 1134030 1133050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1134857 1134027 gene locus_tag LOCUS_11520 gene ctaG 1134857 1134027 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069017.1 protein_id gnl|my_center|LOCUS_11520 1135215 1134862 gene locus_tag LOCUS_11530 1135215 1134862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1135820 1135212 gene locus_tag LOCUS_11540 1135820 1135212 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_11540 1137700 1135820 gene locus_tag LOCUS_11550 gene ctaD 1137700 1135820 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232245.1 protein_id gnl|my_center|LOCUS_11550 1138818 1137712 gene locus_tag LOCUS_11560 gene coxB 1138818 1137712 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745268.1 protein_id gnl|my_center|LOCUS_11560 1139843 1138884 gene locus_tag LOCUS_11570 1139843 1138884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1141447 1139840 gene locus_tag LOCUS_11580 1141447 1139840 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142120627.1 protein_id gnl|my_center|LOCUS_11580 1142244 1141495 gene locus_tag LOCUS_11590 1142244 1141495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1142505 1142918 gene locus_tag LOCUS_11600 1142505 1142918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1142929 1143330 gene locus_tag LOCUS_11610 1142929 1143330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1143366 1144139 gene locus_tag LOCUS_11620 1143366 1144139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1144152 1144994 gene locus_tag LOCUS_11630 1144152 1144994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1144991 1145704 gene locus_tag LOCUS_11640 1144991 1145704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1145713 1146426 gene locus_tag LOCUS_11650 1145713 1146426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1146426 1147178 gene locus_tag LOCUS_11660 1146426 1147178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1148100 1147306 gene locus_tag LOCUS_11670 1148100 1147306 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_11670 1148364 1148131 gene locus_tag LOCUS_11680 1148364 1148131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1148425 1149036 gene locus_tag LOCUS_11690 1148425 1149036 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_11690 1149033 1149737 gene locus_tag LOCUS_11700 1149033 1149737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1150478 1149777 gene locus_tag LOCUS_11710 1150478 1149777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1150651 1151304 gene locus_tag LOCUS_11720 1150651 1151304 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11720 1152271 1151483 gene locus_tag LOCUS_11730 1152271 1151483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1153068 1152415 gene locus_tag LOCUS_11740 1153068 1152415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1154176 1153298 gene locus_tag LOCUS_11750 1154176 1153298 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_11750 1154156 1154989 gene locus_tag LOCUS_11760 1154156 1154989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1155032 1155358 gene locus_tag LOCUS_11770 1155032 1155358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1155355 1155864 gene locus_tag LOCUS_11780 1155355 1155864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1157310 1155877 gene locus_tag LOCUS_11790 gene pyk 1157310 1155877 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227631.1 protein_id gnl|my_center|LOCUS_11790 1158095 1157307 gene locus_tag LOCUS_11800 1158095 1157307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11800 1159808 1158441 gene locus_tag LOCUS_11810 1159808 1158441 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339635.1 protein_id gnl|my_center|LOCUS_11810 1160593 1159805 gene locus_tag LOCUS_11820 1160593 1159805 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_11820 1161507 1160590 gene locus_tag LOCUS_11830 1161507 1160590 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768681.1 protein_id gnl|my_center|LOCUS_11830 1162826 1161531 gene locus_tag LOCUS_11840 1162826 1161531 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143837.1 protein_id gnl|my_center|LOCUS_11840 1164388 1162823 gene locus_tag LOCUS_11850 1164388 1162823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1164712 1164521 gene locus_tag LOCUS_11860 1164712 1164521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1165371 1164823 gene locus_tag LOCUS_11870 1165371 1164823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1165840 1165532 gene locus_tag LOCUS_11880 1165840 1165532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1166404 1166192 gene locus_tag LOCUS_11890 1166404 1166192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1166863 1166600 gene locus_tag LOCUS_11900 1166863 1166600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1167653 1166820 gene locus_tag LOCUS_11910 1167653 1166820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1168137 1167658 gene locus_tag LOCUS_11920 1168137 1167658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1168350 1169486 gene locus_tag LOCUS_11930 1168350 1169486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1169552 1169719 gene locus_tag LOCUS_11940 1169552 1169719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1170031 1169720 gene locus_tag LOCUS_11950 1170031 1169720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1170776 1170042 gene locus_tag LOCUS_11960 1170776 1170042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1171100 1170852 gene locus_tag LOCUS_11970 1171100 1170852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1171736 1171263 gene locus_tag LOCUS_11980 1171736 1171263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1171940 1172746 gene locus_tag LOCUS_11990 1171940 1172746 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 protein_id gnl|my_center|LOCUS_11990 1172923 1172795 gene locus_tag LOCUS_12000 1172923 1172795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1173756 1172923 gene locus_tag LOCUS_12010 gene proC 1173756 1172923 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_12010 1174426 1173764 gene locus_tag LOCUS_12020 1174426 1173764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1176204 1174957 gene locus_tag LOCUS_12030 gene mshA 1176204 1174957 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_12030 1176787 1176242 gene locus_tag LOCUS_12040 1176787 1176242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1177967 1176789 gene locus_tag LOCUS_12050 gene sat 1177967 1176789 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_12050 1178945 1178031 gene locus_tag LOCUS_12060 1178945 1178031 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229709.1 protein_id gnl|my_center|LOCUS_12060 1179011 1179490 gene locus_tag LOCUS_12070 1179011 1179490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1179746 1179438 gene locus_tag LOCUS_12080 1179746 1179438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1179948 1180469 gene locus_tag LOCUS_12090 1179948 1180469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12090 1180979 1182382 gene locus_tag LOCUS_12100 gene glnA 1180979 1182382 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_12100 1185005 1182453 gene locus_tag LOCUS_12110 1185005 1182453 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_12110 1185421 1185080 gene locus_tag LOCUS_12120 1185421 1185080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1185642 1185421 gene locus_tag LOCUS_12130 1185642 1185421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1185756 1187084 gene locus_tag LOCUS_12140 gene glnA 1185756 1187084 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_12140 1187164 1187640 gene locus_tag LOCUS_12150 1187164 1187640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1187683 1189302 gene locus_tag LOCUS_12160 1187683 1189302 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_12160 1190087 1189377 gene locus_tag LOCUS_12170 1190087 1189377 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143260.1 protein_id gnl|my_center|LOCUS_12170 1190177 1190252 gene locus_tag LOCUS_t00280 1190177 1190252 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1191394 1190276 gene locus_tag LOCUS_12180 1191394 1190276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1192025 1191492 gene locus_tag LOCUS_12190 1192025 1191492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1192265 1192495 gene locus_tag LOCUS_12200 1192265 1192495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1192583 1193983 gene locus_tag LOCUS_12210 1192583 1193983 CDS product DUF3631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230503.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12210 1193976 1194626 gene locus_tag LOCUS_12220 1193976 1194626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1195106 1195279 gene locus_tag LOCUS_12230 1195106 1195279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12230 1195312 1195686 gene locus_tag LOCUS_12240 1195312 1195686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12240 1195811 1196299 gene locus_tag LOCUS_12250 1195811 1196299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12250 1197033 1196506 gene locus_tag LOCUS_12260 1197033 1196506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1197610 1196963 gene locus_tag LOCUS_12270 1197610 1196963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1198390 1197620 gene locus_tag LOCUS_12280 1198390 1197620 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112685.1 protein_id gnl|my_center|LOCUS_12280 1198757 1199728 gene locus_tag LOCUS_12290 1198757 1199728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1199940 1200335 gene locus_tag LOCUS_12300 1199940 1200335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1200347 1203103 gene locus_tag LOCUS_12310 1200347 1203103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1203090 1203677 gene locus_tag LOCUS_12320 1203090 1203677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1204299 1206914 gene locus_tag LOCUS_12330 1204299 1206914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12330 1206868 1207266 gene locus_tag LOCUS_12340 1206868 1207266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1207266 1211123 gene locus_tag LOCUS_12350 gene pglX 1207266 1211123 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942751.1 protein_id gnl|my_center|LOCUS_12350 1211125 1213569 gene locus_tag LOCUS_12360 1211125 1213569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1213874 1215646 gene locus_tag LOCUS_12370 gene brxL 1213874 1215646 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942749.1 protein_id gnl|my_center|LOCUS_12370 1216189 1215650 gene locus_tag LOCUS_12380 1216189 1215650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1216632 1216189 gene locus_tag LOCUS_12390 1216632 1216189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1217048 1216629 gene locus_tag LOCUS_12400 1217048 1216629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1217212 1217571 gene locus_tag LOCUS_12410 1217212 1217571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1217720 1218826 gene locus_tag LOCUS_12420 1217720 1218826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1219398 1218823 gene locus_tag LOCUS_12430 1219398 1218823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1219625 1219419 gene locus_tag LOCUS_12440 1219625 1219419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1220388 1220020 gene locus_tag LOCUS_12450 1220388 1220020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1221629 1220946 gene locus_tag LOCUS_12460 1221629 1220946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1222240 1222707 gene locus_tag LOCUS_12470 1222240 1222707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1222693 1222766 gene locus_tag LOCUS_t00290 1222693 1222766 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1222783 1222858 gene locus_tag LOCUS_t00300 1222783 1222858 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1222890 1222964 gene locus_tag LOCUS_t00310 1222890 1222964 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1223771 1222968 gene locus_tag LOCUS_12480 1223771 1222968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 protein_id gnl|my_center|LOCUS_12480 1223827 1224948 gene locus_tag LOCUS_12490 gene pdhA 1223827 1224948 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730030.1 protein_id gnl|my_center|LOCUS_12490 1224945 1225949 gene locus_tag LOCUS_12500 1224945 1225949 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229326.1 protein_id gnl|my_center|LOCUS_12500 1225949 1227007 gene locus_tag LOCUS_12510 1225949 1227007 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886148.1 protein_id gnl|my_center|LOCUS_12510 1227004 1227918 gene locus_tag LOCUS_12520 1227004 1227918 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_12520 1228471 1227965 gene locus_tag LOCUS_12530 1228471 1227965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1228739 1229317 gene locus_tag LOCUS_12540 1228739 1229317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1229352 1229933 gene locus_tag LOCUS_12550 1229352 1229933 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_12550 1229926 1230912 gene locus_tag LOCUS_12560 1229926 1230912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1230946 1231659 gene locus_tag LOCUS_12570 1230946 1231659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1231700 1231909 gene locus_tag LOCUS_12580 1231700 1231909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1231957 1232358 gene locus_tag LOCUS_12590 1231957 1232358 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_12590 1232913 1232380 gene locus_tag LOCUS_12600 1232913 1232380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1233926 1232925 gene locus_tag LOCUS_12610 gene purM 1233926 1232925 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064223.1 protein_id gnl|my_center|LOCUS_12610 1235349 1233946 gene locus_tag LOCUS_12620 gene purF 1235349 1233946 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730800.1 protein_id gnl|my_center|LOCUS_12620 1235933 1235358 gene locus_tag LOCUS_12630 1235933 1235358 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_12630 1236817 1235930 gene locus_tag LOCUS_12640 1236817 1235930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12640 1236774 1237568 gene locus_tag LOCUS_12650 1236774 1237568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1238846 1238139 gene locus_tag LOCUS_12660 gene purQ 1238846 1238139 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403995.1 protein_id gnl|my_center|LOCUS_12660 1239097 1238843 gene locus_tag LOCUS_12670 1239097 1238843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1240041 1239094 gene locus_tag LOCUS_12680 1240041 1239094 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938096.1 protein_id gnl|my_center|LOCUS_12680 1241357 1240047 gene locus_tag LOCUS_12690 gene purB 1241357 1240047 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_12690 1242017 1241367 gene locus_tag LOCUS_12700 1242017 1241367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1242493 1242014 gene locus_tag LOCUS_12710 gene purE 1242493 1242014 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_12710 1243770 1242490 gene locus_tag LOCUS_12720 gene purD 1243770 1242490 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_12720 1245044 1243767 gene locus_tag LOCUS_12730 1245044 1243767 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_12730 1245248 1246453 gene locus_tag LOCUS_12740 1245248 1246453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258388.1 protein_id gnl|my_center|LOCUS_12740 1246729 1246469 gene locus_tag LOCUS_12750 1246729 1246469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1246807 1248120 gene locus_tag LOCUS_12760 1246807 1248120 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133853294.1 protein_id gnl|my_center|LOCUS_12760 1248887 1248144 gene locus_tag LOCUS_12770 1248887 1248144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1249688 1248918 gene locus_tag LOCUS_12780 1249688 1248918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1252338 1249759 gene locus_tag LOCUS_12790 gene clpB 1252338 1249759 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_12790 1252753 1252340 gene locus_tag LOCUS_12800 1252753 1252340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1253122 1252763 gene locus_tag LOCUS_12810 1253122 1252763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12810 1253897 1253055 gene locus_tag LOCUS_12820 1253897 1253055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12820 1254570 1253941 gene locus_tag LOCUS_12830 1254570 1253941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1254989 1254567 gene locus_tag LOCUS_12840 1254989 1254567 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258972.1 protein_id gnl|my_center|LOCUS_12840 1255849 1254986 gene locus_tag LOCUS_12850 1255849 1254986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12850 1256227 1255934 gene locus_tag LOCUS_12860 1256227 1255934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12860 1256710 1256294 gene locus_tag LOCUS_12870 1256710 1256294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12870 1257125 1257805 gene locus_tag LOCUS_12880 1257125 1257805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1257811 1258479 gene locus_tag LOCUS_12890 1257811 1258479 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_12890 1259064 1258501 gene locus_tag LOCUS_12900 gene dcd 1259064 1258501 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898399.1 protein_id gnl|my_center|LOCUS_12900 1260104 1259061 gene locus_tag LOCUS_12910 gene trpD 1260104 1259061 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_12910 1260267 1260339 gene locus_tag LOCUS_t00320 1260267 1260339 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1261118 1260411 gene locus_tag LOCUS_12920 1261118 1260411 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_12920 1262482 1261115 gene locus_tag LOCUS_12930 gene dnaB 1262482 1261115 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_12930 1263222 1262767 gene locus_tag LOCUS_12940 gene rplI 1263222 1262767 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898318.1 protein_id gnl|my_center|LOCUS_12940 1263488 1263219 gene locus_tag LOCUS_12950 1263488 1263219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1263930 1263478 gene locus_tag LOCUS_12960 1263930 1263478 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898320.1 protein_id gnl|my_center|LOCUS_12960 1264402 1263962 gene locus_tag LOCUS_12970 1264402 1263962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1264565 1265350 gene locus_tag LOCUS_12980 gene panB 1264565 1265350 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_12980 1265443 1266165 gene locus_tag LOCUS_12990 1265443 1266165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1266166 1266843 gene locus_tag LOCUS_13000 1266166 1266843 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_13000 1268190 1267024 gene locus_tag LOCUS_13010 gene menE 1268190 1267024 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496096.1 protein_id gnl|my_center|LOCUS_13010 1268246 1269085 gene locus_tag LOCUS_13020 gene menB 1268246 1269085 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963873.1 protein_id gnl|my_center|LOCUS_13020 1269082 1269981 gene locus_tag LOCUS_13030 1269082 1269981 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466560.1 protein_id gnl|my_center|LOCUS_13030 1269981 1271675 gene locus_tag LOCUS_13040 gene menD 1269981 1271675 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_13040 1272829 1271681 gene locus_tag LOCUS_13050 1272829 1271681 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416879.1 protein_id gnl|my_center|LOCUS_13050 1273525 1272833 gene locus_tag LOCUS_13060 gene ubiE 1273525 1272833 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392794.1 protein_id gnl|my_center|LOCUS_13060 1274217 1273522 gene locus_tag LOCUS_13070 1274217 1273522 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975643.1 protein_id gnl|my_center|LOCUS_13070 1274297 1275529 gene locus_tag LOCUS_13080 1274297 1275529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1275526 1276719 gene locus_tag LOCUS_13090 1275526 1276719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1276815 1277453 gene locus_tag LOCUS_13100 1276815 1277453 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_13100 1277612 1279720 gene locus_tag LOCUS_13110 1277612 1279720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1281906 1279717 gene locus_tag LOCUS_13120 1281906 1279717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1282310 1281957 gene locus_tag LOCUS_13130 1282310 1281957 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400504.1 protein_id gnl|my_center|LOCUS_13130 1282459 1282884 gene locus_tag LOCUS_13140 1282459 1282884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1282976 1284508 gene locus_tag LOCUS_13150 1282976 1284508 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226986.1 protein_id gnl|my_center|LOCUS_13150 1284896 1284552 gene locus_tag LOCUS_13160 1284896 1284552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1285279 1284893 gene locus_tag LOCUS_13170 1285279 1284893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1285499 1285269 gene locus_tag LOCUS_13180 1285499 1285269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1286177 1285518 gene locus_tag LOCUS_13190 1286177 1285518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1286890 1286174 gene locus_tag LOCUS_13200 1286890 1286174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1288152 1286887 gene locus_tag LOCUS_13210 1288152 1286887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1289252 1288149 gene locus_tag LOCUS_13220 1289252 1288149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1289541 1290407 gene locus_tag LOCUS_13230 1289541 1290407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1290480 1291721 gene locus_tag LOCUS_13240 1290480 1291721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1291771 1292037 gene locus_tag LOCUS_13250 1291771 1292037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1292128 1293324 gene locus_tag LOCUS_13260 1292128 1293324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1294381 1293530 gene locus_tag LOCUS_13270 1294381 1293530 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_13270 1294880 1294488 gene locus_tag LOCUS_13280 1294880 1294488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1295048 1295443 gene locus_tag LOCUS_13290 1295048 1295443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1295479 1295572 gene locus_tag LOCUS_t00330 1295479 1295572 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1295754 1296053 gene locus_tag LOCUS_13300 1295754 1296053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1296247 1296011 gene locus_tag LOCUS_13310 1296247 1296011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1297001 1296381 gene locus_tag LOCUS_13320 1297001 1296381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1299589 1297001 gene locus_tag LOCUS_13330 1299589 1297001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13330 1300179 1299586 gene locus_tag LOCUS_13340 1300179 1299586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1302036 1300813 gene locus_tag LOCUS_13350 1302036 1300813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_13350 1302553 1302167 gene locus_tag LOCUS_13360 1302553 1302167 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928433.1 protein_id gnl|my_center|LOCUS_13360 1303924 1302614 gene locus_tag LOCUS_13370 1303924 1302614 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270060.1 protein_id gnl|my_center|LOCUS_13370 1304088 1305551 gene locus_tag LOCUS_13380 1304088 1305551 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_13380 1305617 1306159 gene locus_tag LOCUS_13390 1305617 1306159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1306740 1306138 gene locus_tag LOCUS_13400 1306740 1306138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1307713 1306946 gene locus_tag LOCUS_13410 1307713 1306946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13410 1307805 1309112 gene locus_tag LOCUS_13420 1307805 1309112 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 protein_id gnl|my_center|LOCUS_13420 1310010 1309105 gene locus_tag LOCUS_13430 1310010 1309105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1310120 1311700 gene locus_tag LOCUS_13440 1310120 1311700 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259263.1 protein_id gnl|my_center|LOCUS_13440 1313819 1311702 gene locus_tag LOCUS_13450 1313819 1311702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1314951 1313842 gene locus_tag LOCUS_13460 1314951 1313842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1316125 1314956 gene locus_tag LOCUS_13470 1316125 1314956 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097629.1 protein_id gnl|my_center|LOCUS_13470 1316193 1316858 gene locus_tag LOCUS_13480 1316193 1316858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1318480 1316861 gene locus_tag LOCUS_13490 1318480 1316861 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339387.1 protein_id gnl|my_center|LOCUS_13490 1319518 1318526 gene locus_tag LOCUS_13500 1319518 1318526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1321050 1319608 gene locus_tag LOCUS_13510 1321050 1319608 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064301.1 protein_id gnl|my_center|LOCUS_13510 1321467 1321054 gene locus_tag LOCUS_13520 1321467 1321054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1322431 1321499 gene locus_tag LOCUS_13530 1322431 1321499 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894135.1 protein_id gnl|my_center|LOCUS_13530 1322829 1322407 gene locus_tag LOCUS_13540 1322829 1322407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1322804 1323703 gene locus_tag LOCUS_13550 1322804 1323703 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223022.1 protein_id gnl|my_center|LOCUS_13550 1324455 1323733 gene locus_tag LOCUS_13560 1324455 1323733 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_13560 1325266 1324508 gene locus_tag LOCUS_13570 1325266 1324508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1326925 1325303 gene locus_tag LOCUS_13580 1326925 1325303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1328837 1327152 gene locus_tag LOCUS_13590 1328837 1327152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1330492 1328834 gene locus_tag LOCUS_13600 1330492 1328834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1330548 1331846 gene locus_tag LOCUS_13610 1330548 1331846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1331846 1332853 gene locus_tag LOCUS_13620 1331846 1332853 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285799.1 protein_id gnl|my_center|LOCUS_13620 1333220 1333543 gene locus_tag LOCUS_13630 1333220 1333543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1333986 1333528 gene locus_tag LOCUS_13640 1333986 1333528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1334852 1333986 gene locus_tag LOCUS_13650 1334852 1333986 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_13650 1335637 1334849 gene locus_tag LOCUS_13660 1335637 1334849 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_13660 1336556 1335618 gene locus_tag LOCUS_13670 1336556 1335618 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_13670 1337026 1336562 gene locus_tag LOCUS_13680 1337026 1336562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1337364 1337660 gene locus_tag LOCUS_13690 1337364 1337660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1338641 1337685 gene locus_tag LOCUS_13700 1338641 1337685 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257325.1 protein_id gnl|my_center|LOCUS_13700 1338553 1338927 gene locus_tag LOCUS_13710 1338553 1338927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1339109 1338924 gene locus_tag LOCUS_13720 1339109 1338924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1339190 1340614 gene locus_tag LOCUS_13730 1339190 1340614 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_13730 1340622 1341662 gene locus_tag LOCUS_13740 1340622 1341662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1343047 1341659 gene locus_tag LOCUS_13750 1343047 1341659 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_13750 1343458 1343126 gene locus_tag LOCUS_13760 1343458 1343126 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892849.1 protein_id gnl|my_center|LOCUS_13760 1344101 1343484 gene locus_tag LOCUS_13770 1344101 1343484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1344682 1344140 gene locus_tag LOCUS_13780 gene greA 1344682 1344140 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_13780 1344782 1345558 gene locus_tag LOCUS_13790 1344782 1345558 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893953.1 protein_id gnl|my_center|LOCUS_13790 1345561 1345845 gene locus_tag LOCUS_13800 1345561 1345845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1345924 1347606 gene locus_tag LOCUS_13810 1345924 1347606 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972091.1 protein_id gnl|my_center|LOCUS_13810 1347695 1349074 gene locus_tag LOCUS_13820 1347695 1349074 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529682.1 protein_id gnl|my_center|LOCUS_13820 1349097 1349813 gene locus_tag LOCUS_13830 1349097 1349813 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530344.1 protein_id gnl|my_center|LOCUS_13830 1349850 1350863 gene locus_tag LOCUS_13840 1349850 1350863 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_13840 1351167 1350868 gene locus_tag LOCUS_13850 1351167 1350868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1351178 1351729 gene locus_tag LOCUS_13860 1351178 1351729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1352649 1351708 gene locus_tag LOCUS_13870 1352649 1351708 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_13870 1354337 1352730 gene locus_tag LOCUS_13880 1354337 1352730 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979926.1 protein_id gnl|my_center|LOCUS_13880 1354787 1354518 gene locus_tag LOCUS_13890 1354787 1354518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1356173 1354806 gene locus_tag LOCUS_13900 1356173 1354806 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730494.1 protein_id gnl|my_center|LOCUS_13900 1356955 1356131 gene locus_tag LOCUS_13910 1356955 1356131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224460.1 protein_id gnl|my_center|LOCUS_13910 1358871 1356970 gene locus_tag LOCUS_13920 1358871 1356970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1359033 1360412 gene locus_tag LOCUS_13930 1359033 1360412 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190374.1 protein_id gnl|my_center|LOCUS_13930 1360412 1361167 gene locus_tag LOCUS_13940 1360412 1361167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1361174 1362523 gene locus_tag LOCUS_13950 1361174 1362523 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810594.1 protein_id gnl|my_center|LOCUS_13950 1362520 1363821 gene locus_tag LOCUS_13960 1362520 1363821 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_13960 1363940 1365319 gene locus_tag LOCUS_13970 1363940 1365319 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945999.1 protein_id gnl|my_center|LOCUS_13970 1366866 1365346 gene locus_tag LOCUS_13980 gene xylB 1366866 1365346 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_13980 1367915 1366863 gene locus_tag LOCUS_13990 1367915 1366863 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_13990 1368761 1367919 gene locus_tag LOCUS_14000 1368761 1367919 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_14000 1369489 1368758 gene locus_tag LOCUS_14010 1369489 1368758 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114176.1 protein_id gnl|my_center|LOCUS_14010 1369581 1370378 gene locus_tag LOCUS_14020 1369581 1370378 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223702.1 protein_id gnl|my_center|LOCUS_14020 1370510 1371475 gene locus_tag LOCUS_14030 1370510 1371475 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_14030 1371509 1373347 gene locus_tag LOCUS_14040 1371509 1373347 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030408.1 protein_id gnl|my_center|LOCUS_14040 1373368 1374336 gene locus_tag LOCUS_14050 1373368 1374336 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226493.1 protein_id gnl|my_center|LOCUS_14050 1374336 1375280 gene locus_tag LOCUS_14060 1374336 1375280 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973312.1 protein_id gnl|my_center|LOCUS_14060 1375277 1376275 gene locus_tag LOCUS_14070 1375277 1376275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030406.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14070 1376272 1377336 gene locus_tag LOCUS_14080 1376272 1377336 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030405.1 protein_id gnl|my_center|LOCUS_14080 1378023 1377379 gene locus_tag LOCUS_14090 1378023 1377379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1378120 1379274 gene locus_tag LOCUS_14100 1378120 1379274 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389759.1 protein_id gnl|my_center|LOCUS_14100 1379271 1380110 gene locus_tag LOCUS_14110 1379271 1380110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1380687 1380097 gene locus_tag LOCUS_14120 1380687 1380097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1382652 1380712 gene locus_tag LOCUS_14130 1382652 1380712 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730584.1 protein_id gnl|my_center|LOCUS_14130 1383075 1382686 gene locus_tag LOCUS_14140 1383075 1382686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1384504 1383086 gene locus_tag LOCUS_14150 1384504 1383086 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_14150 1385290 1384541 gene locus_tag LOCUS_14160 1385290 1384541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1386006 1385287 gene locus_tag LOCUS_14170 gene ubiE 1386006 1385287 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_14170 1386776 1386003 gene locus_tag LOCUS_14180 1386776 1386003 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064851.1 protein_id gnl|my_center|LOCUS_14180 1387704 1386823 gene locus_tag LOCUS_14190 1387704 1386823 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_14190 1389811 1388297 gene locus_tag LOCUS_14200 1389811 1388297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1391606 1390083 gene locus_tag LOCUS_14210 1391606 1390083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1391729 1392448 gene locus_tag LOCUS_14220 1391729 1392448 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_14220 1392445 1393854 gene locus_tag LOCUS_14230 1392445 1393854 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_14230 1393890 1394255 gene locus_tag LOCUS_14240 1393890 1394255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1394284 1394724 gene locus_tag LOCUS_14250 1394284 1394724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1394727 1395641 gene locus_tag LOCUS_14260 1394727 1395641 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030936.1 protein_id gnl|my_center|LOCUS_14260 1395675 1396811 gene locus_tag LOCUS_14270 1395675 1396811 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_14270 1396824 1399739 gene locus_tag LOCUS_14280 1396824 1399739 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_14280 1399736 1402087 gene locus_tag LOCUS_14290 1399736 1402087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14290 1402053 1403009 gene locus_tag LOCUS_14300 1402053 1403009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1403367 1402990 gene locus_tag LOCUS_14310 1403367 1402990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1403801 1403373 gene locus_tag LOCUS_14320 1403801 1403373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1404111 1404488 gene locus_tag LOCUS_14330 1404111 1404488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1405038 1404541 gene locus_tag LOCUS_14340 1405038 1404541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14340 1405594 1405397 gene locus_tag LOCUS_14350 1405594 1405397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1406724 1406482 gene locus_tag LOCUS_14360 1406724 1406482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1406654 1407124 gene locus_tag LOCUS_14370 1406654 1407124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1407868 1408152 gene locus_tag LOCUS_14380 1407868 1408152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1408257 1408709 gene locus_tag LOCUS_14390 1408257 1408709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1409197 1408676 gene locus_tag LOCUS_14400 1409197 1408676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14400 >Feature sequence2 697 416 gene locus_tag LOCUS_14410 697 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14410 591 1475 gene locus_tag LOCUS_14420 591 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14420 1812 1543 gene locus_tag LOCUS_14430 1812 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1720 2157 gene locus_tag LOCUS_14440 1720 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2132 2566 gene locus_tag LOCUS_14450 2132 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14450 2927 2616 gene locus_tag LOCUS_14460 2927 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3640 4005 gene locus_tag LOCUS_14470 3640 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4521 4054 gene locus_tag LOCUS_14480 4521 4054 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023796.1 protein_id gnl|my_center|LOCUS_14480 6247 4913 gene locus_tag LOCUS_14490 6247 4913 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087715.1 protein_id gnl|my_center|LOCUS_14490 6291 8729 gene locus_tag LOCUS_14500 6291 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 9680 8760 gene locus_tag LOCUS_14510 9680 8760 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229676.1 protein_id gnl|my_center|LOCUS_14510 10241 9786 gene locus_tag LOCUS_14520 10241 9786 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015961.1 protein_id gnl|my_center|LOCUS_14520 10256 11164 gene locus_tag LOCUS_14530 10256 11164 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731114.1 protein_id gnl|my_center|LOCUS_14530 11172 11249 gene locus_tag LOCUS_t00340 11172 11249 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11427 12494 gene locus_tag LOCUS_14540 11427 12494 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976680.1 protein_id gnl|my_center|LOCUS_14540 12703 12458 gene locus_tag LOCUS_14550 12703 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 12760 13362 gene locus_tag LOCUS_14560 gene rpsD 12760 13362 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583370.1 protein_id gnl|my_center|LOCUS_14560 13997 13353 gene locus_tag LOCUS_14570 13997 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 14913 14002 gene locus_tag LOCUS_14580 14913 14002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 16515 14926 gene locus_tag LOCUS_14590 16515 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 17748 16534 gene locus_tag LOCUS_14600 17748 16534 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_14600 20040 17758 gene locus_tag LOCUS_14610 20040 17758 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_14610 20289 21632 gene locus_tag LOCUS_14620 20289 21632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 21685 22155 gene locus_tag LOCUS_14630 21685 22155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 23217 22186 gene locus_tag LOCUS_14640 23217 22186 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921314.1 protein_id gnl|my_center|LOCUS_14640 23911 23267 gene locus_tag LOCUS_14650 23911 23267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 25137 23908 gene locus_tag LOCUS_14660 25137 23908 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063166.1 protein_id gnl|my_center|LOCUS_14660 25225 26232 gene locus_tag LOCUS_14670 25225 26232 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_14670 28339 26237 gene locus_tag LOCUS_14680 28339 26237 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_14680 28932 28336 gene locus_tag LOCUS_14690 gene recR 28932 28336 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_14690 30740 28950 gene locus_tag LOCUS_14700 gene dnaX 30740 28950 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391576.1 protein_id gnl|my_center|LOCUS_14700 31710 31129 gene locus_tag LOCUS_14710 31710 31129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 32099 32521 gene locus_tag LOCUS_14720 32099 32521 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393832.1 protein_id gnl|my_center|LOCUS_14720 32508 32921 gene locus_tag LOCUS_14730 32508 32921 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876102.1 protein_id gnl|my_center|LOCUS_14730 32924 33622 gene locus_tag LOCUS_14740 32924 33622 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_14740 34194 33631 gene locus_tag LOCUS_14750 34194 33631 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_14750 34729 34229 gene locus_tag LOCUS_14760 34729 34229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 34929 35471 gene locus_tag LOCUS_14770 34929 35471 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727039.1 protein_id gnl|my_center|LOCUS_14770 35468 35716 gene locus_tag LOCUS_14780 35468 35716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 35721 36299 gene locus_tag LOCUS_14790 35721 36299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 36312 36518 gene locus_tag LOCUS_14800 36312 36518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 36682 36597 gene locus_tag LOCUS_t00350 36682 36597 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 36818 36728 gene locus_tag LOCUS_t00360 36818 36728 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 37650 37300 gene locus_tag LOCUS_14810 37650 37300 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_14810 37669 39021 gene locus_tag LOCUS_14820 37669 39021 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026898.1 protein_id gnl|my_center|LOCUS_14820 39008 40216 gene locus_tag LOCUS_14830 39008 40216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 40875 40291 gene locus_tag LOCUS_14840 gene leuD 40875 40291 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_14840 42269 40878 gene locus_tag LOCUS_14850 gene leuC 42269 40878 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_14850 42332 43093 gene locus_tag LOCUS_14860 42332 43093 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560682.1 protein_id gnl|my_center|LOCUS_14860 44259 43090 gene locus_tag LOCUS_14870 44259 43090 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_14870 44399 45004 gene locus_tag LOCUS_14880 44399 45004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 46002 44992 gene locus_tag LOCUS_14890 46002 44992 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_14890 46432 45983 gene locus_tag LOCUS_14900 46432 45983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14900 46837 47016 gene locus_tag LOCUS_14910 46837 47016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 48585 47356 gene locus_tag LOCUS_14920 48585 47356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 50789 48660 gene locus_tag LOCUS_14930 50789 48660 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_14930 51839 50796 gene locus_tag LOCUS_14940 51839 50796 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_14940 52051 52272 gene locus_tag LOCUS_14950 52051 52272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 52320 52393 gene locus_tag LOCUS_t00370 52320 52393 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 52366 53526 gene locus_tag LOCUS_14960 gene pimB 52366 53526 CDS product GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411369.1 protein_id gnl|my_center|LOCUS_14960 54235 53552 gene locus_tag LOCUS_14970 54235 53552 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_14970 54374 55198 gene locus_tag LOCUS_14980 54374 55198 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_14980 55222 55626 gene locus_tag LOCUS_14990 55222 55626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 55725 55634 gene locus_tag LOCUS_t00380 55725 55634 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 55785 56957 gene locus_tag LOCUS_15000 55785 56957 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225094.1 protein_id gnl|my_center|LOCUS_15000 58051 56954 gene locus_tag LOCUS_15010 58051 56954 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_15010 57950 59353 gene locus_tag LOCUS_15020 57950 59353 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402699.1 protein_id gnl|my_center|LOCUS_15020 59350 60258 gene locus_tag LOCUS_15030 gene hemC 59350 60258 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 protein_id gnl|my_center|LOCUS_15030 60255 61031 gene locus_tag LOCUS_15040 60255 61031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 61042 62316 gene locus_tag LOCUS_15050 gene hemL 61042 62316 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_15050 62333 63316 gene locus_tag LOCUS_15060 gene hemB 62333 63316 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776657.1 protein_id gnl|my_center|LOCUS_15060 63796 63323 gene locus_tag LOCUS_15070 63796 63323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 64127 64651 gene locus_tag LOCUS_15080 gene msrA 64127 64651 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943782.1 protein_id gnl|my_center|LOCUS_15080 65088 64669 gene locus_tag LOCUS_15090 65088 64669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 65234 67249 gene locus_tag LOCUS_15100 65234 67249 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398395.1 protein_id gnl|my_center|LOCUS_15100 67266 67949 gene locus_tag LOCUS_15110 67266 67949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 68623 67946 gene locus_tag LOCUS_15120 68623 67946 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_15120 70557 68620 gene locus_tag LOCUS_15130 70557 68620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 72033 71017 gene locus_tag LOCUS_15140 gene hemE 72033 71017 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_15140 72551 72123 gene locus_tag LOCUS_15150 72551 72123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 73420 72548 gene locus_tag LOCUS_15160 73420 72548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 73718 74656 gene locus_tag LOCUS_15170 73718 74656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 74822 74733 gene locus_tag LOCUS_t00390 74822 74733 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 74893 77565 gene locus_tag LOCUS_15180 74893 77565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 78730 77456 gene locus_tag LOCUS_15190 gene serS 78730 77456 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_15190 79216 78731 gene locus_tag LOCUS_15200 79216 78731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 79698 79213 gene locus_tag LOCUS_15210 79698 79213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 80712 79762 gene locus_tag LOCUS_15220 80712 79762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 81632 80709 gene locus_tag LOCUS_15230 81632 80709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_15230 81745 81658 gene locus_tag LOCUS_t00400 81745 81658 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 81872 82558 gene locus_tag LOCUS_15240 81872 82558 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257858.1 protein_id gnl|my_center|LOCUS_15240 82560 83015 gene locus_tag LOCUS_15250 82560 83015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 83012 84130 gene locus_tag LOCUS_15260 83012 84130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 84127 85431 gene locus_tag LOCUS_15270 gene rodA 84127 85431 CDS product cell shape-determining peptidoglycan glycosyltransferase RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400364.1 protein_id gnl|my_center|LOCUS_15270 85431 86957 gene locus_tag LOCUS_15280 gene pbpA 85431 86957 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891359.1 protein_id gnl|my_center|LOCUS_15280 86979 88661 gene locus_tag LOCUS_15290 gene pknB 86979 88661 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112820.1 protein_id gnl|my_center|LOCUS_15290 88663 90306 gene locus_tag LOCUS_15300 88663 90306 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_15300 90322 90480 gene locus_tag LOCUS_15310 90322 90480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 90480 90926 gene locus_tag LOCUS_15320 90480 90926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15320 90976 91773 gene locus_tag LOCUS_15330 90976 91773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15330 91770 92828 gene locus_tag LOCUS_15340 91770 92828 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_15340 92825 93409 gene locus_tag LOCUS_15350 gene hisB 92825 93409 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_15350 93406 94011 gene locus_tag LOCUS_15360 gene hisH 93406 94011 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_15360 94008 94718 gene locus_tag LOCUS_15370 gene hisA 94008 94718 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228483.1 protein_id gnl|my_center|LOCUS_15370 94715 95476 gene locus_tag LOCUS_15380 gene hisF 94715 95476 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404312.1 protein_id gnl|my_center|LOCUS_15380 95473 95808 gene locus_tag LOCUS_15390 95473 95808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 95837 96712 gene locus_tag LOCUS_15400 gene hisG 95837 96712 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_15400 96877 97533 gene locus_tag LOCUS_15410 96877 97533 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_15410 97530 98588 gene locus_tag LOCUS_15420 97530 98588 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 protein_id gnl|my_center|LOCUS_15420 98585 100237 gene locus_tag LOCUS_15430 98585 100237 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_15430 100472 101758 gene locus_tag LOCUS_15440 gene aceA 100472 101758 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223536.1 protein_id gnl|my_center|LOCUS_15440 101786 102742 gene locus_tag LOCUS_15450 101786 102742 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900287.1 protein_id gnl|my_center|LOCUS_15450 102739 103641 gene locus_tag LOCUS_15460 102739 103641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 105005 103608 gene locus_tag LOCUS_15470 105005 103608 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228233.1 protein_id gnl|my_center|LOCUS_15470 105353 107002 gene locus_tag LOCUS_15480 gene sirA 105353 107002 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_15480 107142 107996 gene locus_tag LOCUS_15490 107142 107996 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_15490 107998 108657 gene locus_tag LOCUS_15500 107998 108657 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_15500 108654 109550 gene locus_tag LOCUS_15510 108654 109550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 111828 110107 gene locus_tag LOCUS_15520 111828 110107 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181877.1 protein_id gnl|my_center|LOCUS_15520 111846 113624 gene locus_tag LOCUS_15530 111846 113624 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_15530 113624 115432 gene locus_tag LOCUS_15540 113624 115432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_15540 115429 117699 gene locus_tag LOCUS_15550 115429 117699 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389593.1 protein_id gnl|my_center|LOCUS_15550 117749 118687 gene locus_tag LOCUS_15560 117749 118687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 118723 120114 gene locus_tag LOCUS_15570 118723 120114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 120150 120401 gene locus_tag LOCUS_15580 120150 120401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 120676 120404 gene locus_tag LOCUS_15590 120676 120404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 120760 121995 gene locus_tag LOCUS_15600 120760 121995 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257569.1 protein_id gnl|my_center|LOCUS_15600 124325 121992 gene locus_tag LOCUS_15610 124325 121992 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_15610 124371 125531 gene locus_tag LOCUS_15620 124371 125531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 125553 125783 gene locus_tag LOCUS_15630 125553 125783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 125780 126367 gene locus_tag LOCUS_15640 125780 126367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 126498 127298 gene locus_tag LOCUS_15650 126498 127298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 127961 127308 gene locus_tag LOCUS_15660 127961 127308 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285117.1 protein_id gnl|my_center|LOCUS_15660 130006 127988 gene locus_tag LOCUS_15670 130006 127988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 130319 130244 gene locus_tag LOCUS_t00410 130319 130244 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 130938 130351 gene locus_tag LOCUS_15680 130938 130351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 132059 130935 gene locus_tag LOCUS_15690 132059 130935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 132685 132143 gene locus_tag LOCUS_15700 132685 132143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 133182 132673 gene locus_tag LOCUS_15710 133182 132673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 133721 133179 gene locus_tag LOCUS_15720 133721 133179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 135586 133820 gene locus_tag LOCUS_15730 135586 133820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 136745 135597 gene locus_tag LOCUS_15740 gene menC 136745 135597 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_15740 137557 136745 gene locus_tag LOCUS_15750 137557 136745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_15750 137749 137579 gene locus_tag LOCUS_15760 137749 137579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 137911 137836 gene locus_tag LOCUS_t00420 137911 137836 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 138476 137985 gene locus_tag LOCUS_15770 138476 137985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 138821 138558 gene locus_tag LOCUS_15780 138821 138558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 139302 138814 gene locus_tag LOCUS_15790 139302 138814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15790 141262 139388 gene locus_tag LOCUS_15800 141262 139388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15800 143264 141276 gene locus_tag LOCUS_15810 gene gyrB 143264 141276 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_15810 143761 143402 gene locus_tag LOCUS_15820 143761 143402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 144858 143758 gene locus_tag LOCUS_15830 gene recF 144858 143758 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_15830 145976 144873 gene locus_tag LOCUS_15840 gene dnaN 145976 144873 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803666.1 protein_id gnl|my_center|LOCUS_15840 147163 146201 gene locus_tag LOCUS_15850 147163 146201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15850 148046 148351 gene locus_tag LOCUS_15860 148046 148351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 148348 148674 gene locus_tag LOCUS_15870 gene yidD 148348 148674 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816027.1 protein_id gnl|my_center|LOCUS_15870 148671 149774 gene locus_tag LOCUS_15880 148671 149774 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429300.1 protein_id gnl|my_center|LOCUS_15880 149767 150276 gene locus_tag LOCUS_15890 149767 150276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 150314 150916 gene locus_tag LOCUS_15900 150314 150916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 151091 152395 gene locus_tag LOCUS_15910 151091 152395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 152395 153285 gene locus_tag LOCUS_15920 152395 153285 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082835.1 protein_id gnl|my_center|LOCUS_15920 153937 153311 gene locus_tag LOCUS_15930 153937 153311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15930 155488 154256 gene locus_tag LOCUS_15940 155488 154256 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_15940 155551 155715 gene locus_tag LOCUS_15950 155551 155715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 156729 155725 gene locus_tag LOCUS_15960 156729 155725 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231059.1 protein_id gnl|my_center|LOCUS_15960 157153 156815 gene locus_tag LOCUS_15970 gene trxA 157153 156815 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_15970 158192 157209 gene locus_tag LOCUS_15980 gene trxB 158192 157209 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082829.1 protein_id gnl|my_center|LOCUS_15980 158982 158275 gene locus_tag LOCUS_15990 158982 158275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 159572 158979 gene locus_tag LOCUS_16000 gene sigM 159572 158979 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_16000 159983 159582 gene locus_tag LOCUS_16010 159983 159582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 161569 159980 gene locus_tag LOCUS_16020 gene murJ 161569 159980 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224759.1 protein_id gnl|my_center|LOCUS_16020 163617 161566 gene locus_tag LOCUS_16030 163617 161566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 164409 163630 gene locus_tag LOCUS_16040 164409 163630 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763201.1 protein_id gnl|my_center|LOCUS_16040 164948 164406 gene locus_tag LOCUS_16050 164948 164406 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284381.1 protein_id gnl|my_center|LOCUS_16050 165047 166159 gene locus_tag LOCUS_16060 165047 166159 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_16060 166514 166152 gene locus_tag LOCUS_16070 166514 166152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122820.1 protein_id gnl|my_center|LOCUS_16070 166598 167962 gene locus_tag LOCUS_16080 166598 167962 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_16080 168967 167987 gene locus_tag LOCUS_16090 gene ychF 168967 167987 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057426.1 protein_id gnl|my_center|LOCUS_16090 169664 169248 gene locus_tag LOCUS_16100 gene sodN 169664 169248 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_16100 169663 170136 gene locus_tag LOCUS_16110 169663 170136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 170187 170693 gene locus_tag LOCUS_16120 170187 170693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 170801 171076 gene locus_tag LOCUS_16130 170801 171076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 171228 171461 gene locus_tag LOCUS_16140 171228 171461 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_16140 171473 172084 gene locus_tag LOCUS_16150 171473 172084 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256136.1 protein_id gnl|my_center|LOCUS_16150 172175 172648 gene locus_tag LOCUS_16160 172175 172648 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086678640.1 protein_id gnl|my_center|LOCUS_16160 172645 174108 gene locus_tag LOCUS_16170 172645 174108 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16170 175612 174239 gene locus_tag LOCUS_16180 175612 174239 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082819.1 protein_id gnl|my_center|LOCUS_16180 176816 175695 gene locus_tag LOCUS_16190 176816 175695 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975141.1 protein_id gnl|my_center|LOCUS_16190 177421 176813 gene locus_tag LOCUS_16200 177421 176813 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898328.1 protein_id gnl|my_center|LOCUS_16200 178186 177521 gene locus_tag LOCUS_16210 178186 177521 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_16210 178995 178183 gene locus_tag LOCUS_16220 178995 178183 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_16220 180566 178992 gene locus_tag LOCUS_16230 180566 178992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_16230 181393 180566 gene locus_tag LOCUS_16240 181393 180566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 182283 181390 gene locus_tag LOCUS_16250 182283 181390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 183286 182285 gene locus_tag LOCUS_16260 183286 182285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 184390 183533 gene locus_tag LOCUS_16270 184390 183533 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226750.1 protein_id gnl|my_center|LOCUS_16270 184473 184976 gene locus_tag LOCUS_16280 184473 184976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 185608 184994 gene locus_tag LOCUS_16290 185608 184994 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_16290 185693 185887 gene locus_tag LOCUS_16300 185693 185887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 185896 186909 gene locus_tag LOCUS_16310 185896 186909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 186999 187742 gene locus_tag LOCUS_16320 186999 187742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 187744 188922 gene locus_tag LOCUS_16330 187744 188922 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_16330 188919 189665 gene locus_tag LOCUS_16340 188919 189665 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067339.1 protein_id gnl|my_center|LOCUS_16340 189662 190651 gene locus_tag LOCUS_16350 189662 190651 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_16350 190648 191643 gene locus_tag LOCUS_16360 190648 191643 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087313.1 protein_id gnl|my_center|LOCUS_16360 191722 193278 gene locus_tag LOCUS_16370 191722 193278 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459198.1 protein_id gnl|my_center|LOCUS_16370 193303 194265 gene locus_tag LOCUS_16380 193303 194265 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531217.1 protein_id gnl|my_center|LOCUS_16380 194249 195103 gene locus_tag LOCUS_16390 194249 195103 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723841.1 protein_id gnl|my_center|LOCUS_16390 195105 196754 gene locus_tag LOCUS_16400 195105 196754 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_16400 196782 197741 gene locus_tag LOCUS_16410 gene pdhA 196782 197741 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919594.1 protein_id gnl|my_center|LOCUS_16410 197753 198202 gene locus_tag LOCUS_16420 197753 198202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 198199 199203 gene locus_tag LOCUS_16430 198199 199203 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815527.1 protein_id gnl|my_center|LOCUS_16430 199944 199237 gene locus_tag LOCUS_16440 199944 199237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 200891 199956 gene locus_tag LOCUS_16450 200891 199956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 202027 200972 gene locus_tag LOCUS_16460 202027 200972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 202187 203797 gene locus_tag LOCUS_16470 202187 203797 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079489562.1 protein_id gnl|my_center|LOCUS_16470 203800 204549 gene locus_tag LOCUS_16480 203800 204549 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984067.1 protein_id gnl|my_center|LOCUS_16480 204546 205124 gene locus_tag LOCUS_16490 204546 205124 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808076.1 protein_id gnl|my_center|LOCUS_16490 205131 206327 gene locus_tag LOCUS_16500 205131 206327 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530301.1 protein_id gnl|my_center|LOCUS_16500 206345 206965 gene locus_tag LOCUS_16510 206345 206965 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495559.1 protein_id gnl|my_center|LOCUS_16510 206962 208416 gene locus_tag LOCUS_16520 206962 208416 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716439.1 protein_id gnl|my_center|LOCUS_16520 208413 209096 gene locus_tag LOCUS_16530 208413 209096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 209130 210107 gene locus_tag LOCUS_16540 209130 210107 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389455.1 protein_id gnl|my_center|LOCUS_16540 210619 210957 gene locus_tag LOCUS_16550 210619 210957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16550 210954 211724 gene locus_tag LOCUS_16560 210954 211724 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085620.1 protein_id gnl|my_center|LOCUS_16560 211721 212974 gene locus_tag LOCUS_16570 211721 212974 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228287.1 protein_id gnl|my_center|LOCUS_16570 212971 214338 gene locus_tag LOCUS_16580 212971 214338 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_16580 214320 215909 gene locus_tag LOCUS_16590 214320 215909 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140397.1 protein_id gnl|my_center|LOCUS_16590 215906 216880 gene locus_tag LOCUS_16600 215906 216880 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674803.1 protein_id gnl|my_center|LOCUS_16600 217921 216893 gene locus_tag LOCUS_16610 217921 216893 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388931.1 protein_id gnl|my_center|LOCUS_16610 218564 219565 gene locus_tag LOCUS_16620 218564 219565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16620 219552 220877 gene locus_tag LOCUS_16630 219552 220877 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890088.1 protein_id gnl|my_center|LOCUS_16630 221691 220939 gene locus_tag LOCUS_16640 221691 220939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 222214 221681 gene locus_tag LOCUS_16650 222214 221681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 222555 226025 gene locus_tag LOCUS_16660 222555 226025 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_16660 226209 226946 gene locus_tag LOCUS_16670 226209 226946 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223885.1 protein_id gnl|my_center|LOCUS_16670 226943 227899 gene locus_tag LOCUS_16680 226943 227899 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223884.1 protein_id gnl|my_center|LOCUS_16680 228016 229044 gene locus_tag LOCUS_16690 228016 229044 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223883.1 protein_id gnl|my_center|LOCUS_16690 229041 229916 gene locus_tag LOCUS_16700 gene aguB 229041 229916 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889160.1 protein_id gnl|my_center|LOCUS_16700 229913 231301 gene locus_tag LOCUS_16710 229913 231301 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_16710 231432 233474 gene locus_tag LOCUS_16720 231432 233474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 233529 234290 gene locus_tag LOCUS_16730 gene larB 233529 234290 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_16730 234287 235555 gene locus_tag LOCUS_16740 gene larC 234287 235555 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_16740 235552 236481 gene locus_tag LOCUS_16750 gene larE 235552 236481 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_16750 237089 236451 gene locus_tag LOCUS_16760 237089 236451 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978224.1 protein_id gnl|my_center|LOCUS_16760 238722 237211 gene locus_tag LOCUS_16770 238722 237211 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_16770 238919 239917 gene locus_tag LOCUS_16780 238919 239917 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_16780 239967 241559 gene locus_tag LOCUS_16790 239967 241559 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902151.1 protein_id gnl|my_center|LOCUS_16790 241618 242571 gene locus_tag LOCUS_16800 241618 242571 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_16800 242568 243374 gene locus_tag LOCUS_16810 242568 243374 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_16810 244058 243393 gene locus_tag LOCUS_16820 244058 243393 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776775.1 protein_id gnl|my_center|LOCUS_16820 244091 245029 gene locus_tag LOCUS_16830 244091 245029 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965824.1 protein_id gnl|my_center|LOCUS_16830 245841 245290 gene locus_tag LOCUS_16840 245841 245290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 246874 245891 gene locus_tag LOCUS_16850 246874 245891 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_16850 248762 246879 gene locus_tag LOCUS_16860 248762 246879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 248837 250444 gene locus_tag LOCUS_16870 248837 250444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 250978 250448 gene locus_tag LOCUS_16880 250978 250448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 251530 251036 gene locus_tag LOCUS_16890 251530 251036 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_16890 253794 251527 gene locus_tag LOCUS_16900 253794 251527 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_16900 254648 253803 gene locus_tag LOCUS_16910 254648 253803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 255592 254645 gene locus_tag LOCUS_16920 255592 254645 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_16920 256735 255803 gene locus_tag LOCUS_16930 256735 255803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 257472 256732 gene locus_tag LOCUS_16940 257472 256732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 257603 258994 gene locus_tag LOCUS_16950 gene nhaA 257603 258994 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_16950 258987 261293 gene locus_tag LOCUS_16960 258987 261293 CDS product DUF4040 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013521.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16960 261311 261703 gene locus_tag LOCUS_16970 261311 261703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 261700 262119 gene locus_tag LOCUS_16980 261700 262119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 262116 263570 gene locus_tag LOCUS_16990 262116 263570 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_16990 263567 263911 gene locus_tag LOCUS_17000 263567 263911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 263896 264171 gene locus_tag LOCUS_17010 263896 264171 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887530.1 protein_id gnl|my_center|LOCUS_17010 264168 264524 gene locus_tag LOCUS_17020 gene mnhG 264168 264524 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942974.1 protein_id gnl|my_center|LOCUS_17020 264746 267028 gene locus_tag LOCUS_17030 264746 267028 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_17030 267059 267421 gene locus_tag LOCUS_17040 267059 267421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 268102 267425 gene locus_tag LOCUS_17050 268102 267425 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067924.1 protein_id gnl|my_center|LOCUS_17050 268761 268102 gene locus_tag LOCUS_17060 268761 268102 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_17060 269072 270517 gene locus_tag LOCUS_17070 269072 270517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 270514 271200 gene locus_tag LOCUS_17080 270514 271200 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730508.1 protein_id gnl|my_center|LOCUS_17080 273578 271170 gene locus_tag LOCUS_17090 273578 271170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 273675 275081 gene locus_tag LOCUS_17100 273675 275081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 275078 275758 gene locus_tag LOCUS_17110 275078 275758 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_17110 275793 278117 gene locus_tag LOCUS_17120 275793 278117 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_17120 278845 278114 gene locus_tag LOCUS_17130 278845 278114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 278846 278995 gene locus_tag LOCUS_17140 278846 278995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 279037 279516 gene locus_tag LOCUS_17150 279037 279516 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 protein_id gnl|my_center|LOCUS_17150 280204 279536 gene locus_tag LOCUS_17160 280204 279536 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_17160 280360 282795 gene locus_tag LOCUS_17170 gene topA 280360 282795 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943185.1 protein_id gnl|my_center|LOCUS_17170 282803 284851 gene locus_tag LOCUS_17180 282803 284851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 284856 286013 gene locus_tag LOCUS_17190 284856 286013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 286156 287280 gene locus_tag LOCUS_17200 286156 287280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 287366 287438 gene locus_tag LOCUS_t00430 287366 287438 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 287413 288225 gene locus_tag LOCUS_17210 287413 288225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 288240 289304 gene locus_tag LOCUS_17220 288240 289304 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_17220 289309 290355 gene locus_tag LOCUS_17230 289309 290355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 290369 290914 gene locus_tag LOCUS_17240 gene hpt 290369 290914 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_17240 290911 293085 gene locus_tag LOCUS_17250 gene ftsH 290911 293085 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_17250 293085 293759 gene locus_tag LOCUS_17260 293085 293759 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226459.1 protein_id gnl|my_center|LOCUS_17260 293794 294351 gene locus_tag LOCUS_17270 293794 294351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 294397 294963 gene locus_tag LOCUS_17280 gene folE 294397 294963 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_17280 295005 295856 gene locus_tag LOCUS_17290 gene folP 295005 295856 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_17290 295853 296803 gene locus_tag LOCUS_17300 295853 296803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 296800 297150 gene locus_tag LOCUS_17310 gene folB 296800 297150 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419537.1 protein_id gnl|my_center|LOCUS_17310 297147 297647 gene locus_tag LOCUS_17320 gene folK 297147 297647 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391686.1 protein_id gnl|my_center|LOCUS_17320 297644 298945 gene locus_tag LOCUS_17330 297644 298945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 298960 299817 gene locus_tag LOCUS_17340 298960 299817 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_17340 299808 300665 gene locus_tag LOCUS_17350 gene panC 299808 300665 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173797.1 protein_id gnl|my_center|LOCUS_17350 300741 301175 gene locus_tag LOCUS_17360 300741 301175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17360 301126 301524 gene locus_tag LOCUS_17370 301126 301524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17370 301517 303061 gene locus_tag LOCUS_17380 gene lysS 301517 303061 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_17380 303435 303046 gene locus_tag LOCUS_17390 303435 303046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 303822 304433 gene locus_tag LOCUS_17400 303822 304433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 304708 305907 gene locus_tag LOCUS_17410 304708 305907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17410 306703 306395 gene locus_tag LOCUS_17420 306703 306395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 307386 306865 gene locus_tag LOCUS_17430 307386 306865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 307713 308228 gene locus_tag LOCUS_17440 307713 308228 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_17440 308709 308266 gene locus_tag LOCUS_17450 308709 308266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 308702 309409 gene locus_tag LOCUS_17460 308702 309409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17460 309479 310180 gene locus_tag LOCUS_17470 309479 310180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17470 310403 310221 gene locus_tag LOCUS_17480 310403 310221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 310341 310685 gene locus_tag LOCUS_17490 310341 310685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 310658 311419 gene locus_tag LOCUS_17500 gene rlmB 310658 311419 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887393.1 protein_id gnl|my_center|LOCUS_17500 311434 311946 gene locus_tag LOCUS_17510 311434 311946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 311956 312033 gene locus_tag LOCUS_t00440 311956 312033 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 312100 312636 gene locus_tag LOCUS_17520 312100 312636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 313004 312633 gene locus_tag LOCUS_17530 313004 312633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 313179 313649 gene locus_tag LOCUS_17540 313179 313649 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_17540 313841 313668 gene locus_tag LOCUS_17550 313841 313668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 315417 315629 gene locus_tag LOCUS_17560 315417 315629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 315815 316021 gene locus_tag LOCUS_17570 315815 316021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 316018 316422 gene locus_tag LOCUS_17580 316018 316422 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_17580 318307 316460 gene locus_tag LOCUS_17590 318307 316460 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975329.1 protein_id gnl|my_center|LOCUS_17590 319085 319627 gene locus_tag LOCUS_17600 319085 319627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17600 319773 320081 gene locus_tag LOCUS_17610 319773 320081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17610 320256 320167 gene locus_tag LOCUS_t00450 320256 320167 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 320327 320722 gene locus_tag LOCUS_17620 320327 320722 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_17620 321042 321350 gene locus_tag LOCUS_17630 321042 321350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 322574 322059 gene locus_tag LOCUS_17640 322574 322059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 322683 323942 gene locus_tag LOCUS_17650 322683 323942 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173608.1 protein_id gnl|my_center|LOCUS_17650 324025 325488 gene locus_tag LOCUS_17660 324025 325488 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408473.1 protein_id gnl|my_center|LOCUS_17660 325514 326527 gene locus_tag LOCUS_17670 325514 326527 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974954.1 protein_id gnl|my_center|LOCUS_17670 326527 326931 gene locus_tag LOCUS_17680 326527 326931 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413208.1 protein_id gnl|my_center|LOCUS_17680 327379 326966 gene locus_tag LOCUS_17690 327379 326966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 327423 328283 gene locus_tag LOCUS_17700 327423 328283 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_17700 328280 330310 gene locus_tag LOCUS_17710 328280 330310 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258483.1 protein_id gnl|my_center|LOCUS_17710 330307 330918 gene locus_tag LOCUS_17720 330307 330918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 332061 331057 gene locus_tag LOCUS_17730 gene moaA 332061 331057 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_17730 332379 332140 gene locus_tag LOCUS_17740 332379 332140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 332460 332948 gene locus_tag LOCUS_17750 332460 332948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 332945 334228 gene locus_tag LOCUS_17760 332945 334228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 334225 335010 gene locus_tag LOCUS_17770 334225 335010 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_17770 334991 336277 gene locus_tag LOCUS_17780 334991 336277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 336362 337807 gene locus_tag LOCUS_17790 336362 337807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 337804 338520 gene locus_tag LOCUS_17800 337804 338520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 339993 338545 gene locus_tag LOCUS_17810 339993 338545 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742083.1 protein_id gnl|my_center|LOCUS_17810 340365 340099 gene locus_tag LOCUS_17820 340365 340099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 340430 342709 gene locus_tag LOCUS_17830 340430 342709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 344543 342696 gene locus_tag LOCUS_17840 344543 342696 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030966.1 protein_id gnl|my_center|LOCUS_17840 344639 345613 gene locus_tag LOCUS_17850 344639 345613 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144407.1 protein_id gnl|my_center|LOCUS_17850 345634 346821 gene locus_tag LOCUS_17860 345634 346821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 348983 346824 gene locus_tag LOCUS_17870 348983 346824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 350015 349155 gene locus_tag LOCUS_17880 350015 349155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 350779 350012 gene locus_tag LOCUS_17890 350779 350012 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179719124.1 protein_id gnl|my_center|LOCUS_17890 350875 353511 gene locus_tag LOCUS_17900 350875 353511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 353460 354182 gene locus_tag LOCUS_17910 353460 354182 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852013.1 protein_id gnl|my_center|LOCUS_17910 354853 354626 gene locus_tag LOCUS_17920 354853 354626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 354924 355772 gene locus_tag LOCUS_17930 354924 355772 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895546.1 protein_id gnl|my_center|LOCUS_17930 355862 356110 gene locus_tag LOCUS_17940 355862 356110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 356574 356233 gene locus_tag LOCUS_17950 356574 356233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 356831 357619 gene locus_tag LOCUS_17960 356831 357619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17960 357791 357603 gene locus_tag LOCUS_17970 357791 357603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 357896 358183 gene locus_tag LOCUS_17980 357896 358183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 358467 358745 gene locus_tag LOCUS_17990 358467 358745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 358916 360034 gene locus_tag LOCUS_18000 358916 360034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727105.1 protein_id gnl|my_center|LOCUS_18000 360990 360049 gene locus_tag LOCUS_18010 360990 360049 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727101.1 protein_id gnl|my_center|LOCUS_18010 361922 360987 gene locus_tag LOCUS_18020 361922 360987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727102.1 protein_id gnl|my_center|LOCUS_18020 363275 361938 gene locus_tag LOCUS_18030 363275 361938 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727103.1 protein_id gnl|my_center|LOCUS_18030 363500 364324 gene locus_tag LOCUS_18040 363500 364324 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064413.1 protein_id gnl|my_center|LOCUS_18040 365570 366418 gene locus_tag LOCUS_18050 365570 366418 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064212.1 protein_id gnl|my_center|LOCUS_18050 366415 367281 gene locus_tag LOCUS_18060 366415 367281 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 protein_id gnl|my_center|LOCUS_18060 368968 367292 gene locus_tag LOCUS_18070 gene betA 368968 367292 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_18070 369108 370130 gene locus_tag LOCUS_18080 369108 370130 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_18080 370132 372204 gene locus_tag LOCUS_18090 370132 372204 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_18090 372201 373181 gene locus_tag LOCUS_18100 372201 373181 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_18100 373264 374703 gene locus_tag LOCUS_18110 373264 374703 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173762.1 protein_id gnl|my_center|LOCUS_18110 374714 375940 gene locus_tag LOCUS_18120 374714 375940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 375937 377019 gene locus_tag LOCUS_18130 gene serC 375937 377019 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_18130 377016 378230 gene locus_tag LOCUS_18140 377016 378230 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_18140 378236 380710 gene locus_tag LOCUS_18150 378236 380710 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_18150 380710 381414 gene locus_tag LOCUS_18160 380710 381414 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386375.1 protein_id gnl|my_center|LOCUS_18160 381414 381713 gene locus_tag LOCUS_18170 381414 381713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence3 524 1831 gene locus_tag LOCUS_18180 524 1831 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528942.1 protein_id gnl|my_center|LOCUS_18180 1925 1839 gene locus_tag LOCUS_t00460 1925 1839 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2563 1961 gene locus_tag LOCUS_18190 2563 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3398 2565 gene locus_tag LOCUS_18200 3398 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 4465 3395 gene locus_tag LOCUS_18210 4465 3395 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_18210 5265 4822 gene locus_tag LOCUS_18220 5265 4822 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218379.1 protein_id gnl|my_center|LOCUS_18220 6489 5302 gene locus_tag LOCUS_18230 6489 5302 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224850.1 protein_id gnl|my_center|LOCUS_18230 7325 6486 gene locus_tag LOCUS_18240 7325 6486 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 protein_id gnl|my_center|LOCUS_18240 8236 7322 gene locus_tag LOCUS_18250 8236 7322 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530273.1 protein_id gnl|my_center|LOCUS_18250 9574 8255 gene locus_tag LOCUS_18260 9574 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 9691 10518 gene locus_tag LOCUS_18270 9691 10518 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_18270 11548 10523 gene locus_tag LOCUS_18280 11548 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 12477 11545 gene locus_tag LOCUS_18290 12477 11545 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_18290 13787 12483 gene locus_tag LOCUS_18300 13787 12483 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225276.1 protein_id gnl|my_center|LOCUS_18300 13828 15066 gene locus_tag LOCUS_18310 13828 15066 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392273.1 protein_id gnl|my_center|LOCUS_18310 15063 16073 gene locus_tag LOCUS_18320 15063 16073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 16132 17271 gene locus_tag LOCUS_18330 16132 17271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969226.1 protein_id gnl|my_center|LOCUS_18330 17625 17275 gene locus_tag LOCUS_18340 17625 17275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 18911 17622 gene locus_tag LOCUS_18350 gene eno 18911 17622 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_18350 19793 18957 gene locus_tag LOCUS_18360 gene mazG 19793 18957 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_18360 20791 19790 gene locus_tag LOCUS_18370 20791 19790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 21682 20801 gene locus_tag LOCUS_18380 21682 20801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18380 24274 22283 gene locus_tag LOCUS_18390 24274 22283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18390 26554 24377 gene locus_tag LOCUS_18400 26554 24377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 27140 26541 gene locus_tag LOCUS_18410 27140 26541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 27504 27361 gene locus_tag LOCUS_18420 27504 27361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 28657 28079 gene locus_tag LOCUS_18430 gene pth 28657 28079 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059133.1 protein_id gnl|my_center|LOCUS_18430 29344 28667 gene locus_tag LOCUS_18440 29344 28667 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_18440 30389 29409 gene locus_tag LOCUS_18450 30389 29409 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052033.1 protein_id gnl|my_center|LOCUS_18450 31823 30399 gene locus_tag LOCUS_18460 gene glmU 31823 30399 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_18460 31946 31874 gene locus_tag LOCUS_t00470 31946 31874 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 32832 31969 gene locus_tag LOCUS_18470 gene ispE 32832 31969 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_18470 33623 32829 gene locus_tag LOCUS_18480 gene rsmA 33623 32829 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229977.1 protein_id gnl|my_center|LOCUS_18480 34806 33676 gene locus_tag LOCUS_18490 34806 33676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 35745 34951 gene locus_tag LOCUS_18500 35745 34951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 36713 35853 gene locus_tag LOCUS_18510 36713 35853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18510 38279 37443 gene locus_tag LOCUS_18520 gene rsmI 38279 37443 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_18520 38344 39873 gene locus_tag LOCUS_18530 38344 39873 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109948.1 protein_id gnl|my_center|LOCUS_18530 40470 39877 gene locus_tag LOCUS_18540 40470 39877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 41272 40523 gene locus_tag LOCUS_18550 41272 40523 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_18550 42897 41308 gene locus_tag LOCUS_18560 42897 41308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 44753 42897 gene locus_tag LOCUS_18570 44753 42897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 45083 44835 gene locus_tag LOCUS_18580 45083 44835 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_18580 45684 45163 gene locus_tag LOCUS_18590 45684 45163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 47498 45633 gene locus_tag LOCUS_18600 47498 45633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 48061 48405 gene locus_tag LOCUS_18610 48061 48405 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975095.1 protein_id gnl|my_center|LOCUS_18610 48475 51000 gene locus_tag LOCUS_18620 48475 51000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 51051 51641 gene locus_tag LOCUS_18630 51051 51641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 52845 53057 gene locus_tag LOCUS_18640 52845 53057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18640 53500 52994 gene locus_tag LOCUS_18650 53500 52994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 54642 53497 gene locus_tag LOCUS_18660 54642 53497 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_18660 55510 54635 gene locus_tag LOCUS_18670 55510 54635 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_18670 56415 55540 gene locus_tag LOCUS_18680 56415 55540 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416127.1 protein_id gnl|my_center|LOCUS_18680 57292 56474 gene locus_tag LOCUS_18690 57292 56474 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_18690 59652 57289 gene locus_tag LOCUS_18700 59652 57289 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_18700 60135 59665 gene locus_tag LOCUS_18710 60135 59665 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_18710 60256 61410 gene locus_tag LOCUS_18720 60256 61410 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_18720 61421 62038 gene locus_tag LOCUS_18730 61421 62038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 61981 62598 gene locus_tag LOCUS_18740 61981 62598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 63417 62599 gene locus_tag LOCUS_18750 63417 62599 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_18750 63536 63706 gene locus_tag LOCUS_18760 63536 63706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 63703 64176 gene locus_tag LOCUS_18770 63703 64176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 64919 64173 gene locus_tag LOCUS_18780 64919 64173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 65292 64912 gene locus_tag LOCUS_18790 65292 64912 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_18790 65365 66063 gene locus_tag LOCUS_18800 65365 66063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 66060 66209 gene locus_tag LOCUS_18810 66060 66209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 67062 66286 gene locus_tag LOCUS_18820 67062 66286 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_18820 67149 67496 gene locus_tag LOCUS_18830 67149 67496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 68824 67505 gene locus_tag LOCUS_18840 68824 67505 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_18840 70077 68821 gene locus_tag LOCUS_18850 70077 68821 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920961.1 protein_id gnl|my_center|LOCUS_18850 70193 72223 gene locus_tag LOCUS_18860 70193 72223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 72664 72242 gene locus_tag LOCUS_18870 72664 72242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 72757 76338 gene locus_tag LOCUS_18880 72757 76338 CDS product DUF4020 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106004657.1 protein_id gnl|my_center|LOCUS_18880 77969 76365 gene locus_tag LOCUS_18890 77969 76365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 78673 77966 gene locus_tag LOCUS_18900 78673 77966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 78909 78772 gene locus_tag LOCUS_18910 78909 78772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 79688 78957 gene locus_tag LOCUS_18920 79688 78957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 79984 79685 gene locus_tag LOCUS_18930 79984 79685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 83264 79974 gene locus_tag LOCUS_18940 83264 79974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 83368 83292 gene locus_tag LOCUS_t00480 83368 83292 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 84056 83409 gene locus_tag LOCUS_18950 84056 83409 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_18950 84595 84095 gene locus_tag LOCUS_18960 84595 84095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 85238 84762 gene locus_tag LOCUS_18970 gene moaC 85238 84762 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531740.1 protein_id gnl|my_center|LOCUS_18970 86508 85240 gene locus_tag LOCUS_18980 86508 85240 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_18980 87442 86564 gene locus_tag LOCUS_18990 gene galU 87442 86564 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937189.1 protein_id gnl|my_center|LOCUS_18990 87630 87896 gene locus_tag LOCUS_19000 87630 87896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 87893 88681 gene locus_tag LOCUS_19010 87893 88681 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_19010 88693 88893 gene locus_tag LOCUS_19020 88693 88893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 89004 89648 gene locus_tag LOCUS_19030 89004 89648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 89705 90547 gene locus_tag LOCUS_19040 gene uppP 89705 90547 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_19040 91933 90578 gene locus_tag LOCUS_19050 91933 90578 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_19050 93311 91926 gene locus_tag LOCUS_19060 93311 91926 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_19060 93440 93940 gene locus_tag LOCUS_19070 93440 93940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 93933 96113 gene locus_tag LOCUS_19080 93933 96113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 96279 96740 gene locus_tag LOCUS_19090 96279 96740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 98240 97359 gene locus_tag LOCUS_19100 98240 97359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 99371 98304 gene locus_tag LOCUS_19110 99371 98304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 99279 101204 gene locus_tag LOCUS_19120 99279 101204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 101325 101978 gene locus_tag LOCUS_19130 101325 101978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 101975 102844 gene locus_tag LOCUS_19140 101975 102844 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975922.1 protein_id gnl|my_center|LOCUS_19140 102852 104702 gene locus_tag LOCUS_19150 102852 104702 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460092.1 protein_id gnl|my_center|LOCUS_19150 104699 105310 gene locus_tag LOCUS_19160 104699 105310 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 protein_id gnl|my_center|LOCUS_19160 105297 106751 gene locus_tag LOCUS_19170 105297 106751 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328727.1 protein_id gnl|my_center|LOCUS_19170 106798 107469 gene locus_tag LOCUS_19180 106798 107469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 108112 108642 gene locus_tag LOCUS_19190 108112 108642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19190 108548 108991 gene locus_tag LOCUS_19200 108548 108991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19200 108877 109350 gene locus_tag LOCUS_19210 108877 109350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19210 109535 110563 gene locus_tag LOCUS_19220 109535 110563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 111187 111816 gene locus_tag LOCUS_19230 111187 111816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 111773 112711 gene locus_tag LOCUS_19240 111773 112711 CDS product IS3-like element ISGvi5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929392.1 protein_id gnl|my_center|LOCUS_19240 112989 112750 gene locus_tag LOCUS_19250 112989 112750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 113322 114218 gene locus_tag LOCUS_19260 113322 114218 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877851.1 protein_id gnl|my_center|LOCUS_19260 115599 114229 gene locus_tag LOCUS_19270 gene merA 115599 114229 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228473.1 protein_id gnl|my_center|LOCUS_19270 115849 116826 gene locus_tag LOCUS_19280 115849 116826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 116804 117325 gene locus_tag LOCUS_19290 116804 117325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 117364 119676 gene locus_tag LOCUS_19300 117364 119676 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145665688.1 protein_id gnl|my_center|LOCUS_19300 120746 119802 gene locus_tag LOCUS_19310 gene mmuM 120746 119802 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030679.1 protein_id gnl|my_center|LOCUS_19310 120855 121997 gene locus_tag LOCUS_19320 120855 121997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_19320 122977 121991 gene locus_tag LOCUS_19330 122977 121991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 122862 123071 gene locus_tag LOCUS_19340 122862 123071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19340 124323 123082 gene locus_tag LOCUS_19350 124323 123082 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188359.1 protein_id gnl|my_center|LOCUS_19350 124459 124719 gene locus_tag LOCUS_19360 124459 124719 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413167.1 protein_id gnl|my_center|LOCUS_19360 124716 125093 gene locus_tag LOCUS_19370 124716 125093 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413174.1 protein_id gnl|my_center|LOCUS_19370 126108 125365 gene locus_tag LOCUS_19380 126108 125365 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112467.1 protein_id gnl|my_center|LOCUS_19380 126985 126284 gene locus_tag LOCUS_19390 126985 126284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 127607 126972 gene locus_tag LOCUS_19400 127607 126972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 127633 127839 gene locus_tag LOCUS_19410 127633 127839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 127986 129767 gene locus_tag LOCUS_19420 127986 129767 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_19420 130530 129772 gene locus_tag LOCUS_19430 130530 129772 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_19430 130563 131537 gene locus_tag LOCUS_19440 130563 131537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 131519 132292 gene locus_tag LOCUS_19450 gene hisN 131519 132292 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 protein_id gnl|my_center|LOCUS_19450 132727 132296 gene locus_tag LOCUS_19460 132727 132296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 134334 132724 gene locus_tag LOCUS_19470 134334 132724 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921426.1 protein_id gnl|my_center|LOCUS_19470 135337 134342 gene locus_tag LOCUS_19480 135337 134342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 136245 135334 gene locus_tag LOCUS_19490 136245 135334 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086091.1 protein_id gnl|my_center|LOCUS_19490 136985 136284 gene locus_tag LOCUS_19500 gene urtE 136985 136284 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112317.1 protein_id gnl|my_center|LOCUS_19500 137727 136987 gene locus_tag LOCUS_19510 gene urtD 137727 136987 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889582.1 protein_id gnl|my_center|LOCUS_19510 138746 137724 gene locus_tag LOCUS_19520 138746 137724 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532994.1 protein_id gnl|my_center|LOCUS_19520 139588 138743 gene locus_tag LOCUS_19530 gene urtB 139588 138743 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532993.1 protein_id gnl|my_center|LOCUS_19530 140867 139629 gene locus_tag LOCUS_19540 140867 139629 CDS product substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532997.1 protein_id gnl|my_center|LOCUS_19540 141539 140907 gene locus_tag LOCUS_19550 141539 140907 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029673.1 protein_id gnl|my_center|LOCUS_19550 143001 141577 gene locus_tag LOCUS_19560 143001 141577 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945999.1 protein_id gnl|my_center|LOCUS_19560 144364 143006 gene locus_tag LOCUS_19570 gene glnA 144364 143006 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080619.1 protein_id gnl|my_center|LOCUS_19570 145446 144361 gene locus_tag LOCUS_19580 145446 144361 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_19580 146215 145631 gene locus_tag LOCUS_19590 146215 145631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19590 146133 146747 gene locus_tag LOCUS_19600 146133 146747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 146888 147808 gene locus_tag LOCUS_19610 146888 147808 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803754.1 protein_id gnl|my_center|LOCUS_19610 149285 147828 gene locus_tag LOCUS_19620 149285 147828 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920973.1 protein_id gnl|my_center|LOCUS_19620 150649 149309 gene locus_tag LOCUS_19630 gene hemL 150649 149309 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460175.1 protein_id gnl|my_center|LOCUS_19630 150814 151953 gene locus_tag LOCUS_19640 150814 151953 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257556.1 protein_id gnl|my_center|LOCUS_19640 151976 152863 gene locus_tag LOCUS_19650 151976 152863 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257554.1 protein_id gnl|my_center|LOCUS_19650 152860 153714 gene locus_tag LOCUS_19660 152860 153714 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_19660 156040 153734 gene locus_tag LOCUS_19670 156040 153734 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_19670 156528 156037 gene locus_tag LOCUS_19680 156528 156037 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227068.1 protein_id gnl|my_center|LOCUS_19680 157391 156525 gene locus_tag LOCUS_19690 157391 156525 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893830.1 protein_id gnl|my_center|LOCUS_19690 158737 157478 gene locus_tag LOCUS_19700 158737 157478 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_19700 159684 158734 gene locus_tag LOCUS_19710 159684 158734 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007717423.1 protein_id gnl|my_center|LOCUS_19710 159757 160602 gene locus_tag LOCUS_19720 159757 160602 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_19720 160599 161390 gene locus_tag LOCUS_19730 160599 161390 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564075.1 protein_id gnl|my_center|LOCUS_19730 162056 161400 gene locus_tag LOCUS_19740 162056 161400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 163297 162080 gene locus_tag LOCUS_19750 163297 162080 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251197.1 protein_id gnl|my_center|LOCUS_19750 163467 165005 gene locus_tag LOCUS_19760 163467 165005 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706871.1 protein_id gnl|my_center|LOCUS_19760 166105 165026 gene locus_tag LOCUS_19770 166105 165026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 167540 166155 gene locus_tag LOCUS_19780 167540 166155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 167768 170230 gene locus_tag LOCUS_19790 167768 170230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 170463 170227 gene locus_tag LOCUS_19800 170463 170227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 171497 170571 gene locus_tag LOCUS_19810 171497 170571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 172986 171544 gene locus_tag LOCUS_19820 172986 171544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 173301 174572 gene locus_tag LOCUS_19830 173301 174572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19830 175947 174550 gene locus_tag LOCUS_19840 175947 174550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 176428 176009 gene locus_tag LOCUS_19850 176428 176009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 177329 176517 gene locus_tag LOCUS_19860 177329 176517 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_19860 177392 177466 gene locus_tag LOCUS_t00490 177392 177466 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 177872 179038 gene locus_tag LOCUS_19870 177872 179038 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_19870 179449 179306 gene locus_tag LOCUS_19880 179449 179306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 179792 179643 gene locus_tag LOCUS_19890 179792 179643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 181172 182551 gene locus_tag LOCUS_19900 181172 182551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 182528 182606 gene locus_tag LOCUS_t00500 182528 182606 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 182905 184296 gene locus_tag LOCUS_19910 182905 184296 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_19910 184293 185075 gene locus_tag LOCUS_19920 184293 185075 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_19920 185592 185110 gene locus_tag LOCUS_19930 185592 185110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 185839 186102 gene locus_tag LOCUS_19940 185839 186102 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119905.1 protein_id gnl|my_center|LOCUS_19940 187684 186338 gene locus_tag LOCUS_19950 187684 186338 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110781.1 protein_id gnl|my_center|LOCUS_19950 187827 188450 gene locus_tag LOCUS_19960 gene ureA 187827 188450 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030293.1 protein_id gnl|my_center|LOCUS_19960 188443 190173 gene locus_tag LOCUS_19970 gene ureC 188443 190173 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170136789.1 protein_id gnl|my_center|LOCUS_19970 190221 191075 gene locus_tag LOCUS_19980 190221 191075 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225296.1 protein_id gnl|my_center|LOCUS_19980 191246 191659 gene locus_tag LOCUS_19990 191246 191659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 196509 191677 gene locus_tag LOCUS_20000 196509 191677 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_20000 198439 196544 gene locus_tag LOCUS_20010 198439 196544 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_20010 198588 201194 gene locus_tag LOCUS_20020 198588 201194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 201299 202645 gene locus_tag LOCUS_20030 201299 202645 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_20030 203418 202651 gene locus_tag LOCUS_20040 203418 202651 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967644.1 protein_id gnl|my_center|LOCUS_20040 203523 206732 gene locus_tag LOCUS_20050 203523 206732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 209472 206818 gene locus_tag LOCUS_20060 209472 206818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 211034 209469 gene locus_tag LOCUS_20070 211034 209469 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_20070 212044 211031 gene locus_tag LOCUS_20080 gene ilvC 212044 211031 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_20080 212635 212087 gene locus_tag LOCUS_20090 gene ilvN 212635 212087 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893741.1 protein_id gnl|my_center|LOCUS_20090 214323 212632 gene locus_tag LOCUS_20100 214323 212632 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_20100 214694 214380 gene locus_tag LOCUS_20110 214694 214380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 215070 215732 gene locus_tag LOCUS_20120 215070 215732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20120 215621 216598 gene locus_tag LOCUS_20130 215621 216598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20130 219051 217213 gene locus_tag LOCUS_20140 219051 217213 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223305.1 protein_id gnl|my_center|LOCUS_20140 220364 219126 gene locus_tag LOCUS_20150 gene thrC 220364 219126 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142060.1 protein_id gnl|my_center|LOCUS_20150 222004 220361 gene locus_tag LOCUS_20160 gene ilvD 222004 220361 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900824.1 protein_id gnl|my_center|LOCUS_20160 222126 223538 gene locus_tag LOCUS_20170 222126 223538 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114931.1 protein_id gnl|my_center|LOCUS_20170 223552 223845 gene locus_tag LOCUS_20180 223552 223845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20180 223763 224965 gene locus_tag LOCUS_20190 223763 224965 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114931.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20190 226608 224968 gene locus_tag LOCUS_20200 226608 224968 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_20200 227561 226662 gene locus_tag LOCUS_20210 227561 226662 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 protein_id gnl|my_center|LOCUS_20210 228817 227567 gene locus_tag LOCUS_20220 228817 227567 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_20220 230494 228830 gene locus_tag LOCUS_20230 230494 228830 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257624.1 protein_id gnl|my_center|LOCUS_20230 231631 230537 gene locus_tag LOCUS_20240 231631 230537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_20240 232512 231628 gene locus_tag LOCUS_20250 232512 231628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720158.1 protein_id gnl|my_center|LOCUS_20250 233414 232509 gene locus_tag LOCUS_20260 233414 232509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 protein_id gnl|my_center|LOCUS_20260 234585 233425 gene locus_tag LOCUS_20270 234585 233425 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532862.1 protein_id gnl|my_center|LOCUS_20270 235151 234672 gene locus_tag LOCUS_20280 235151 234672 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230688.1 protein_id gnl|my_center|LOCUS_20280 236289 235195 gene locus_tag LOCUS_20290 236289 235195 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384418.1 protein_id gnl|my_center|LOCUS_20290 236362 237555 gene locus_tag LOCUS_20300 236362 237555 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895548.1 protein_id gnl|my_center|LOCUS_20300 237908 237552 gene locus_tag LOCUS_20310 237908 237552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 238656 237982 gene locus_tag LOCUS_20320 238656 237982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 238819 238598 gene locus_tag LOCUS_20330 238819 238598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 238802 240238 gene locus_tag LOCUS_20340 238802 240238 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200034.1 protein_id gnl|my_center|LOCUS_20340 242309 240222 gene locus_tag LOCUS_20350 242309 240222 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748465.1 protein_id gnl|my_center|LOCUS_20350 243979 242348 gene locus_tag LOCUS_20360 243979 242348 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_20360 244185 244835 gene locus_tag LOCUS_20370 244185 244835 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892083.1 protein_id gnl|my_center|LOCUS_20370 246006 244828 gene locus_tag LOCUS_20380 246006 244828 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 protein_id gnl|my_center|LOCUS_20380 246124 247041 gene locus_tag LOCUS_20390 246124 247041 CDS product choline kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400536.1 protein_id gnl|my_center|LOCUS_20390 247042 249462 gene locus_tag LOCUS_20400 247042 249462 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533043.1 protein_id gnl|my_center|LOCUS_20400 249459 250121 gene locus_tag LOCUS_20410 249459 250121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 250121 251407 gene locus_tag LOCUS_20420 250121 251407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 251728 251429 gene locus_tag LOCUS_20430 251728 251429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 252681 251779 gene locus_tag LOCUS_20440 252681 251779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 255095 252678 gene locus_tag LOCUS_20450 255095 252678 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061787.1 protein_id gnl|my_center|LOCUS_20450 256800 255166 gene locus_tag LOCUS_20460 256800 255166 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979926.1 protein_id gnl|my_center|LOCUS_20460 257835 256837 gene locus_tag LOCUS_20470 257835 256837 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_20470 258605 257832 gene locus_tag LOCUS_20480 258605 257832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 259407 258598 gene locus_tag LOCUS_20490 259407 258598 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_20490 259544 260308 gene locus_tag LOCUS_20500 259544 260308 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_20500 260308 261270 gene locus_tag LOCUS_20510 260308 261270 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899889.1 protein_id gnl|my_center|LOCUS_20510 261345 263246 gene locus_tag LOCUS_20520 261345 263246 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401734.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20520 263454 264161 gene locus_tag LOCUS_20530 263454 264161 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_20530 264164 265075 gene locus_tag LOCUS_20540 264164 265075 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250218.1 protein_id gnl|my_center|LOCUS_20540 265134 265895 gene locus_tag LOCUS_20550 265134 265895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 268502 266013 gene locus_tag LOCUS_20560 268502 266013 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975818.1 protein_id gnl|my_center|LOCUS_20560 269727 268570 gene locus_tag LOCUS_20570 269727 268570 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_20570 269866 270393 gene locus_tag LOCUS_20580 269866 270393 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_20580 270820 270374 gene locus_tag LOCUS_20590 270820 270374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 271025 270834 gene locus_tag LOCUS_20600 271025 270834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 272266 271091 gene locus_tag LOCUS_20610 272266 271091 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727109.1 protein_id gnl|my_center|LOCUS_20610 273750 272311 gene locus_tag LOCUS_20620 273750 272311 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531377.1 protein_id gnl|my_center|LOCUS_20620 274846 273806 gene locus_tag LOCUS_20630 gene cysK 274846 273806 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_20630 275652 274867 gene locus_tag LOCUS_20640 275652 274867 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_20640 275825 277024 gene locus_tag LOCUS_20650 275825 277024 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229309.1 protein_id gnl|my_center|LOCUS_20650 277024 277302 gene locus_tag LOCUS_20660 277024 277302 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_20660 277299 279980 gene locus_tag LOCUS_20670 277299 279980 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229307.1 protein_id gnl|my_center|LOCUS_20670 280283 280522 gene locus_tag LOCUS_20680 280283 280522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20680 281483 280533 gene locus_tag LOCUS_20690 281483 280533 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775992.1 protein_id gnl|my_center|LOCUS_20690 282174 281488 gene locus_tag LOCUS_20700 282174 281488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20700 283613 283032 gene locus_tag LOCUS_20710 283613 283032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20710 284944 283610 gene locus_tag LOCUS_20720 284944 283610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20720 285632 285057 gene locus_tag LOCUS_20730 285632 285057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20730 >Feature sequence4 303 683 gene locus_tag LOCUS_20740 303 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20740 656 1198 gene locus_tag LOCUS_20750 656 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20750 1760 1984 gene locus_tag LOCUS_20760 1760 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20760 2182 2364 gene locus_tag LOCUS_20770 2182 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 3443 2292 gene locus_tag LOCUS_20780 3443 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 3896 4345 gene locus_tag LOCUS_20790 3896 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20790 4342 5322 gene locus_tag LOCUS_20800 4342 5322 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896728.1 protein_id gnl|my_center|LOCUS_20800 6489 5335 gene locus_tag LOCUS_20810 6489 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 7483 6629 gene locus_tag LOCUS_20820 7483 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 7656 8687 gene locus_tag LOCUS_20830 7656 8687 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_20830 8721 9590 gene locus_tag LOCUS_20840 8721 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 9801 10616 gene locus_tag LOCUS_20850 9801 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 12625 10655 gene locus_tag LOCUS_20860 12625 10655 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742782.1 protein_id gnl|my_center|LOCUS_20860 13546 12638 gene locus_tag LOCUS_20870 13546 12638 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727101.1 protein_id gnl|my_center|LOCUS_20870 14631 13543 gene locus_tag LOCUS_20880 14631 13543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727102.1 protein_id gnl|my_center|LOCUS_20880 14633 15892 gene locus_tag LOCUS_20890 14633 15892 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727103.1 protein_id gnl|my_center|LOCUS_20890 16849 15947 gene locus_tag LOCUS_20900 gene sucD 16849 15947 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_20900 18027 16846 gene locus_tag LOCUS_20910 18027 16846 CDS product malate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329404.1 protein_id gnl|my_center|LOCUS_20910 19019 18024 gene locus_tag LOCUS_20920 19019 18024 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387970.1 protein_id gnl|my_center|LOCUS_20920 21809 19176 gene locus_tag LOCUS_20930 21809 19176 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068577.1 protein_id gnl|my_center|LOCUS_20930 21889 23898 gene locus_tag LOCUS_20940 21889 23898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 25048 23885 gene locus_tag LOCUS_20950 25048 23885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 27237 25150 gene locus_tag LOCUS_20960 27237 25150 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_20960 27287 27931 gene locus_tag LOCUS_20970 27287 27931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 27970 28635 gene locus_tag LOCUS_20980 27970 28635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 28683 29399 gene locus_tag LOCUS_20990 28683 29399 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803691.1 protein_id gnl|my_center|LOCUS_20990 30842 29403 gene locus_tag LOCUS_21000 30842 29403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 31045 31251 gene locus_tag LOCUS_21010 31045 31251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 31356 31796 gene locus_tag LOCUS_21020 31356 31796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 31808 33253 gene locus_tag LOCUS_21030 31808 33253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 33350 34198 gene locus_tag LOCUS_21040 33350 34198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 34195 35445 gene locus_tag LOCUS_21050 34195 35445 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926861.1 protein_id gnl|my_center|LOCUS_21050 35461 36780 gene locus_tag LOCUS_21060 35461 36780 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_21060 36777 37775 gene locus_tag LOCUS_21070 36777 37775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 37768 38718 gene locus_tag LOCUS_21080 37768 38718 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_21080 38901 39140 gene locus_tag LOCUS_21090 38901 39140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 41214 39226 gene locus_tag LOCUS_21100 41214 39226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 41318 42139 gene locus_tag LOCUS_21110 gene pheA 41318 42139 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_21110 42139 43623 gene locus_tag LOCUS_21120 42139 43623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 44589 43642 gene locus_tag LOCUS_21130 44589 43642 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_21130 45572 44589 gene locus_tag LOCUS_21140 45572 44589 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256486.1 protein_id gnl|my_center|LOCUS_21140 46746 45592 gene locus_tag LOCUS_21150 46746 45592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 47308 46757 gene locus_tag LOCUS_21160 47308 46757 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_21160 48039 47293 gene locus_tag LOCUS_21170 48039 47293 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_21170 48524 48000 gene locus_tag LOCUS_21180 48524 48000 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_21180 49194 48529 gene locus_tag LOCUS_21190 49194 48529 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257526.1 protein_id gnl|my_center|LOCUS_21190 50384 49191 gene locus_tag LOCUS_21200 50384 49191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 50459 51433 gene locus_tag LOCUS_21210 50459 51433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 51520 52452 gene locus_tag LOCUS_21220 gene pstC 51520 52452 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_21220 52449 53462 gene locus_tag LOCUS_21230 52449 53462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 54471 54148 gene locus_tag LOCUS_21240 54471 54148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 54491 54853 gene locus_tag LOCUS_21250 54491 54853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21250 54850 55389 gene locus_tag LOCUS_21260 54850 55389 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21260 55876 55520 gene locus_tag LOCUS_21270 55876 55520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 56356 56676 gene locus_tag LOCUS_21280 56356 56676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21280 56782 57714 gene locus_tag LOCUS_21290 56782 57714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21290 58462 58818 gene locus_tag LOCUS_21300 58462 58818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21300 59310 59429 gene locus_tag LOCUS_21310 59310 59429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 60647 59448 gene locus_tag LOCUS_21320 60647 59448 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_21320 61890 60640 gene locus_tag LOCUS_21330 61890 60640 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_21330 62913 61990 gene locus_tag LOCUS_21340 62913 61990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 64169 62910 gene locus_tag LOCUS_21350 64169 62910 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028234.1 protein_id gnl|my_center|LOCUS_21350 65561 64221 gene locus_tag LOCUS_21360 gene gabT 65561 64221 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973349.1 protein_id gnl|my_center|LOCUS_21360 65730 67283 gene locus_tag LOCUS_21370 65730 67283 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223101.1 protein_id gnl|my_center|LOCUS_21370 67401 68849 gene locus_tag LOCUS_21380 67401 68849 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707523.1 protein_id gnl|my_center|LOCUS_21380 68923 70350 gene locus_tag LOCUS_21390 68923 70350 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 protein_id gnl|my_center|LOCUS_21390 70384 70746 gene locus_tag LOCUS_21400 70384 70746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 70793 71782 gene locus_tag LOCUS_21410 70793 71782 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_21410 71779 72105 gene locus_tag LOCUS_21420 71779 72105 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858631.1 protein_id gnl|my_center|LOCUS_21420 74620 72164 gene locus_tag LOCUS_21430 74620 72164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 75856 74693 gene locus_tag LOCUS_21440 75856 74693 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_21440 76267 75923 gene locus_tag LOCUS_21450 gene erpA 76267 75923 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035737.1 protein_id gnl|my_center|LOCUS_21450 76336 76914 gene locus_tag LOCUS_21460 76336 76914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 76896 77366 gene locus_tag LOCUS_21470 76896 77366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 77363 77530 gene locus_tag LOCUS_21480 77363 77530 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776605.1 protein_id gnl|my_center|LOCUS_21480 78728 77508 gene locus_tag LOCUS_21490 78728 77508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 79918 78776 gene locus_tag LOCUS_21500 79918 78776 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_21500 80754 79915 gene locus_tag LOCUS_21510 80754 79915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 82132 80756 gene locus_tag LOCUS_21520 82132 80756 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_21520 82204 83427 gene locus_tag LOCUS_21530 gene hutI 82204 83427 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389058.1 protein_id gnl|my_center|LOCUS_21530 84995 83436 gene locus_tag LOCUS_21540 gene hutH 84995 83436 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_21540 86578 84995 gene locus_tag LOCUS_21550 gene hutU 86578 84995 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223168.1 protein_id gnl|my_center|LOCUS_21550 86774 87970 gene locus_tag LOCUS_21560 86774 87970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 87949 89109 gene locus_tag LOCUS_21570 87949 89109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 90073 89114 gene locus_tag LOCUS_21580 90073 89114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 90183 90674 gene locus_tag LOCUS_21590 90183 90674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 90960 90631 gene locus_tag LOCUS_21600 90960 90631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 91027 92493 gene locus_tag LOCUS_21610 91027 92493 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_21610 92532 93311 gene locus_tag LOCUS_21620 92532 93311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 93311 93940 gene locus_tag LOCUS_21630 93311 93940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 93937 94884 gene locus_tag LOCUS_21640 93937 94884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 94881 95351 gene locus_tag LOCUS_21650 94881 95351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 95647 95354 gene locus_tag LOCUS_21660 95647 95354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 95685 96296 gene locus_tag LOCUS_21670 95685 96296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 96307 97248 gene locus_tag LOCUS_21680 gene lgt 96307 97248 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227898.1 protein_id gnl|my_center|LOCUS_21680 98351 97245 gene locus_tag LOCUS_21690 98351 97245 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_21690 98414 99106 gene locus_tag LOCUS_21700 98414 99106 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727432.1 protein_id gnl|my_center|LOCUS_21700 99134 100273 gene locus_tag LOCUS_21710 99134 100273 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_21710 101206 100277 gene locus_tag LOCUS_21720 101206 100277 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147080.1 protein_id gnl|my_center|LOCUS_21720 102567 101206 gene locus_tag LOCUS_21730 102567 101206 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665631.1 protein_id gnl|my_center|LOCUS_21730 102642 103352 gene locus_tag LOCUS_21740 102642 103352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 103349 104125 gene locus_tag LOCUS_21750 103349 104125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 104155 105156 gene locus_tag LOCUS_21760 104155 105156 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110924.1 protein_id gnl|my_center|LOCUS_21760 105153 105371 gene locus_tag LOCUS_21770 105153 105371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 105646 105368 gene locus_tag LOCUS_21780 105646 105368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 106658 105663 gene locus_tag LOCUS_21790 gene glpX 106658 105663 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_21790 107702 106698 gene locus_tag LOCUS_21800 107702 106698 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_21800 108265 107699 gene locus_tag LOCUS_21810 gene pgsA 108265 107699 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037265.1 protein_id gnl|my_center|LOCUS_21810 109024 108323 gene locus_tag LOCUS_21820 109024 108323 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081684.1 protein_id gnl|my_center|LOCUS_21820 109107 110162 gene locus_tag LOCUS_21830 109107 110162 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_21830 110197 111042 gene locus_tag LOCUS_21840 110197 111042 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_21840 111113 111781 gene locus_tag LOCUS_21850 111113 111781 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775255.1 protein_id gnl|my_center|LOCUS_21850 111778 113166 gene locus_tag LOCUS_21860 111778 113166 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_21860 113650 113180 gene locus_tag LOCUS_21870 113650 113180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 115100 113745 gene locus_tag LOCUS_21880 115100 113745 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141561.1 protein_id gnl|my_center|LOCUS_21880 116542 115097 gene locus_tag LOCUS_21890 116542 115097 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_21890 116744 117115 gene locus_tag LOCUS_21900 116744 117115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 117118 118293 gene locus_tag LOCUS_21910 117118 118293 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_21910 118727 118305 gene locus_tag LOCUS_21920 118727 118305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 118990 120030 gene locus_tag LOCUS_21930 118990 120030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 120065 121111 gene locus_tag LOCUS_21940 gene argC 120065 121111 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459299.1 protein_id gnl|my_center|LOCUS_21940 121108 122304 gene locus_tag LOCUS_21950 gene argJ 121108 122304 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057748.1 protein_id gnl|my_center|LOCUS_21950 123200 122415 gene locus_tag LOCUS_21960 123200 122415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 123624 123250 gene locus_tag LOCUS_21970 123624 123250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970