>Feature sequence01 57 914 gene locus_tag LOCUS_00010 57 914 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_00010 1603 911 gene locus_tag LOCUS_00020 1603 911 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_00020 1732 2013 gene locus_tag LOCUS_00030 1732 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2020 2715 gene locus_tag LOCUS_00040 2020 2715 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_00040 2719 3375 gene locus_tag LOCUS_00050 2719 3375 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_00050 3488 4933 gene locus_tag LOCUS_00060 gene sufB 3488 4933 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_00060 4951 5709 gene locus_tag LOCUS_00070 gene sufC 4951 5709 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_00070 5706 6992 gene locus_tag LOCUS_00080 gene sufD 5706 6992 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_00080 6996 8240 gene locus_tag LOCUS_00090 6996 8240 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_00090 8244 8684 gene locus_tag LOCUS_00100 8244 8684 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_00100 8690 9028 gene locus_tag LOCUS_00110 8690 9028 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_00110 9112 9501 gene locus_tag LOCUS_00120 9112 9501 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_00120 10390 9512 gene locus_tag LOCUS_00130 10390 9512 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_00130 10557 11462 gene locus_tag LOCUS_00140 10557 11462 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_00140 14491 11441 gene locus_tag LOCUS_00150 14491 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15731 14508 gene locus_tag LOCUS_00160 gene dinB 15731 14508 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_00160 15860 17428 gene locus_tag LOCUS_00170 15860 17428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21209 17538 gene locus_tag LOCUS_00180 21209 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21795 21391 gene locus_tag LOCUS_00190 21795 21391 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_00190 23795 21810 gene locus_tag LOCUS_00200 gene rpsA 23795 21810 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_00200 24070 24441 gene locus_tag LOCUS_00210 24070 24441 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071772.1 protein_id gnl|my_center|LOCUS_00210 25630 24413 gene locus_tag LOCUS_00220 25630 24413 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228462.1 protein_id gnl|my_center|LOCUS_00220 26779 25805 gene locus_tag LOCUS_00230 26779 25805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 29016 26893 gene locus_tag LOCUS_00240 29016 26893 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832365.1 protein_id gnl|my_center|LOCUS_00240 29310 32036 gene locus_tag LOCUS_00250 29310 32036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 32178 32630 gene locus_tag LOCUS_00260 32178 32630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32710 34740 gene locus_tag LOCUS_00270 32710 34740 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_00270 34737 35138 gene locus_tag LOCUS_00280 34737 35138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 37690 35453 gene locus_tag LOCUS_00290 37690 35453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 38649 37687 gene locus_tag LOCUS_00300 38649 37687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 40051 38693 gene locus_tag LOCUS_00310 40051 38693 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_00310 40727 40900 gene locus_tag LOCUS_00320 40727 40900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 41187 43811 gene locus_tag LOCUS_00330 gene clpB 41187 43811 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963875.1 protein_id gnl|my_center|LOCUS_00330 43893 43818 gene locus_tag LOCUS_t00010 43893 43818 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 48378 44128 gene locus_tag LOCUS_00340 48378 44128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 49171 48311 gene locus_tag LOCUS_00350 49171 48311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 52230 49249 gene locus_tag LOCUS_00360 52230 49249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 54087 52540 gene locus_tag LOCUS_00370 54087 52540 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_00370 55110 54151 gene locus_tag LOCUS_00380 55110 54151 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_00380 55294 57294 gene locus_tag LOCUS_00390 55294 57294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 57759 58790 gene locus_tag LOCUS_00400 57759 58790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 59334 58771 gene locus_tag LOCUS_00410 59334 58771 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963692.1 protein_id gnl|my_center|LOCUS_00410 61063 59306 gene locus_tag LOCUS_00420 61063 59306 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_00420 62148 61093 gene locus_tag LOCUS_00430 gene recA 62148 61093 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_00430 62929 62267 gene locus_tag LOCUS_00440 gene nth 62929 62267 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_00440 65694 62926 gene locus_tag LOCUS_00450 65694 62926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 66356 65730 gene locus_tag LOCUS_00460 66356 65730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 67423 66356 gene locus_tag LOCUS_00470 67423 66356 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_00470 68126 67389 gene locus_tag LOCUS_00480 68126 67389 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_00480 70024 68981 gene locus_tag LOCUS_00490 70024 68981 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729232.1 protein_id gnl|my_center|LOCUS_00490 70560 70081 gene locus_tag LOCUS_00500 70560 70081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 70617 71984 gene locus_tag LOCUS_00510 70617 71984 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_00510 73360 71981 gene locus_tag LOCUS_00520 73360 71981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 73815 74576 gene locus_tag LOCUS_00530 73815 74576 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927143.1 protein_id gnl|my_center|LOCUS_00530 74663 79546 gene locus_tag LOCUS_00540 74663 79546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 80344 79634 gene locus_tag LOCUS_00550 80344 79634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 80438 81682 gene locus_tag LOCUS_00560 80438 81682 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_00560 81772 83100 gene locus_tag LOCUS_00570 gene rimO 81772 83100 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_00570 83215 84813 gene locus_tag LOCUS_00580 gene bshC 83215 84813 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_00580 84953 85906 gene locus_tag LOCUS_00590 84953 85906 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964315.1 protein_id gnl|my_center|LOCUS_00590 85912 86937 gene locus_tag LOCUS_00600 gene nuoH 85912 86937 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_00600 86953 87513 gene locus_tag LOCUS_00610 86953 87513 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_00610 87510 88016 gene locus_tag LOCUS_00620 87510 88016 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_00620 88024 88353 gene locus_tag LOCUS_00630 gene nuoK 88024 88353 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964311.1 protein_id gnl|my_center|LOCUS_00630 88347 89717 gene locus_tag LOCUS_00640 88347 89717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00640 89728 90276 gene locus_tag LOCUS_00650 89728 90276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00650 90281 91750 gene locus_tag LOCUS_00660 90281 91750 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_00660 91755 93176 gene locus_tag LOCUS_00670 91755 93176 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964308.1 protein_id gnl|my_center|LOCUS_00670 94130 93315 gene locus_tag LOCUS_00680 94130 93315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 96229 94280 gene locus_tag LOCUS_00690 96229 94280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 97738 96341 gene locus_tag LOCUS_00700 97738 96341 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444159.1 protein_id gnl|my_center|LOCUS_00700 99267 97735 gene locus_tag LOCUS_00710 99267 97735 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_00710 100402 99296 gene locus_tag LOCUS_00720 100402 99296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 100483 101022 gene locus_tag LOCUS_00730 100483 101022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 101726 101286 gene locus_tag LOCUS_00740 101726 101286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 103248 101875 gene locus_tag LOCUS_00750 gene atoC 103248 101875 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125282.1 protein_id gnl|my_center|LOCUS_00750 105793 103328 gene locus_tag LOCUS_00760 105793 103328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 105882 106583 gene locus_tag LOCUS_00770 105882 106583 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202227.1 protein_id gnl|my_center|LOCUS_00770 106567 107217 gene locus_tag LOCUS_00780 gene mnmD 106567 107217 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_00780 107288 108001 gene locus_tag LOCUS_00790 107288 108001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 108058 108915 gene locus_tag LOCUS_00800 108058 108915 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 protein_id gnl|my_center|LOCUS_00800 108912 109778 gene locus_tag LOCUS_00810 gene hisG 108912 109778 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_00810 109951 110712 gene locus_tag LOCUS_00820 109951 110712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 112291 110756 gene locus_tag LOCUS_00830 112291 110756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 112462 112857 gene locus_tag LOCUS_00840 112462 112857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 113649 112867 gene locus_tag LOCUS_00850 113649 112867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 117681 115516 gene locus_tag LOCUS_00860 117681 115516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 117737 118975 gene locus_tag LOCUS_00870 117737 118975 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_00870 119980 118985 gene locus_tag LOCUS_00880 119980 118985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 120071 120703 gene locus_tag LOCUS_00890 120071 120703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 121139 120708 gene locus_tag LOCUS_00900 121139 120708 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355850.1 protein_id gnl|my_center|LOCUS_00900 121201 122355 gene locus_tag LOCUS_00910 121201 122355 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_00910 122368 122613 gene locus_tag LOCUS_00920 122368 122613 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403584.1 protein_id gnl|my_center|LOCUS_00920 122748 123506 gene locus_tag LOCUS_00930 gene pyrF 122748 123506 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_00930 123528 124790 gene locus_tag LOCUS_00940 123528 124790 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_00940 124839 125057 gene locus_tag LOCUS_00950 124839 125057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_00950 125120 126421 gene locus_tag LOCUS_00960 125120 126421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 126472 127869 gene locus_tag LOCUS_00970 126472 127869 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_00970 127880 128200 gene locus_tag LOCUS_00980 127880 128200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_00980 128252 129619 gene locus_tag LOCUS_00990 128252 129619 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_00990 130165 129629 gene locus_tag LOCUS_01000 130165 129629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 130420 130752 gene locus_tag LOCUS_01010 130420 130752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 130768 131601 gene locus_tag LOCUS_01020 gene nadC 130768 131601 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_01020 131701 132597 gene locus_tag LOCUS_01030 131701 132597 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_01030 132766 133866 gene locus_tag LOCUS_01040 gene mnmA 132766 133866 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_01040 133942 134652 gene locus_tag LOCUS_01050 133942 134652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 134658 136355 gene locus_tag LOCUS_01060 134658 136355 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764149.1 protein_id gnl|my_center|LOCUS_01060 136408 137610 gene locus_tag LOCUS_01070 136408 137610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 138172 137741 gene locus_tag LOCUS_01080 138172 137741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 138567 138244 gene locus_tag LOCUS_01090 138567 138244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 139011 138571 gene locus_tag LOCUS_01100 139011 138571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 139750 139196 gene locus_tag LOCUS_01110 139750 139196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 140548 139982 gene locus_tag LOCUS_01120 140548 139982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921973.1 protein_id gnl|my_center|LOCUS_01120 140741 141184 gene locus_tag LOCUS_01130 140741 141184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 141850 141200 gene locus_tag LOCUS_01140 gene kdsB 141850 141200 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_01140 142005 143315 gene locus_tag LOCUS_01150 142005 143315 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_01150 144018 143371 gene locus_tag LOCUS_01160 144018 143371 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_01160 144343 144657 gene locus_tag LOCUS_01170 144343 144657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 145953 144661 gene locus_tag LOCUS_01180 145953 144661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946837.1 protein_id gnl|my_center|LOCUS_01180 147898 146297 gene locus_tag LOCUS_01190 147898 146297 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932499.1 protein_id gnl|my_center|LOCUS_01190 148071 148520 gene locus_tag LOCUS_01200 148071 148520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 148638 148725 gene locus_tag LOCUS_t00020 148638 148725 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 151442 148743 gene locus_tag LOCUS_01210 151442 148743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 152174 151581 gene locus_tag LOCUS_01220 152174 151581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 152800 152162 gene locus_tag LOCUS_01230 152800 152162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 153144 152941 gene locus_tag LOCUS_01240 153144 152941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 154295 153339 gene locus_tag LOCUS_01250 154295 153339 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101381.1 protein_id gnl|my_center|LOCUS_01250 154409 155263 gene locus_tag LOCUS_01260 154409 155263 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_01260 156965 155265 gene locus_tag LOCUS_01270 156965 155265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 159482 157086 gene locus_tag LOCUS_01280 159482 157086 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_01280 161503 159926 gene locus_tag LOCUS_01290 161503 159926 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_01290 162112 161648 gene locus_tag LOCUS_01300 162112 161648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 162328 164712 gene locus_tag LOCUS_01310 162328 164712 CDS product Rv1355c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728218.1 protein_id gnl|my_center|LOCUS_01310 164712 165392 gene locus_tag LOCUS_01320 164712 165392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 165433 167667 gene locus_tag LOCUS_01330 165433 167667 CDS product 7TM diverse intracellular signaling domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090388836.1 protein_id gnl|my_center|LOCUS_01330 167670 168773 gene locus_tag LOCUS_01340 167670 168773 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837658.1 protein_id gnl|my_center|LOCUS_01340 168760 169164 gene locus_tag LOCUS_01350 168760 169164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 169306 169222 gene locus_tag LOCUS_t00030 169306 169222 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 169448 169375 gene locus_tag LOCUS_t00040 169448 169375 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 169631 169559 gene locus_tag LOCUS_t00050 169631 169559 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 173382 169684 gene locus_tag LOCUS_01360 173382 169684 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062542257.1 protein_id gnl|my_center|LOCUS_01360 174219 173443 gene locus_tag LOCUS_01370 gene mazG 174219 173443 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_01370 174417 174992 gene locus_tag LOCUS_01380 174417 174992 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_01380 176966 175011 gene locus_tag LOCUS_01390 176966 175011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 177568 176921 gene locus_tag LOCUS_01400 177568 176921 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_01400 178583 177702 gene locus_tag LOCUS_01410 gene folD 178583 177702 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780414.1 protein_id gnl|my_center|LOCUS_01410 180402 178585 gene locus_tag LOCUS_01420 gene lepA 180402 178585 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_01420 180686 185188 gene locus_tag LOCUS_01430 180686 185188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 185336 186256 gene locus_tag LOCUS_01440 gene cas1 185336 186256 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_01440 186286 186633 gene locus_tag LOCUS_01450 gene cas2 186286 186633 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_01450 186746 192941 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatatcggttatccatctttgtcttcaaaccacaac 194152 193346 gene locus_tag LOCUS_01460 194152 193346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 195124 194771 gene locus_tag LOCUS_01470 195124 194771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 196806 195256 gene locus_tag LOCUS_01480 196806 195256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 198599 196827 gene locus_tag LOCUS_01490 198599 196827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 199839 198604 gene locus_tag LOCUS_01500 199839 198604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 200935 199886 gene locus_tag LOCUS_01510 200935 199886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 202164 201517 gene locus_tag LOCUS_01520 202164 201517 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_01520 203837 202161 gene locus_tag LOCUS_01530 203837 202161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 205551 204217 gene locus_tag LOCUS_01540 205551 204217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 206242 207264 gene locus_tag LOCUS_01550 206242 207264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 208900 207404 gene locus_tag LOCUS_01560 gene glpK 208900 207404 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760011.1 protein_id gnl|my_center|LOCUS_01560 217100 209100 gene locus_tag LOCUS_01570 217100 209100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 217512 217877 gene locus_tag LOCUS_01580 gene ndhC 217512 217877 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964322.1 protein_id gnl|my_center|LOCUS_01580 217899 218456 gene locus_tag LOCUS_01590 217899 218456 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_01590 218456 219010 gene locus_tag LOCUS_01600 218456 219010 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964320.1 protein_id gnl|my_center|LOCUS_01600 219020 220249 gene locus_tag LOCUS_01610 219020 220249 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964319.1 protein_id gnl|my_center|LOCUS_01610 220256 220792 gene locus_tag LOCUS_01620 220256 220792 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964318.1 protein_id gnl|my_center|LOCUS_01620 221332 220856 gene locus_tag LOCUS_01630 221332 220856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 221685 221329 gene locus_tag LOCUS_01640 221685 221329 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362343.1 protein_id gnl|my_center|LOCUS_01640 222444 221686 gene locus_tag LOCUS_01650 gene ric 222444 221686 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_01650 222917 222525 gene locus_tag LOCUS_01660 222917 222525 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920892.1 protein_id gnl|my_center|LOCUS_01660 223517 223083 gene locus_tag LOCUS_01670 223517 223083 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_01670 224109 223594 gene locus_tag LOCUS_01680 224109 223594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 224324 224992 gene locus_tag LOCUS_01690 224324 224992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 225098 225526 gene locus_tag LOCUS_01700 225098 225526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 225539 226582 gene locus_tag LOCUS_01710 225539 226582 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_01710 226796 226551 gene locus_tag LOCUS_01720 226796 226551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 227410 227892 gene locus_tag LOCUS_01730 227410 227892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 228268 228528 gene locus_tag LOCUS_01740 228268 228528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 228525 228938 gene locus_tag LOCUS_01750 228525 228938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 229013 229798 gene locus_tag LOCUS_01760 229013 229798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 230053 229871 gene locus_tag LOCUS_01770 230053 229871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 230605 230063 gene locus_tag LOCUS_01780 230605 230063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 231109 230702 gene locus_tag LOCUS_01790 231109 230702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 231654 231247 gene locus_tag LOCUS_01800 231654 231247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 232310 231792 gene locus_tag LOCUS_01810 232310 231792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 233099 232518 gene locus_tag LOCUS_01820 233099 232518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 233587 233096 gene locus_tag LOCUS_01830 233587 233096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 234353 233589 gene locus_tag LOCUS_01840 234353 233589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 234634 234356 gene locus_tag LOCUS_01850 234634 234356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 235079 234636 gene locus_tag LOCUS_01860 235079 234636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 235407 235126 gene locus_tag LOCUS_01870 235407 235126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 235620 235411 gene locus_tag LOCUS_01880 235620 235411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 235844 235641 gene locus_tag LOCUS_01890 235844 235641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 237016 235841 gene locus_tag LOCUS_01900 237016 235841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 238469 236955 gene locus_tag LOCUS_01910 238469 236955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 239046 238444 gene locus_tag LOCUS_01920 239046 238444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 239657 239043 gene locus_tag LOCUS_01930 239657 239043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 240987 239779 gene locus_tag LOCUS_01940 240987 239779 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_01940 243666 241168 gene locus_tag LOCUS_01950 gene gyrA 243666 241168 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_01950 244096 244722 gene locus_tag LOCUS_01960 244096 244722 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_01960 244725 245126 gene locus_tag LOCUS_01970 244725 245126 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_01970 245123 246013 gene locus_tag LOCUS_01980 245123 246013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964028.1 protein_id gnl|my_center|LOCUS_01980 246087 247409 gene locus_tag LOCUS_01990 246087 247409 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_01990 252530 247437 gene locus_tag LOCUS_02000 252530 247437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 252803 255025 gene locus_tag LOCUS_02010 gene purL 252803 255025 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_02010 255122 256657 gene locus_tag LOCUS_02020 255122 256657 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_02020 256720 259047 gene locus_tag LOCUS_02030 256720 259047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 259058 260179 gene locus_tag LOCUS_02040 gene hisB 259058 260179 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963105.1 protein_id gnl|my_center|LOCUS_02040 260180 260758 gene locus_tag LOCUS_02050 gene hisH 260180 260758 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_02050 260755 261480 gene locus_tag LOCUS_02060 gene hisA 260755 261480 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963103.1 protein_id gnl|my_center|LOCUS_02060 261477 262274 gene locus_tag LOCUS_02070 gene hisF 261477 262274 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_02070 262241 262849 gene locus_tag LOCUS_02080 gene hisIE 262241 262849 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_02080 263719 262862 gene locus_tag LOCUS_02090 gene accD 263719 262862 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933219.1 protein_id gnl|my_center|LOCUS_02090 264976 263900 gene locus_tag LOCUS_02100 264976 263900 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_02100 265845 265039 gene locus_tag LOCUS_02110 265845 265039 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_02110 265874 267571 gene locus_tag LOCUS_02120 265874 267571 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_02120 267694 268434 gene locus_tag LOCUS_02130 267694 268434 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_02130 268481 268933 gene locus_tag LOCUS_02140 268481 268933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 269496 268939 gene locus_tag LOCUS_02150 269496 268939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 270788 269553 gene locus_tag LOCUS_02160 270788 269553 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_02160 270962 272173 gene locus_tag LOCUS_02170 270962 272173 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_02170 273067 272207 gene locus_tag LOCUS_02180 gene prfB 273067 272207 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02180 274332 273367 gene locus_tag LOCUS_02190 gene ftsY 274332 273367 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107516.1 protein_id gnl|my_center|LOCUS_02190 274575 274411 gene locus_tag LOCUS_02200 274575 274411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 274770 274582 gene locus_tag LOCUS_02210 gene rpmG 274770 274582 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_02210 275023 274781 gene locus_tag LOCUS_02220 gene rpmB 275023 274781 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216391.1 protein_id gnl|my_center|LOCUS_02220 275556 275113 gene locus_tag LOCUS_02230 275556 275113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 275976 275608 gene locus_tag LOCUS_02240 275976 275608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 276201 277349 gene locus_tag LOCUS_02250 276201 277349 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902843.1 protein_id gnl|my_center|LOCUS_02250 282094 277403 gene locus_tag LOCUS_02260 282094 277403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 283517 282126 gene locus_tag LOCUS_02270 283517 282126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 283806 283585 gene locus_tag LOCUS_02280 283806 283585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 283984 285063 gene locus_tag LOCUS_02290 283984 285063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 286511 285069 gene locus_tag LOCUS_02300 286511 285069 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107154.1 protein_id gnl|my_center|LOCUS_02300 286781 288136 gene locus_tag LOCUS_02310 286781 288136 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_02310 288305 288553 gene locus_tag LOCUS_02320 288305 288553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 290000 288561 gene locus_tag LOCUS_02330 290000 288561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 291611 290331 gene locus_tag LOCUS_02340 gene aceA 291611 290331 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787351.1 protein_id gnl|my_center|LOCUS_02340 293269 291665 gene locus_tag LOCUS_02350 gene aceB 293269 291665 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258821.1 protein_id gnl|my_center|LOCUS_02350 294774 293536 gene locus_tag LOCUS_02360 294774 293536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 295991 295176 gene locus_tag LOCUS_02370 295991 295176 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_02370 296026 296487 gene locus_tag LOCUS_02380 gene rnhA 296026 296487 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_02380 297514 296495 gene locus_tag LOCUS_02390 gene fbp 297514 296495 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705872.1 protein_id gnl|my_center|LOCUS_02390 297616 298116 gene locus_tag LOCUS_02400 297616 298116 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_02400 298163 299428 gene locus_tag LOCUS_02410 298163 299428 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_02410 299662 306672 gene locus_tag LOCUS_02420 299662 306672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 306948 307454 gene locus_tag LOCUS_02430 306948 307454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 307493 309649 gene locus_tag LOCUS_02440 307493 309649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 309997 310566 gene locus_tag LOCUS_02450 309997 310566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963138.1 protein_id gnl|my_center|LOCUS_02450 311320 310571 gene locus_tag LOCUS_02460 311320 310571 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_02460 311452 312357 gene locus_tag LOCUS_02470 311452 312357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 312398 313369 gene locus_tag LOCUS_02480 312398 313369 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_02480 314070 313360 gene locus_tag LOCUS_02490 gene aat 314070 313360 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947494.1 protein_id gnl|my_center|LOCUS_02490 314337 316199 gene locus_tag LOCUS_02500 314337 316199 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_02500 316306 319116 gene locus_tag LOCUS_02510 316306 319116 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_02510 319211 319660 gene locus_tag LOCUS_02520 319211 319660 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_02520 320578 319676 gene locus_tag LOCUS_02530 320578 319676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 321862 320687 gene locus_tag LOCUS_02540 321862 320687 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_02540 321974 324055 gene locus_tag LOCUS_02550 321974 324055 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_02550 324923 324132 gene locus_tag LOCUS_02560 324923 324132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 325017 326948 gene locus_tag LOCUS_02570 gene dnaG 325017 326948 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_02570 328259 327066 gene locus_tag LOCUS_02580 328259 327066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 328615 328250 gene locus_tag LOCUS_02590 328615 328250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 328749 329819 gene locus_tag LOCUS_02600 328749 329819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 329855 337543 gene locus_tag LOCUS_02610 329855 337543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 337702 343332 gene locus_tag LOCUS_02620 337702 343332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 344604 343348 gene locus_tag LOCUS_02630 344604 343348 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933139.1 protein_id gnl|my_center|LOCUS_02630 345683 344613 gene locus_tag LOCUS_02640 gene proB 345683 344613 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933124.1 protein_id gnl|my_center|LOCUS_02640 346800 345694 gene locus_tag LOCUS_02650 346800 345694 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_02650 347696 346797 gene locus_tag LOCUS_02660 347696 346797 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_02660 348899 347700 gene locus_tag LOCUS_02670 348899 347700 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_02670 350447 349179 gene locus_tag LOCUS_02680 gene aroA 350447 349179 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249218.1 protein_id gnl|my_center|LOCUS_02680 350709 351878 gene locus_tag LOCUS_02690 350709 351878 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975888.1 protein_id gnl|my_center|LOCUS_02690 351895 352197 gene locus_tag LOCUS_02700 351895 352197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 352375 352302 gene locus_tag LOCUS_t00060 352375 352302 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 353239 352451 gene locus_tag LOCUS_02710 353239 352451 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_02710 353318 354238 gene locus_tag LOCUS_02720 353318 354238 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_02720 354362 355942 gene locus_tag LOCUS_02730 354362 355942 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_02730 355993 356727 gene locus_tag LOCUS_02740 gene fabG 355993 356727 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_02740 356724 357947 gene locus_tag LOCUS_02750 356724 357947 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_02750 357957 358214 gene locus_tag LOCUS_02760 357957 358214 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_02760 358214 359098 gene locus_tag LOCUS_02770 358214 359098 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_02770 359139 361499 gene locus_tag LOCUS_02780 359139 361499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 361520 361966 gene locus_tag LOCUS_02790 361520 361966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964368.1 protein_id gnl|my_center|LOCUS_02790 361963 363252 gene locus_tag LOCUS_02800 361963 363252 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_02800 363259 363828 gene locus_tag LOCUS_02810 363259 363828 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_02810 363801 364976 gene locus_tag LOCUS_02820 363801 364976 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964359.1 protein_id gnl|my_center|LOCUS_02820 364969 366225 gene locus_tag LOCUS_02830 364969 366225 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964378.1 protein_id gnl|my_center|LOCUS_02830 366237 366887 gene locus_tag LOCUS_02840 366237 366887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_02840 366838 367092 gene locus_tag LOCUS_02850 366838 367092 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_02850 367158 368375 gene locus_tag LOCUS_02860 367158 368375 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_02860 368359 369414 gene locus_tag LOCUS_02870 368359 369414 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_02870 369408 370184 gene locus_tag LOCUS_02880 369408 370184 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964353.1 protein_id gnl|my_center|LOCUS_02880 370177 370806 gene locus_tag LOCUS_02890 370177 370806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 370835 371404 gene locus_tag LOCUS_02900 370835 371404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 371470 371856 gene locus_tag LOCUS_02910 371470 371856 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964349.1 protein_id gnl|my_center|LOCUS_02910 371840 372391 gene locus_tag LOCUS_02920 371840 372391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02920 372677 373036 gene locus_tag LOCUS_02930 372677 373036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02930 373047 376907 gene locus_tag LOCUS_02940 373047 376907 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964346.1 protein_id gnl|my_center|LOCUS_02940 376897 378402 gene locus_tag LOCUS_02950 376897 378402 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_02950 378395 380086 gene locus_tag LOCUS_02960 378395 380086 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964344.1 protein_id gnl|my_center|LOCUS_02960 380104 381429 gene locus_tag LOCUS_02970 380104 381429 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_02970 381456 382937 gene locus_tag LOCUS_02980 381456 382937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 383356 382943 gene locus_tag LOCUS_02990 383356 382943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 383403 384092 gene locus_tag LOCUS_03000 383403 384092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 384604 384101 gene locus_tag LOCUS_03010 384604 384101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 384937 384677 gene locus_tag LOCUS_03020 384937 384677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 385027 386355 gene locus_tag LOCUS_03030 385027 386355 CDS product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 protein_id gnl|my_center|LOCUS_03030 386405 387433 gene locus_tag LOCUS_03040 386405 387433 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_03040 387441 388448 gene locus_tag LOCUS_03050 387441 388448 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_03050 390191 388464 gene locus_tag LOCUS_03060 gene aceK 390191 388464 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706819.1 protein_id gnl|my_center|LOCUS_03060 391120 390242 gene locus_tag LOCUS_03070 391120 390242 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838346.1 protein_id gnl|my_center|LOCUS_03070 391732 391154 gene locus_tag LOCUS_03080 391732 391154 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104390.1 protein_id gnl|my_center|LOCUS_03080 391942 392784 gene locus_tag LOCUS_03090 391942 392784 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 protein_id gnl|my_center|LOCUS_03090 392917 394989 gene locus_tag LOCUS_03100 392917 394989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 395217 395597 gene locus_tag LOCUS_03110 395217 395597 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_03110 395599 396741 gene locus_tag LOCUS_03120 395599 396741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 396791 397753 gene locus_tag LOCUS_03130 396791 397753 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765880.1 protein_id gnl|my_center|LOCUS_03130 397746 398945 gene locus_tag LOCUS_03140 397746 398945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 399685 398954 gene locus_tag LOCUS_03150 399685 398954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 401220 399721 gene locus_tag LOCUS_03160 401220 399721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 401963 401346 gene locus_tag LOCUS_03170 401963 401346 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202967.1 protein_id gnl|my_center|LOCUS_03170 403193 401979 gene locus_tag LOCUS_03180 403193 401979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 404533 403241 gene locus_tag LOCUS_03190 404533 403241 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860184.1 protein_id gnl|my_center|LOCUS_03190 405083 405664 gene locus_tag LOCUS_03200 405083 405664 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_03200 405748 406038 gene locus_tag LOCUS_03210 405748 406038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 406105 406566 gene locus_tag LOCUS_03220 406105 406566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 406740 407726 gene locus_tag LOCUS_03230 406740 407726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 408450 407977 gene locus_tag LOCUS_03240 408450 407977 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963491.1 protein_id gnl|my_center|LOCUS_03240 408654 408908 gene locus_tag LOCUS_03250 408654 408908 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_03250 409146 411377 gene locus_tag LOCUS_03260 409146 411377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 411441 411839 gene locus_tag LOCUS_03270 411441 411839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 411935 412153 gene locus_tag LOCUS_03280 411935 412153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 412400 413011 gene locus_tag LOCUS_03290 412400 413011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 413096 413539 gene locus_tag LOCUS_03300 413096 413539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 413960 413616 gene locus_tag LOCUS_03310 gene rplT 413960 413616 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_03310 414177 413989 gene locus_tag LOCUS_03320 gene rpmI 414177 413989 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786574.1 protein_id gnl|my_center|LOCUS_03320 414819 414259 gene locus_tag LOCUS_03330 gene infC 414819 414259 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_03330 416774 414843 gene locus_tag LOCUS_03340 gene thrS 416774 414843 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_03340 417719 416787 gene locus_tag LOCUS_03350 417719 416787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 417923 418624 gene locus_tag LOCUS_03360 417923 418624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 418980 418708 gene locus_tag LOCUS_03370 418980 418708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 419277 419513 gene locus_tag LOCUS_03380 419277 419513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 419510 421597 gene locus_tag LOCUS_03390 gene feoB 419510 421597 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_03390 421823 422953 gene locus_tag LOCUS_03400 421823 422953 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_03400 422950 426138 gene locus_tag LOCUS_03410 422950 426138 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838342.1 protein_id gnl|my_center|LOCUS_03410 426125 427363 gene locus_tag LOCUS_03420 426125 427363 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838343.1 protein_id gnl|my_center|LOCUS_03420 429507 427369 gene locus_tag LOCUS_03430 gene fadJ 429507 427369 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072985.1 protein_id gnl|my_center|LOCUS_03430 430841 429540 gene locus_tag LOCUS_03440 430841 429540 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021108.1 protein_id gnl|my_center|LOCUS_03440 430886 432250 gene locus_tag LOCUS_03450 430886 432250 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_03450 433385 432255 gene locus_tag LOCUS_03460 433385 432255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 434362 433436 gene locus_tag LOCUS_03470 434362 433436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 435524 434367 gene locus_tag LOCUS_03480 435524 434367 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_03480 436243 435572 gene locus_tag LOCUS_03490 436243 435572 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_03490 436327 437730 gene locus_tag LOCUS_03500 436327 437730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 437855 438760 gene locus_tag LOCUS_03510 437855 438760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 438699 439025 gene locus_tag LOCUS_03520 438699 439025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 439456 439629 gene locus_tag LOCUS_03530 439456 439629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 440028 440483 gene locus_tag LOCUS_03540 440028 440483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03540 440650 441180 gene locus_tag LOCUS_03550 440650 441180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 442809 441457 gene locus_tag LOCUS_03560 gene nuoF 442809 441457 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_03560 443048 444547 gene locus_tag LOCUS_03570 443048 444547 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088683.1 protein_id gnl|my_center|LOCUS_03570 444636 445175 gene locus_tag LOCUS_03580 444636 445175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 445925 445188 gene locus_tag LOCUS_03590 445925 445188 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_03590 447246 445936 gene locus_tag LOCUS_03600 gene ahcY 447246 445936 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_03600 447413 450001 gene locus_tag LOCUS_03610 447413 450001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 450475 450173 gene locus_tag LOCUS_03620 450475 450173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 451223 452671 gene locus_tag LOCUS_03630 451223 452671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 452675 454123 gene locus_tag LOCUS_03640 452675 454123 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_03640 454617 454120 gene locus_tag LOCUS_03650 454617 454120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 454725 455306 gene locus_tag LOCUS_03660 454725 455306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 455368 456147 gene locus_tag LOCUS_03670 455368 456147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 456144 456674 gene locus_tag LOCUS_03680 gene rsmD 456144 456674 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_03680 456729 456944 gene locus_tag LOCUS_03690 456729 456944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 457072 458040 gene locus_tag LOCUS_03700 457072 458040 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_03700 458699 458094 gene locus_tag LOCUS_03710 458699 458094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 460125 458854 gene locus_tag LOCUS_03720 gene serS 460125 458854 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 protein_id gnl|my_center|LOCUS_03720 460248 461048 gene locus_tag LOCUS_03730 460248 461048 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489429.1 protein_id gnl|my_center|LOCUS_03730 463900 461057 gene locus_tag LOCUS_03740 gene uvrA 463900 461057 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107958.1 protein_id gnl|my_center|LOCUS_03740 464093 464671 gene locus_tag LOCUS_03750 464093 464671 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_03750 464833 465066 gene locus_tag LOCUS_03760 464833 465066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 465775 465080 gene locus_tag LOCUS_03770 465775 465080 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027645.1 protein_id gnl|my_center|LOCUS_03770 466126 466998 gene locus_tag LOCUS_03780 466126 466998 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_03780 466967 469114 gene locus_tag LOCUS_03790 gene ppk1 466967 469114 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963117.1 protein_id gnl|my_center|LOCUS_03790 469220 470137 gene locus_tag LOCUS_03800 469220 470137 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_03800 470715 470116 gene locus_tag LOCUS_03810 470715 470116 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783551.1 protein_id gnl|my_center|LOCUS_03810 470817 471908 gene locus_tag LOCUS_03820 470817 471908 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832304.1 protein_id gnl|my_center|LOCUS_03820 472823 471930 gene locus_tag LOCUS_03830 472823 471930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 473620 472916 gene locus_tag LOCUS_03840 473620 472916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 475660 473813 gene locus_tag LOCUS_03850 475660 473813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 475830 478382 gene locus_tag LOCUS_03860 475830 478382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 478484 479569 gene locus_tag LOCUS_03870 478484 479569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 479625 480860 gene locus_tag LOCUS_03880 479625 480860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 480948 482687 gene locus_tag LOCUS_03890 480948 482687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 482695 483885 gene locus_tag LOCUS_03900 482695 483885 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373755.1 protein_id gnl|my_center|LOCUS_03900 483989 484063 gene locus_tag LOCUS_t00070 483989 484063 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 484961 485815 gene locus_tag LOCUS_03910 gene tauD 484961 485815 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004027.1 protein_id gnl|my_center|LOCUS_03910 485886 487067 gene locus_tag LOCUS_03920 485886 487067 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250039.1 protein_id gnl|my_center|LOCUS_03920 487184 488062 gene locus_tag LOCUS_03930 487184 488062 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_03930 488090 489151 gene locus_tag LOCUS_03940 488090 489151 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_03940 490191 489163 gene locus_tag LOCUS_03950 gene mltG 490191 489163 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_03950 492104 490191 gene locus_tag LOCUS_03960 492104 490191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 492512 492114 gene locus_tag LOCUS_03970 492512 492114 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_03970 494730 492514 gene locus_tag LOCUS_03980 494730 492514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 495545 494727 gene locus_tag LOCUS_03990 495545 494727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 498219 495532 gene locus_tag LOCUS_04000 498219 495532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 501082 498359 gene locus_tag LOCUS_04010 501082 498359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 501847 501086 gene locus_tag LOCUS_04020 501847 501086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 502159 503439 gene locus_tag LOCUS_04030 502159 503439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 503465 504136 gene locus_tag LOCUS_04040 503465 504136 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_04040 504751 504170 gene locus_tag LOCUS_04050 504751 504170 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_04050 505984 504809 gene locus_tag LOCUS_04060 505984 504809 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836861.1 protein_id gnl|my_center|LOCUS_04060 506407 506030 gene locus_tag LOCUS_04070 506407 506030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 506519 507043 gene locus_tag LOCUS_04080 506519 507043 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240524.1 protein_id gnl|my_center|LOCUS_04080 507057 508043 gene locus_tag LOCUS_04090 507057 508043 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_04090 508649 508020 gene locus_tag LOCUS_04100 508649 508020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 509275 508691 gene locus_tag LOCUS_04110 509275 508691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 509466 511595 gene locus_tag LOCUS_04120 509466 511595 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790956.1 protein_id gnl|my_center|LOCUS_04120 512335 511643 gene locus_tag LOCUS_04130 gene cmk 512335 511643 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_04130 513441 512404 gene locus_tag LOCUS_04140 513441 512404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 516046 513602 gene locus_tag LOCUS_04150 gene lon 516046 513602 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_04150 516195 517649 gene locus_tag LOCUS_04160 516195 517649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 517646 518542 gene locus_tag LOCUS_04170 gene ligD 517646 518542 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227027.1 protein_id gnl|my_center|LOCUS_04170 519213 518662 gene locus_tag LOCUS_04180 519213 518662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 519843 519355 gene locus_tag LOCUS_04190 519843 519355 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_04190 520872 519895 gene locus_tag LOCUS_04200 520872 519895 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_04200 521876 520869 gene locus_tag LOCUS_04210 521876 520869 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_04210 521929 522717 gene locus_tag LOCUS_04220 521929 522717 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_04220 522714 523016 gene locus_tag LOCUS_04230 522714 523016 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_04230 523060 523144 gene locus_tag LOCUS_t00080 523060 523144 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 526451 523182 gene locus_tag LOCUS_04240 526451 523182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 527076 526534 gene locus_tag LOCUS_04250 gene thpR 527076 526534 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_04250 527332 527952 gene locus_tag LOCUS_04260 527332 527952 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_04260 529903 527942 gene locus_tag LOCUS_04270 529903 527942 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409258.1 protein_id gnl|my_center|LOCUS_04270 530372 530037 gene locus_tag LOCUS_04280 530372 530037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 530649 530341 gene locus_tag LOCUS_04290 530649 530341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 530688 531626 gene locus_tag LOCUS_04300 530688 531626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 531673 532209 gene locus_tag LOCUS_04310 gene dcd 531673 532209 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_04310 532883 532218 gene locus_tag LOCUS_04320 532883 532218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 533551 532883 gene locus_tag LOCUS_04330 gene ubiE 533551 532883 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_04330 533669 534103 gene locus_tag LOCUS_04340 533669 534103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04340 534078 534269 gene locus_tag LOCUS_04350 534078 534269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04350 534352 535371 gene locus_tag LOCUS_04360 534352 535371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838772.1 protein_id gnl|my_center|LOCUS_04360 536317 535412 gene locus_tag LOCUS_04370 536317 535412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 536913 536566 gene locus_tag LOCUS_04380 536913 536566 CDS product DUF6370 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962578.1 protein_id gnl|my_center|LOCUS_04380 537026 537817 gene locus_tag LOCUS_04390 537026 537817 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529276.1 protein_id gnl|my_center|LOCUS_04390 537849 538310 gene locus_tag LOCUS_04400 gene coaD 537849 538310 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_04400 538975 538307 gene locus_tag LOCUS_04410 538975 538307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 541010 539040 gene locus_tag LOCUS_04420 541010 539040 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_04420 541518 541090 gene locus_tag LOCUS_04430 541518 541090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 543593 541518 gene locus_tag LOCUS_04440 543593 541518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 544088 543774 gene locus_tag LOCUS_04450 544088 543774 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_04450 548601 544162 gene locus_tag LOCUS_04460 gene gltB 548601 544162 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240188.1 protein_id gnl|my_center|LOCUS_04460 548841 550220 gene locus_tag LOCUS_04470 548841 550220 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_04470 550224 550619 gene locus_tag LOCUS_04480 550224 550619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 551476 550646 gene locus_tag LOCUS_04490 551476 550646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 551611 552558 gene locus_tag LOCUS_04500 gene queG 551611 552558 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_04500 552917 552555 gene locus_tag LOCUS_04510 552917 552555 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_04510 553019 553579 gene locus_tag LOCUS_04520 553019 553579 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_04520 553639 554523 gene locus_tag LOCUS_04530 553639 554523 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236296.1 protein_id gnl|my_center|LOCUS_04530 554628 559748 gene locus_tag LOCUS_04540 554628 559748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 560120 560731 gene locus_tag LOCUS_04550 560120 560731 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_04550 560746 560982 gene locus_tag LOCUS_04560 560746 560982 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_04560 560985 561440 gene locus_tag LOCUS_04570 560985 561440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 561535 562722 gene locus_tag LOCUS_04580 561535 562722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 563472 562831 gene locus_tag LOCUS_04590 563472 562831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 564248 563634 gene locus_tag LOCUS_04600 564248 563634 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_04600 565262 564285 gene locus_tag LOCUS_04610 565262 564285 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_04610 566006 565266 gene locus_tag LOCUS_04620 566006 565266 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_04620 566078 566410 gene locus_tag LOCUS_04630 566078 566410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 566397 567752 gene locus_tag LOCUS_04640 gene tilS 566397 567752 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_04640 569626 567761 gene locus_tag LOCUS_04650 569626 567761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 569864 570193 gene locus_tag LOCUS_04660 569864 570193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 570299 570565 gene locus_tag LOCUS_04670 570299 570565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 571428 570658 gene locus_tag LOCUS_04680 571428 570658 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403082.1 protein_id gnl|my_center|LOCUS_04680 572142 574019 gene locus_tag LOCUS_04690 572142 574019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 574489 574016 gene locus_tag LOCUS_04700 574489 574016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 576147 574615 gene locus_tag LOCUS_04710 576147 574615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 576555 577451 gene locus_tag LOCUS_04720 576555 577451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 578723 577455 gene locus_tag LOCUS_04730 578723 577455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 579794 578727 gene locus_tag LOCUS_04740 579794 578727 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110811.1 protein_id gnl|my_center|LOCUS_04740 580672 579791 gene locus_tag LOCUS_04750 580672 579791 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765895.1 protein_id gnl|my_center|LOCUS_04750 583199 580809 gene locus_tag LOCUS_04760 583199 580809 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_04760 584197 583223 gene locus_tag LOCUS_04770 584197 583223 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_04770 584833 585561 gene locus_tag LOCUS_04780 584833 585561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 585539 587641 gene locus_tag LOCUS_04790 585539 587641 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_04790 587696 588412 gene locus_tag LOCUS_04800 gene bshB1 587696 588412 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_04800 588544 589284 gene locus_tag LOCUS_04810 gene truB 588544 589284 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_04810 589361 590302 gene locus_tag LOCUS_04820 589361 590302 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_04820 590304 590765 gene locus_tag LOCUS_04830 590304 590765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 591763 590762 gene locus_tag LOCUS_04840 gene holA 591763 590762 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_04840 591863 592255 gene locus_tag LOCUS_04850 591863 592255 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_04850 593701 592265 gene locus_tag LOCUS_04860 593701 592265 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_04860 593937 593734 gene locus_tag LOCUS_04870 593937 593734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 594995 593934 gene locus_tag LOCUS_04880 594995 593934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 595743 595069 gene locus_tag LOCUS_04890 595743 595069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 596099 595800 gene locus_tag LOCUS_04900 596099 595800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 596231 596881 gene locus_tag LOCUS_04910 596231 596881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 596878 597612 gene locus_tag LOCUS_04920 gene dapB 596878 597612 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_04920 597758 599197 gene locus_tag LOCUS_04930 gene lepB 597758 599197 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963265.1 protein_id gnl|my_center|LOCUS_04930 599255 599584 gene locus_tag LOCUS_04940 599255 599584 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_04940 599640 600452 gene locus_tag LOCUS_04950 599640 600452 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_04950 600599 600970 gene locus_tag LOCUS_04960 gene crcB 600599 600970 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_04960 600972 601343 gene locus_tag LOCUS_04970 600972 601343 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_04970 601452 602069 gene locus_tag LOCUS_04980 601452 602069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 602377 602796 gene locus_tag LOCUS_04990 602377 602796 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_04990 602941 602865 gene locus_tag LOCUS_t00090 602941 602865 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 603149 605731 gene locus_tag LOCUS_05000 603149 605731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 605796 606965 gene locus_tag LOCUS_05010 605796 606965 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_05010 606969 609461 gene locus_tag LOCUS_05020 606969 609461 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_05020 611214 609733 gene locus_tag LOCUS_05030 611214 609733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 611439 615050 gene locus_tag LOCUS_05040 611439 615050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 615188 615970 gene locus_tag LOCUS_05050 615188 615970 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422110.1 protein_id gnl|my_center|LOCUS_05050 617225 616005 gene locus_tag LOCUS_05060 617225 616005 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_05060 617423 618184 gene locus_tag LOCUS_05070 617423 618184 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_05070 619763 618150 gene locus_tag LOCUS_05080 619763 618150 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142698.1 protein_id gnl|my_center|LOCUS_05080 620433 619777 gene locus_tag LOCUS_05090 620433 619777 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_05090 621857 620430 gene locus_tag LOCUS_05100 621857 620430 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763745.1 protein_id gnl|my_center|LOCUS_05100 621952 622557 gene locus_tag LOCUS_05110 621952 622557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 623259 622561 gene locus_tag LOCUS_05120 623259 622561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 623506 624375 gene locus_tag LOCUS_05130 623506 624375 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_05130 624465 625799 gene locus_tag LOCUS_05140 gene ffh 624465 625799 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_05140 625849 627114 gene locus_tag LOCUS_05150 625849 627114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 627126 628223 gene locus_tag LOCUS_05160 627126 628223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 628243 632001 gene locus_tag LOCUS_05170 628243 632001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 632899 632051 gene locus_tag LOCUS_05180 632899 632051 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 protein_id gnl|my_center|LOCUS_05180 633161 632958 gene locus_tag LOCUS_05190 633161 632958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 633703 633170 gene locus_tag LOCUS_05200 633703 633170 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 protein_id gnl|my_center|LOCUS_05200 634971 633754 gene locus_tag LOCUS_05210 634971 633754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 635270 635806 gene locus_tag LOCUS_05220 635270 635806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 636633 635797 gene locus_tag LOCUS_05230 636633 635797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 638477 636699 gene locus_tag LOCUS_05240 638477 636699 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303156.1 protein_id gnl|my_center|LOCUS_05240 638811 640526 gene locus_tag LOCUS_05250 638811 640526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 641006 640533 gene locus_tag LOCUS_05260 641006 640533 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_05260 641114 641548 gene locus_tag LOCUS_05270 641114 641548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 642453 641557 gene locus_tag LOCUS_05280 gene nusB 642453 641557 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962698.1 protein_id gnl|my_center|LOCUS_05280 642626 644416 gene locus_tag LOCUS_05290 642626 644416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_05290 644527 645027 gene locus_tag LOCUS_05300 644527 645027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 645895 645089 gene locus_tag LOCUS_05310 645895 645089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 646158 647387 gene locus_tag LOCUS_05320 646158 647387 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926053.1 protein_id gnl|my_center|LOCUS_05320 649953 647536 gene locus_tag LOCUS_05330 649953 647536 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_05330 650419 649997 gene locus_tag LOCUS_05340 650419 649997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 650482 650976 gene locus_tag LOCUS_05350 gene sixA 650482 650976 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_05350 652725 650992 gene locus_tag LOCUS_05360 652725 650992 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_05360 654439 652817 gene locus_tag LOCUS_05370 654439 652817 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_05370 659028 654649 gene locus_tag LOCUS_05380 659028 654649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 660515 659184 gene locus_tag LOCUS_05390 660515 659184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 660869 661303 gene locus_tag LOCUS_05400 660869 661303 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_05400 661430 661750 gene locus_tag LOCUS_05410 661430 661750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 661747 661989 gene locus_tag LOCUS_05420 661747 661989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 662272 662634 gene locus_tag LOCUS_05430 662272 662634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 662634 665096 gene locus_tag LOCUS_05440 gene ccsA 662634 665096 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_05440 665113 665889 gene locus_tag LOCUS_05450 665113 665889 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_05450 665891 666838 gene locus_tag LOCUS_05460 665891 666838 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_05460 666842 667408 gene locus_tag LOCUS_05470 666842 667408 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203220.1 protein_id gnl|my_center|LOCUS_05470 668789 667428 gene locus_tag LOCUS_05480 668789 667428 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_05480 668995 668786 gene locus_tag LOCUS_05490 668995 668786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 669590 670672 gene locus_tag LOCUS_05500 669590 670672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 672292 670685 gene locus_tag LOCUS_05510 672292 670685 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_05510 672458 673267 gene locus_tag LOCUS_05520 672458 673267 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_05520 673264 674166 gene locus_tag LOCUS_05530 673264 674166 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760916.1 protein_id gnl|my_center|LOCUS_05530 674348 675022 gene locus_tag LOCUS_05540 674348 675022 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_05540 676717 675143 gene locus_tag LOCUS_05550 676717 675143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 679644 676768 gene locus_tag LOCUS_05560 679644 676768 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_05560 679778 681451 gene locus_tag LOCUS_05570 679778 681451 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500125.1 protein_id gnl|my_center|LOCUS_05570 681477 683024 gene locus_tag LOCUS_05580 681477 683024 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887662.1 protein_id gnl|my_center|LOCUS_05580 683021 683932 gene locus_tag LOCUS_05590 683021 683932 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_05590 684743 684072 gene locus_tag LOCUS_05600 gene rsmG 684743 684072 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_05600 685404 684796 gene locus_tag LOCUS_05610 gene sigW 685404 684796 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_05610 686492 685395 gene locus_tag LOCUS_05620 686492 685395 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129003072.1 protein_id gnl|my_center|LOCUS_05620 686592 687722 gene locus_tag LOCUS_05630 gene tgt 686592 687722 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761519.1 protein_id gnl|my_center|LOCUS_05630 687726 688808 gene locus_tag LOCUS_05640 687726 688808 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_05640 690355 688826 gene locus_tag LOCUS_05650 gene dnaB 690355 688826 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_05650 691867 690650 gene locus_tag LOCUS_05660 691867 690650 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_05660 691944 692336 gene locus_tag LOCUS_05670 gene folB 691944 692336 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964579.1 protein_id gnl|my_center|LOCUS_05670 692356 692430 gene locus_tag LOCUS_t00100 692356 692430 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 698357 692685 gene locus_tag LOCUS_05680 698357 692685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 698795 700912 gene locus_tag LOCUS_05690 698795 700912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 700974 701600 gene locus_tag LOCUS_05700 700974 701600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 701662 702534 gene locus_tag LOCUS_05710 701662 702534 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615599.1 protein_id gnl|my_center|LOCUS_05710 702715 702945 gene locus_tag LOCUS_05720 702715 702945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 703806 704351 gene locus_tag LOCUS_05730 703806 704351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 706127 704502 gene locus_tag LOCUS_05740 706127 704502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 709277 706260 gene locus_tag LOCUS_05750 709277 706260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 709548 710657 gene locus_tag LOCUS_05760 gene dprA 709548 710657 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172795629.1 protein_id gnl|my_center|LOCUS_05760 710858 711844 gene locus_tag LOCUS_05770 710858 711844 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_05770 711957 713567 gene locus_tag LOCUS_05780 gene pckA 711957 713567 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_05780 713780 714724 gene locus_tag LOCUS_05790 713780 714724 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_05790 715005 719249 gene locus_tag LOCUS_05800 715005 719249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 719251 720204 gene locus_tag LOCUS_05810 719251 720204 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_05810 720348 720923 gene locus_tag LOCUS_05820 720348 720923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 727041 720979 gene locus_tag LOCUS_05830 727041 720979 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_05830 727705 727136 gene locus_tag LOCUS_05840 727705 727136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 727835 728887 gene locus_tag LOCUS_05850 gene thiL 727835 728887 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_05850 730370 728925 gene locus_tag LOCUS_05860 730370 728925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 730471 730543 gene locus_tag LOCUS_t00110 730471 730543 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 730485 731297 gene locus_tag LOCUS_05870 730485 731297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 731702 732895 gene locus_tag LOCUS_05880 731702 732895 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_05880 733287 732898 gene locus_tag LOCUS_05890 733287 732898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 735524 733581 gene locus_tag LOCUS_05900 735524 733581 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409258.1 protein_id gnl|my_center|LOCUS_05900 736115 735582 gene locus_tag LOCUS_05910 736115 735582 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_05910 736183 738801 gene locus_tag LOCUS_05920 gene mutS 736183 738801 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962564.1 protein_id gnl|my_center|LOCUS_05920 739251 738772 gene locus_tag LOCUS_05930 739251 738772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 739481 741010 gene locus_tag LOCUS_05940 739481 741010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 742940 741519 gene locus_tag LOCUS_05950 742940 741519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 748765 742955 gene locus_tag LOCUS_05960 748765 742955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 749616 749068 gene locus_tag LOCUS_05970 749616 749068 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723656.1 protein_id gnl|my_center|LOCUS_05970 749934 751151 gene locus_tag LOCUS_05980 749934 751151 CDS product VLRF1 family aeRF1-type release factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256216.1 protein_id gnl|my_center|LOCUS_05980 751248 752066 gene locus_tag LOCUS_05990 751248 752066 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839609.1 protein_id gnl|my_center|LOCUS_05990 752614 752078 gene locus_tag LOCUS_06000 752614 752078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 753433 752795 gene locus_tag LOCUS_06010 753433 752795 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_06010 753843 754598 gene locus_tag LOCUS_06020 gene iaaA 753843 754598 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030503.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06020 755086 755415 gene locus_tag LOCUS_06030 755086 755415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 755547 756422 gene locus_tag LOCUS_06040 755547 756422 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_06040 756515 756715 gene locus_tag LOCUS_06050 756515 756715 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_06050 756725 757597 gene locus_tag LOCUS_06060 gene uppP 756725 757597 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881444.1 protein_id gnl|my_center|LOCUS_06060 758112 757483 gene locus_tag LOCUS_06070 gene coaE 758112 757483 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785766.1 protein_id gnl|my_center|LOCUS_06070 759038 758121 gene locus_tag LOCUS_06080 759038 758121 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109340.1 protein_id gnl|my_center|LOCUS_06080 759421 759089 gene locus_tag LOCUS_06090 gene yajC 759421 759089 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_06090 759939 759424 gene locus_tag LOCUS_06100 759939 759424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 761487 760075 gene locus_tag LOCUS_06110 gene glnA 761487 760075 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_06110 761678 762217 gene locus_tag LOCUS_06120 761678 762217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 762429 766019 gene locus_tag LOCUS_06130 762429 766019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 766023 766349 gene locus_tag LOCUS_06140 766023 766349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 766589 773134 gene locus_tag LOCUS_06150 766589 773134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 773839 773201 gene locus_tag LOCUS_06160 773839 773201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 774337 774741 gene locus_tag LOCUS_06170 774337 774741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 774822 775307 gene locus_tag LOCUS_06180 774822 775307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 776128 775340 gene locus_tag LOCUS_06190 776128 775340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 776797 776237 gene locus_tag LOCUS_06200 776797 776237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 778285 776822 gene locus_tag LOCUS_06210 778285 776822 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_06210 778615 780027 gene locus_tag LOCUS_06220 778615 780027 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414672.1 protein_id gnl|my_center|LOCUS_06220 780352 780035 gene locus_tag LOCUS_06230 780352 780035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 780642 783131 gene locus_tag LOCUS_06240 gene hrpB 780642 783131 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_06240 783160 783609 gene locus_tag LOCUS_06250 783160 783609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 783799 783635 gene locus_tag LOCUS_06260 783799 783635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 783878 784288 gene locus_tag LOCUS_06270 783878 784288 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788096.1 protein_id gnl|my_center|LOCUS_06270 786143 784347 gene locus_tag LOCUS_06280 786143 784347 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 protein_id gnl|my_center|LOCUS_06280 787203 786262 gene locus_tag LOCUS_06290 787203 786262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 788362 787331 gene locus_tag LOCUS_06300 788362 787331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 789872 788391 gene locus_tag LOCUS_06310 789872 788391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 789963 790745 gene locus_tag LOCUS_06320 789963 790745 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_06320 790748 792247 gene locus_tag LOCUS_06330 790748 792247 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795889.1 protein_id gnl|my_center|LOCUS_06330 792244 794190 gene locus_tag LOCUS_06340 792244 794190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 794187 794990 gene locus_tag LOCUS_06350 gene proC 794187 794990 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_06350 796678 795029 gene locus_tag LOCUS_06360 796678 795029 CDS product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898877.1 protein_id gnl|my_center|LOCUS_06360 796760 798208 gene locus_tag LOCUS_06370 796760 798208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 799120 798230 gene locus_tag LOCUS_06380 799120 798230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 800433 799117 gene locus_tag LOCUS_06390 gene rseP 800433 799117 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962261.1 protein_id gnl|my_center|LOCUS_06390 800698 801879 gene locus_tag LOCUS_06400 800698 801879 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_06400 801893 802708 gene locus_tag LOCUS_06410 801893 802708 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088003.1 protein_id gnl|my_center|LOCUS_06410 804472 802772 gene locus_tag LOCUS_06420 804472 802772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 804702 806438 gene locus_tag LOCUS_06430 804702 806438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 806533 807294 gene locus_tag LOCUS_06440 806533 807294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 807371 808324 gene locus_tag LOCUS_06450 807371 808324 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_06450 808391 809596 gene locus_tag LOCUS_06460 808391 809596 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_06460 811140 809656 gene locus_tag LOCUS_06470 811140 809656 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_06470 811308 812135 gene locus_tag LOCUS_06480 gene dapF 811308 812135 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135464474.1 protein_id gnl|my_center|LOCUS_06480 830944 812111 gene locus_tag LOCUS_06490 830944 812111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 832672 831356 gene locus_tag LOCUS_06500 832672 831356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 840201 833026 gene locus_tag LOCUS_06510 840201 833026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 840379 840185 gene locus_tag LOCUS_06520 840379 840185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 843352 840611 gene locus_tag LOCUS_06530 843352 840611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 844213 843410 gene locus_tag LOCUS_06540 844213 843410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 849517 844574 gene locus_tag LOCUS_06550 849517 844574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 855849 849679 gene locus_tag LOCUS_06560 855849 849679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 857520 855949 gene locus_tag LOCUS_06570 857520 855949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 858105 858029 gene locus_tag LOCUS_t00120 858105 858029 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 859125 858139 gene locus_tag LOCUS_06580 gene floA 859125 858139 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785715.1 protein_id gnl|my_center|LOCUS_06580 859604 859128 gene locus_tag LOCUS_06590 859604 859128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 860014 859601 gene locus_tag LOCUS_06600 860014 859601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 860192 860653 gene locus_tag LOCUS_06610 gene rlmH 860192 860653 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_06610 860657 861274 gene locus_tag LOCUS_06620 860657 861274 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 protein_id gnl|my_center|LOCUS_06620 861264 862292 gene locus_tag LOCUS_06630 861264 862292 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_06630 863585 862305 gene locus_tag LOCUS_06640 gene hemL 863585 862305 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963336.1 protein_id gnl|my_center|LOCUS_06640 864567 863566 gene locus_tag LOCUS_06650 gene hemB 864567 863566 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962216.1 protein_id gnl|my_center|LOCUS_06650 865273 864560 gene locus_tag LOCUS_06660 865273 864560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 866187 865276 gene locus_tag LOCUS_06670 gene hemC 866187 865276 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962224.1 protein_id gnl|my_center|LOCUS_06670 867341 866184 gene locus_tag LOCUS_06680 867341 866184 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141218.1 protein_id gnl|my_center|LOCUS_06680 868035 867343 gene locus_tag LOCUS_06690 868035 867343 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919005.1 protein_id gnl|my_center|LOCUS_06690 868634 868032 gene locus_tag LOCUS_06700 868634 868032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 869385 868600 gene locus_tag LOCUS_06710 gene cobA 869385 868600 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_06710 871544 869382 gene locus_tag LOCUS_06720 871544 869382 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_06720 871789 872355 gene locus_tag LOCUS_06730 871789 872355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 872358 873047 gene locus_tag LOCUS_06740 872358 873047 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_06740 873034 873606 gene locus_tag LOCUS_06750 873034 873606 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_06750 873788 876205 gene locus_tag LOCUS_06760 873788 876205 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_06760 876948 876211 gene locus_tag LOCUS_06770 876948 876211 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_06770 876947 879274 gene locus_tag LOCUS_06780 876947 879274 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_06780 879280 881565 gene locus_tag LOCUS_06790 879280 881565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 881809 881609 gene locus_tag LOCUS_06800 881809 881609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 882148 884439 gene locus_tag LOCUS_06810 882148 884439 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_06810 884634 885731 gene locus_tag LOCUS_06820 gene ychF 884634 885731 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_06820 887642 886131 gene locus_tag LOCUS_06830 887642 886131 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_06830 889339 887900 gene locus_tag LOCUS_06840 889339 887900 CDS product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174235.1 protein_id gnl|my_center|LOCUS_06840 891120 889501 gene locus_tag LOCUS_06850 891120 889501 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_06850 891236 892066 gene locus_tag LOCUS_06860 gene panB 891236 892066 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_06860 892136 894484 gene locus_tag LOCUS_06870 892136 894484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 894501 895412 gene locus_tag LOCUS_06880 894501 895412 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_06880 896054 895413 gene locus_tag LOCUS_06890 896054 895413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 896169 896936 gene locus_tag LOCUS_06900 896169 896936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06900 896929 897336 gene locus_tag LOCUS_06910 896929 897336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06910 897570 897821 gene locus_tag LOCUS_06920 897570 897821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 898576 898061 gene locus_tag LOCUS_06930 898576 898061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 899452 898664 gene locus_tag LOCUS_06940 899452 898664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 900839 899505 gene locus_tag LOCUS_06950 gene bioA 900839 899505 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_06950 902302 900857 gene locus_tag LOCUS_06960 902302 900857 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_06960 902511 902585 gene locus_tag LOCUS_t00130 902511 902585 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 904064 903015 gene locus_tag LOCUS_06970 904064 903015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 904989 904117 gene locus_tag LOCUS_06980 904989 904117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 906039 905953 gene locus_tag LOCUS_t00140 906039 905953 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 906164 907009 gene locus_tag LOCUS_06990 906164 907009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 907006 908073 gene locus_tag LOCUS_07000 907006 908073 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526415.1 protein_id gnl|my_center|LOCUS_07000 908164 908091 gene locus_tag LOCUS_t00150 908164 908091 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 909471 908260 gene locus_tag LOCUS_07010 gene rocD 909471 908260 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_07010 910662 909541 gene locus_tag LOCUS_07020 910662 909541 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008588454.1 protein_id gnl|my_center|LOCUS_07020 912072 910678 gene locus_tag LOCUS_07030 gene glmM 912072 910678 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_07030 912154 912888 gene locus_tag LOCUS_07040 912154 912888 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_07040 912885 913451 gene locus_tag LOCUS_07050 912885 913451 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_07050 913494 914273 gene locus_tag LOCUS_07060 913494 914273 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_07060 914524 914330 gene locus_tag LOCUS_07070 914524 914330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 914632 915951 gene locus_tag LOCUS_07080 914632 915951 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938700.1 protein_id gnl|my_center|LOCUS_07080 917189 915969 gene locus_tag LOCUS_07090 917189 915969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 918120 917320 gene locus_tag LOCUS_07100 918120 917320 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727645.1 protein_id gnl|my_center|LOCUS_07100 918250 920505 gene locus_tag LOCUS_07110 918250 920505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 920926 920516 gene locus_tag LOCUS_07120 920926 920516 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_07120 921429 920929 gene locus_tag LOCUS_07130 921429 920929 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_07130 922983 921571 gene locus_tag LOCUS_07140 922983 921571 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_07140 923808 923011 gene locus_tag LOCUS_07150 923808 923011 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963923.1 protein_id gnl|my_center|LOCUS_07150 924453 923809 gene locus_tag LOCUS_07160 924453 923809 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_07160 924452 925099 gene locus_tag LOCUS_07170 gene pyrE 924452 925099 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_07170 925571 925104 gene locus_tag LOCUS_07180 925571 925104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 926726 925686 gene locus_tag LOCUS_07190 926726 925686 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 protein_id gnl|my_center|LOCUS_07190 928226 926778 gene locus_tag LOCUS_07200 928226 926778 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_07200 929584 928244 gene locus_tag LOCUS_07210 gene trkA 929584 928244 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_07210 930665 929658 gene locus_tag LOCUS_07220 930665 929658 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_07220 931829 930810 gene locus_tag LOCUS_07230 931829 930810 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328040.1 protein_id gnl|my_center|LOCUS_07230 932567 931836 gene locus_tag LOCUS_07240 932567 931836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 932792 933352 gene locus_tag LOCUS_07250 932792 933352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 933428 934549 gene locus_tag LOCUS_07260 933428 934549 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_07260 934859 935371 gene locus_tag LOCUS_07270 934859 935371 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_07270 935635 936861 gene locus_tag LOCUS_07280 935635 936861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 937122 948248 gene locus_tag LOCUS_07290 937122 948248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 948424 950253 gene locus_tag LOCUS_07300 948424 950253 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_07300 951258 950488 gene locus_tag LOCUS_07310 951258 950488 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_07310 952172 951258 gene locus_tag LOCUS_07320 952172 951258 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_07320 952500 952183 gene locus_tag LOCUS_07330 gene trxA 952500 952183 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932522.1 protein_id gnl|my_center|LOCUS_07330 956191 952619 gene locus_tag LOCUS_07340 gene dnaE 956191 952619 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_07340 956712 956377 gene locus_tag LOCUS_07350 956712 956377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 957372 956725 gene locus_tag LOCUS_07360 957372 956725 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 protein_id gnl|my_center|LOCUS_07360 957628 957389 gene locus_tag LOCUS_07370 957628 957389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 958283 958567 gene locus_tag LOCUS_07380 958283 958567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 958608 960527 gene locus_tag LOCUS_07390 958608 960527 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_07390 960604 960936 gene locus_tag LOCUS_07400 960604 960936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 960937 961995 gene locus_tag LOCUS_07410 960937 961995 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_07410 962060 962134 gene locus_tag LOCUS_t00160 962060 962134 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 962741 962217 gene locus_tag LOCUS_07420 962741 962217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 962902 963828 gene locus_tag LOCUS_07430 962902 963828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 963856 964752 gene locus_tag LOCUS_07440 gene galU 963856 964752 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245127.1 protein_id gnl|my_center|LOCUS_07440 964914 965153 gene locus_tag LOCUS_07450 964914 965153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 965215 965646 gene locus_tag LOCUS_07460 965215 965646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 967090 965663 gene locus_tag LOCUS_07470 967090 965663 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_07470 968515 967199 gene locus_tag LOCUS_07480 gene aspC 968515 967199 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080007.1 protein_id gnl|my_center|LOCUS_07480 969909 968515 gene locus_tag LOCUS_07490 969909 968515 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_07490 971415 970186 gene locus_tag LOCUS_07500 gene kbl 971415 970186 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_07500 971477 972457 gene locus_tag LOCUS_07510 971477 972457 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_07510 973162 972491 gene locus_tag LOCUS_07520 973162 972491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 974656 973175 gene locus_tag LOCUS_07530 974656 973175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 975299 974826 gene locus_tag LOCUS_07540 gene cdd 975299 974826 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_07540 975347 976681 gene locus_tag LOCUS_07550 975347 976681 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_07550 976678 977340 gene locus_tag LOCUS_07560 976678 977340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 978043 977345 gene locus_tag LOCUS_07570 978043 977345 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_07570 978642 978124 gene locus_tag LOCUS_07580 978642 978124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 979579 978731 gene locus_tag LOCUS_07590 979579 978731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 979636 980703 gene locus_tag LOCUS_07600 gene aroB 979636 980703 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109049.1 protein_id gnl|my_center|LOCUS_07600 980700 981950 gene locus_tag LOCUS_07610 gene aroA 980700 981950 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693605.1 protein_id gnl|my_center|LOCUS_07610 982911 983210 gene locus_tag LOCUS_07620 982911 983210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 983210 986509 gene locus_tag LOCUS_07630 983210 986509 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_07630 986509 989943 gene locus_tag LOCUS_07640 986509 989943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 989992 990894 gene locus_tag LOCUS_07650 989992 990894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 990900 991631 gene locus_tag LOCUS_07660 990900 991631 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112685.1 protein_id gnl|my_center|LOCUS_07660 991699 991890 gene locus_tag LOCUS_07670 991699 991890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 992596 991943 gene locus_tag LOCUS_07680 992596 991943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 993711 992746 gene locus_tag LOCUS_07690 gene rfaD 993711 992746 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_07690 994470 993745 gene locus_tag LOCUS_07700 994470 993745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 994571 995281 gene locus_tag LOCUS_07710 994571 995281 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115288.1 protein_id gnl|my_center|LOCUS_07710 995367 995924 gene locus_tag LOCUS_07720 995367 995924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 996111 996992 gene locus_tag LOCUS_07730 gene era 996111 996992 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_07730 997046 998356 gene locus_tag LOCUS_07740 gene der 997046 998356 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_07740 999993 998371 gene locus_tag LOCUS_07750 999993 998371 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_07750 1000110 1000985 gene locus_tag LOCUS_07760 1000110 1000985 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_07760 1000998 1001795 gene locus_tag LOCUS_07770 gene murQ 1000998 1001795 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801650.1 protein_id gnl|my_center|LOCUS_07770 1002426 1001824 gene locus_tag LOCUS_07780 1002426 1001824 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820119.1 protein_id gnl|my_center|LOCUS_07780 1002609 1003112 gene locus_tag LOCUS_07790 1002609 1003112 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_07790 1003277 1004017 gene locus_tag LOCUS_07800 1003277 1004017 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656803.1 protein_id gnl|my_center|LOCUS_07800 1004134 1006314 gene locus_tag LOCUS_07810 1004134 1006314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 1006488 1008509 gene locus_tag LOCUS_07820 1006488 1008509 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_07820 1008709 1011102 gene locus_tag LOCUS_07830 1008709 1011102 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_07830 1011099 1011461 gene locus_tag LOCUS_07840 1011099 1011461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1011448 1011903 gene locus_tag LOCUS_07850 1011448 1011903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 1013843 1011900 gene locus_tag LOCUS_07860 1013843 1011900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1013880 1015529 gene locus_tag LOCUS_07870 1013880 1015529 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080653.1 protein_id gnl|my_center|LOCUS_07870 1016579 1015677 gene locus_tag LOCUS_07880 gene ribD 1016579 1015677 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932429.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07880 1016613 1017497 gene locus_tag LOCUS_07890 gene prmC 1016613 1017497 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_07890 1017472 1017894 gene locus_tag LOCUS_07900 1017472 1017894 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_07900 1017888 1018067 gene locus_tag LOCUS_07910 1017888 1018067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1017988 1018992 gene locus_tag LOCUS_07920 1017988 1018992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1019770 1019009 gene locus_tag LOCUS_07930 1019770 1019009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 1021673 1019859 gene locus_tag LOCUS_07940 gene typA 1021673 1019859 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_07940 1021766 1023406 gene locus_tag LOCUS_07950 1021766 1023406 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_07950 1024673 1023420 gene locus_tag LOCUS_07960 1024673 1023420 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_07960 1024860 1026404 gene locus_tag LOCUS_07970 1024860 1026404 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_07970 1027249 1026581 gene locus_tag LOCUS_07980 1027249 1026581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 1027456 1027650 gene locus_tag LOCUS_07990 1027456 1027650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1030048 1027724 gene locus_tag LOCUS_08000 1030048 1027724 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_08000 1030107 1031180 gene locus_tag LOCUS_08010 1030107 1031180 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_08010 1033089 1031158 gene locus_tag LOCUS_08020 1033089 1031158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 1033255 1033599 gene locus_tag LOCUS_08030 1033255 1033599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 1034262 1033603 gene locus_tag LOCUS_08040 1034262 1033603 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_08040 1034480 1034884 gene locus_tag LOCUS_08050 gene rplS 1034480 1034884 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_08050 1035319 1034885 gene locus_tag LOCUS_08060 1035319 1034885 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_08060 1038277 1035344 gene locus_tag LOCUS_08070 1038277 1035344 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109118.1 protein_id gnl|my_center|LOCUS_08070 1038411 1039028 gene locus_tag LOCUS_08080 gene trmH 1038411 1039028 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174221.1 protein_id gnl|my_center|LOCUS_08080 1040346 1039054 gene locus_tag LOCUS_08090 1040346 1039054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 1042029 1040485 gene locus_tag LOCUS_08100 1042029 1040485 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_08100 1042117 1042884 gene locus_tag LOCUS_08110 1042117 1042884 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444884.1 protein_id gnl|my_center|LOCUS_08110 1042881 1045865 gene locus_tag LOCUS_08120 1042881 1045865 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_08120 1048103 1045872 gene locus_tag LOCUS_08130 1048103 1045872 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_08130 1048177 1048800 gene locus_tag LOCUS_08140 1048177 1048800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1048991 1053415 gene locus_tag LOCUS_08150 1048991 1053415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1054397 1053420 gene locus_tag LOCUS_08160 1054397 1053420 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_08160 1054465 1054827 gene locus_tag LOCUS_08170 gene gldC 1054465 1054827 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_08170 1054898 1055590 gene locus_tag LOCUS_08180 1054898 1055590 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_08180 1056212 1055580 gene locus_tag LOCUS_08190 1056212 1055580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08190 1056702 1056202 gene locus_tag LOCUS_08200 gene folK 1056702 1056202 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_08200 1056800 1058530 gene locus_tag LOCUS_08210 gene sppA 1056800 1058530 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_08210 1058649 1061213 gene locus_tag LOCUS_08220 1058649 1061213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1061244 1061897 gene locus_tag LOCUS_08230 1061244 1061897 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_08230 1062854 1061910 gene locus_tag LOCUS_08240 gene trxB 1062854 1061910 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_08240 1063599 1063015 gene locus_tag LOCUS_08250 1063599 1063015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1064648 1063767 gene locus_tag LOCUS_08260 1064648 1063767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1067017 1064645 gene locus_tag LOCUS_08270 1067017 1064645 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_08270 1067523 1067107 gene locus_tag LOCUS_08280 1067523 1067107 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867748.1 protein_id gnl|my_center|LOCUS_08280 1068587 1067577 gene locus_tag LOCUS_08290 1068587 1067577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1068654 1069619 gene locus_tag LOCUS_08300 gene bioB 1068654 1069619 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_08300 1069645 1070796 gene locus_tag LOCUS_08310 1069645 1070796 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_08310 1070810 1071445 gene locus_tag LOCUS_08320 gene bioD 1070810 1071445 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964418.1 protein_id gnl|my_center|LOCUS_08320 1071691 1072503 gene locus_tag LOCUS_08330 1071691 1072503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 1072618 1073991 gene locus_tag LOCUS_08340 1072618 1073991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1073992 1075242 gene locus_tag LOCUS_08350 1073992 1075242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 1075310 1076902 gene locus_tag LOCUS_08360 1075310 1076902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1077020 1078024 gene locus_tag LOCUS_08370 1077020 1078024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1079820 1077979 gene locus_tag LOCUS_08380 1079820 1077979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1079892 1081169 gene locus_tag LOCUS_08390 1079892 1081169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1081237 1082130 gene locus_tag LOCUS_08400 1081237 1082130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1082237 1083703 gene locus_tag LOCUS_08410 1082237 1083703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 1083855 1086491 gene locus_tag LOCUS_08420 1083855 1086491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1088048 1086492 gene locus_tag LOCUS_08430 1088048 1086492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1088170 1089351 gene locus_tag LOCUS_08440 1088170 1089351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1089363 1090958 gene locus_tag LOCUS_08450 1089363 1090958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1091384 1090968 gene locus_tag LOCUS_08460 1091384 1090968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1091672 1093105 gene locus_tag LOCUS_08470 1091672 1093105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1093263 1093904 gene locus_tag LOCUS_08480 1093263 1093904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1095074 1094256 gene locus_tag LOCUS_08490 1095074 1094256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1097059 1095395 gene locus_tag LOCUS_08500 gene ettA 1097059 1095395 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_08500 1098259 1097168 gene locus_tag LOCUS_08510 1098259 1097168 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261512.1 protein_id gnl|my_center|LOCUS_08510 1099051 1098296 gene locus_tag LOCUS_08520 1099051 1098296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1099186 1100400 gene locus_tag LOCUS_08530 1099186 1100400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_08530 1100503 1103316 gene locus_tag LOCUS_08540 1100503 1103316 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_08540 1103378 1105024 gene locus_tag LOCUS_08550 1103378 1105024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140647.1 protein_id gnl|my_center|LOCUS_08550 1105483 1106649 gene locus_tag LOCUS_08560 1105483 1106649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1107354 1106641 gene locus_tag LOCUS_08570 1107354 1106641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1107519 1108391 gene locus_tag LOCUS_08580 1107519 1108391 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_08580 1108428 1109432 gene locus_tag LOCUS_08590 1108428 1109432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1109587 1111506 gene locus_tag LOCUS_08600 gene dnaK 1109587 1111506 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_08600 1111621 1113324 gene locus_tag LOCUS_08610 1111621 1113324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1114012 1113347 gene locus_tag LOCUS_08620 1114012 1113347 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_08620 1115187 1114276 gene locus_tag LOCUS_08630 1115187 1114276 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_08630 1116982 1115198 gene locus_tag LOCUS_08640 1116982 1115198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1117467 1117171 gene locus_tag LOCUS_08650 1117467 1117171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963991.1 protein_id gnl|my_center|LOCUS_08650 1118134 1117529 gene locus_tag LOCUS_08660 1118134 1117529 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964030.1 protein_id gnl|my_center|LOCUS_08660 1118246 1118782 gene locus_tag LOCUS_08670 1118246 1118782 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_08670 1119935 1118841 gene locus_tag LOCUS_08680 gene alkB1 1119935 1118841 CDS product alkane 1-monooxygenase AlkB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102475.1 protein_id gnl|my_center|LOCUS_08680 1119998 1120618 gene locus_tag LOCUS_08690 1119998 1120618 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233008.1 protein_id gnl|my_center|LOCUS_08690 1122271 1120619 gene locus_tag LOCUS_08700 1122271 1120619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1122769 1122395 gene locus_tag LOCUS_08710 1122769 1122395 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_08710 1122854 1123150 gene locus_tag LOCUS_08720 1122854 1123150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08720 1123059 1123421 gene locus_tag LOCUS_08730 1123059 1123421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08730 1126929 1123486 gene locus_tag LOCUS_08740 1126929 1123486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_08740 1127118 1128749 gene locus_tag LOCUS_08750 1127118 1128749 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533539.1 protein_id gnl|my_center|LOCUS_08750 1129186 1130154 gene locus_tag LOCUS_08760 1129186 1130154 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942152.1 protein_id gnl|my_center|LOCUS_08760 1130151 1130690 gene locus_tag LOCUS_08770 1130151 1130690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1130878 1131282 gene locus_tag LOCUS_08780 1130878 1131282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 1132087 1131296 gene locus_tag LOCUS_08790 1132087 1131296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1132791 1132084 gene locus_tag LOCUS_08800 1132791 1132084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1134029 1132785 gene locus_tag LOCUS_08810 1134029 1132785 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192948.1 protein_id gnl|my_center|LOCUS_08810 1134463 1134041 gene locus_tag LOCUS_08820 1134463 1134041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1135073 1134510 gene locus_tag LOCUS_08830 1135073 1134510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_08830 1137174 1135195 gene locus_tag LOCUS_08840 gene nosZ 1137174 1135195 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_08840 1137768 1137208 gene locus_tag LOCUS_08850 1137768 1137208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1138012 1137930 gene locus_tag LOCUS_t00170 1138012 1137930 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1138143 1138067 gene locus_tag LOCUS_t00180 1138143 1138067 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1139727 1138600 gene locus_tag LOCUS_08860 gene lpxB 1139727 1138600 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_08860 1140027 1139731 gene locus_tag LOCUS_08870 1140027 1139731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1140799 1140020 gene locus_tag LOCUS_08880 gene surE 1140799 1140020 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_08880 1141225 1140881 gene locus_tag LOCUS_08890 1141225 1140881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1142029 1141325 gene locus_tag LOCUS_08900 1142029 1141325 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_08900 1144945 1142087 gene locus_tag LOCUS_08910 1144945 1142087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1145571 1145095 gene locus_tag LOCUS_08920 1145571 1145095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1146470 1146398 gene locus_tag LOCUS_t00190 1146470 1146398 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1147164 1146562 gene locus_tag LOCUS_08930 1147164 1146562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1147610 1147179 gene locus_tag LOCUS_08940 1147610 1147179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1147771 1148799 gene locus_tag LOCUS_08950 1147771 1148799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1148824 1150890 gene locus_tag LOCUS_08960 1148824 1150890 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_08960 1150947 1152035 gene locus_tag LOCUS_08970 gene aroC 1150947 1152035 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_08970 1152040 1153467 gene locus_tag LOCUS_08980 1152040 1153467 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_08980 1153464 1153976 gene locus_tag LOCUS_08990 1153464 1153976 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257161.1 protein_id gnl|my_center|LOCUS_08990 1154645 1154052 gene locus_tag LOCUS_09000 1154645 1154052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 1163547 1154869 gene locus_tag LOCUS_09010 1163547 1154869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1164360 1163647 gene locus_tag LOCUS_09020 1164360 1163647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1164450 1165310 gene locus_tag LOCUS_09030 1164450 1165310 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_09030 1165369 1166802 gene locus_tag LOCUS_09040 1165369 1166802 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_09040 1166834 1167346 gene locus_tag LOCUS_09050 1166834 1167346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 1167343 1168275 gene locus_tag LOCUS_09060 gene miaA 1167343 1168275 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_09060 1168352 1169545 gene locus_tag LOCUS_09070 1168352 1169545 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174245.1 protein_id gnl|my_center|LOCUS_09070 1169694 1171058 gene locus_tag LOCUS_09080 1169694 1171058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1171069 1172361 gene locus_tag LOCUS_09090 1171069 1172361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1172444 1173496 gene locus_tag LOCUS_09100 1172444 1173496 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206885.1 protein_id gnl|my_center|LOCUS_09100 1173940 1173575 gene locus_tag LOCUS_09110 1173940 1173575 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_09110 1173929 1175305 gene locus_tag LOCUS_09120 1173929 1175305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1176439 1175279 gene locus_tag LOCUS_09130 1176439 1175279 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767224.1 protein_id gnl|my_center|LOCUS_09130 1176492 1176728 gene locus_tag LOCUS_09140 1176492 1176728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1176779 1177834 gene locus_tag LOCUS_09150 1176779 1177834 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 protein_id gnl|my_center|LOCUS_09150 1177904 1178824 gene locus_tag LOCUS_09160 1177904 1178824 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989618.1 protein_id gnl|my_center|LOCUS_09160 1178824 1179456 gene locus_tag LOCUS_09170 1178824 1179456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1179467 1179913 gene locus_tag LOCUS_09180 1179467 1179913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1181441 1179888 gene locus_tag LOCUS_09190 1181441 1179888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1182939 1181446 gene locus_tag LOCUS_09200 1182939 1181446 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265670.1 protein_id gnl|my_center|LOCUS_09200 1183059 1183241 gene locus_tag LOCUS_09210 1183059 1183241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1183296 1183805 gene locus_tag LOCUS_09220 1183296 1183805 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_09220 1184139 1183897 gene locus_tag LOCUS_09230 1184139 1183897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1184553 1184206 gene locus_tag LOCUS_09240 1184553 1184206 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_09240 1184622 1185656 gene locus_tag LOCUS_09250 1184622 1185656 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_09250 1188913 1185752 gene locus_tag LOCUS_09260 1188913 1185752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1190831 1189041 gene locus_tag LOCUS_09270 1190831 1189041 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760864.1 protein_id gnl|my_center|LOCUS_09270 1191123 1192133 gene locus_tag LOCUS_09280 1191123 1192133 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_09280 1192165 1193445 gene locus_tag LOCUS_09290 1192165 1193445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1193469 1194218 gene locus_tag LOCUS_09300 1193469 1194218 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108120.1 protein_id gnl|my_center|LOCUS_09300 1194378 1194806 gene locus_tag LOCUS_09310 1194378 1194806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1196645 1194834 gene locus_tag LOCUS_09320 1196645 1194834 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_09320 1196795 1198285 gene locus_tag LOCUS_09330 1196795 1198285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1198468 1199664 gene locus_tag LOCUS_09340 1198468 1199664 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_09340 1199826 1200620 gene locus_tag LOCUS_09350 1199826 1200620 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_09350 1200639 1201130 gene locus_tag LOCUS_09360 gene dfrA 1200639 1201130 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_09360 1201167 1201967 gene locus_tag LOCUS_09370 1201167 1201967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1202340 1202026 gene locus_tag LOCUS_09380 1202340 1202026 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_09380 1203399 1202401 gene locus_tag LOCUS_09390 1203399 1202401 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_09390 1213544 1203402 gene locus_tag LOCUS_09400 1213544 1203402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1214502 1213777 gene locus_tag LOCUS_09410 gene trmB 1214502 1213777 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_09410 1215920 1214502 gene locus_tag LOCUS_09420 1215920 1214502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1216168 1217496 gene locus_tag LOCUS_09430 1216168 1217496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1217543 1220140 gene locus_tag LOCUS_09440 1217543 1220140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1220829 1220215 gene locus_tag LOCUS_09450 1220829 1220215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1222106 1221099 gene locus_tag LOCUS_09460 1222106 1221099 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_09460 1223605 1222106 gene locus_tag LOCUS_09470 gene cysS 1223605 1222106 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962759.1 protein_id gnl|my_center|LOCUS_09470 1227176 1223988 gene locus_tag LOCUS_09480 1227176 1223988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1230016 1227188 gene locus_tag LOCUS_09490 1230016 1227188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1231718 1230069 gene locus_tag LOCUS_09500 gene gldM 1231718 1230069 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_09500 1232292 1231759 gene locus_tag LOCUS_09510 gene gldL 1232292 1231759 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_09510 1233640 1232411 gene locus_tag LOCUS_09520 gene clpX 1233640 1232411 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_09520 1235541 1233757 gene locus_tag LOCUS_09530 1235541 1233757 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_09530 1235594 1236478 gene locus_tag LOCUS_09540 1235594 1236478 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_09540 1236484 1236957 gene locus_tag LOCUS_09550 1236484 1236957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1238692 1236974 gene locus_tag LOCUS_09560 1238692 1236974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1238727 1239005 gene locus_tag LOCUS_09570 1238727 1239005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1239098 1240591 gene locus_tag LOCUS_09580 1239098 1240591 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071171.1 protein_id gnl|my_center|LOCUS_09580 1242174 1240630 gene locus_tag LOCUS_09590 1242174 1240630 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762559.1 protein_id gnl|my_center|LOCUS_09590 1242316 1242969 gene locus_tag LOCUS_09600 1242316 1242969 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_09600 1243027 1244934 gene locus_tag LOCUS_09610 1243027 1244934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1244937 1245467 gene locus_tag LOCUS_09620 gene hpt 1244937 1245467 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_09620 1245555 1246130 gene locus_tag LOCUS_09630 1245555 1246130 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_09630 1246131 1247126 gene locus_tag LOCUS_09640 gene obgE 1246131 1247126 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109231.1 protein_id gnl|my_center|LOCUS_09640 1247144 1248031 gene locus_tag LOCUS_09650 1247144 1248031 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037756.1 protein_id gnl|my_center|LOCUS_09650 1248144 1249241 gene locus_tag LOCUS_09660 1248144 1249241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1249839 1249264 gene locus_tag LOCUS_09670 1249839 1249264 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883143.1 protein_id gnl|my_center|LOCUS_09670 1249977 1250693 gene locus_tag LOCUS_09680 1249977 1250693 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_09680 1250806 1252974 gene locus_tag LOCUS_09690 1250806 1252974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1253020 1253094 gene locus_tag LOCUS_t00200 1253020 1253094 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1253959 1253123 gene locus_tag LOCUS_09700 1253959 1253123 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028152332.1 protein_id gnl|my_center|LOCUS_09700 1254116 1256542 gene locus_tag LOCUS_09710 1254116 1256542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1256693 1259470 gene locus_tag LOCUS_09720 1256693 1259470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1259540 1259905 gene locus_tag LOCUS_09730 1259540 1259905 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_09730 1259956 1260828 gene locus_tag LOCUS_09740 1259956 1260828 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_09740 1262776 1261139 gene locus_tag LOCUS_09750 1262776 1261139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1262952 1263027 gene locus_tag LOCUS_t00210 1262952 1263027 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1263756 1263121 gene locus_tag LOCUS_09760 1263756 1263121 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_09760 1264511 1263900 gene locus_tag LOCUS_09770 1264511 1263900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1265043 1264576 gene locus_tag LOCUS_09780 1265043 1264576 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_09780 1265126 1266688 gene locus_tag LOCUS_09790 1265126 1266688 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_09790 1266790 1267878 gene locus_tag LOCUS_09800 1266790 1267878 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_09800 1267939 1269471 gene locus_tag LOCUS_09810 1267939 1269471 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_09810 1269524 1269967 gene locus_tag LOCUS_09820 1269524 1269967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1269971 1270579 gene locus_tag LOCUS_09830 1269971 1270579 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_09830 1270683 1271708 gene locus_tag LOCUS_09840 1270683 1271708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1271966 1272856 gene locus_tag LOCUS_09850 1271966 1272856 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962619.1 protein_id gnl|my_center|LOCUS_09850 1272857 1274599 gene locus_tag LOCUS_09860 gene ilvD 1272857 1274599 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_09860 1274596 1276338 gene locus_tag LOCUS_09870 gene ilvB 1274596 1276338 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_09870 1276385 1276978 gene locus_tag LOCUS_09880 gene ilvN 1276385 1276978 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_09880 1276985 1278022 gene locus_tag LOCUS_09890 gene ilvC 1276985 1278022 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962615.1 protein_id gnl|my_center|LOCUS_09890 1278093 1278392 gene locus_tag LOCUS_09900 1278093 1278392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1278400 1279665 gene locus_tag LOCUS_09910 gene ilvA 1278400 1279665 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962614.1 protein_id gnl|my_center|LOCUS_09910 1279750 1280361 gene locus_tag LOCUS_09920 1279750 1280361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1280462 1281733 gene locus_tag LOCUS_09930 1280462 1281733 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_09930 1281743 1282696 gene locus_tag LOCUS_09940 1281743 1282696 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_09940 1282705 1283652 gene locus_tag LOCUS_09950 1282705 1283652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1283636 1284388 gene locus_tag LOCUS_09960 1283636 1284388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1284385 1285491 gene locus_tag LOCUS_09970 1284385 1285491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_09970 1285497 1286618 gene locus_tag LOCUS_09980 1285497 1286618 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_09980 1287395 1286751 gene locus_tag LOCUS_09990 gene clpP 1287395 1286751 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_09990 1288840 1287488 gene locus_tag LOCUS_10000 1288840 1287488 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_10000 1289023 1288938 gene locus_tag LOCUS_t00220 1289023 1288938 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1289191 1291404 gene locus_tag LOCUS_10010 1289191 1291404 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_10010 1292066 1291416 gene locus_tag LOCUS_10020 gene upp 1292066 1291416 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_10020 1292993 1292079 gene locus_tag LOCUS_10030 1292993 1292079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1294309 1292990 gene locus_tag LOCUS_10040 1294309 1292990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1296909 1294462 gene locus_tag LOCUS_10050 1296909 1294462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1297031 1297564 gene locus_tag LOCUS_10060 1297031 1297564 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_10060 1298947 1297604 gene locus_tag LOCUS_10070 1298947 1297604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1300181 1299045 gene locus_tag LOCUS_10080 1300181 1299045 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966190.1 protein_id gnl|my_center|LOCUS_10080 1300647 1301825 gene locus_tag LOCUS_10090 1300647 1301825 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_10090 1301822 1303003 gene locus_tag LOCUS_10100 1301822 1303003 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659109.1 protein_id gnl|my_center|LOCUS_10100 1304552 1303131 gene locus_tag LOCUS_10110 1304552 1303131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1307225 1304616 gene locus_tag LOCUS_10120 1307225 1304616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1308990 1307407 gene locus_tag LOCUS_10130 1308990 1307407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1314003 1309117 gene locus_tag LOCUS_10140 1314003 1309117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1314155 1316587 gene locus_tag LOCUS_10150 1314155 1316587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1317124 1316741 gene locus_tag LOCUS_10160 1317124 1316741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1317213 1318115 gene locus_tag LOCUS_10170 1317213 1318115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1318168 1322991 gene locus_tag LOCUS_10180 1318168 1322991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1323011 1325047 gene locus_tag LOCUS_10190 1323011 1325047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1327147 1325060 gene locus_tag LOCUS_10200 1327147 1325060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1329693 1327297 gene locus_tag LOCUS_10210 1329693 1327297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1342731 1329871 gene locus_tag LOCUS_10220 1342731 1329871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1343381 1343070 gene locus_tag LOCUS_10230 1343381 1343070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1343587 1344321 gene locus_tag LOCUS_10240 1343587 1344321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1344465 1346681 gene locus_tag LOCUS_10250 1344465 1346681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1346788 1346714 gene locus_tag LOCUS_t00230 1346788 1346714 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1347462 1348142 gene locus_tag LOCUS_10260 gene ung 1347462 1348142 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957938.1 protein_id gnl|my_center|LOCUS_10260 1350754 1348145 gene locus_tag LOCUS_10270 1350754 1348145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1350796 1350951 gene locus_tag LOCUS_10280 1350796 1350951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1350954 1351340 gene locus_tag LOCUS_10290 1350954 1351340 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269203.1 protein_id gnl|my_center|LOCUS_10290 1352195 1351374 gene locus_tag LOCUS_10300 1352195 1351374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1354755 1352293 gene locus_tag LOCUS_10310 1354755 1352293 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_10310 1356106 1354781 gene locus_tag LOCUS_10320 1356106 1354781 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_10320 1357162 1356152 gene locus_tag LOCUS_10330 1357162 1356152 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_10330 1357400 1358137 gene locus_tag LOCUS_10340 1357400 1358137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1359172 1358141 gene locus_tag LOCUS_10350 gene rlmN 1359172 1358141 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_10350 1359316 1359915 gene locus_tag LOCUS_10360 1359316 1359915 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_10360 1359915 1361264 gene locus_tag LOCUS_10370 1359915 1361264 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791600.1 protein_id gnl|my_center|LOCUS_10370 1361257 1362417 gene locus_tag LOCUS_10380 1361257 1362417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1362436 1365876 gene locus_tag LOCUS_10390 1362436 1365876 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_10390 1366392 1365880 gene locus_tag LOCUS_10400 gene ftnA 1366392 1365880 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260955.1 protein_id gnl|my_center|LOCUS_10400 1367378 1366542 gene locus_tag LOCUS_10410 1367378 1366542 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546027.1 protein_id gnl|my_center|LOCUS_10410 1368109 1367384 gene locus_tag LOCUS_10420 1368109 1367384 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_10420 1368552 1369583 gene locus_tag LOCUS_10430 1368552 1369583 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_10430 1369978 1369586 gene locus_tag LOCUS_10440 1369978 1369586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1370843 1370028 gene locus_tag LOCUS_10450 gene murI 1370843 1370028 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_10450 1371375 1370854 gene locus_tag LOCUS_10460 1371375 1370854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1371955 1371410 gene locus_tag LOCUS_10470 1371955 1371410 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_10470 1374585 1371982 gene locus_tag LOCUS_10480 gene bamA 1374585 1371982 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404583.1 protein_id gnl|my_center|LOCUS_10480 1375331 1374582 gene locus_tag LOCUS_10490 1375331 1374582 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_10490 1376165 1375368 gene locus_tag LOCUS_10500 1376165 1375368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1377216 1376230 gene locus_tag LOCUS_10510 1377216 1376230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1378285 1377407 gene locus_tag LOCUS_10520 1378285 1377407 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_10520 1379710 1378355 gene locus_tag LOCUS_10530 1379710 1378355 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_10530 1380897 1379707 gene locus_tag LOCUS_10540 1380897 1379707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1381679 1380918 gene locus_tag LOCUS_10550 1381679 1380918 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791872.1 protein_id gnl|my_center|LOCUS_10550 1382311 1381676 gene locus_tag LOCUS_10560 1382311 1381676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_10560 1382477 1383175 gene locus_tag LOCUS_10570 1382477 1383175 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_10570 1383424 1383179 gene locus_tag LOCUS_10580 1383424 1383179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1384166 1383651 gene locus_tag LOCUS_10590 1384166 1383651 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_10590 1384850 1384179 gene locus_tag LOCUS_10600 1384850 1384179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1385217 1384888 gene locus_tag LOCUS_10610 1385217 1384888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1385952 1385266 gene locus_tag LOCUS_10620 1385952 1385266 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394318.1 protein_id gnl|my_center|LOCUS_10620 1386595 1385984 gene locus_tag LOCUS_10630 1386595 1385984 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_10630 1387515 1386598 gene locus_tag LOCUS_10640 gene cyoE 1387515 1386598 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_10640 1389377 1387548 gene locus_tag LOCUS_10650 1389377 1387548 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_10650 1390448 1389402 gene locus_tag LOCUS_10660 1390448 1389402 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_10660 1391660 1390455 gene locus_tag LOCUS_10670 1391660 1390455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1392308 1391664 gene locus_tag LOCUS_10680 1392308 1391664 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_10680 1392829 1392320 gene locus_tag LOCUS_10690 1392829 1392320 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_10690 1393879 1392839 gene locus_tag LOCUS_10700 1393879 1392839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10700 1394276 1393812 gene locus_tag LOCUS_10710 1394276 1393812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10710 1397386 1394291 gene locus_tag LOCUS_10720 1397386 1394291 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_10720 1398751 1397402 gene locus_tag LOCUS_10730 1398751 1397402 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_10730 1398962 1399414 gene locus_tag LOCUS_10740 1398962 1399414 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762411.1 protein_id gnl|my_center|LOCUS_10740 1399768 1399523 gene locus_tag LOCUS_10750 1399768 1399523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1401361 1399859 gene locus_tag LOCUS_10760 gene atpD 1401361 1399859 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_10760 1402423 1401482 gene locus_tag LOCUS_10770 1402423 1401482 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_10770 1402604 1404793 gene locus_tag LOCUS_10780 gene katG 1402604 1404793 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_10780 1406592 1404916 gene locus_tag LOCUS_10790 1406592 1404916 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583646.1 protein_id gnl|my_center|LOCUS_10790 1407405 1406872 gene locus_tag LOCUS_10800 1407405 1406872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10800 1407691 1407356 gene locus_tag LOCUS_10810 1407691 1407356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10810 1407980 1407720 gene locus_tag LOCUS_10820 1407980 1407720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10820 1408195 1410759 gene locus_tag LOCUS_10830 1408195 1410759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1410865 1412205 gene locus_tag LOCUS_10840 gene mtaB 1410865 1412205 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_10840 1412234 1413121 gene locus_tag LOCUS_10850 gene sucD 1412234 1413121 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_10850 1413126 1413872 gene locus_tag LOCUS_10860 gene fabG 1413126 1413872 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_10860 1414059 1416095 gene locus_tag LOCUS_10870 1414059 1416095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_10870 1416132 1417946 gene locus_tag LOCUS_10880 gene uvrC 1416132 1417946 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_10880 1418742 1417915 gene locus_tag LOCUS_10890 1418742 1417915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1420403 1418754 gene locus_tag LOCUS_10900 1420403 1418754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1421263 1420454 gene locus_tag LOCUS_10910 1421263 1420454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1422658 1421387 gene locus_tag LOCUS_10920 gene gldK 1422658 1421387 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_10920 1423763 1422789 gene locus_tag LOCUS_10930 1423763 1422789 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_10930 1424689 1423847 gene locus_tag LOCUS_10940 1424689 1423847 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_10940 1425429 1424677 gene locus_tag LOCUS_10950 1425429 1424677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1427269 1425491 gene locus_tag LOCUS_10960 1427269 1425491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1427412 1428272 gene locus_tag LOCUS_10970 1427412 1428272 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_10970 1428934 1428299 gene locus_tag LOCUS_10980 1428934 1428299 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_10980 1430225 1429038 gene locus_tag LOCUS_10990 1430225 1429038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1431371 1430244 gene locus_tag LOCUS_11000 1431371 1430244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1432314 1431373 gene locus_tag LOCUS_11010 1432314 1431373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1433772 1432480 gene locus_tag LOCUS_11020 1433772 1432480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1434909 1433821 gene locus_tag LOCUS_11030 gene wecB 1434909 1433821 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250181.1 protein_id gnl|my_center|LOCUS_11030 1436186 1434927 gene locus_tag LOCUS_11040 1436186 1434927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1436322 1437392 gene locus_tag LOCUS_11050 1436322 1437392 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_11050 1437389 1437967 gene locus_tag LOCUS_11060 1437389 1437967 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_11060 1437967 1439304 gene locus_tag LOCUS_11070 1437967 1439304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1439306 1440406 gene locus_tag LOCUS_11080 1439306 1440406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1440459 1442450 gene locus_tag LOCUS_11090 1440459 1442450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1442447 1443490 gene locus_tag LOCUS_11100 1442447 1443490 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021093.1 protein_id gnl|my_center|LOCUS_11100 1443549 1445381 gene locus_tag LOCUS_11110 gene asnB 1443549 1445381 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_11110 1445378 1445746 gene locus_tag LOCUS_11120 1445378 1445746 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_11120 1446020 1445715 gene locus_tag LOCUS_11130 1446020 1445715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1448177 1446108 gene locus_tag LOCUS_11140 1448177 1446108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1449820 1448240 gene locus_tag LOCUS_11150 1449820 1448240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1449989 1451584 gene locus_tag LOCUS_11160 1449989 1451584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1453760 1451610 gene locus_tag LOCUS_11170 1453760 1451610 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_11170 1454814 1453807 gene locus_tag LOCUS_11180 1454814 1453807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1455999 1454941 gene locus_tag LOCUS_11190 1455999 1454941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1458832 1456085 gene locus_tag LOCUS_11200 1458832 1456085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1461521 1458855 gene locus_tag LOCUS_11210 1461521 1458855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1461664 1463409 gene locus_tag LOCUS_11220 gene aspS 1461664 1463409 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_11220 1463607 1465673 gene locus_tag LOCUS_11230 1463607 1465673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1466446 1465715 gene locus_tag LOCUS_11240 1466446 1465715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1467694 1466984 gene locus_tag LOCUS_11250 gene radC 1467694 1466984 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_11250 1468194 1467799 gene locus_tag LOCUS_11260 1468194 1467799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1468193 1470892 gene locus_tag LOCUS_11270 1468193 1470892 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_11270 1470958 1472235 gene locus_tag LOCUS_11280 gene odhB 1470958 1472235 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_11280 1473675 1472422 gene locus_tag LOCUS_11290 1473675 1472422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1475202 1473862 gene locus_tag LOCUS_11300 gene accC 1475202 1473862 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_11300 1475698 1475210 gene locus_tag LOCUS_11310 gene accB 1475698 1475210 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_11310 1476310 1475747 gene locus_tag LOCUS_11320 gene efp 1476310 1475747 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_11320 1477353 1476367 gene locus_tag LOCUS_11330 1477353 1476367 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789175.1 protein_id gnl|my_center|LOCUS_11330 1477569 1477378 gene locus_tag LOCUS_11340 1477569 1477378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1478104 1477580 gene locus_tag LOCUS_11350 1478104 1477580 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_11350 1478186 1479112 gene locus_tag LOCUS_11360 1478186 1479112 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480227.1 protein_id gnl|my_center|LOCUS_11360 1479880 1479164 gene locus_tag LOCUS_11370 1479880 1479164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1481024 1479900 gene locus_tag LOCUS_11380 1481024 1479900 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_11380 1481142 1482485 gene locus_tag LOCUS_11390 1481142 1482485 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_11390 1484565 1482547 gene locus_tag LOCUS_11400 gene asnB 1484565 1482547 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545305.1 protein_id gnl|my_center|LOCUS_11400 1484608 1486044 gene locus_tag LOCUS_11410 1484608 1486044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1487385 1486048 gene locus_tag LOCUS_11420 1487385 1486048 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022166.1 protein_id gnl|my_center|LOCUS_11420 1488304 1487378 gene locus_tag LOCUS_11430 1488304 1487378 CDS product formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869032.1 protein_id gnl|my_center|LOCUS_11430 1489086 1488337 gene locus_tag LOCUS_11440 1489086 1488337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376454.1 protein_id gnl|my_center|LOCUS_11440 1490026 1489091 gene locus_tag LOCUS_11450 1490026 1489091 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807064.1 protein_id gnl|my_center|LOCUS_11450 1490763 1490035 gene locus_tag LOCUS_11460 1490763 1490035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807062.1 protein_id gnl|my_center|LOCUS_11460 1491686 1490766 gene locus_tag LOCUS_11470 1491686 1490766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407616.1 protein_id gnl|my_center|LOCUS_11470 1492304 1491690 gene locus_tag LOCUS_11480 1492304 1491690 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902091.1 protein_id gnl|my_center|LOCUS_11480 1492957 1492301 gene locus_tag LOCUS_11490 1492957 1492301 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_11490 1493835 1492954 gene locus_tag LOCUS_11500 1493835 1492954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1495909 1493996 gene locus_tag LOCUS_11510 gene asnB 1495909 1493996 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927303.1 protein_id gnl|my_center|LOCUS_11510 1497053 1495914 gene locus_tag LOCUS_11520 1497053 1495914 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807055.1 protein_id gnl|my_center|LOCUS_11520 1498045 1497053 gene locus_tag LOCUS_11530 1498045 1497053 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957832.1 protein_id gnl|my_center|LOCUS_11530 1498430 1499737 gene locus_tag LOCUS_11540 gene radA 1498430 1499737 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764082.1 protein_id gnl|my_center|LOCUS_11540 1499769 1500476 gene locus_tag LOCUS_11550 1499769 1500476 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_11550 1500567 1501964 gene locus_tag LOCUS_11560 1500567 1501964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_11560 1502735 1501965 gene locus_tag LOCUS_11570 1502735 1501965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1502912 1506061 gene locus_tag LOCUS_11580 1502912 1506061 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_11580 1506072 1506821 gene locus_tag LOCUS_11590 gene rlmB 1506072 1506821 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_11590 1506869 1508170 gene locus_tag LOCUS_11600 1506869 1508170 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896135.1 protein_id gnl|my_center|LOCUS_11600 1509153 1508197 gene locus_tag LOCUS_11610 1509153 1508197 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403982.1 protein_id gnl|my_center|LOCUS_11610 1509423 1509163 gene locus_tag LOCUS_11620 1509423 1509163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1511040 1509514 gene locus_tag LOCUS_11630 1511040 1509514 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_11630 1511951 1511049 gene locus_tag LOCUS_11640 gene deoC 1511951 1511049 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838655.1 protein_id gnl|my_center|LOCUS_11640 1513152 1512007 gene locus_tag LOCUS_11650 1513152 1512007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1513380 1514876 gene locus_tag LOCUS_11660 1513380 1514876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1514857 1515975 gene locus_tag LOCUS_11670 1514857 1515975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1515997 1516068 gene locus_tag LOCUS_t00240 1515997 1516068 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1517475 1516075 gene locus_tag LOCUS_11680 gene lpdA 1517475 1516075 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_11680 1517998 1517576 gene locus_tag LOCUS_11690 1517998 1517576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1518216 1517995 gene locus_tag LOCUS_11700 1518216 1517995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1518592 1518182 gene locus_tag LOCUS_11710 1518592 1518182 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791781.1 protein_id gnl|my_center|LOCUS_11710 1519457 1518612 gene locus_tag LOCUS_11720 1519457 1518612 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_11720 1519529 1522321 gene locus_tag LOCUS_11730 1519529 1522321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_11730 1522328 1524571 gene locus_tag LOCUS_11740 1522328 1524571 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_11740 1524655 1526565 gene locus_tag LOCUS_11750 1524655 1526565 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_11750 1527824 1526817 gene locus_tag LOCUS_11760 gene aroF 1527824 1526817 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_11760 1528614 1527802 gene locus_tag LOCUS_11770 gene trpA 1528614 1527802 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788291.1 protein_id gnl|my_center|LOCUS_11770 1529777 1528611 gene locus_tag LOCUS_11780 gene trpB 1529777 1528611 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_11780 1530415 1529774 gene locus_tag LOCUS_11790 1530415 1529774 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_11790 1531226 1530423 gene locus_tag LOCUS_11800 gene trpC 1531226 1530423 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_11800 1532227 1531223 gene locus_tag LOCUS_11810 gene trpD 1532227 1531223 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_11810 1532796 1532224 gene locus_tag LOCUS_11820 1532796 1532224 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_11820 1534163 1532793 gene locus_tag LOCUS_11830 1534163 1532793 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_11830 1534396 1536234 gene locus_tag LOCUS_11840 1534396 1536234 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931857.1 protein_id gnl|my_center|LOCUS_11840 1536231 1537262 gene locus_tag LOCUS_11850 1536231 1537262 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838141.1 protein_id gnl|my_center|LOCUS_11850 1537472 1538050 gene locus_tag LOCUS_11860 1537472 1538050 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_11860 1538398 1538033 gene locus_tag LOCUS_11870 1538398 1538033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1538379 1539953 gene locus_tag LOCUS_11880 gene nadB 1538379 1539953 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_11880 1541025 1539976 gene locus_tag LOCUS_11890 1541025 1539976 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555792.1 protein_id gnl|my_center|LOCUS_11890 1541770 1541030 gene locus_tag LOCUS_11900 1541770 1541030 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931830.1 protein_id gnl|my_center|LOCUS_11900 1542801 1542163 gene locus_tag LOCUS_11910 1542801 1542163 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_11910 1542883 1546323 gene locus_tag LOCUS_11920 1542883 1546323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1546440 1547342 gene locus_tag LOCUS_11930 1546440 1547342 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_11930 1549167 1547329 gene locus_tag LOCUS_11940 gene glmS 1549167 1547329 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_11940 1550502 1549174 gene locus_tag LOCUS_11950 1550502 1549174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1551336 1550521 gene locus_tag LOCUS_11960 1551336 1550521 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_11960 1551463 1552314 gene locus_tag LOCUS_11970 gene panC 1551463 1552314 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_11970 1552327 1552671 gene locus_tag LOCUS_11980 1552327 1552671 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_11980 1552676 1553734 gene locus_tag LOCUS_11990 1552676 1553734 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_11990 1553721 1554209 gene locus_tag LOCUS_12000 1553721 1554209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1554285 1555424 gene locus_tag LOCUS_12010 1554285 1555424 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_12010 1555794 1555429 gene locus_tag LOCUS_12020 1555794 1555429 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_12020 1555867 1556394 gene locus_tag LOCUS_12030 1555867 1556394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_12030 1556396 1557139 gene locus_tag LOCUS_12040 1556396 1557139 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763633.1 protein_id gnl|my_center|LOCUS_12040 1557136 1558047 gene locus_tag LOCUS_12050 1557136 1558047 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_12050 1558147 1559604 gene locus_tag LOCUS_12060 gene dnaA 1558147 1559604 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_12060 1559664 1559751 gene locus_tag LOCUS_t00250 1559664 1559751 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1559799 1559874 gene locus_tag LOCUS_t00260 1559799 1559874 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1560002 1561447 gene locus_tag LOCUS_12070 1560002 1561447 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 protein_id gnl|my_center|LOCUS_12070 1561444 1561860 gene locus_tag LOCUS_12080 1561444 1561860 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_12080 1562956 1561850 gene locus_tag LOCUS_12090 1562956 1561850 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_12090 1565418 1562983 gene locus_tag LOCUS_12100 1565418 1562983 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_12100 1566176 1565415 gene locus_tag LOCUS_12110 1566176 1565415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1567409 1566207 gene locus_tag LOCUS_12120 1567409 1566207 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_12120 1568049 1567414 gene locus_tag LOCUS_12130 1568049 1567414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1569322 1568021 gene locus_tag LOCUS_12140 1569322 1568021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1569434 1570786 gene locus_tag LOCUS_12150 1569434 1570786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1571799 1570735 gene locus_tag LOCUS_12160 1571799 1570735 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_12160 1573136 1571907 gene locus_tag LOCUS_12170 1573136 1571907 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056098.1 protein_id gnl|my_center|LOCUS_12170 1574995 1573133 gene locus_tag LOCUS_12180 gene asnB 1574995 1573133 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036622.1 protein_id gnl|my_center|LOCUS_12180 1576060 1575119 gene locus_tag LOCUS_12190 1576060 1575119 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_12190 1576117 1576308 gene locus_tag LOCUS_12200 1576117 1576308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1578551 1576251 gene locus_tag LOCUS_12210 1578551 1576251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1579955 1578726 gene locus_tag LOCUS_12220 1579955 1578726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1581111 1580782 gene locus_tag LOCUS_12230 1581111 1580782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1581440 1583452 gene locus_tag LOCUS_12240 1581440 1583452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1583484 1583732 gene locus_tag LOCUS_12250 1583484 1583732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1583902 1584927 gene locus_tag LOCUS_12260 gene hemW 1583902 1584927 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_12260 1584974 1586278 gene locus_tag LOCUS_12270 gene purD 1584974 1586278 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369278.1 protein_id gnl|my_center|LOCUS_12270 1588187 1586283 gene locus_tag LOCUS_12280 1588187 1586283 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_12280 1588342 1589106 gene locus_tag LOCUS_12290 1588342 1589106 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_12290 1594589 1589103 gene locus_tag LOCUS_12300 1594589 1589103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1594852 1595688 gene locus_tag LOCUS_12310 1594852 1595688 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_12310 1595688 1596968 gene locus_tag LOCUS_12320 1595688 1596968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1596965 1597621 gene locus_tag LOCUS_12330 1596965 1597621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1597652 1598665 gene locus_tag LOCUS_12340 1597652 1598665 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141615041.1 protein_id gnl|my_center|LOCUS_12340 1598658 1599623 gene locus_tag LOCUS_12350 1598658 1599623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1599784 1600767 gene locus_tag LOCUS_12360 1599784 1600767 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141615041.1 protein_id gnl|my_center|LOCUS_12360 1600836 1601600 gene locus_tag LOCUS_12370 1600836 1601600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1601617 1602636 gene locus_tag LOCUS_12380 1601617 1602636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1602643 1603770 gene locus_tag LOCUS_12390 1602643 1603770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1603805 1604860 gene locus_tag LOCUS_12400 1603805 1604860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1604850 1606145 gene locus_tag LOCUS_12410 1604850 1606145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1608145 1606151 gene locus_tag LOCUS_12420 1608145 1606151 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_12420 1609033 1608194 gene locus_tag LOCUS_12430 1609033 1608194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1610069 1609434 gene locus_tag LOCUS_12440 1610069 1609434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1610443 1610066 gene locus_tag LOCUS_12450 1610443 1610066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1611092 1610754 gene locus_tag LOCUS_12460 1611092 1610754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1611840 1611139 gene locus_tag LOCUS_12470 1611840 1611139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1612095 1611859 gene locus_tag LOCUS_12480 1612095 1611859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1614105 1612240 gene locus_tag LOCUS_12490 1614105 1612240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1615739 1614339 gene locus_tag LOCUS_12500 1615739 1614339 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203354.1 protein_id gnl|my_center|LOCUS_12500 1617359 1616124 gene locus_tag LOCUS_12510 1617359 1616124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1621260 1617460 gene locus_tag LOCUS_12520 1621260 1617460 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_12520 1621786 1621367 gene locus_tag LOCUS_12530 1621786 1621367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1623130 1621901 gene locus_tag LOCUS_12540 1623130 1621901 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_12540 1625062 1623227 gene locus_tag LOCUS_12550 1625062 1623227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_12550 1625189 1625530 gene locus_tag LOCUS_12560 gene rbfA 1625189 1625530 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_12560 1625614 1626849 gene locus_tag LOCUS_12570 1625614 1626849 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_12570 1627659 1626856 gene locus_tag LOCUS_12580 1627659 1626856 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_12580 1629530 1627656 gene locus_tag LOCUS_12590 1629530 1627656 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_12590 1630313 1629534 gene locus_tag LOCUS_12600 1630313 1629534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1631350 1630310 gene locus_tag LOCUS_12610 1631350 1630310 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_12610 1632349 1631453 gene locus_tag LOCUS_12620 gene atpG 1632349 1631453 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_12620 1633957 1632377 gene locus_tag LOCUS_12630 gene atpA 1633957 1632377 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_12630 1634540 1633977 gene locus_tag LOCUS_12640 gene atpH 1634540 1633977 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_12640 1635137 1634640 gene locus_tag LOCUS_12650 1635137 1634640 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_12650 1635493 1635248 gene locus_tag LOCUS_12660 gene atpE 1635493 1635248 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295758.1 protein_id gnl|my_center|LOCUS_12660 1636513 1635515 gene locus_tag LOCUS_12670 gene atpB 1636513 1635515 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_12670 1637682 1636891 gene locus_tag LOCUS_12680 1637682 1636891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1638297 1640117 gene locus_tag LOCUS_12690 1638297 1640117 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661313.1 protein_id gnl|my_center|LOCUS_12690 1640560 1641267 gene locus_tag LOCUS_12700 1640560 1641267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1645139 1641276 gene locus_tag LOCUS_12710 1645139 1641276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1646599 1645307 gene locus_tag LOCUS_12720 1646599 1645307 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_12720 1647529 1646624 gene locus_tag LOCUS_12730 gene cysD 1647529 1646624 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_12730 1648175 1647549 gene locus_tag LOCUS_12740 gene cysC 1648175 1647549 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107257.1 protein_id gnl|my_center|LOCUS_12740 1649447 1648266 gene locus_tag LOCUS_12750 1649447 1648266 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_12750 1649867 1649451 gene locus_tag LOCUS_12760 1649867 1649451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1653186 1649857 gene locus_tag LOCUS_12770 gene secA 1653186 1649857 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764528.1 protein_id gnl|my_center|LOCUS_12770 1653314 1654582 gene locus_tag LOCUS_12780 gene purD 1653314 1654582 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_12780 1662993 1654900 gene locus_tag LOCUS_12790 1662993 1654900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1663285 1664850 gene locus_tag LOCUS_12800 1663285 1664850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1666998 1664890 gene locus_tag LOCUS_12810 1666998 1664890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1668613 1667162 gene locus_tag LOCUS_12820 1668613 1667162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1670890 1668698 gene locus_tag LOCUS_12830 1670890 1668698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1672301 1670982 gene locus_tag LOCUS_12840 1672301 1670982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1673815 1672418 gene locus_tag LOCUS_12850 gene fumC 1673815 1672418 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650562.1 protein_id gnl|my_center|LOCUS_12850 1675317 1674004 gene locus_tag LOCUS_12860 1675317 1674004 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_12860 1676873 1675389 gene locus_tag LOCUS_12870 gene gldJ 1676873 1675389 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_12870 1677962 1676940 gene locus_tag LOCUS_12880 1677962 1676940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1678098 1681937 gene locus_tag LOCUS_12890 gene porU 1678098 1681937 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_12890 1681954 1683165 gene locus_tag LOCUS_12900 gene porV 1681954 1683165 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_12900 1683404 1683676 gene locus_tag LOCUS_12910 1683404 1683676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1685264 1683768 gene locus_tag LOCUS_12920 gene hutH 1685264 1683768 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962994.1 protein_id gnl|my_center|LOCUS_12920 1686900 1685461 gene locus_tag LOCUS_12930 1686900 1685461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1687223 1690297 gene locus_tag LOCUS_12940 1687223 1690297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1690472 1692469 gene locus_tag LOCUS_12950 1690472 1692469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1692626 1692880 gene locus_tag LOCUS_12960 1692626 1692880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1692922 1695039 gene locus_tag LOCUS_12970 1692922 1695039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1695116 1695778 gene locus_tag LOCUS_12980 1695116 1695778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1695873 1698647 gene locus_tag LOCUS_12990 1695873 1698647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1699018 1699359 gene locus_tag LOCUS_13000 1699018 1699359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1699519 1700238 gene locus_tag LOCUS_13010 1699519 1700238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1702163 1700466 gene locus_tag LOCUS_13020 1702163 1700466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1702334 1703236 gene locus_tag LOCUS_13030 gene dapA 1702334 1703236 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_13030 1703318 1707406 gene locus_tag LOCUS_13040 1703318 1707406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1707419 1708531 gene locus_tag LOCUS_13050 1707419 1708531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1708619 1709347 gene locus_tag LOCUS_13060 1708619 1709347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1711380 1709416 gene locus_tag LOCUS_13070 gene gyrB 1711380 1709416 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_13070 1711645 1712133 gene locus_tag LOCUS_13080 1711645 1712133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1712859 1712170 gene locus_tag LOCUS_13090 gene elbB 1712859 1712170 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099212.1 protein_id gnl|my_center|LOCUS_13090 1713900 1712881 gene locus_tag LOCUS_13100 1713900 1712881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1714972 1714232 gene locus_tag LOCUS_13110 1714972 1714232 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765640.1 protein_id gnl|my_center|LOCUS_13110 1715232 1715624 gene locus_tag LOCUS_13120 1715232 1715624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1715621 1716952 gene locus_tag LOCUS_13130 1715621 1716952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1718159 1716936 gene locus_tag LOCUS_13140 1718159 1716936 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_13140 1718670 1718200 gene locus_tag LOCUS_13150 1718670 1718200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1718755 1719786 gene locus_tag LOCUS_13160 1718755 1719786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1720283 1719783 gene locus_tag LOCUS_13170 1720283 1719783 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760630.1 protein_id gnl|my_center|LOCUS_13170 1720613 1720293 gene locus_tag LOCUS_13180 1720613 1720293 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_13180 1722828 1720630 gene locus_tag LOCUS_13190 1722828 1720630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1723179 1722838 gene locus_tag LOCUS_13200 1723179 1722838 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_13200 1724891 1723308 gene locus_tag LOCUS_13210 1724891 1723308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13210 1726053 1724839 gene locus_tag LOCUS_13220 1726053 1724839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13220 1726137 1726697 gene locus_tag LOCUS_13230 1726137 1726697 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_13230 1726700 1727143 gene locus_tag LOCUS_13240 1726700 1727143 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_13240 1727140 1727910 gene locus_tag LOCUS_13250 1727140 1727910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1727992 1728603 gene locus_tag LOCUS_13260 1727992 1728603 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_13260 1728879 1731680 gene locus_tag LOCUS_13270 1728879 1731680 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_13270 1731984 1732205 gene locus_tag LOCUS_13280 1731984 1732205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1732384 1733796 gene locus_tag LOCUS_13290 1732384 1733796 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022106.1 protein_id gnl|my_center|LOCUS_13290 1733851 1734960 gene locus_tag LOCUS_13300 1733851 1734960 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_13300 1735189 1736154 gene locus_tag LOCUS_13310 gene rhuM 1735189 1736154 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957909.1 protein_id gnl|my_center|LOCUS_13310 1736151 1737641 gene locus_tag LOCUS_13320 1736151 1737641 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_13320 1737992 1739548 gene locus_tag LOCUS_13330 1737992 1739548 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_13330 1740796 1739693 gene locus_tag LOCUS_13340 1740796 1739693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1740999 1741322 gene locus_tag LOCUS_13350 1740999 1741322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1741454 1742530 gene locus_tag LOCUS_13360 1741454 1742530 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_13360 1742530 1743537 gene locus_tag LOCUS_13370 1742530 1743537 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_13370 1743626 1743775 gene locus_tag LOCUS_13380 1743626 1743775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1744165 1743758 gene locus_tag LOCUS_13390 1744165 1743758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1745299 1744544 gene locus_tag LOCUS_13400 1745299 1744544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1745558 1746943 gene locus_tag LOCUS_13410 1745558 1746943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1747611 1746949 gene locus_tag LOCUS_13420 1747611 1746949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668135.1 protein_id gnl|my_center|LOCUS_13420 1747934 1747611 gene locus_tag LOCUS_13430 1747934 1747611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1748980 1748063 gene locus_tag LOCUS_13440 1748980 1748063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1750983 1749013 gene locus_tag LOCUS_13450 gene metG 1750983 1749013 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_13450 1751136 1752035 gene locus_tag LOCUS_13460 1751136 1752035 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179062.1 protein_id gnl|my_center|LOCUS_13460 1752036 1752590 gene locus_tag LOCUS_13470 gene pnuC 1752036 1752590 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_13470 1752578 1753096 gene locus_tag LOCUS_13480 1752578 1753096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1753218 1754456 gene locus_tag LOCUS_13490 1753218 1754456 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081499.1 protein_id gnl|my_center|LOCUS_13490 1755221 1754796 gene locus_tag LOCUS_13500 1755221 1754796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13500 1755874 1755260 gene locus_tag LOCUS_13510 1755874 1755260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1756006 1757247 gene locus_tag LOCUS_13520 gene serA 1756006 1757247 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071152.1 protein_id gnl|my_center|LOCUS_13520 1757257 1759035 gene locus_tag LOCUS_13530 1757257 1759035 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929446.1 protein_id gnl|my_center|LOCUS_13530 1759475 1759053 gene locus_tag LOCUS_13540 1759475 1759053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1760991 1759486 gene locus_tag LOCUS_13550 1760991 1759486 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986831.1 protein_id gnl|my_center|LOCUS_13550 1762232 1760997 gene locus_tag LOCUS_13560 1762232 1760997 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_13560 1762466 1763635 gene locus_tag LOCUS_13570 1762466 1763635 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_13570 1763930 1764928 gene locus_tag LOCUS_13580 1763930 1764928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1764846 1766708 gene locus_tag LOCUS_13590 1764846 1766708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1767001 1768932 gene locus_tag LOCUS_13600 gene scpA 1767001 1768932 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_13600 1768929 1769918 gene locus_tag LOCUS_13610 gene meaB 1768929 1769918 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094315.1 protein_id gnl|my_center|LOCUS_13610 1770039 1771667 gene locus_tag LOCUS_13620 1770039 1771667 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759736.1 protein_id gnl|my_center|LOCUS_13620 1771701 1772432 gene locus_tag LOCUS_13630 1771701 1772432 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_13630 1772875 1772447 gene locus_tag LOCUS_13640 1772875 1772447 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 protein_id gnl|my_center|LOCUS_13640 1773262 1776450 gene locus_tag LOCUS_13650 1773262 1776450 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120701253.1 protein_id gnl|my_center|LOCUS_13650 1776566 1777921 gene locus_tag LOCUS_13660 1776566 1777921 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_13660 1778908 1777973 gene locus_tag LOCUS_13670 1778908 1777973 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928602.1 protein_id gnl|my_center|LOCUS_13670 1779141 1779473 gene locus_tag LOCUS_13680 1779141 1779473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1779623 1781311 gene locus_tag LOCUS_13690 1779623 1781311 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_13690 1781915 1781313 gene locus_tag LOCUS_13700 1781915 1781313 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903191.1 protein_id gnl|my_center|LOCUS_13700 1782589 1781912 gene locus_tag LOCUS_13710 1782589 1781912 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_13710 1783187 1782645 gene locus_tag LOCUS_13720 1783187 1782645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1784407 1783184 gene locus_tag LOCUS_13730 gene ricT 1784407 1783184 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_13730 1785610 1784465 gene locus_tag LOCUS_13740 1785610 1784465 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_13740 1785713 1786120 gene locus_tag LOCUS_13750 1785713 1786120 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_13750 1786996 1786124 gene locus_tag LOCUS_13760 1786996 1786124 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_13760 1787504 1787016 gene locus_tag LOCUS_13770 1787504 1787016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1788529 1787648 gene locus_tag LOCUS_13780 1788529 1787648 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_13780 1788753 1789697 gene locus_tag LOCUS_13790 1788753 1789697 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_13790 1789713 1790357 gene locus_tag LOCUS_13800 1789713 1790357 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_13800 1790422 1790976 gene locus_tag LOCUS_13810 gene pth 1790422 1790976 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764745.1 protein_id gnl|my_center|LOCUS_13810 1791908 1791123 gene locus_tag LOCUS_13820 1791908 1791123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1792864 1791911 gene locus_tag LOCUS_13830 1792864 1791911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1792905 1793516 gene locus_tag LOCUS_13840 1792905 1793516 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_13840 1794394 1794008 gene locus_tag LOCUS_13850 1794394 1794008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1794455 1795405 gene locus_tag LOCUS_13860 1794455 1795405 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_13860 1795792 1795406 gene locus_tag LOCUS_13870 1795792 1795406 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_13870 1795832 1796512 gene locus_tag LOCUS_13880 1795832 1796512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1796576 1796947 gene locus_tag LOCUS_13890 1796576 1796947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962738.1 protein_id gnl|my_center|LOCUS_13890 1797005 1797904 gene locus_tag LOCUS_13900 1797005 1797904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1798017 1798385 gene locus_tag LOCUS_13910 1798017 1798385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1799007 1798453 gene locus_tag LOCUS_13920 1799007 1798453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1800437 1799079 gene locus_tag LOCUS_13930 1800437 1799079 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_13930 1802700 1800451 gene locus_tag LOCUS_13940 1802700 1800451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13940 1803445 1802660 gene locus_tag LOCUS_13950 1803445 1802660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13950 1803444 1804301 gene locus_tag LOCUS_13960 1803444 1804301 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_13960 1804336 1807188 gene locus_tag LOCUS_13970 1804336 1807188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1807384 1807752 gene locus_tag LOCUS_13980 1807384 1807752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1807796 1808503 gene locus_tag LOCUS_13990 1807796 1808503 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_13990 1810702 1808504 gene locus_tag LOCUS_14000 1810702 1808504 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926991.1 protein_id gnl|my_center|LOCUS_14000 1812174 1810801 gene locus_tag LOCUS_14010 1812174 1810801 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969774.1 protein_id gnl|my_center|LOCUS_14010 1813006 1812251 gene locus_tag LOCUS_14020 1813006 1812251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1813232 1813579 gene locus_tag LOCUS_14030 1813232 1813579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1813696 1816752 gene locus_tag LOCUS_14040 1813696 1816752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1816875 1817885 gene locus_tag LOCUS_14050 1816875 1817885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1817953 1819710 gene locus_tag LOCUS_14060 1817953 1819710 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_14060 1819753 1822737 gene locus_tag LOCUS_14070 1819753 1822737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1822734 1823372 gene locus_tag LOCUS_14080 1822734 1823372 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768051.1 protein_id gnl|my_center|LOCUS_14080 1823471 1824118 gene locus_tag LOCUS_14090 1823471 1824118 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_14090 1824221 1825696 gene locus_tag LOCUS_14100 gene guaB 1824221 1825696 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963927.1 protein_id gnl|my_center|LOCUS_14100 1825797 1826843 gene locus_tag LOCUS_14110 gene pheS 1825797 1826843 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_14110 1826905 1827786 gene locus_tag LOCUS_14120 1826905 1827786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1827882 1828310 gene locus_tag LOCUS_14130 1827882 1828310 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073919.1 protein_id gnl|my_center|LOCUS_14130 1828337 1830031 gene locus_tag LOCUS_14140 1828337 1830031 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_14140 1830028 1830498 gene locus_tag LOCUS_14150 1830028 1830498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1830557 1831015 gene locus_tag LOCUS_14160 1830557 1831015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1831281 1832054 gene locus_tag LOCUS_14170 1831281 1832054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1832186 1832941 gene locus_tag LOCUS_14180 1832186 1832941 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_14180 1833744 1832887 gene locus_tag LOCUS_14190 1833744 1832887 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_14190 1833822 1834511 gene locus_tag LOCUS_14200 1833822 1834511 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_14200 1834515 1835243 gene locus_tag LOCUS_14210 1834515 1835243 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_14210 1835263 1836495 gene locus_tag LOCUS_14220 1835263 1836495 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_14220 1836488 1837885 gene locus_tag LOCUS_14230 1836488 1837885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785453.1 protein_id gnl|my_center|LOCUS_14230 1837869 1838471 gene locus_tag LOCUS_14240 1837869 1838471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1838509 1839780 gene locus_tag LOCUS_14250 1838509 1839780 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_14250 1839854 1841956 gene locus_tag LOCUS_14260 1839854 1841956 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_14260 1842101 1842619 gene locus_tag LOCUS_14270 1842101 1842619 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_14270 1842624 1843580 gene locus_tag LOCUS_14280 1842624 1843580 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055217507.1 protein_id gnl|my_center|LOCUS_14280 1843631 1844353 gene locus_tag LOCUS_14290 1843631 1844353 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_14290 1844463 1844536 gene locus_tag LOCUS_t00270 1844463 1844536 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1844960 1845418 gene locus_tag LOCUS_14300 1844960 1845418 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986776.1 protein_id gnl|my_center|LOCUS_14300 1846433 1845633 gene locus_tag LOCUS_14310 1846433 1845633 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_14310 1846508 1846999 gene locus_tag LOCUS_14320 1846508 1846999 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_14320 1847575 1847078 gene locus_tag LOCUS_14330 1847575 1847078 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784022.1 protein_id gnl|my_center|LOCUS_14330 1848593 1847688 gene locus_tag LOCUS_14340 1848593 1847688 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_14340 1848766 1848590 gene locus_tag LOCUS_14350 1848766 1848590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1848791 1850545 gene locus_tag LOCUS_14360 1848791 1850545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1850686 1851642 gene locus_tag LOCUS_14370 1850686 1851642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1851687 1852640 gene locus_tag LOCUS_14380 1851687 1852640 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_14380 1852738 1853379 gene locus_tag LOCUS_14390 1852738 1853379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1853376 1854677 gene locus_tag LOCUS_14400 1853376 1854677 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_14400 1855343 1854735 gene locus_tag LOCUS_14410 1855343 1854735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1855795 1855391 gene locus_tag LOCUS_14420 1855795 1855391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1856382 1855801 gene locus_tag LOCUS_14430 1856382 1855801 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256689.1 protein_id gnl|my_center|LOCUS_14430 1857943 1856582 gene locus_tag LOCUS_14440 1857943 1856582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1858559 1858014 gene locus_tag LOCUS_14450 1858559 1858014 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_14450 1858721 1859728 gene locus_tag LOCUS_14460 1858721 1859728 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_14460 1859735 1861381 gene locus_tag LOCUS_14470 1859735 1861381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1861366 1862082 gene locus_tag LOCUS_14480 1861366 1862082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1862776 1862171 gene locus_tag LOCUS_14490 1862776 1862171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838236.1 protein_id gnl|my_center|LOCUS_14490 1864125 1862815 gene locus_tag LOCUS_14500 1864125 1862815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_14500 1865026 1864091 gene locus_tag LOCUS_14510 1865026 1864091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_14510 1866228 1865059 gene locus_tag LOCUS_14520 gene dnaJ 1866228 1865059 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_14520 1866859 1866281 gene locus_tag LOCUS_14530 1866859 1866281 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800555.1 protein_id gnl|my_center|LOCUS_14530 1867057 1867599 gene locus_tag LOCUS_14540 1867057 1867599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1868262 1867666 gene locus_tag LOCUS_14550 1868262 1867666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1868464 1869249 gene locus_tag LOCUS_14560 1868464 1869249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1869756 1869289 gene locus_tag LOCUS_14570 1869756 1869289 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762666.1 protein_id gnl|my_center|LOCUS_14570 1869910 1871166 gene locus_tag LOCUS_14580 1869910 1871166 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275517.1 protein_id gnl|my_center|LOCUS_14580 1872162 1871110 gene locus_tag LOCUS_14590 1872162 1871110 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_14590 1872741 1872316 gene locus_tag LOCUS_14600 gene apaG 1872741 1872316 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_14600 1873301 1872738 gene locus_tag LOCUS_14610 gene gmk 1873301 1872738 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402819.1 protein_id gnl|my_center|LOCUS_14610 1874400 1873309 gene locus_tag LOCUS_14620 1874400 1873309 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_14620 1874622 1875017 gene locus_tag LOCUS_14630 1874622 1875017 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_14630 1875356 1875066 gene locus_tag LOCUS_14640 1875356 1875066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1877396 1875813 gene locus_tag LOCUS_14650 1877396 1875813 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_14650 1877619 1877513 gene locus_tag LOCUS_r00010 1877619 1877513 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1880575 1877680 gene locus_tag LOCUS_r00020 1880575 1877680 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1880796 1880722 gene locus_tag LOCUS_t00280 1880796 1880722 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1880927 1880851 gene locus_tag LOCUS_t00290 1880927 1880851 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1882602 1881076 gene locus_tag LOCUS_r00030 1882602 1881076 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1883227 1884174 gene locus_tag LOCUS_14660 1883227 1884174 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_14660 1884175 1884612 gene locus_tag LOCUS_14670 1884175 1884612 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_14670 1884640 1884918 gene locus_tag LOCUS_14680 1884640 1884918 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143402.1 protein_id gnl|my_center|LOCUS_14680 1884940 1886139 gene locus_tag LOCUS_14690 gene moeB 1884940 1886139 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_14690 1886369 1888102 gene locus_tag LOCUS_14700 1886369 1888102 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_14700 1888928 1888137 gene locus_tag LOCUS_14710 1888928 1888137 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_14710 1889006 1889533 gene locus_tag LOCUS_14720 1889006 1889533 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_14720 1889540 1890553 gene locus_tag LOCUS_14730 1889540 1890553 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_14730 1891491 1890703 gene locus_tag LOCUS_14740 1891491 1890703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1892171 1891527 gene locus_tag LOCUS_14750 1892171 1891527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1893907 1892240 gene locus_tag LOCUS_14760 gene paaN 1893907 1892240 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813288.1 protein_id gnl|my_center|LOCUS_14760 1894169 1896643 gene locus_tag LOCUS_14770 1894169 1896643 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421594.1 protein_id gnl|my_center|LOCUS_14770 1897494 1896745 gene locus_tag LOCUS_14780 1897494 1896745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1897554 1898507 gene locus_tag LOCUS_14790 1897554 1898507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1899636 1898515 gene locus_tag LOCUS_14800 1899636 1898515 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922183.1 protein_id gnl|my_center|LOCUS_14800 1899783 1900145 gene locus_tag LOCUS_14810 1899783 1900145 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281604.1 protein_id gnl|my_center|LOCUS_14810 1901802 1900447 gene locus_tag LOCUS_14820 1901802 1900447 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_14820 1902552 1901806 gene locus_tag LOCUS_14830 gene lptB 1902552 1901806 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_14830 1904306 1902549 gene locus_tag LOCUS_14840 gene recJ 1904306 1902549 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_14840 1906398 1904389 gene locus_tag LOCUS_14850 1906398 1904389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1907735 1906476 gene locus_tag LOCUS_14860 1907735 1906476 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_14860 1914128 1907883 gene locus_tag LOCUS_14870 1914128 1907883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1915834 1914569 gene locus_tag LOCUS_14880 gene kynU 1915834 1914569 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_14880 1916562 1915849 gene locus_tag LOCUS_14890 1916562 1915849 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_14890 1918360 1916741 gene locus_tag LOCUS_14900 1918360 1916741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1918466 1919104 gene locus_tag LOCUS_14910 1918466 1919104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1919111 1921585 gene locus_tag LOCUS_14920 1919111 1921585 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_14920 1922033 1923208 gene locus_tag LOCUS_14930 1922033 1923208 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_14930 1923320 1925113 gene locus_tag LOCUS_14940 1923320 1925113 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_14940 1925869 1925126 gene locus_tag LOCUS_14950 1925869 1925126 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_14950 1927284 1925878 gene locus_tag LOCUS_14960 1927284 1925878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1927584 1927354 gene locus_tag LOCUS_14970 1927584 1927354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1927471 1930497 gene locus_tag LOCUS_14980 1927471 1930497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1930508 1931533 gene locus_tag LOCUS_14990 1930508 1931533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14990 1931487 1932071 gene locus_tag LOCUS_15000 1931487 1932071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15000 1933677 1932088 gene locus_tag LOCUS_15010 1933677 1932088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1934735 1933764 gene locus_tag LOCUS_15020 1934735 1933764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1936306 1934834 gene locus_tag LOCUS_15030 1936306 1934834 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250770.1 protein_id gnl|my_center|LOCUS_15030 1936361 1937098 gene locus_tag LOCUS_15040 1936361 1937098 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902763.1 protein_id gnl|my_center|LOCUS_15040 1937102 1937776 gene locus_tag LOCUS_15050 1937102 1937776 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461004.1 protein_id gnl|my_center|LOCUS_15050 1937773 1939041 gene locus_tag LOCUS_15060 1937773 1939041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1939099 1939854 gene locus_tag LOCUS_15070 1939099 1939854 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_15070 1940302 1939898 gene locus_tag LOCUS_15080 1940302 1939898 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_15080 1940774 1940304 gene locus_tag LOCUS_15090 gene greA 1940774 1940304 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840123.1 protein_id gnl|my_center|LOCUS_15090 1942051 1940948 gene locus_tag LOCUS_15100 1942051 1940948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1946154 1942051 gene locus_tag LOCUS_15110 1946154 1942051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1949972 1946163 gene locus_tag LOCUS_15120 1949972 1946163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1951091 1950150 gene locus_tag LOCUS_15130 1951091 1950150 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_15130 1951929 1951123 gene locus_tag LOCUS_15140 gene rsmA 1951929 1951123 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_15140 1952004 1953449 gene locus_tag LOCUS_15150 1952004 1953449 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932852.1 protein_id gnl|my_center|LOCUS_15150 1953446 1954501 gene locus_tag LOCUS_15160 gene pdxA 1953446 1954501 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_15160 1955989 1954523 gene locus_tag LOCUS_15170 1955989 1954523 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_15170 1957450 1956017 gene locus_tag LOCUS_15180 1957450 1956017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1957573 1959048 gene locus_tag LOCUS_15190 gene proS 1957573 1959048 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_15190 1960885 1959098 gene locus_tag LOCUS_15200 1960885 1959098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1961554 1960964 gene locus_tag LOCUS_15210 1961554 1960964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1963890 1961593 gene locus_tag LOCUS_15220 1963890 1961593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1965879 1963909 gene locus_tag LOCUS_15230 1965879 1963909 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_15230 1966861 1965929 gene locus_tag LOCUS_15240 1966861 1965929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1969202 1966956 gene locus_tag LOCUS_15250 1969202 1966956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1969749 1970318 gene locus_tag LOCUS_15260 1969749 1970318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1970315 1971217 gene locus_tag LOCUS_15270 1970315 1971217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1971300 1972625 gene locus_tag LOCUS_15280 1971300 1972625 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_15280 1973504 1972665 gene locus_tag LOCUS_15290 1973504 1972665 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_15290 1975136 1973736 gene locus_tag LOCUS_15300 1975136 1973736 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404928.1 protein_id gnl|my_center|LOCUS_15300 1975249 1975911 gene locus_tag LOCUS_15310 1975249 1975911 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_15310 1975934 1977163 gene locus_tag LOCUS_15320 1975934 1977163 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166151256.1 protein_id gnl|my_center|LOCUS_15320 1977176 1978135 gene locus_tag LOCUS_15330 1977176 1978135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1978696 1978136 gene locus_tag LOCUS_15340 1978696 1978136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1979679 1978693 gene locus_tag LOCUS_15350 1979679 1978693 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_15350 1979858 1979784 gene locus_tag LOCUS_t00300 1979858 1979784 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1980230 1980535 gene locus_tag LOCUS_15360 1980230 1980535 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583889.1 protein_id gnl|my_center|LOCUS_15360 1981724 1980567 gene locus_tag LOCUS_15370 1981724 1980567 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972086.1 protein_id gnl|my_center|LOCUS_15370 1983174 1981768 gene locus_tag LOCUS_15380 1983174 1981768 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_15380 1984605 1983238 gene locus_tag LOCUS_15390 1984605 1983238 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_15390 1985953 1984598 gene locus_tag LOCUS_15400 gene eat 1985953 1984598 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551092.1 protein_id gnl|my_center|LOCUS_15400 1986140 1986514 gene locus_tag LOCUS_15410 1986140 1986514 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158859187.1 protein_id gnl|my_center|LOCUS_15410 1987467 1986520 gene locus_tag LOCUS_15420 1987467 1986520 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_15420 1988474 1987464 gene locus_tag LOCUS_15430 1988474 1987464 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130541252.1 protein_id gnl|my_center|LOCUS_15430 1989281 1988550 gene locus_tag LOCUS_15440 1989281 1988550 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_15440 1989314 1991038 gene locus_tag LOCUS_15450 1989314 1991038 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_15450 1991044 1991814 gene locus_tag LOCUS_15460 gene xth 1991044 1991814 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_15460 1991874 1992623 gene locus_tag LOCUS_15470 gene gpmA 1991874 1992623 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_15470 1992627 1993310 gene locus_tag LOCUS_15480 1992627 1993310 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_15480 1994195 1993332 gene locus_tag LOCUS_15490 1994195 1993332 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_15490 1994631 1995191 gene locus_tag LOCUS_15500 1994631 1995191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1995678 1995199 gene locus_tag LOCUS_15510 1995678 1995199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1996138 1995707 gene locus_tag LOCUS_15520 1996138 1995707 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_15520 1996829 1996143 gene locus_tag LOCUS_15530 1996829 1996143 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760381.1 protein_id gnl|my_center|LOCUS_15530 1998616 1996835 gene locus_tag LOCUS_15540 1998616 1996835 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_15540 2000039 1998735 gene locus_tag LOCUS_15550 gene murA 2000039 1998735 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_15550 2000716 2000039 gene locus_tag LOCUS_15560 2000716 2000039 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_15560 2001117 2002433 gene locus_tag LOCUS_15570 2001117 2002433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2002456 2003523 gene locus_tag LOCUS_15580 2002456 2003523 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_15580 2003551 2004429 gene locus_tag LOCUS_15590 gene pstC 2003551 2004429 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_15590 2004422 2005279 gene locus_tag LOCUS_15600 gene pstA 2004422 2005279 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_15600 2005315 2006121 gene locus_tag LOCUS_15610 gene pstB 2005315 2006121 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061132.1 protein_id gnl|my_center|LOCUS_15610 2006237 2006893 gene locus_tag LOCUS_15620 gene phoU 2006237 2006893 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788573.1 protein_id gnl|my_center|LOCUS_15620 2007197 2008081 gene locus_tag LOCUS_15630 2007197 2008081 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224928.1 protein_id gnl|my_center|LOCUS_15630 2008242 2009009 gene locus_tag LOCUS_15640 gene ygiD 2008242 2009009 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184346.1 protein_id gnl|my_center|LOCUS_15640 2009051 2009761 gene locus_tag LOCUS_15650 2009051 2009761 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_15650 2010818 2009844 gene locus_tag LOCUS_15660 2010818 2009844 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_15660 2010867 2011742 gene locus_tag LOCUS_15670 2010867 2011742 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_15670 2012494 2011763 gene locus_tag LOCUS_15680 2012494 2011763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 2012804 2012517 gene locus_tag LOCUS_15690 2012804 2012517 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_15690 2014965 2012857 gene locus_tag LOCUS_15700 gene ligA 2014965 2012857 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880378.1 protein_id gnl|my_center|LOCUS_15700 2015202 2014969 gene locus_tag LOCUS_15710 2015202 2014969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2016300 2015254 gene locus_tag LOCUS_15720 2016300 2015254 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_15720 2016429 2017319 gene locus_tag LOCUS_15730 2016429 2017319 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937646.1 protein_id gnl|my_center|LOCUS_15730 2017334 2018224 gene locus_tag LOCUS_15740 2017334 2018224 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_15740 2018221 2018883 gene locus_tag LOCUS_15750 2018221 2018883 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877398.1 protein_id gnl|my_center|LOCUS_15750 2018880 2019530 gene locus_tag LOCUS_15760 2018880 2019530 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 protein_id gnl|my_center|LOCUS_15760 2021923 2019503 gene locus_tag LOCUS_15770 2021923 2019503 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_15770 2022089 2024329 gene locus_tag LOCUS_15780 2022089 2024329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2025722 2024337 gene locus_tag LOCUS_15790 gene rlmD 2025722 2024337 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107369.1 protein_id gnl|my_center|LOCUS_15790 2025855 2026196 gene locus_tag LOCUS_15800 2025855 2026196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2026186 2026599 gene locus_tag LOCUS_15810 2026186 2026599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2028286 2026616 gene locus_tag LOCUS_15820 2028286 2026616 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_15820 2028437 2028763 gene locus_tag LOCUS_15830 2028437 2028763 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_15830 2030136 2028760 gene locus_tag LOCUS_15840 2030136 2028760 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433135.1 protein_id gnl|my_center|LOCUS_15840 2031450 2030158 gene locus_tag LOCUS_15850 2031450 2030158 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_15850 2036250 2031598 gene locus_tag LOCUS_15860 2036250 2031598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2036810 2037187 gene locus_tag LOCUS_15870 2036810 2037187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 2037734 2038543 gene locus_tag LOCUS_15880 2037734 2038543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2038886 2038810 gene locus_tag LOCUS_t00310 2038886 2038810 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2039131 2038916 gene locus_tag LOCUS_15890 2039131 2038916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 2040715 2039174 gene locus_tag LOCUS_15900 gene gltX 2040715 2039174 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_15900 2040758 2041372 gene locus_tag LOCUS_15910 2040758 2041372 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_15910 2043080 2041377 gene locus_tag LOCUS_15920 2043080 2041377 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_15920 2043177 2043947 gene locus_tag LOCUS_15930 2043177 2043947 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567380.1 protein_id gnl|my_center|LOCUS_15930 2045115 2044057 gene locus_tag LOCUS_15940 2045115 2044057 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964012.1 protein_id gnl|my_center|LOCUS_15940 2045476 2045129 gene locus_tag LOCUS_15950 2045476 2045129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 2046263 2045487 gene locus_tag LOCUS_15960 2046263 2045487 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266913.1 protein_id gnl|my_center|LOCUS_15960 2047402 2046251 gene locus_tag LOCUS_15970 2047402 2046251 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_15970 2048154 2047468 gene locus_tag LOCUS_15980 2048154 2047468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 2048811 2048329 gene locus_tag LOCUS_15990 gene bcp 2048811 2048329 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_15990 2050514 2048874 gene locus_tag LOCUS_16000 2050514 2048874 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_16000 2051364 2050651 gene locus_tag LOCUS_16010 2051364 2050651 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_16010 2052862 2051372 gene locus_tag LOCUS_16020 2052862 2051372 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_16020 2054090 2052945 gene locus_tag LOCUS_16030 gene hflX 2054090 2052945 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964502.1 protein_id gnl|my_center|LOCUS_16030 2054403 2054230 gene locus_tag LOCUS_16040 2054403 2054230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2055011 2057308 gene locus_tag LOCUS_16050 2055011 2057308 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_16050 2057627 2057788 gene locus_tag LOCUS_16060 2057627 2057788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16060 2058012 2058467 gene locus_tag LOCUS_16070 2058012 2058467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16070 2059543 2058695 gene locus_tag LOCUS_16080 2059543 2058695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16080 2060246 2059776 gene locus_tag LOCUS_16090 2060246 2059776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16090 2060870 2060298 gene locus_tag LOCUS_16100 2060870 2060298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2062221 2061490 gene locus_tag LOCUS_16110 2062221 2061490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 2062754 2062389 gene locus_tag LOCUS_16120 2062754 2062389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 2063439 2062882 gene locus_tag LOCUS_16130 2063439 2062882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 2064367 2063531 gene locus_tag LOCUS_16140 2064367 2063531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 2064968 2064780 gene locus_tag LOCUS_16150 2064968 2064780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2065676 2065113 gene locus_tag LOCUS_16160 2065676 2065113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2069889 2065657 gene locus_tag LOCUS_16170 2069889 2065657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2071774 2070245 gene locus_tag LOCUS_16180 2071774 2070245 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202573.1 protein_id gnl|my_center|LOCUS_16180 2072241 2071936 gene locus_tag LOCUS_16190 2072241 2071936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2072454 2072245 gene locus_tag LOCUS_16200 2072454 2072245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 2072857 2072513 gene locus_tag LOCUS_16210 2072857 2072513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2073507 2073193 gene locus_tag LOCUS_16220 2073507 2073193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2073741 2073547 gene locus_tag LOCUS_16230 2073741 2073547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2074452 2073865 gene locus_tag LOCUS_16240 2074452 2073865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2075740 2074610 gene locus_tag LOCUS_16250 2075740 2074610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2076525 2075920 gene locus_tag LOCUS_16260 2076525 2075920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2076746 2076522 gene locus_tag LOCUS_16270 2076746 2076522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence02 928 542 gene locus_tag LOCUS_16280 928 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1310 1056 gene locus_tag LOCUS_16290 1310 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1787 7249 gene locus_tag LOCUS_16300 1787 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 7300 8331 gene locus_tag LOCUS_16310 7300 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 8367 10415 gene locus_tag LOCUS_16320 8367 10415 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_16320 11646 10870 gene locus_tag LOCUS_16330 11646 10870 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_16330 13487 12141 gene locus_tag LOCUS_16340 13487 12141 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_16340 13632 14537 gene locus_tag LOCUS_16350 13632 14537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 14571 14969 gene locus_tag LOCUS_16360 14571 14969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 14992 16302 gene locus_tag LOCUS_16370 14992 16302 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_16370 16319 17236 gene locus_tag LOCUS_16380 16319 17236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 17312 18163 gene locus_tag LOCUS_16390 17312 18163 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 protein_id gnl|my_center|LOCUS_16390 18209 18910 gene locus_tag LOCUS_16400 18209 18910 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_16400 19562 18999 gene locus_tag LOCUS_16410 19562 18999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964330.1 protein_id gnl|my_center|LOCUS_16410 21000 19708 gene locus_tag LOCUS_16420 gene thrC 21000 19708 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_16420 21937 21008 gene locus_tag LOCUS_16430 21937 21008 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_16430 24384 21940 gene locus_tag LOCUS_16440 gene thrA 24384 21940 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_16440 24616 26058 gene locus_tag LOCUS_16450 24616 26058 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986882.1 protein_id gnl|my_center|LOCUS_16450 36686 26118 gene locus_tag LOCUS_16460 36686 26118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 39406 36683 gene locus_tag LOCUS_16470 39406 36683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 44239 39827 gene locus_tag LOCUS_16480 44239 39827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 46225 44390 gene locus_tag LOCUS_16490 46225 44390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 47172 46387 gene locus_tag LOCUS_16500 47172 46387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 49253 47247 gene locus_tag LOCUS_16510 49253 47247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 49724 56506 gene locus_tag LOCUS_16520 49724 56506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 57833 56514 gene locus_tag LOCUS_16530 57833 56514 CDS product 7-dehydrocholesterol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958044.1 protein_id gnl|my_center|LOCUS_16530 60118 57947 gene locus_tag LOCUS_16540 60118 57947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 63670 60245 gene locus_tag LOCUS_16550 63670 60245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 69684 63787 gene locus_tag LOCUS_16560 69684 63787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 70187 69684 gene locus_tag LOCUS_16570 70187 69684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 70559 72163 gene locus_tag LOCUS_16580 70559 72163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 72487 72176 gene locus_tag LOCUS_16590 72487 72176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 73875 72592 gene locus_tag LOCUS_16600 gene eno 73875 72592 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931839.1 protein_id gnl|my_center|LOCUS_16600 75053 73920 gene locus_tag LOCUS_16610 gene carA 75053 73920 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_16610 75718 75179 gene locus_tag LOCUS_16620 gene rplQ 75718 75179 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963444.1 protein_id gnl|my_center|LOCUS_16620 76768 75770 gene locus_tag LOCUS_16630 76768 75770 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_16630 77407 76802 gene locus_tag LOCUS_16640 gene rpsD 77407 76802 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_16640 77807 77430 gene locus_tag LOCUS_16650 gene rpsK 77807 77430 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_16650 78233 77850 gene locus_tag LOCUS_16660 gene rpsM 78233 77850 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_16660 78627 78409 gene locus_tag LOCUS_16670 gene infA 78627 78409 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_16670 79452 78628 gene locus_tag LOCUS_16680 gene map 79452 78628 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_16680 80794 79454 gene locus_tag LOCUS_16690 gene secY 80794 79454 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_16690 81252 80791 gene locus_tag LOCUS_16700 gene rplO 81252 80791 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_16700 81436 81257 gene locus_tag LOCUS_16710 gene rpmD 81436 81257 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085234.1 protein_id gnl|my_center|LOCUS_16710 81959 81441 gene locus_tag LOCUS_16720 gene rpsE 81959 81441 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963453.1 protein_id gnl|my_center|LOCUS_16720 82348 81995 gene locus_tag LOCUS_16730 gene rplR 82348 81995 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_16730 82925 82362 gene locus_tag LOCUS_16740 gene rplF 82925 82362 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963455.1 protein_id gnl|my_center|LOCUS_16740 83334 82939 gene locus_tag LOCUS_16750 gene rpsH 83334 82939 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_16750 83624 83355 gene locus_tag LOCUS_16760 gene rpsN 83624 83355 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_16760 84189 83641 gene locus_tag LOCUS_16770 gene rplE 84189 83641 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_16770 84530 84186 gene locus_tag LOCUS_16780 gene rplX 84530 84186 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_16780 84920 84552 gene locus_tag LOCUS_16790 gene rplN 84920 84552 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_16790 85182 84922 gene locus_tag LOCUS_16800 gene rpsQ 85182 84922 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_16800 85408 85184 gene locus_tag LOCUS_16810 gene rpmC 85408 85184 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 protein_id gnl|my_center|LOCUS_16810 85795 85424 gene locus_tag LOCUS_16820 gene rplP 85795 85424 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_16820 86578 85847 gene locus_tag LOCUS_16830 gene rpsC 86578 85847 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_16830 87191 86583 gene locus_tag LOCUS_16840 87191 86583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 87469 87194 gene locus_tag LOCUS_16850 gene rpsS 87469 87194 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_16850 88293 87469 gene locus_tag LOCUS_16860 gene rplB 88293 87469 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963466.1 protein_id gnl|my_center|LOCUS_16860 88593 88303 gene locus_tag LOCUS_16870 gene rplW 88593 88303 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963467.1 protein_id gnl|my_center|LOCUS_16870 89226 88597 gene locus_tag LOCUS_16880 gene rplD 89226 88597 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762035.1 protein_id gnl|my_center|LOCUS_16880 89843 89226 gene locus_tag LOCUS_16890 gene rplC 89843 89226 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_16890 90154 89846 gene locus_tag LOCUS_16900 gene rpsJ 90154 89846 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_16900 91491 90463 gene locus_tag LOCUS_16910 91491 90463 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116578.1 protein_id gnl|my_center|LOCUS_16910 92312 91461 gene locus_tag LOCUS_16920 92312 91461 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116577.1 protein_id gnl|my_center|LOCUS_16920 94143 92323 gene locus_tag LOCUS_16930 94143 92323 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_16930 96576 94468 gene locus_tag LOCUS_16940 gene fusA 96576 94468 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762033.1 protein_id gnl|my_center|LOCUS_16940 97060 96590 gene locus_tag LOCUS_16950 gene rpsG 97060 96590 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_16950 97438 97064 gene locus_tag LOCUS_16960 gene rpsL 97438 97064 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_16960 97599 98885 gene locus_tag LOCUS_16970 97599 98885 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_16970 99012 99752 gene locus_tag LOCUS_16980 99012 99752 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099200.1 protein_id gnl|my_center|LOCUS_16980 99736 99990 gene locus_tag LOCUS_16990 gene purS 99736 99990 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140445.1 protein_id gnl|my_center|LOCUS_16990 100002 100670 gene locus_tag LOCUS_17000 gene rsmI 100002 100670 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_17000 100687 101490 gene locus_tag LOCUS_17010 100687 101490 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_17010 105837 101509 gene locus_tag LOCUS_17020 gene rpoC 105837 101509 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_17020 109699 105878 gene locus_tag LOCUS_17030 gene rpoB 109699 105878 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963312.1 protein_id gnl|my_center|LOCUS_17030 110262 109876 gene locus_tag LOCUS_17040 gene rplL 110262 109876 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_17040 110821 110291 gene locus_tag LOCUS_17050 gene rplJ 110821 110291 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963314.1 protein_id gnl|my_center|LOCUS_17050 111558 110833 gene locus_tag LOCUS_17060 gene rplA 111558 110833 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782161.1 protein_id gnl|my_center|LOCUS_17060 111989 111540 gene locus_tag LOCUS_17070 gene rplK 111989 111540 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963316.1 protein_id gnl|my_center|LOCUS_17070 112565 111993 gene locus_tag LOCUS_17080 gene nusG 112565 111993 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_17080 112768 112571 gene locus_tag LOCUS_17090 112768 112571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 112857 112784 gene locus_tag LOCUS_t00320 112857 112784 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 114055 112868 gene locus_tag LOCUS_17100 gene tuf 114055 112868 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782155.1 protein_id gnl|my_center|LOCUS_17100 114202 114130 gene locus_tag LOCUS_t00330 114202 114130 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 114405 114333 gene locus_tag LOCUS_t00340 114405 114333 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 114668 114584 gene locus_tag LOCUS_t00350 114668 114584 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 114775 114701 gene locus_tag LOCUS_t00360 114775 114701 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 115186 114875 gene locus_tag LOCUS_17110 gene raiA 115186 114875 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_17110 116061 115186 gene locus_tag LOCUS_17120 gene xerC 116061 115186 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_17120 116312 116112 gene locus_tag LOCUS_17130 116312 116112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 117624 116479 gene locus_tag LOCUS_17140 gene acdA 117624 116479 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_17140 118195 117641 gene locus_tag LOCUS_17150 118195 117641 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_17150 119227 118253 gene locus_tag LOCUS_17160 119227 118253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 119594 119788 gene locus_tag LOCUS_17170 119594 119788 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_17170 120070 121305 gene locus_tag LOCUS_17180 120070 121305 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_17180 121521 122126 gene locus_tag LOCUS_17190 121521 122126 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_17190 122137 122388 gene locus_tag LOCUS_17200 122137 122388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 122458 122904 gene locus_tag LOCUS_17210 122458 122904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 122901 123428 gene locus_tag LOCUS_17220 122901 123428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_17220 123430 123975 gene locus_tag LOCUS_17230 123430 123975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 125371 124190 gene locus_tag LOCUS_17240 125371 124190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_17240 126793 125513 gene locus_tag LOCUS_17250 gene icd 126793 125513 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_17250 126932 127957 gene locus_tag LOCUS_17260 gene ruvB 126932 127957 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_17260 128559 127954 gene locus_tag LOCUS_17270 128559 127954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 128649 128912 gene locus_tag LOCUS_17280 128649 128912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 128916 129677 gene locus_tag LOCUS_17290 128916 129677 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_17290 130169 131767 gene locus_tag LOCUS_17300 130169 131767 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_17300 133784 131904 gene locus_tag LOCUS_17310 133784 131904 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795080.1 protein_id gnl|my_center|LOCUS_17310 134762 133938 gene locus_tag LOCUS_17320 134762 133938 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761225.1 protein_id gnl|my_center|LOCUS_17320 135841 134774 gene locus_tag LOCUS_17330 gene lpxK 135841 134774 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_17330 135961 137055 gene locus_tag LOCUS_17340 135961 137055 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_17340 137059 137814 gene locus_tag LOCUS_17350 137059 137814 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_17350 137864 139348 gene locus_tag LOCUS_17360 137864 139348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 139450 140466 gene locus_tag LOCUS_17370 gene murB 139450 140466 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_17370 140519 141100 gene locus_tag LOCUS_17380 140519 141100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 141117 141998 gene locus_tag LOCUS_17390 141117 141998 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_17390 142552 141968 gene locus_tag LOCUS_17400 142552 141968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 143951 142515 gene locus_tag LOCUS_17410 143951 142515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17410 144072 145418 gene locus_tag LOCUS_17420 144072 145418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 145424 146485 gene locus_tag LOCUS_17430 gene vmeC 145424 146485 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455175.1 protein_id gnl|my_center|LOCUS_17430 146495 149587 gene locus_tag LOCUS_17440 146495 149587 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_17440 149740 150258 gene locus_tag LOCUS_17450 149740 150258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 151842 150301 gene locus_tag LOCUS_17460 151842 150301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 153139 151835 gene locus_tag LOCUS_17470 gene ftsA 153139 151835 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_17470 154415 153129 gene locus_tag LOCUS_17480 gene ftsA 154415 153129 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_17480 155193 154408 gene locus_tag LOCUS_17490 155193 154408 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784001.1 protein_id gnl|my_center|LOCUS_17490 156565 155204 gene locus_tag LOCUS_17500 gene murC 156565 155204 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_17500 157665 156562 gene locus_tag LOCUS_17510 gene murG 157665 156562 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_17510 158818 157652 gene locus_tag LOCUS_17520 158818 157652 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_17520 160169 158832 gene locus_tag LOCUS_17530 gene murD 160169 158832 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_17530 161425 160178 gene locus_tag LOCUS_17540 gene mraY 161425 160178 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_17540 162891 161425 gene locus_tag LOCUS_17550 162891 161425 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_17550 164984 162888 gene locus_tag LOCUS_17560 164984 162888 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_17560 165318 164974 gene locus_tag LOCUS_17570 165318 164974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 166284 165331 gene locus_tag LOCUS_17580 gene rsmH 166284 165331 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_17580 166738 166271 gene locus_tag LOCUS_17590 gene mraZ 166738 166271 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964164.1 protein_id gnl|my_center|LOCUS_17590 168294 166987 gene locus_tag LOCUS_17600 168294 166987 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_17600 169571 168291 gene locus_tag LOCUS_17610 169571 168291 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964006.1 protein_id gnl|my_center|LOCUS_17610 169946 169605 gene locus_tag LOCUS_17620 169946 169605 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695903.1 protein_id gnl|my_center|LOCUS_17620 170461 169976 gene locus_tag LOCUS_17630 170461 169976 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_17630 171060 170530 gene locus_tag LOCUS_17640 171060 170530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 171733 172788 gene locus_tag LOCUS_17650 gene dusB 171733 172788 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_17650 172825 173499 gene locus_tag LOCUS_17660 172825 173499 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_17660 173631 174074 gene locus_tag LOCUS_17670 gene rplM 173631 174074 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_17670 174076 174459 gene locus_tag LOCUS_17680 gene rpsI 174076 174459 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287505.1 protein_id gnl|my_center|LOCUS_17680 174482 175402 gene locus_tag LOCUS_17690 gene rpsB 174482 175402 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_17690 175508 176350 gene locus_tag LOCUS_17700 gene tsf 175508 176350 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_17700 176431 177138 gene locus_tag LOCUS_17710 gene pyrH 176431 177138 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_17710 177228 177791 gene locus_tag LOCUS_17720 gene frr 177228 177791 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_17720 179123 177816 gene locus_tag LOCUS_17730 179123 177816 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_17730 180550 179123 gene locus_tag LOCUS_17740 180550 179123 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_17740 180628 181122 gene locus_tag LOCUS_17750 180628 181122 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962451.1 protein_id gnl|my_center|LOCUS_17750 181220 181831 gene locus_tag LOCUS_17760 181220 181831 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_17760 181974 182756 gene locus_tag LOCUS_17770 181974 182756 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_17770 182910 183473 gene locus_tag LOCUS_17780 gene msrA 182910 183473 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434146.1 protein_id gnl|my_center|LOCUS_17780 183581 183670 gene locus_tag LOCUS_t00370 183581 183670 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 183793 184860 gene locus_tag LOCUS_17790 183793 184860 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246499.1 protein_id gnl|my_center|LOCUS_17790 184873 185094 gene locus_tag LOCUS_17800 184873 185094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 185342 185100 gene locus_tag LOCUS_17810 185342 185100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 186137 185397 gene locus_tag LOCUS_17820 186137 185397 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_17820 188162 186150 gene locus_tag LOCUS_17830 188162 186150 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_17830 188872 188159 gene locus_tag LOCUS_17840 188872 188159 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_17840 189610 189029 gene locus_tag LOCUS_17850 189610 189029 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_17850 189701 190972 gene locus_tag LOCUS_17860 189701 190972 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_17860 191960 191028 gene locus_tag LOCUS_17870 191960 191028 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_17870 194020 192086 gene locus_tag LOCUS_17880 194020 192086 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_17880 194136 195038 gene locus_tag LOCUS_17890 194136 195038 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479748.1 protein_id gnl|my_center|LOCUS_17890 196517 195072 gene locus_tag LOCUS_17900 196517 195072 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_17900 197577 196594 gene locus_tag LOCUS_17910 197577 196594 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_17910 198493 197645 gene locus_tag LOCUS_17920 198493 197645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 198879 198523 gene locus_tag LOCUS_17930 198879 198523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 199141 198890 gene locus_tag LOCUS_17940 199141 198890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 200093 199134 gene locus_tag LOCUS_17950 200093 199134 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256215.1 protein_id gnl|my_center|LOCUS_17950 200677 200282 gene locus_tag LOCUS_17960 200677 200282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 200800 201468 gene locus_tag LOCUS_17970 200800 201468 CDS product phosphatase PAP2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947360.1 protein_id gnl|my_center|LOCUS_17970 202179 201472 gene locus_tag LOCUS_17980 202179 201472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 203353 202262 gene locus_tag LOCUS_17990 203353 202262 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 protein_id gnl|my_center|LOCUS_17990 203469 206171 gene locus_tag LOCUS_18000 203469 206171 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_18000 206225 207403 gene locus_tag LOCUS_18010 206225 207403 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_18010 207400 208161 gene locus_tag LOCUS_18020 gene tpiA 207400 208161 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_18020 208172 209002 gene locus_tag LOCUS_18030 gene prmA 208172 209002 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766150.1 protein_id gnl|my_center|LOCUS_18030 208972 214044 gene locus_tag LOCUS_18040 208972 214044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 214219 214812 gene locus_tag LOCUS_18050 214219 214812 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_18050 214802 215965 gene locus_tag LOCUS_18060 214802 215965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 216053 216775 gene locus_tag LOCUS_18070 216053 216775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 216759 218414 gene locus_tag LOCUS_18080 216759 218414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 220727 218556 gene locus_tag LOCUS_18090 gene rnr 220727 218556 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 protein_id gnl|my_center|LOCUS_18090 222585 220780 gene locus_tag LOCUS_18100 222585 220780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920781.1 protein_id gnl|my_center|LOCUS_18100 222756 223538 gene locus_tag LOCUS_18110 222756 223538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 223535 223879 gene locus_tag LOCUS_18120 223535 223879 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_18120 223879 225129 gene locus_tag LOCUS_18130 gene coaBC 223879 225129 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_18130 225245 226090 gene locus_tag LOCUS_18140 225245 226090 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_18140 226178 227836 gene locus_tag LOCUS_18150 gene recN 226178 227836 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_18150 227851 228663 gene locus_tag LOCUS_18160 227851 228663 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_18160 231213 228667 gene locus_tag LOCUS_18170 231213 228667 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_18170 231447 231818 gene locus_tag LOCUS_18180 231447 231818 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_18180 231818 232753 gene locus_tag LOCUS_18190 231818 232753 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963815.1 protein_id gnl|my_center|LOCUS_18190 232867 233976 gene locus_tag LOCUS_18200 232867 233976 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_18200 236063 234063 gene locus_tag LOCUS_18210 236063 234063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 236191 237279 gene locus_tag LOCUS_18220 236191 237279 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_18220 237322 238803 gene locus_tag LOCUS_18230 237322 238803 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_18230 238796 241255 gene locus_tag LOCUS_18240 238796 241255 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_18240 241345 242097 gene locus_tag LOCUS_18250 241345 242097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 244110 242416 gene locus_tag LOCUS_18260 gene hutU 244110 242416 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 protein_id gnl|my_center|LOCUS_18260 244736 244122 gene locus_tag LOCUS_18270 244736 244122 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_18270 245484 244744 gene locus_tag LOCUS_18280 245484 244744 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259682.1 protein_id gnl|my_center|LOCUS_18280 245610 246344 gene locus_tag LOCUS_18290 245610 246344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 246385 248361 gene locus_tag LOCUS_18300 246385 248361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 248371 248982 gene locus_tag LOCUS_18310 248371 248982 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_18310 249305 248961 gene locus_tag LOCUS_18320 249305 248961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 254497 249308 gene locus_tag LOCUS_18330 254497 249308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 255553 254501 gene locus_tag LOCUS_18340 255553 254501 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_18340 256299 255616 gene locus_tag LOCUS_18350 256299 255616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 256372 257649 gene locus_tag LOCUS_18360 gene tyrS 256372 257649 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_18360 258855 257662 gene locus_tag LOCUS_18370 258855 257662 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_18370 259932 258892 gene locus_tag LOCUS_18380 gene gap 259932 258892 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_18380 259968 260040 gene locus_tag LOCUS_t00380 259968 260040 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 260193 260390 gene locus_tag LOCUS_18390 260193 260390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 261350 260433 gene locus_tag LOCUS_18400 261350 260433 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_18400 262064 261396 gene locus_tag LOCUS_18410 262064 261396 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_18410 263891 262071 gene locus_tag LOCUS_18420 gene mutL 263891 262071 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_18420 264219 263929 gene locus_tag LOCUS_18430 264219 263929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 265441 264272 gene locus_tag LOCUS_18440 265441 264272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 267856 265490 gene locus_tag LOCUS_18450 267856 265490 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_18450 268636 267929 gene locus_tag LOCUS_18460 gene purQ 268636 267929 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403297.1 protein_id gnl|my_center|LOCUS_18460 269647 268661 gene locus_tag LOCUS_18470 269647 268661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 271208 269658 gene locus_tag LOCUS_18480 271208 269658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 272531 271224 gene locus_tag LOCUS_18490 272531 271224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 274057 272528 gene locus_tag LOCUS_18500 274057 272528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 275894 274080 gene locus_tag LOCUS_18510 275894 274080 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_18510 276037 276948 gene locus_tag LOCUS_18520 276037 276948 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_18520 278514 277276 gene locus_tag LOCUS_18530 278514 277276 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_18530 278928 278566 gene locus_tag LOCUS_18540 278928 278566 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_18540 279208 281250 gene locus_tag LOCUS_18550 279208 281250 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_18550 281275 281823 gene locus_tag LOCUS_18560 281275 281823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 282890 281826 gene locus_tag LOCUS_18570 282890 281826 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109381.1 protein_id gnl|my_center|LOCUS_18570 283148 283336 gene locus_tag LOCUS_18580 283148 283336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 283740 283474 gene locus_tag LOCUS_18590 283740 283474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 284078 283899 gene locus_tag LOCUS_18600 284078 283899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 285037 284102 gene locus_tag LOCUS_18610 285037 284102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022344.1 protein_id gnl|my_center|LOCUS_18610 285529 285047 gene locus_tag LOCUS_18620 285529 285047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 288864 285526 gene locus_tag LOCUS_18630 288864 285526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 289104 288883 gene locus_tag LOCUS_18640 289104 288883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 289470 289991 gene locus_tag LOCUS_18650 289470 289991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 290084 292108 gene locus_tag LOCUS_18660 290084 292108 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839782.1 protein_id gnl|my_center|LOCUS_18660 292127 293398 gene locus_tag LOCUS_18670 292127 293398 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_18670 293395 293958 gene locus_tag LOCUS_18680 293395 293958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 293958 294929 gene locus_tag LOCUS_18690 293958 294929 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_18690 295099 294911 gene locus_tag LOCUS_18700 295099 294911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 296219 295269 gene locus_tag LOCUS_18710 296219 295269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 297735 296212 gene locus_tag LOCUS_18720 297735 296212 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_18720 298463 297738 gene locus_tag LOCUS_18730 298463 297738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_18730 299397 298468 gene locus_tag LOCUS_18740 299397 298468 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_18740 301095 299494 gene locus_tag LOCUS_18750 301095 299494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 303863 301089 gene locus_tag LOCUS_18760 303863 301089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 305281 303944 gene locus_tag LOCUS_18770 305281 303944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 306830 305289 gene locus_tag LOCUS_18780 gene guaA 306830 305289 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_18780 307444 306893 gene locus_tag LOCUS_18790 307444 306893 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_18790 308169 307456 gene locus_tag LOCUS_18800 308169 307456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_18800 308462 308166 gene locus_tag LOCUS_18810 gene gatC 308462 308166 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_18810 308552 309547 gene locus_tag LOCUS_18820 gene trpS 308552 309547 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706960.1 protein_id gnl|my_center|LOCUS_18820 309559 310218 gene locus_tag LOCUS_18830 309559 310218 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_18830 310526 316141 gene locus_tag LOCUS_18840 310526 316141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 318472 316271 gene locus_tag LOCUS_18850 318472 316271 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_18850 321341 318579 gene locus_tag LOCUS_18860 321341 318579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 321520 321741 gene locus_tag LOCUS_18870 321520 321741 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_18870 322821 321772 gene locus_tag LOCUS_18880 gene queA 322821 321772 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_18880 322981 324276 gene locus_tag LOCUS_18890 322981 324276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_18890 325268 324273 gene locus_tag LOCUS_18900 gene rfaE1 325268 324273 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_18900 326480 325287 gene locus_tag LOCUS_18910 326480 325287 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_18910 326591 327835 gene locus_tag LOCUS_18920 326591 327835 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_18920 329620 327965 gene locus_tag LOCUS_18930 329620 327965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 333478 329846 gene locus_tag LOCUS_18940 333478 329846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 334161 333763 gene locus_tag LOCUS_18950 gene mscL 334161 333763 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008119.1 protein_id gnl|my_center|LOCUS_18950 334252 335889 gene locus_tag LOCUS_18960 334252 335889 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_18960 337003 335891 gene locus_tag LOCUS_18970 337003 335891 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703897.1 protein_id gnl|my_center|LOCUS_18970 337136 337885 gene locus_tag LOCUS_18980 337136 337885 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_18980 337935 339149 gene locus_tag LOCUS_18990 337935 339149 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_18990 339146 340381 gene locus_tag LOCUS_19000 339146 340381 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_19000 340412 341098 gene locus_tag LOCUS_19010 340412 341098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_19010 342439 341129 gene locus_tag LOCUS_19020 342439 341129 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_19020 342533 343042 gene locus_tag LOCUS_19030 342533 343042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_19030 343163 343330 gene locus_tag LOCUS_19040 343163 343330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 344753 343320 gene locus_tag LOCUS_19050 344753 343320 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_19050 345281 344832 gene locus_tag LOCUS_19060 gene msrB 345281 344832 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_19060 346536 345286 gene locus_tag LOCUS_19070 346536 345286 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693669.1 protein_id gnl|my_center|LOCUS_19070 346614 347468 gene locus_tag LOCUS_19080 346614 347468 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_19080 347648 348301 gene locus_tag LOCUS_19090 347648 348301 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_19090 348690 349637 gene locus_tag LOCUS_19100 348690 349637 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_19100 349730 350941 gene locus_tag LOCUS_19110 349730 350941 CDS product phosphatidylinositol-specific phospholipase C1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038314.1 protein_id gnl|my_center|LOCUS_19110 351080 351541 gene locus_tag LOCUS_19120 351080 351541 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_19120 351636 352853 gene locus_tag LOCUS_19130 351636 352853 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_19130 354037 352835 gene locus_tag LOCUS_19140 354037 352835 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_19140 354172 354539 gene locus_tag LOCUS_tm00010 354172 354539 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 354757 355767 gene locus_tag LOCUS_19150 354757 355767 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_19150 356233 356006 gene locus_tag LOCUS_19160 356233 356006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 360425 356424 gene locus_tag LOCUS_19170 360425 356424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 361213 360575 gene locus_tag LOCUS_19180 361213 360575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 361603 363843 gene locus_tag LOCUS_19190 gene ppsA 361603 363843 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_19190 364614 363862 gene locus_tag LOCUS_19200 364614 363862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 365171 364731 gene locus_tag LOCUS_19210 365171 364731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 365300 365704 gene locus_tag LOCUS_19220 365300 365704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 365911 366621 gene locus_tag LOCUS_19230 365911 366621 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_19230 366661 366891 gene locus_tag LOCUS_19240 366661 366891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 366993 367748 gene locus_tag LOCUS_19250 366993 367748 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_19250 367799 368197 gene locus_tag LOCUS_19260 367799 368197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 368792 368511 gene locus_tag LOCUS_19270 368792 368511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 368680 369207 gene locus_tag LOCUS_19280 368680 369207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 369211 371802 gene locus_tag LOCUS_19290 369211 371802 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942321.1 protein_id gnl|my_center|LOCUS_19290 371948 372346 gene locus_tag LOCUS_19300 371948 372346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 372339 372791 gene locus_tag LOCUS_19310 gene smpB 372339 372791 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_19310 372935 375208 gene locus_tag LOCUS_19320 372935 375208 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_19320 375243 375767 gene locus_tag LOCUS_19330 375243 375767 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986716.1 protein_id gnl|my_center|LOCUS_19330 376810 375770 gene locus_tag LOCUS_19340 376810 375770 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_19340 377371 376856 gene locus_tag LOCUS_19350 gene purE 377371 376856 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_19350 378498 377368 gene locus_tag LOCUS_19360 378498 377368 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_19360 378690 379115 gene locus_tag LOCUS_19370 378690 379115 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_19370 379308 380066 gene locus_tag LOCUS_19380 379308 380066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 380566 384252 gene locus_tag LOCUS_19390 380566 384252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 384294 385532 gene locus_tag LOCUS_19400 gene hutI 384294 385532 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_19400 387119 385590 gene locus_tag LOCUS_19410 387119 385590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 393632 387249 gene locus_tag LOCUS_19420 393632 387249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 395382 393685 gene locus_tag LOCUS_19430 395382 393685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 395494 395925 gene locus_tag LOCUS_19440 395494 395925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 396656 395913 gene locus_tag LOCUS_19450 396656 395913 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_19450 396709 397584 gene locus_tag LOCUS_19460 396709 397584 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_19460 397612 398403 gene locus_tag LOCUS_19470 397612 398403 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_19470 398528 399400 gene locus_tag LOCUS_19480 398528 399400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 399606 401204 gene locus_tag LOCUS_19490 399606 401204 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726853.1 protein_id gnl|my_center|LOCUS_19490 401276 401605 gene locus_tag LOCUS_19500 401276 401605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 401619 402899 gene locus_tag LOCUS_19510 401619 402899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19510 402841 403599 gene locus_tag LOCUS_19520 402841 403599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19520 403719 404543 gene locus_tag LOCUS_19530 403719 404543 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088784.1 protein_id gnl|my_center|LOCUS_19530 407190 404599 gene locus_tag LOCUS_19540 407190 404599 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_19540 407340 408158 gene locus_tag LOCUS_19550 407340 408158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038682.1 protein_id gnl|my_center|LOCUS_19550 408171 409019 gene locus_tag LOCUS_19560 408171 409019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 409023 409859 gene locus_tag LOCUS_19570 409023 409859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 409861 410631 gene locus_tag LOCUS_19580 409861 410631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 410628 412268 gene locus_tag LOCUS_19590 410628 412268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 412265 413164 gene locus_tag LOCUS_19600 412265 413164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 413222 414544 gene locus_tag LOCUS_19610 413222 414544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 415525 414539 gene locus_tag LOCUS_19620 415525 414539 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187699.1 protein_id gnl|my_center|LOCUS_19620 416462 415674 gene locus_tag LOCUS_19630 416462 415674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 417277 416459 gene locus_tag LOCUS_19640 417277 416459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 418094 417258 gene locus_tag LOCUS_19650 418094 417258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 418254 419387 gene locus_tag LOCUS_19660 418254 419387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 419398 420675 gene locus_tag LOCUS_19670 419398 420675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 420695 420967 gene locus_tag LOCUS_19680 420695 420967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 420964 422730 gene locus_tag LOCUS_19690 420964 422730 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312152.1 protein_id gnl|my_center|LOCUS_19690 423428 422736 gene locus_tag LOCUS_19700 423428 422736 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244408.1 protein_id gnl|my_center|LOCUS_19700 424731 423433 gene locus_tag LOCUS_19710 424731 423433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 424784 425509 gene locus_tag LOCUS_19720 424784 425509 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065795.1 protein_id gnl|my_center|LOCUS_19720 427174 425510 gene locus_tag LOCUS_19730 427174 425510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 427619 427176 gene locus_tag LOCUS_19740 427619 427176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 428116 427616 gene locus_tag LOCUS_19750 428116 427616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 429411 428113 gene locus_tag LOCUS_19760 429411 428113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 429891 429418 gene locus_tag LOCUS_19770 429891 429418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 430678 429896 gene locus_tag LOCUS_19780 430678 429896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 432558 430864 gene locus_tag LOCUS_19790 432558 430864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 432623 433327 gene locus_tag LOCUS_19800 432623 433327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 433435 434511 gene locus_tag LOCUS_19810 gene rfbG 433435 434511 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107729.1 protein_id gnl|my_center|LOCUS_19810 435832 434915 gene locus_tag LOCUS_19820 435832 434915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 441035 436236 gene locus_tag LOCUS_19830 441035 436236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 441099 442103 gene locus_tag LOCUS_19840 gene tsaD 441099 442103 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_19840 442117 443934 gene locus_tag LOCUS_19850 442117 443934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 444341 443946 gene locus_tag LOCUS_19860 444341 443946 CDS product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974224.1 protein_id gnl|my_center|LOCUS_19860 444369 445064 gene locus_tag LOCUS_19870 444369 445064 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 protein_id gnl|my_center|LOCUS_19870 445106 446086 gene locus_tag LOCUS_19880 445106 446086 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028525108.1 protein_id gnl|my_center|LOCUS_19880 446114 447316 gene locus_tag LOCUS_19890 gene eboE 446114 447316 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_19890 447313 448683 gene locus_tag LOCUS_19900 447313 448683 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_19900 449044 448685 gene locus_tag LOCUS_19910 449044 448685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 450034 449096 gene locus_tag LOCUS_19920 450034 449096 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028852.1 protein_id gnl|my_center|LOCUS_19920 450979 450065 gene locus_tag LOCUS_19930 450979 450065 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_19930 451924 451016 gene locus_tag LOCUS_19940 451924 451016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 452718 451975 gene locus_tag LOCUS_19950 452718 451975 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_19950 454222 452708 gene locus_tag LOCUS_19960 gene accC 454222 452708 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_19960 454353 454859 gene locus_tag LOCUS_19970 gene bfr 454353 454859 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561543.1 protein_id gnl|my_center|LOCUS_19970 455055 456545 gene locus_tag LOCUS_19980 455055 456545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 456947 456549 gene locus_tag LOCUS_19990 gene msrB 456947 456549 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404556.1 protein_id gnl|my_center|LOCUS_19990 457207 458130 gene locus_tag LOCUS_20000 gene ilvE 457207 458130 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_20000 459013 458108 gene locus_tag LOCUS_20010 459013 458108 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_20010 460260 459040 gene locus_tag LOCUS_20020 460260 459040 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_20020 461390 460257 gene locus_tag LOCUS_20030 gene rffA 461390 460257 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612080.1 protein_id gnl|my_center|LOCUS_20030 461612 463204 gene locus_tag LOCUS_20040 461612 463204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 463629 463237 gene locus_tag LOCUS_20050 463629 463237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 465167 463635 gene locus_tag LOCUS_20060 465167 463635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 466714 465164 gene locus_tag LOCUS_20070 466714 465164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 468374 466785 gene locus_tag LOCUS_20080 468374 466785 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_20080 469325 468507 gene locus_tag LOCUS_20090 469325 468507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 469503 470273 gene locus_tag LOCUS_20100 469503 470273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 470371 471750 gene locus_tag LOCUS_20110 470371 471750 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_20110 471779 473386 gene locus_tag LOCUS_20120 471779 473386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 473759 473968 gene locus_tag LOCUS_20130 473759 473968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 475807 473987 gene locus_tag LOCUS_20140 475807 473987 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557282.1 protein_id gnl|my_center|LOCUS_20140 476501 476061 gene locus_tag LOCUS_20150 476501 476061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 477194 476586 gene locus_tag LOCUS_20160 477194 476586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 477301 478281 gene locus_tag LOCUS_20170 477301 478281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 479927 478275 gene locus_tag LOCUS_20180 479927 478275 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202103.1 protein_id gnl|my_center|LOCUS_20180 480038 481246 gene locus_tag LOCUS_20190 gene sucC 480038 481246 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_20190 482582 481248 gene locus_tag LOCUS_20200 482582 481248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 482808 485093 gene locus_tag LOCUS_20210 482808 485093 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839622.1 protein_id gnl|my_center|LOCUS_20210 485161 488301 gene locus_tag LOCUS_20220 485161 488301 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108497.1 protein_id gnl|my_center|LOCUS_20220 488309 489973 gene locus_tag LOCUS_20230 488309 489973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 489970 491034 gene locus_tag LOCUS_20240 489970 491034 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815896.1 protein_id gnl|my_center|LOCUS_20240 492057 491041 gene locus_tag LOCUS_20250 492057 491041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 497537 492069 gene locus_tag LOCUS_20260 497537 492069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 499320 497854 gene locus_tag LOCUS_20270 499320 497854 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_20270 499428 501200 gene locus_tag LOCUS_20280 gene argS 499428 501200 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_20280 501207 502361 gene locus_tag LOCUS_20290 501207 502361 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_20290 502485 502892 gene locus_tag LOCUS_20300 502485 502892 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_20300 502939 503565 gene locus_tag LOCUS_20310 gene folE 502939 503565 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932463.1 protein_id gnl|my_center|LOCUS_20310 503575 504453 gene locus_tag LOCUS_20320 gene fabD 503575 504453 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_20320 505016 504444 gene locus_tag LOCUS_20330 505016 504444 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764211.1 protein_id gnl|my_center|LOCUS_20330 505443 505102 gene locus_tag LOCUS_20340 505443 505102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 506577 505516 gene locus_tag LOCUS_20350 506577 505516 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_20350 507808 506612 gene locus_tag LOCUS_20360 507808 506612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 507894 509849 gene locus_tag LOCUS_20370 507894 509849 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_20370 509921 510910 gene locus_tag LOCUS_20380 509921 510910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 512686 510893 gene locus_tag LOCUS_20390 512686 510893 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_20390 512875 514152 gene locus_tag LOCUS_20400 512875 514152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 515466 514171 gene locus_tag LOCUS_20410 515466 514171 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_20410 515557 516036 gene locus_tag LOCUS_20420 515557 516036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 516157 517863 gene locus_tag LOCUS_20430 516157 517863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 517856 518908 gene locus_tag LOCUS_20440 517856 518908 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109958.1 protein_id gnl|my_center|LOCUS_20440 519556 518921 gene locus_tag LOCUS_20450 519556 518921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 522614 519666 gene locus_tag LOCUS_20460 522614 519666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 522939 525047 gene locus_tag LOCUS_20470 522939 525047 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109032.1 protein_id gnl|my_center|LOCUS_20470 525081 526178 gene locus_tag LOCUS_20480 gene mtnA 525081 526178 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970692.1 protein_id gnl|my_center|LOCUS_20480 527404 526223 gene locus_tag LOCUS_20490 527404 526223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 528864 527401 gene locus_tag LOCUS_20500 gene gatB 528864 527401 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_20500 531513 528874 gene locus_tag LOCUS_20510 gene alaS 531513 528874 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_20510 531620 532594 gene locus_tag LOCUS_20520 531620 532594 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_20520 532587 532946 gene locus_tag LOCUS_20530 532587 532946 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_20530 534609 532972 gene locus_tag LOCUS_20540 534609 532972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 534882 535874 gene locus_tag LOCUS_20550 gene pfkA 534882 535874 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963726.1 protein_id gnl|my_center|LOCUS_20550 535890 537230 gene locus_tag LOCUS_20560 535890 537230 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_20560 537770 537243 gene locus_tag LOCUS_20570 537770 537243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 538421 537798 gene locus_tag LOCUS_20580 538421 537798 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962515.1 protein_id gnl|my_center|LOCUS_20580 539886 540989 gene locus_tag LOCUS_20590 539886 540989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 541104 545990 gene locus_tag LOCUS_20600 541104 545990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 545987 546919 gene locus_tag LOCUS_20610 gene cas1 545987 546919 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_20610 546932 547261 gene locus_tag LOCUS_20620 gene cas2 546932 547261 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_20620 547375 550512 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gatgtcaaagatcgttcactgaaagcaaatcacaac 550585 550857 gene locus_tag LOCUS_20630 550585 550857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 551004 551552 gene locus_tag LOCUS_20640 551004 551552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 551625 552179 gene locus_tag LOCUS_20650 551625 552179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 552352 560322 gene locus_tag LOCUS_20660 552352 560322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 560402 561304 gene locus_tag LOCUS_20670 560402 561304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964370.1 protein_id gnl|my_center|LOCUS_20670 561330 562472 gene locus_tag LOCUS_20680 561330 562472 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_20680 562489 562896 gene locus_tag LOCUS_20690 562489 562896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 562886 563905 gene locus_tag LOCUS_20700 562886 563905 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_20700 563946 565646 gene locus_tag LOCUS_20710 563946 565646 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039072.1 protein_id gnl|my_center|LOCUS_20710 565639 566520 gene locus_tag LOCUS_20720 565639 566520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 566501 567250 gene locus_tag LOCUS_20730 566501 567250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100836.1 protein_id gnl|my_center|LOCUS_20730 567237 568520 gene locus_tag LOCUS_20740 567237 568520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099434.1 protein_id gnl|my_center|LOCUS_20740 568531 568803 gene locus_tag LOCUS_20750 568531 568803 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_20750 568808 569998 gene locus_tag LOCUS_20760 568808 569998 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_20760 570001 571035 gene locus_tag LOCUS_20770 570001 571035 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_20770 572388 571021 gene locus_tag LOCUS_20780 572388 571021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 572499 573182 gene locus_tag LOCUS_20790 gene trmD 572499 573182 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_20790 573238 573510 gene locus_tag LOCUS_20800 gene rpsO 573238 573510 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761978.1 protein_id gnl|my_center|LOCUS_20800 573637 575781 gene locus_tag LOCUS_20810 gene pnp 573637 575781 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_20810 575956 576834 gene locus_tag LOCUS_20820 575956 576834 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_20820 576879 577550 gene locus_tag LOCUS_20830 gene rpe 576879 577550 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_20830 577563 580076 gene locus_tag LOCUS_20840 577563 580076 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_20840 580085 580723 gene locus_tag LOCUS_20850 gene tmk 580085 580723 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762936.1 protein_id gnl|my_center|LOCUS_20850 580812 581696 gene locus_tag LOCUS_20860 580812 581696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 589837 581888 gene locus_tag LOCUS_20870 589837 581888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 591608 589995 gene locus_tag LOCUS_20880 591608 589995 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_20880 592870 591605 gene locus_tag LOCUS_20890 592870 591605 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_20890 593631 592876 gene locus_tag LOCUS_20900 593631 592876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 593753 594886 gene locus_tag LOCUS_20910 593753 594886 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_20910 594912 596228 gene locus_tag LOCUS_20920 594912 596228 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_20920 596231 597214 gene locus_tag LOCUS_20930 596231 597214 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_20930 597224 598513 gene locus_tag LOCUS_20940 597224 598513 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_20940 598520 599584 gene locus_tag LOCUS_20950 gene rfbB 598520 599584 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_20950 599643 600638 gene locus_tag LOCUS_20960 599643 600638 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_20960 600648 601208 gene locus_tag LOCUS_20970 gene rfbC 600648 601208 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_20970 601209 602075 gene locus_tag LOCUS_20980 gene rfbD 601209 602075 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_20980 602068 602847 gene locus_tag LOCUS_20990 gene cysQ 602068 602847 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786528.1 protein_id gnl|my_center|LOCUS_20990 602946 606053 gene locus_tag LOCUS_21000 gene secDF 602946 606053 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_21000 606784 606110 gene locus_tag LOCUS_21010 gene fsa 606784 606110 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107927.1 protein_id gnl|my_center|LOCUS_21010 608350 607049 gene locus_tag LOCUS_21020 608350 607049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 608930 610627 gene locus_tag LOCUS_21030 608930 610627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 610719 611354 gene locus_tag LOCUS_21040 610719 611354 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_21040 611541 613973 gene locus_tag LOCUS_21050 611541 613973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 616094 613977 gene locus_tag LOCUS_21060 616094 613977 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_21060 617475 616141 gene locus_tag LOCUS_21070 617475 616141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 619979 617712 gene locus_tag LOCUS_21080 619979 617712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 621916 620288 gene locus_tag LOCUS_21090 621916 620288 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_21090 622136 622630 gene locus_tag LOCUS_21100 622136 622630 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767597.1 protein_id gnl|my_center|LOCUS_21100 623142 622618 gene locus_tag LOCUS_21110 gene pyrR 623142 622618 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295862.1 protein_id gnl|my_center|LOCUS_21110 625665 623245 gene locus_tag LOCUS_21120 625665 623245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 625805 627874 gene locus_tag LOCUS_21130 625805 627874 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462072.1 protein_id gnl|my_center|LOCUS_21130 627983 629458 gene locus_tag LOCUS_21140 gene miaB 627983 629458 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_21140 629498 630727 gene locus_tag LOCUS_21150 629498 630727 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_21150 630724 631272 gene locus_tag LOCUS_21160 630724 631272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 631278 632321 gene locus_tag LOCUS_21170 631278 632321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 632332 632670 gene locus_tag LOCUS_21180 632332 632670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 633434 632709 gene locus_tag LOCUS_21190 633434 632709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838648.1 protein_id gnl|my_center|LOCUS_21190 633688 633981 gene locus_tag LOCUS_21200 633688 633981 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_21200 634022 635653 gene locus_tag LOCUS_21210 gene groL 634022 635653 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_21210 635999 635811 gene locus_tag LOCUS_21220 635999 635811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 636448 636203 gene locus_tag LOCUS_21230 636448 636203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 637226 638095 gene locus_tag LOCUS_21240 637226 638095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 638434 638706 gene locus_tag LOCUS_21250 638434 638706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 638915 639085 gene locus_tag LOCUS_21260 638915 639085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 639104 640375 gene locus_tag LOCUS_21270 639104 640375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21270 640674 641255 gene locus_tag LOCUS_21280 640674 641255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 641484 641771 gene locus_tag LOCUS_21290 641484 641771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 641925 642314 gene locus_tag LOCUS_21300 641925 642314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 642905 642540 gene locus_tag LOCUS_21310 642905 642540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 643062 644003 gene locus_tag LOCUS_21320 gene mntA 643062 644003 CDS product manganese ABC transporter substrate-binding protein/adhesin MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229060.1 protein_id gnl|my_center|LOCUS_21320 644000 644791 gene locus_tag LOCUS_21330 gene mntB 644000 644791 CDS product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 protein_id gnl|my_center|LOCUS_21330 644795 646105 gene locus_tag LOCUS_21340 644795 646105 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_21340 646102 646992 gene locus_tag LOCUS_21350 gene mntD 646102 646992 CDS product manganese ABC transporter permease MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229067.1 protein_id gnl|my_center|LOCUS_21350 646955 647500 gene locus_tag LOCUS_21360 646955 647500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 650419 647477 gene locus_tag LOCUS_21370 gene uvrA 650419 647477 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813763.1 protein_id gnl|my_center|LOCUS_21370 650641 651630 gene locus_tag LOCUS_21380 650641 651630 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983101.1 protein_id gnl|my_center|LOCUS_21380 651800 654088 gene locus_tag LOCUS_21390 651800 654088 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111477477.1 protein_id gnl|my_center|LOCUS_21390 654196 654852 gene locus_tag LOCUS_21400 654196 654852 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_21400 655602 654913 gene locus_tag LOCUS_21410 655602 654913 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206916.1 protein_id gnl|my_center|LOCUS_21410 656666 655602 gene locus_tag LOCUS_21420 656666 655602 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206917.1 protein_id gnl|my_center|LOCUS_21420 657978 656740 gene locus_tag LOCUS_21430 657978 656740 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090631.1 protein_id gnl|my_center|LOCUS_21430 660616 658181 gene locus_tag LOCUS_21440 gene priA 660616 658181 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_21440 661457 660669 gene locus_tag LOCUS_21450 gene truA 661457 660669 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_21450 661843 661562 gene locus_tag LOCUS_21460 661843 661562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 662832 661942 gene locus_tag LOCUS_21470 662832 661942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 663555 662941 gene locus_tag LOCUS_21480 663555 662941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 664220 663612 gene locus_tag LOCUS_21490 664220 663612 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_21490 664281 664356 gene locus_tag LOCUS_t00390 664281 664356 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 664762 664391 gene locus_tag LOCUS_21500 664762 664391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 664924 664772 gene locus_tag LOCUS_21510 664924 664772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 666832 664976 gene locus_tag LOCUS_21520 666832 664976 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_21520 666902 667360 gene locus_tag LOCUS_21530 666902 667360 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_21530 667374 667904 gene locus_tag LOCUS_21540 667374 667904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 667970 668767 gene locus_tag LOCUS_21550 667970 668767 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_21550 668764 669426 gene locus_tag LOCUS_21560 668764 669426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 670228 669428 gene locus_tag LOCUS_21570 670228 669428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 670565 672403 gene locus_tag LOCUS_21580 gene htpG 670565 672403 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_21580 672769 672506 gene locus_tag LOCUS_21590 672769 672506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 672981 672907 gene locus_tag LOCUS_t00400 672981 672907 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 673305 673084 gene locus_tag LOCUS_21600 673305 673084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 674317 675243 gene locus_tag LOCUS_21610 674317 675243 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_21610 675276 676040 gene locus_tag LOCUS_21620 675276 676040 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_21620 676181 676537 gene locus_tag LOCUS_21630 676181 676537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 676910 677917 gene locus_tag LOCUS_21640 676910 677917 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674020.1 protein_id gnl|my_center|LOCUS_21640 677927 678814 gene locus_tag LOCUS_21650 677927 678814 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_21650 679074 679808 gene locus_tag LOCUS_21660 679074 679808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 679918 681426 gene locus_tag LOCUS_21670 gene lysS 679918 681426 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_21670 681872 681420 gene locus_tag LOCUS_21680 gene rpiB 681872 681420 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_21680 682705 681875 gene locus_tag LOCUS_21690 gene tatC 682705 681875 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_21690 683757 682774 gene locus_tag LOCUS_21700 683757 682774 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_21700 685279 683933 gene locus_tag LOCUS_21710 685279 683933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 685823 685269 gene locus_tag LOCUS_21720 685823 685269 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_21720 687141 685897 gene locus_tag LOCUS_21730 687141 685897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 687567 688331 gene locus_tag LOCUS_21740 687567 688331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 689142 688381 gene locus_tag LOCUS_21750 689142 688381 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_21750 691209 689317 gene locus_tag LOCUS_21760 691209 689317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 691230 691973 gene locus_tag LOCUS_21770 691230 691973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 692516 691998 gene locus_tag LOCUS_21780 692516 691998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 692646 694352 gene locus_tag LOCUS_21790 692646 694352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 694354 695217 gene locus_tag LOCUS_21800 694354 695217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 695236 697653 gene locus_tag LOCUS_21810 gene pheT 695236 697653 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963186.1 protein_id gnl|my_center|LOCUS_21810 697657 697950 gene locus_tag LOCUS_21820 697657 697950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 697954 698253 gene locus_tag LOCUS_21830 697954 698253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 698320 699930 gene locus_tag LOCUS_21840 gene rny 698320 699930 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760083.1 protein_id gnl|my_center|LOCUS_21840 701225 700065 gene locus_tag LOCUS_21850 701225 700065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038521.1 protein_id gnl|my_center|LOCUS_21850 702332 701292 gene locus_tag LOCUS_21860 702332 701292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 702942 702472 gene locus_tag LOCUS_21870 702942 702472 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_21870 703484 702942 gene locus_tag LOCUS_21880 703484 702942 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_21880 703838 703515 gene locus_tag LOCUS_21890 703838 703515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 704193 703876 gene locus_tag LOCUS_21900 704193 703876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21900 704683 704234 gene locus_tag LOCUS_21910 704683 704234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21910 704851 704763 gene locus_tag LOCUS_t00410 704851 704763 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 705072 706139 gene locus_tag LOCUS_21920 gene serC 705072 706139 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962801.1 protein_id gnl|my_center|LOCUS_21920 706151 707119 gene locus_tag LOCUS_21930 706151 707119 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_21930 707116 708357 gene locus_tag LOCUS_21940 707116 708357 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_21940 708592 709473 gene locus_tag LOCUS_21950 708592 709473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 710070 709480 gene locus_tag LOCUS_21960 710070 709480 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_21960 710205 712238 gene locus_tag LOCUS_21970 gene uvrB 710205 712238 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_21970 712269 714170 gene locus_tag LOCUS_21980 712269 714170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 717191 714192 gene locus_tag LOCUS_21990 717191 714192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 717595 717197 gene locus_tag LOCUS_22000 717595 717197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 717787 718281 gene locus_tag LOCUS_22010 gene slyD 717787 718281 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391442.1 protein_id gnl|my_center|LOCUS_22010 718429 720237 gene locus_tag LOCUS_22020 718429 720237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_22020 721541 720234 gene locus_tag LOCUS_22030 721541 720234 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_22030 722325 721684 gene locus_tag LOCUS_22040 722325 721684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 723258 722491 gene locus_tag LOCUS_22050 723258 722491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 723718 723269 gene locus_tag LOCUS_22060 723718 723269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 725262 723715 gene locus_tag LOCUS_22070 725262 723715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 725506 725652 gene locus_tag LOCUS_22080 725506 725652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 726670 725732 gene locus_tag LOCUS_22090 726670 725732 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_22090 727760 726675 gene locus_tag LOCUS_22100 gene gmd 727760 726675 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868774.1 protein_id gnl|my_center|LOCUS_22100 727917 728501 gene locus_tag LOCUS_22110 gene purN 727917 728501 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_22110 728498 730066 gene locus_tag LOCUS_22120 gene purH 728498 730066 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_22120 730184 731203 gene locus_tag LOCUS_22130 730184 731203 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_22130 731300 732124 gene locus_tag LOCUS_22140 gene mreC 731300 732124 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099559.1 protein_id gnl|my_center|LOCUS_22140 732117 732635 gene locus_tag LOCUS_22150 732117 732635 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_22150 732639 734474 gene locus_tag LOCUS_22160 gene mrdA 732639 734474 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_22160 734471 735718 gene locus_tag LOCUS_22170 gene rodA 734471 735718 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_22170 735771 736688 gene locus_tag LOCUS_22180 gene gldA 735771 736688 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_22180 736685 737419 gene locus_tag LOCUS_22190 gene gldF 736685 737419 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_22190 737410 739122 gene locus_tag LOCUS_22200 gene gldG 737410 739122 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_22200 739119 740159 gene locus_tag LOCUS_22210 739119 740159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 741780 740353 gene locus_tag LOCUS_22220 741780 740353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 742485 743609 gene locus_tag LOCUS_22230 gene dnaN 742485 743609 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_22230 743807 745561 gene locus_tag LOCUS_22240 743807 745561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 746566 745577 gene locus_tag LOCUS_22250 746566 745577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 747168 746563 gene locus_tag LOCUS_22260 747168 746563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 748412 747225 gene locus_tag LOCUS_22270 748412 747225 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_22270 749552 748425 gene locus_tag LOCUS_22280 749552 748425 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016055.1 protein_id gnl|my_center|LOCUS_22280 751168 749633 gene locus_tag LOCUS_22290 751168 749633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 751356 753263 gene locus_tag LOCUS_22300 751356 753263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 757165 753632 gene locus_tag LOCUS_22310 757165 753632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 757748 757173 gene locus_tag LOCUS_22320 757748 757173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 758663 757749 gene locus_tag LOCUS_22330 758663 757749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 760202 758838 gene locus_tag LOCUS_22340 760202 758838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 760714 760259 gene locus_tag LOCUS_22350 760714 760259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 761669 760776 gene locus_tag LOCUS_22360 761669 760776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 762270 761827 gene locus_tag LOCUS_22370 762270 761827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142078.1 protein_id gnl|my_center|LOCUS_22370 762773 762267 gene locus_tag LOCUS_22380 762773 762267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 763434 762811 gene locus_tag LOCUS_22390 763434 762811 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_22390 764404 763448 gene locus_tag LOCUS_22400 764404 763448 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_22400 765802 764408 gene locus_tag LOCUS_22410 765802 764408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 767202 765799 gene locus_tag LOCUS_22420 767202 765799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 768110 767265 gene locus_tag LOCUS_22430 768110 767265 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_22430 768251 771628 gene locus_tag LOCUS_22440 768251 771628 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143960588.1 protein_id gnl|my_center|LOCUS_22440 773842 772100 gene locus_tag LOCUS_22450 773842 772100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 775165 773906 gene locus_tag LOCUS_22460 775165 773906 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_22460 776442 775189 gene locus_tag LOCUS_22470 776442 775189 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766931.1 protein_id gnl|my_center|LOCUS_22470 777198 776605 gene locus_tag LOCUS_22480 777198 776605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 778736 777345 gene locus_tag LOCUS_22490 gene mnmE 778736 777345 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_22490 779770 778742 gene locus_tag LOCUS_22500 gene gldB 779770 778742 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202220.1 protein_id gnl|my_center|LOCUS_22500 779808 780500 gene locus_tag LOCUS_22510 779808 780500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 780575 781387 gene locus_tag LOCUS_22520 780575 781387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 781371 782234 gene locus_tag LOCUS_22530 781371 782234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 782277 783044 gene locus_tag LOCUS_22540 782277 783044 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_22540 783215 783616 gene locus_tag LOCUS_22550 783215 783616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 783793 784188 gene locus_tag LOCUS_22560 783793 784188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 784582 784205 gene locus_tag LOCUS_22570 784582 784205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 785592 784900 gene locus_tag LOCUS_22580 785592 784900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 785931 786197 gene locus_tag LOCUS_22590 785931 786197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 786232 786489 gene locus_tag LOCUS_22600 786232 786489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 786584 788779 gene locus_tag LOCUS_22610 786584 788779 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_22610 788863 791811 gene locus_tag LOCUS_22620 788863 791811 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_22620 792461 791808 gene locus_tag LOCUS_22630 792461 791808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 792645 793793 gene locus_tag LOCUS_22640 gene bshA 792645 793793 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_22640 793844 795373 gene locus_tag LOCUS_22650 793844 795373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 795455 797020 gene locus_tag LOCUS_22660 795455 797020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 799653 797017 gene locus_tag LOCUS_22670 gene infB 799653 797017 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012779652.1 protein_id gnl|my_center|LOCUS_22670 800997 799735 gene locus_tag LOCUS_22680 gene nusA 800997 799735 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_22680 801469 801002 gene locus_tag LOCUS_22690 801469 801002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 802852 801572 gene locus_tag LOCUS_22700 gene metK 802852 801572 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783643.1 protein_id gnl|my_center|LOCUS_22700 804998 802914 gene locus_tag LOCUS_22710 804998 802914 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871691.1 protein_id gnl|my_center|LOCUS_22710 805172 809446 gene locus_tag LOCUS_22720 805172 809446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 809443 810642 gene locus_tag LOCUS_22730 gene rlmI 809443 810642 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704914.1 protein_id gnl|my_center|LOCUS_22730 811150 810644 gene locus_tag LOCUS_22740 811150 810644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 811233 811700 gene locus_tag LOCUS_22750 811233 811700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 811705 812283 gene locus_tag LOCUS_22760 811705 812283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 812304 813191 gene locus_tag LOCUS_22770 812304 813191 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_22770 813322 813735 gene locus_tag LOCUS_22780 gene rpsF 813322 813735 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_22780 813739 814011 gene locus_tag LOCUS_22790 gene rpsR 813739 814011 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790946.1 protein_id gnl|my_center|LOCUS_22790 814019 814468 gene locus_tag LOCUS_22800 gene rplI 814019 814468 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_22800 814501 815766 gene locus_tag LOCUS_22810 gene lysA 814501 815766 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_22810 815959 816183 gene locus_tag LOCUS_22820 815959 816183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 816302 818131 gene locus_tag LOCUS_22830 gene phoD 816302 818131 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_22830 818278 818206 gene locus_tag LOCUS_t00420 818278 818206 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 819624 818320 gene locus_tag LOCUS_22840 gene argH 819624 818320 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_22840 820718 819621 gene locus_tag LOCUS_22850 820718 819621 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_22850 821487 820693 gene locus_tag LOCUS_22860 gene argB 821487 820693 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_22860 822490 821492 gene locus_tag LOCUS_22870 822490 821492 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_22870 823236 822487 gene locus_tag LOCUS_22880 823236 822487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22880 823633 823274 gene locus_tag LOCUS_22890 823633 823274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22890 824628 823639 gene locus_tag LOCUS_22900 gene argC 824628 823639 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796494.1 protein_id gnl|my_center|LOCUS_22900 825823 824612 gene locus_tag LOCUS_22910 825823 824612 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_22910 826540 825827 gene locus_tag LOCUS_22920 826540 825827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 828111 826894 gene locus_tag LOCUS_22930 828111 826894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 828686 828150 gene locus_tag LOCUS_22940 828686 828150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 828929 828765 gene locus_tag LOCUS_22950 828929 828765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 828938 829720 gene locus_tag LOCUS_22960 828938 829720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 829789 830079 gene locus_tag LOCUS_22970 829789 830079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 831318 830074 gene locus_tag LOCUS_22980 831318 830074 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_22980 832656 831382 gene locus_tag LOCUS_22990 832656 831382 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_22990 835629 832705 gene locus_tag LOCUS_23000 835629 832705 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_23000 837477 835726 gene locus_tag LOCUS_23010 837477 835726 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767911.1 protein_id gnl|my_center|LOCUS_23010 839368 837593 gene locus_tag LOCUS_23020 839368 837593 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_23020 839897 839529 gene locus_tag LOCUS_23030 839897 839529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 840202 841968 gene locus_tag LOCUS_23040 840202 841968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 842109 843452 gene locus_tag LOCUS_23050 842109 843452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 843674 844927 gene locus_tag LOCUS_23060 843674 844927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 845898 846845 gene locus_tag LOCUS_23070 845898 846845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 846847 847845 gene locus_tag LOCUS_23080 846847 847845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 848219 848398 gene locus_tag LOCUS_23090 848219 848398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 849324 850415 gene locus_tag LOCUS_23100 849324 850415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 850488 850685 gene locus_tag LOCUS_23110 850488 850685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 850743 851183 gene locus_tag LOCUS_23120 850743 851183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23120 851463 851933 gene locus_tag LOCUS_23130 851463 851933 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100664.1 protein_id gnl|my_center|LOCUS_23130 852121 853491 gene locus_tag LOCUS_23140 gene hisS 852121 853491 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_23140 853593 853817 gene locus_tag LOCUS_23150 853593 853817 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883135.1 protein_id gnl|my_center|LOCUS_23150 854818 853868 gene locus_tag LOCUS_23160 854818 853868 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_23160 855866 854820 gene locus_tag LOCUS_23170 gene mvaD 855866 854820 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_23170 858234 855913 gene locus_tag LOCUS_23180 858234 855913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 859217 858285 gene locus_tag LOCUS_23190 859217 858285 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_23190 860559 859222 gene locus_tag LOCUS_23200 860559 859222 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964430.1 protein_id gnl|my_center|LOCUS_23200 861626 860571 gene locus_tag LOCUS_23210 gene fni 861626 860571 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599487.1 protein_id gnl|my_center|LOCUS_23210 863125 861635 gene locus_tag LOCUS_23220 gene hmgB 863125 861635 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_23220 864848 863244 gene locus_tag LOCUS_23230 864848 863244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 867120 864817 gene locus_tag LOCUS_23240 gene shc 867120 864817 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387823.1 protein_id gnl|my_center|LOCUS_23240 867248 868456 gene locus_tag LOCUS_23250 867248 868456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 868453 869850 gene locus_tag LOCUS_23260 868453 869850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 871080 869851 gene locus_tag LOCUS_23270 871080 869851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 873905 871131 gene locus_tag LOCUS_23280 873905 871131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 877451 873921 gene locus_tag LOCUS_23290 877451 873921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 877816 877574 gene locus_tag LOCUS_23300 877816 877574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 878407 877823 gene locus_tag LOCUS_23310 878407 877823 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_23310 878492 879235 gene locus_tag LOCUS_23320 878492 879235 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704187.1 protein_id gnl|my_center|LOCUS_23320 881224 879257 gene locus_tag LOCUS_23330 881224 879257 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_23330 881905 881282 gene locus_tag LOCUS_23340 gene recR 881905 881282 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787270.1 protein_id gnl|my_center|LOCUS_23340 883875 881974 gene locus_tag LOCUS_23350 883875 881974 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_23350 885422 884040 gene locus_tag LOCUS_23360 885422 884040 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_23360 886716 885544 gene locus_tag LOCUS_23370 886716 885544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795935.1 protein_id gnl|my_center|LOCUS_23370 887358 886717 gene locus_tag LOCUS_23380 887358 886717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 888856 887438 gene locus_tag LOCUS_23390 888856 887438 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_23390 889686 888862 gene locus_tag LOCUS_23400 889686 888862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 890690 889686 gene locus_tag LOCUS_23410 890690 889686 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_23410 891434 891024 gene locus_tag LOCUS_23420 gene rnpA 891434 891024 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964465.1 protein_id gnl|my_center|LOCUS_23420 893194 891683 gene locus_tag LOCUS_23430 893194 891683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 893497 896178 gene locus_tag LOCUS_23440 gene metH 893497 896178 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194931144.1 protein_id gnl|my_center|LOCUS_23440 897146 896166 gene locus_tag LOCUS_23450 897146 896166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 897264 897944 gene locus_tag LOCUS_23460 897264 897944 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870604.1 protein_id gnl|my_center|LOCUS_23460 898599 898204 gene locus_tag LOCUS_23470 898599 898204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 898783 899562 gene locus_tag LOCUS_23480 898783 899562 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_23480 899559 900494 gene locus_tag LOCUS_23490 gene rsgA 899559 900494 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_23490 900552 901004 gene locus_tag LOCUS_23500 gene dtd 900552 901004 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_23500 901001 901498 gene locus_tag LOCUS_23510 901001 901498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 901499 901834 gene locus_tag LOCUS_23520 901499 901834 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_23520 902811 901831 gene locus_tag LOCUS_23530 902811 901831 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_23530 903206 902793 gene locus_tag LOCUS_23540 gene ybeY 903206 902793 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_23540 903659 903243 gene locus_tag LOCUS_23550 903659 903243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 907043 903735 gene locus_tag LOCUS_23560 907043 903735 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_23560 908844 907180 gene locus_tag LOCUS_23570 908844 907180 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_23570 909172 911661 gene locus_tag LOCUS_23580 909172 911661 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_23580 911689 912348 gene locus_tag LOCUS_23590 911689 912348 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_23590 914275 912842 gene locus_tag LOCUS_23600 914275 912842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 914567 914379 gene locus_tag LOCUS_23610 914567 914379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 915307 914990 gene locus_tag LOCUS_23620 915307 914990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 915724 917124 gene locus_tag LOCUS_23630 915724 917124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 917989 917144 gene locus_tag LOCUS_23640 917989 917144 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767607.1 protein_id gnl|my_center|LOCUS_23640 918106 918405 gene locus_tag LOCUS_23650 gene trxA 918106 918405 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760534.1 protein_id gnl|my_center|LOCUS_23650 918664 918852 gene locus_tag LOCUS_23660 918664 918852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 918936 920156 gene locus_tag LOCUS_23670 gene lhgO 918936 920156 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_23670 920946 920143 gene locus_tag LOCUS_23680 920946 920143 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_23680 921462 921082 gene locus_tag LOCUS_23690 gene gcvH 921462 921082 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_23690 921536 922030 gene locus_tag LOCUS_23700 gene rraA 921536 922030 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267431.1 protein_id gnl|my_center|LOCUS_23700 922790 922020 gene locus_tag LOCUS_23710 922790 922020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_23710 923679 922783 gene locus_tag LOCUS_23720 923679 922783 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_23720 923744 924382 gene locus_tag LOCUS_23730 923744 924382 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_23730 924441 925460 gene locus_tag LOCUS_23740 924441 925460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 926557 925457 gene locus_tag LOCUS_23750 gene gcvT 926557 925457 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_23750 926682 927632 gene locus_tag LOCUS_23760 926682 927632 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_23760 927712 928152 gene locus_tag LOCUS_23770 gene queF 927712 928152 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_23770 929667 928195 gene locus_tag LOCUS_23780 929667 928195 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142683.1 protein_id gnl|my_center|LOCUS_23780 931825 929723 gene locus_tag LOCUS_23790 gene recG 931825 929723 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791121.1 protein_id gnl|my_center|LOCUS_23790 932519 931899 gene locus_tag LOCUS_23800 gene gldD 932519 931899 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_23800 933780 932497 gene locus_tag LOCUS_23810 933780 932497 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_23810 934312 933881 gene locus_tag LOCUS_23820 gene ssb 934312 933881 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137264126.1 protein_id gnl|my_center|LOCUS_23820 935448 934447 gene locus_tag LOCUS_23830 935448 934447 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_23830 936407 935445 gene locus_tag LOCUS_23840 936407 935445 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_23840 937288 936413 gene locus_tag LOCUS_23850 937288 936413 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_23850 938386 937382 gene locus_tag LOCUS_23860 938386 937382 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_23860 940020 938503 gene locus_tag LOCUS_23870 940020 938503 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_23870 948019 940172 gene locus_tag LOCUS_23880 948019 940172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 948646 948062 gene locus_tag LOCUS_23890 gene ruvA 948646 948062 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_23890 949174 948800 gene locus_tag LOCUS_23900 949174 948800 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_23900 950388 949306 gene locus_tag LOCUS_23910 950388 949306 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_23910 951921 950395 gene locus_tag LOCUS_23920 951921 950395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 953553 952216 gene locus_tag LOCUS_23930 953553 952216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 955076 953688 gene locus_tag LOCUS_23940 955076 953688 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_23940 958375 955100 gene locus_tag LOCUS_23950 958375 955100 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766447.1 protein_id gnl|my_center|LOCUS_23950 958775 962155 gene locus_tag LOCUS_23960 gene mfd 958775 962155 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_23960 962436 963872 gene locus_tag LOCUS_23970 962436 963872 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_23970 965312 963903 gene locus_tag LOCUS_23980 gene gatA 965312 963903 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931960.1 protein_id gnl|my_center|LOCUS_23980 965543 965325 gene locus_tag LOCUS_23990 965543 965325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 966809 965565 gene locus_tag LOCUS_24000 966809 965565 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129254226.1 protein_id gnl|my_center|LOCUS_24000 967536 966796 gene locus_tag LOCUS_24010 967536 966796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 969319 967550 gene locus_tag LOCUS_24020 969319 967550 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_24020 970317 969316 gene locus_tag LOCUS_24030 970317 969316 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_24030 970828 970388 gene locus_tag LOCUS_24040 gene dut 970828 970388 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964537.1 protein_id gnl|my_center|LOCUS_24040 971504 970878 gene locus_tag LOCUS_24050 971504 970878 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932818.1 protein_id gnl|my_center|LOCUS_24050 971591 972316 gene locus_tag LOCUS_24060 971591 972316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 972313 973968 gene locus_tag LOCUS_24070 972313 973968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 974079 975692 gene locus_tag LOCUS_24080 974079 975692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 976405 975698 gene locus_tag LOCUS_24090 gene recO 976405 975698 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962443.1 protein_id gnl|my_center|LOCUS_24090 978683 976407 gene locus_tag LOCUS_24100 978683 976407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 978805 982107 gene locus_tag LOCUS_24110 gene ileS 978805 982107 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962393.1 protein_id gnl|my_center|LOCUS_24110 982098 982820 gene locus_tag LOCUS_24120 982098 982820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 982834 983517 gene locus_tag LOCUS_24130 982834 983517 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765667.1 protein_id gnl|my_center|LOCUS_24130 984245 983514 gene locus_tag LOCUS_24140 984245 983514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 984690 984439 gene locus_tag LOCUS_24150 984690 984439 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297160.1 protein_id gnl|my_center|LOCUS_24150 985162 984791 gene locus_tag LOCUS_24160 985162 984791 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392133.1 protein_id gnl|my_center|LOCUS_24160 989495 985281 gene locus_tag LOCUS_24170 989495 985281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 989551 990588 gene locus_tag LOCUS_24180 989551 990588 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_24180 990610 990858 gene locus_tag LOCUS_24190 990610 990858 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876114.1 protein_id gnl|my_center|LOCUS_24190 993135 990916 gene locus_tag LOCUS_24200 gene recQ 993135 990916 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_24200 993386 994474 gene locus_tag LOCUS_24210 993386 994474 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_24210 994580 996388 gene locus_tag LOCUS_24220 994580 996388 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_24220 997038 996451 gene locus_tag LOCUS_24230 997038 996451 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_24230 997133 997732 gene locus_tag LOCUS_24240 gene pdxH 997133 997732 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_24240 997705 998988 gene locus_tag LOCUS_24250 997705 998988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 999563 999294 gene locus_tag LOCUS_24260 999563 999294 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_24260 999872 1000462 gene locus_tag LOCUS_24270 999872 1000462 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_24270 1000475 1001413 gene locus_tag LOCUS_24280 1000475 1001413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1010008 1001420 gene locus_tag LOCUS_24290 1010008 1001420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1010214 1010600 gene locus_tag LOCUS_24300 1010214 1010600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 1010771 1011448 gene locus_tag LOCUS_24310 1010771 1011448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 1012241 1011462 gene locus_tag LOCUS_24320 gene paaG 1012241 1011462 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528139.1 protein_id gnl|my_center|LOCUS_24320 1012906 1012295 gene locus_tag LOCUS_24330 1012906 1012295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 1014372 1012906 gene locus_tag LOCUS_24340 gene rpoN 1014372 1012906 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_24340 1014456 1015973 gene locus_tag LOCUS_24350 1014456 1015973 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387048.1 protein_id gnl|my_center|LOCUS_24350 1016053 1017570 gene locus_tag LOCUS_24360 1016053 1017570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 1018953 1017739 gene locus_tag LOCUS_24370 1018953 1017739 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529103.1 protein_id gnl|my_center|LOCUS_24370 1021169 1019040 gene locus_tag LOCUS_24380 1021169 1019040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 1021546 1021731 gene locus_tag LOCUS_24390 1021546 1021731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24390 1021919 1024336 gene locus_tag LOCUS_24400 1021919 1024336 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144184.1 protein_id gnl|my_center|LOCUS_24400 1025632 1024802 gene locus_tag LOCUS_24410 1025632 1024802 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_24410 1025738 1026811 gene locus_tag LOCUS_24420 1025738 1026811 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986423.1 protein_id gnl|my_center|LOCUS_24420 1026835 1027755 gene locus_tag LOCUS_24430 1026835 1027755 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403948.1 protein_id gnl|my_center|LOCUS_24430 1027759 1028994 gene locus_tag LOCUS_24440 1027759 1028994 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_24440 1029040 1030062 gene locus_tag LOCUS_24450 1029040 1030062 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_24450 1030144 1031799 gene locus_tag LOCUS_24460 gene glpD 1030144 1031799 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233382.1 protein_id gnl|my_center|LOCUS_24460 1031805 1032443 gene locus_tag LOCUS_24470 1031805 1032443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1032619 1033413 gene locus_tag LOCUS_24480 gene rfbA 1032619 1033413 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_24480 1033415 1034350 gene locus_tag LOCUS_24490 1033415 1034350 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615482.1 protein_id gnl|my_center|LOCUS_24490 1034409 1035458 gene locus_tag LOCUS_24500 gene galE 1034409 1035458 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_24500 1037054 1035576 gene locus_tag LOCUS_24510 1037054 1035576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1037945 1037070 gene locus_tag LOCUS_24520 1037945 1037070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1039599 1038052 gene locus_tag LOCUS_24530 1039599 1038052 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_24530 1040676 1039840 gene locus_tag LOCUS_24540 1040676 1039840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1040981 1040673 gene locus_tag LOCUS_24550 1040981 1040673 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_24550 1041099 1042178 gene locus_tag LOCUS_24560 gene mutY 1041099 1042178 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_24560 1043598 1042165 gene locus_tag LOCUS_24570 1043598 1042165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1043956 1045062 gene locus_tag LOCUS_24580 1043956 1045062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 1045219 1045959 gene locus_tag LOCUS_24590 gene scpB 1045219 1045959 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932165.1 protein_id gnl|my_center|LOCUS_24590 1046035 1046910 gene locus_tag LOCUS_24600 1046035 1046910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 1046968 1048197 gene locus_tag LOCUS_24610 1046968 1048197 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_24610 1049488 1048112 gene locus_tag LOCUS_24620 1049488 1048112 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_24620 1050135 1049542 gene locus_tag LOCUS_24630 1050135 1049542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 1051115 1050150 gene locus_tag LOCUS_24640 1051115 1050150 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_24640 1052512 1051187 gene locus_tag LOCUS_24650 1052512 1051187 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_24650 1053024 1052590 gene locus_tag LOCUS_24660 1053024 1052590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1053494 1053189 gene locus_tag LOCUS_24670 1053494 1053189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1055535 1053556 gene locus_tag LOCUS_24680 1055535 1053556 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_24680 1055719 1056375 gene locus_tag LOCUS_24690 1055719 1056375 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364337.1 protein_id gnl|my_center|LOCUS_24690 1056388 1057404 gene locus_tag LOCUS_24700 1056388 1057404 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937492.1 protein_id gnl|my_center|LOCUS_24700 1060236 1057420 gene locus_tag LOCUS_24710 gene carB 1060236 1057420 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 protein_id gnl|my_center|LOCUS_24710 1061454 1060345 gene locus_tag LOCUS_24720 1061454 1060345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 1062148 1061582 gene locus_tag LOCUS_24730 1062148 1061582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 1062232 1062654 gene locus_tag LOCUS_24740 1062232 1062654 CDS product ABA4-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_24740 1062728 1064494 gene locus_tag LOCUS_24750 1062728 1064494 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_24750 1064495 1066174 gene locus_tag LOCUS_24760 1064495 1066174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1066207 1066878 gene locus_tag LOCUS_24770 gene tsaB 1066207 1066878 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_24770 1066917 1067261 gene locus_tag LOCUS_24780 1066917 1067261 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803884.1 protein_id gnl|my_center|LOCUS_24780 1068266 1067256 gene locus_tag LOCUS_24790 gene nadA 1068266 1067256 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_24790 1069093 1068626 gene locus_tag LOCUS_24800 gene nadD 1069093 1068626 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_24800 1069241 1069549 gene locus_tag LOCUS_24810 1069241 1069549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 1069537 1070133 gene locus_tag LOCUS_24820 1069537 1070133 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762908.1 protein_id gnl|my_center|LOCUS_24820 1070126 1070902 gene locus_tag LOCUS_24830 gene kdsA 1070126 1070902 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785350.1 protein_id gnl|my_center|LOCUS_24830 1071039 1072208 gene locus_tag LOCUS_24840 1071039 1072208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 1072192 1073439 gene locus_tag LOCUS_24850 1072192 1073439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1074809 1073448 gene locus_tag LOCUS_24860 gene sulP 1074809 1073448 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24860 1076451 1074721 gene locus_tag LOCUS_24870 1076451 1074721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 1076700 1076464 gene locus_tag LOCUS_24880 1076700 1076464 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_24880 1076840 1077268 gene locus_tag LOCUS_24890 1076840 1077268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 1077265 1078686 gene locus_tag LOCUS_24900 gene pyk 1077265 1078686 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_24900 1079260 1078700 gene locus_tag LOCUS_24910 gene ruvC 1079260 1078700 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_24910 1080295 1079288 gene locus_tag LOCUS_24920 1080295 1079288 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_24920 1083516 1080424 gene locus_tag LOCUS_24930 1083516 1080424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 1086541 1083656 gene locus_tag LOCUS_24940 1086541 1083656 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_24940 1087877 1086651 gene locus_tag LOCUS_24950 1087877 1086651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 1088037 1088714 gene locus_tag LOCUS_24960 1088037 1088714 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_24960 1088840 1089829 gene locus_tag LOCUS_24970 1088840 1089829 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_24970 1089895 1090797 gene locus_tag LOCUS_24980 1089895 1090797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 1090806 1091012 gene locus_tag LOCUS_24990 1090806 1091012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 1091005 1091841 gene locus_tag LOCUS_25000 1091005 1091841 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_25000 1091918 1092610 gene locus_tag LOCUS_25010 1091918 1092610 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_25010 1092622 1092933 gene locus_tag LOCUS_25020 1092622 1092933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 1093383 1092964 gene locus_tag LOCUS_25030 gene mce 1093383 1092964 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_25030 1093449 1094624 gene locus_tag LOCUS_25040 1093449 1094624 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_25040 1097172 1094665 gene locus_tag LOCUS_25050 1097172 1094665 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503907.1 protein_id gnl|my_center|LOCUS_25050 1098321 1097251 gene locus_tag LOCUS_25060 gene prfA 1098321 1097251 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931817.1 protein_id gnl|my_center|LOCUS_25060 1099035 1098334 gene locus_tag LOCUS_25070 1099035 1098334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 1099888 1099100 gene locus_tag LOCUS_25080 1099888 1099100 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_25080 1101994 1099892 gene locus_tag LOCUS_25090 gene ftsH 1101994 1099892 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_25090 1102390 1102001 gene locus_tag LOCUS_25100 gene rsfS 1102390 1102001 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_25100 1102454 1103218 gene locus_tag LOCUS_25110 1102454 1103218 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_25110 1103272 1103853 gene locus_tag LOCUS_25120 1103272 1103853 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228340.1 protein_id gnl|my_center|LOCUS_25120 1103862 1104848 gene locus_tag LOCUS_25130 gene paaA 1103862 1104848 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_25130 1104845 1105201 gene locus_tag LOCUS_25140 1104845 1105201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 1105198 1105950 gene locus_tag LOCUS_25150 gene paaC 1105198 1105950 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 protein_id gnl|my_center|LOCUS_25150 1105974 1106453 gene locus_tag LOCUS_25160 gene paaJ 1105974 1106453 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618854.1 protein_id gnl|my_center|LOCUS_25160 1108317 1106656 gene locus_tag LOCUS_25170 1108317 1106656 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_25170 1110176 1108314 gene locus_tag LOCUS_25180 gene mnmG 1110176 1108314 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_25180 1111581 1110439 gene locus_tag LOCUS_25190 1111581 1110439 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_25190 1111680 1113134 gene locus_tag LOCUS_25200 1111680 1113134 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250663.1 protein_id gnl|my_center|LOCUS_25200 1113324 1114391 gene locus_tag LOCUS_25210 1113324 1114391 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_25210 1114788 1115111 gene locus_tag LOCUS_25220 1114788 1115111 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962894.1 protein_id gnl|my_center|LOCUS_25220 1115108 1117858 gene locus_tag LOCUS_25230 1115108 1117858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 1117860 1118813 gene locus_tag LOCUS_25240 1117860 1118813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 1118838 1119347 gene locus_tag LOCUS_25250 1118838 1119347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 1119966 1119295 gene locus_tag LOCUS_25260 1119966 1119295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25260 1120300 1120097 gene locus_tag LOCUS_25270 1120300 1120097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1120396 1121421 gene locus_tag LOCUS_25280 1120396 1121421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 1121418 1122941 gene locus_tag LOCUS_25290 1121418 1122941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093039140.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence03 11284 1472 gene locus_tag LOCUS_25300 11284 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 12137 11847 gene locus_tag LOCUS_25310 12137 11847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 13253 12159 gene locus_tag LOCUS_25320 gene recF 13253 12159 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_25320 13340 14380 gene locus_tag LOCUS_25330 gene pdhA 13340 14380 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328145.1 protein_id gnl|my_center|LOCUS_25330 14393 15055 gene locus_tag LOCUS_25340 14393 15055 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_25340 15078 15572 gene locus_tag LOCUS_25350 gene ribH 15078 15572 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_25350 15632 16471 gene locus_tag LOCUS_25360 15632 16471 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_25360 17238 18053 gene locus_tag LOCUS_25370 17238 18053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 18185 18691 gene locus_tag LOCUS_25380 18185 18691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 19007 18932 gene locus_tag LOCUS_t00430 19007 18932 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19522 19109 gene locus_tag LOCUS_25390 19522 19109 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_25390 19633 20643 gene locus_tag LOCUS_25400 19633 20643 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_25400 20709 21272 gene locus_tag LOCUS_25410 20709 21272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 22071 21274 gene locus_tag LOCUS_25420 gene cdaA 22071 21274 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_25420 22959 22081 gene locus_tag LOCUS_25430 gene folP 22959 22081 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_25430 23062 24348 gene locus_tag LOCUS_25440 23062 24348 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_25440 24345 25409 gene locus_tag LOCUS_25450 24345 25409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810095.1 protein_id gnl|my_center|LOCUS_25450 26816 25428 gene locus_tag LOCUS_25460 gene lpdA 26816 25428 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_25460 27591 26902 gene locus_tag LOCUS_25470 27591 26902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 30008 27588 gene locus_tag LOCUS_25480 30008 27588 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_25480 30160 31785 gene locus_tag LOCUS_25490 gene pruA 30160 31785 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_25490 31815 33137 gene locus_tag LOCUS_25500 gene nhaA 31815 33137 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_25500 33281 34309 gene locus_tag LOCUS_25510 33281 34309 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_25510 35407 34337 gene locus_tag LOCUS_25520 35407 34337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 36862 35648 gene locus_tag LOCUS_25530 36862 35648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 37151 40048 gene locus_tag LOCUS_25540 37151 40048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 40066 42444 gene locus_tag LOCUS_25550 40066 42444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 42691 43707 gene locus_tag LOCUS_25560 42691 43707 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922049.1 protein_id gnl|my_center|LOCUS_25560 43829 46012 gene locus_tag LOCUS_25570 43829 46012 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_25570 46049 48148 gene locus_tag LOCUS_25580 46049 48148 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_25580 49110 48199 gene locus_tag LOCUS_25590 49110 48199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 50024 49119 gene locus_tag LOCUS_25600 50024 49119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 50791 50021 gene locus_tag LOCUS_25610 50791 50021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 52113 50770 gene locus_tag LOCUS_25620 52113 50770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 52315 53898 gene locus_tag LOCUS_25630 52315 53898 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208365.1 protein_id gnl|my_center|LOCUS_25630 54985 53927 gene locus_tag LOCUS_25640 54985 53927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 55948 55001 gene locus_tag LOCUS_25650 55948 55001 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_25650 56033 56992 gene locus_tag LOCUS_25660 56033 56992 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267772.1 protein_id gnl|my_center|LOCUS_25660 56995 57783 gene locus_tag LOCUS_25670 56995 57783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 58922 57789 gene locus_tag LOCUS_25680 58922 57789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 59116 58922 gene locus_tag LOCUS_25690 59116 58922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 59273 60943 gene locus_tag LOCUS_25700 59273 60943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 60930 62552 gene locus_tag LOCUS_25710 60930 62552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 63254 63484 gene locus_tag LOCUS_25720 63254 63484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 63471 65282 gene locus_tag LOCUS_25730 63471 65282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 65309 67237 gene locus_tag LOCUS_25740 65309 67237 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_25740 68230 67229 gene locus_tag LOCUS_25750 68230 67229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 69102 68197 gene locus_tag LOCUS_25760 69102 68197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 69883 69125 gene locus_tag LOCUS_25770 69883 69125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 70816 69899 gene locus_tag LOCUS_25780 70816 69899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 71097 71585 gene locus_tag LOCUS_25790 71097 71585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 71605 78009 gene locus_tag LOCUS_25800 71605 78009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 77957 81277 gene locus_tag LOCUS_25810 77957 81277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 81455 82900 gene locus_tag LOCUS_25820 81455 82900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 82908 84530 gene locus_tag LOCUS_25830 82908 84530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 84604 85299 gene locus_tag LOCUS_25840 84604 85299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_25840 85491 87431 gene locus_tag LOCUS_25850 85491 87431 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_25850 87428 88519 gene locus_tag LOCUS_25860 87428 88519 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986993.1 protein_id gnl|my_center|LOCUS_25860 89381 88560 gene locus_tag LOCUS_25870 89381 88560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 90882 89482 gene locus_tag LOCUS_25880 90882 89482 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_25880 91311 90994 gene locus_tag LOCUS_25890 91311 90994 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401030.1 protein_id gnl|my_center|LOCUS_25890 92448 91315 gene locus_tag LOCUS_25900 92448 91315 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_25900 92537 94456 gene locus_tag LOCUS_25910 gene acs 92537 94456 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_25910 95418 94516 gene locus_tag LOCUS_25920 95418 94516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 95566 96360 gene locus_tag LOCUS_25930 95566 96360 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_25930 97594 96362 gene locus_tag LOCUS_25940 97594 96362 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_25940 97793 98881 gene locus_tag LOCUS_25950 97793 98881 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_25950 98886 99794 gene locus_tag LOCUS_25960 gene fmt 98886 99794 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 protein_id gnl|my_center|LOCUS_25960 100694 100293 gene locus_tag LOCUS_25970 100694 100293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 101504 100773 gene locus_tag LOCUS_25980 gene lipB 101504 100773 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_25980 102496 101504 gene locus_tag LOCUS_25990 102496 101504 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_25990 102644 103291 gene locus_tag LOCUS_26000 102644 103291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 103306 103983 gene locus_tag LOCUS_26010 103306 103983 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_26010 104039 104503 gene locus_tag LOCUS_26020 104039 104503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 105155 104571 gene locus_tag LOCUS_26030 105155 104571 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763837.1 protein_id gnl|my_center|LOCUS_26030 105213 105953 gene locus_tag LOCUS_26040 105213 105953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 106000 106764 gene locus_tag LOCUS_26050 106000 106764 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_26050 111017 106761 gene locus_tag LOCUS_26060 111017 106761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 112294 111014 gene locus_tag LOCUS_26070 112294 111014 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_26070 113626 112322 gene locus_tag LOCUS_26080 113626 112322 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_26080 115600 113630 gene locus_tag LOCUS_26090 115600 113630 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_26090 115751 116647 gene locus_tag LOCUS_26100 115751 116647 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_26100 116661 117740 gene locus_tag LOCUS_26110 gene corA 116661 117740 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_26110 118756 117815 gene locus_tag LOCUS_26120 118756 117815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 121128 118804 gene locus_tag LOCUS_26130 121128 118804 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963613.1 protein_id gnl|my_center|LOCUS_26130 122324 121218 gene locus_tag LOCUS_26140 122324 121218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 122472 122927 gene locus_tag LOCUS_26150 122472 122927 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093139.1 protein_id gnl|my_center|LOCUS_26150 122924 123646 gene locus_tag LOCUS_26160 122924 123646 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_26160 124300 123671 gene locus_tag LOCUS_26170 124300 123671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 128892 124501 gene locus_tag LOCUS_26180 128892 124501 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_26180 129781 129017 gene locus_tag LOCUS_26190 129781 129017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 130727 129789 gene locus_tag LOCUS_26200 gene mdh 130727 129789 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_26200 133754 130806 gene locus_tag LOCUS_26210 gene gcvP 133754 130806 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_26210 133877 134497 gene locus_tag LOCUS_26220 133877 134497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 134657 136282 gene locus_tag LOCUS_26230 134657 136282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 136474 141138 gene locus_tag LOCUS_26240 136474 141138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 142448 141135 gene locus_tag LOCUS_26250 142448 141135 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_26250 143296 142442 gene locus_tag LOCUS_26260 143296 142442 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_26260 144426 143299 gene locus_tag LOCUS_26270 144426 143299 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202512.1 protein_id gnl|my_center|LOCUS_26270 145186 144452 gene locus_tag LOCUS_26280 145186 144452 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_26280 145110 146624 gene locus_tag LOCUS_26290 145110 146624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 146621 147514 gene locus_tag LOCUS_26300 146621 147514 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_26300 147549 148607 gene locus_tag LOCUS_26310 147549 148607 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_26310 149499 148576 gene locus_tag LOCUS_26320 149499 148576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 149979 149560 gene locus_tag LOCUS_26330 gene aroQ 149979 149560 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_26330 150023 150937 gene locus_tag LOCUS_26340 gene xerD 150023 150937 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964120.1 protein_id gnl|my_center|LOCUS_26340 151889 150945 gene locus_tag LOCUS_26350 151889 150945 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_26350 152499 151954 gene locus_tag LOCUS_26360 gene pyrR 152499 151954 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_26360 153796 152594 gene locus_tag LOCUS_26370 153796 152594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 153990 153805 gene locus_tag LOCUS_26380 153990 153805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 154447 154001 gene locus_tag LOCUS_26390 154447 154001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 155386 154451 gene locus_tag LOCUS_26400 155386 154451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 156926 155511 gene locus_tag LOCUS_26410 156926 155511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 157012 158304 gene locus_tag LOCUS_26420 157012 158304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 158353 159594 gene locus_tag LOCUS_26430 158353 159594 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_26430 160177 159605 gene locus_tag LOCUS_26440 160177 159605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 161338 160235 gene locus_tag LOCUS_26450 161338 160235 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_26450 162691 161345 gene locus_tag LOCUS_26460 gene purB 162691 161345 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_26460 162806 165133 gene locus_tag LOCUS_26470 gene topA 162806 165133 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_26470 165135 165992 gene locus_tag LOCUS_26480 165135 165992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 166751 166005 gene locus_tag LOCUS_26490 166751 166005 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_26490 168122 166926 gene locus_tag LOCUS_26500 168122 166926 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_26500 168325 170025 gene locus_tag LOCUS_26510 168325 170025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 172659 170515 gene locus_tag LOCUS_26520 172659 170515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 173240 172974 gene locus_tag LOCUS_26530 173240 172974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 178156 173561 gene locus_tag LOCUS_26540 178156 173561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 181067 178266 gene locus_tag LOCUS_26550 181067 178266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 181289 181861 gene locus_tag LOCUS_26560 181289 181861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 181909 182442 gene locus_tag LOCUS_26570 181909 182442 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_26570 182466 183140 gene locus_tag LOCUS_26580 182466 183140 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_26580 183304 184398 gene locus_tag LOCUS_26590 183304 184398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_26590 184482 185012 gene locus_tag LOCUS_26600 184482 185012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 185226 184969 gene locus_tag LOCUS_26610 185226 184969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 185330 186811 gene locus_tag LOCUS_26620 185330 186811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 186962 188116 gene locus_tag LOCUS_26630 186962 188116 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_26630 188166 189299 gene locus_tag LOCUS_26640 gene hppD 188166 189299 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_26640 189452 189631 gene locus_tag LOCUS_26650 189452 189631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 189673 190389 gene locus_tag LOCUS_26660 189673 190389 CDS product (S)-benzoin forming benzil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271070.1 protein_id gnl|my_center|LOCUS_26660 191381 190386 gene locus_tag LOCUS_26670 191381 190386 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_26670 191467 191967 gene locus_tag LOCUS_26680 191467 191967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 192462 192013 gene locus_tag LOCUS_26690 192462 192013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 194025 192589 gene locus_tag LOCUS_26700 194025 192589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 194310 196142 gene locus_tag LOCUS_26710 194310 196142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 196774 196163 gene locus_tag LOCUS_26720 196774 196163 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_26720 196863 198161 gene locus_tag LOCUS_26730 196863 198161 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_26730 198647 200911 gene locus_tag LOCUS_26740 198647 200911 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_26740 200937 201509 gene locus_tag LOCUS_26750 200937 201509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 205469 201525 gene locus_tag LOCUS_26760 205469 201525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 205598 207712 gene locus_tag LOCUS_26770 205598 207712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 208581 207721 gene locus_tag LOCUS_26780 208581 207721 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_26780 211172 208635 gene locus_tag LOCUS_26790 211172 208635 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_26790 212416 211178 gene locus_tag LOCUS_26800 212416 211178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 213100 212528 gene locus_tag LOCUS_26810 213100 212528 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_26810 217357 213248 gene locus_tag LOCUS_26820 217357 213248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 217530 217883 gene locus_tag LOCUS_26830 217530 217883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 217929 218786 gene locus_tag LOCUS_26840 217929 218786 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_26840 221452 218774 gene locus_tag LOCUS_26850 221452 218774 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_26850 221537 222106 gene locus_tag LOCUS_26860 221537 222106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 222174 223577 gene locus_tag LOCUS_26870 222174 223577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 223574 224578 gene locus_tag LOCUS_26880 223574 224578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 225933 224641 gene locus_tag LOCUS_26890 225933 224641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 226409 225996 gene locus_tag LOCUS_26900 226409 225996 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_26900 226505 227323 gene locus_tag LOCUS_26910 226505 227323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 227352 228224 gene locus_tag LOCUS_26920 gene lipA 227352 228224 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_26920 228366 231275 gene locus_tag LOCUS_26930 228366 231275 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208256196.1 protein_id gnl|my_center|LOCUS_26930 231358 232956 gene locus_tag LOCUS_26940 231358 232956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 233036 234568 gene locus_tag LOCUS_26950 233036 234568 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_26950 238170 234640 gene locus_tag LOCUS_26960 gene smc 238170 234640 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092731919.1 protein_id gnl|my_center|LOCUS_26960 239639 238407 gene locus_tag LOCUS_26970 239639 238407 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_26970 241633 240077 gene locus_tag LOCUS_26980 241633 240077 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_26980 241681 242940 gene locus_tag LOCUS_26990 241681 242940 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_26990 242944 243993 gene locus_tag LOCUS_27000 gene lpxD 242944 243993 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_27000 243986 245392 gene locus_tag LOCUS_27010 243986 245392 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_27010 245413 246264 gene locus_tag LOCUS_27020 gene lpxA 245413 246264 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_27020 246248 246910 gene locus_tag LOCUS_27030 246248 246910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838378.1 protein_id gnl|my_center|LOCUS_27030 251963 247029 gene locus_tag LOCUS_27040 251963 247029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 252198 252935 gene locus_tag LOCUS_27050 252198 252935 CDS product CRISPR-associated endonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065262.1 protein_id gnl|my_center|LOCUS_27050 252932 255547 gene locus_tag LOCUS_27060 gene cas10 252932 255547 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545463.1 protein_id gnl|my_center|LOCUS_27060 255574 256059 gene locus_tag LOCUS_27070 gene csm2 255574 256059 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256464.1 protein_id gnl|my_center|LOCUS_27070 256084 256827 gene locus_tag LOCUS_27080 gene csm3 256084 256827 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082356.1 protein_id gnl|my_center|LOCUS_27080 256824 257825 gene locus_tag LOCUS_27090 gene csm4 256824 257825 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021930.1 protein_id gnl|my_center|LOCUS_27090 257836 259062 gene locus_tag LOCUS_27100 257836 259062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 259076 260524 gene locus_tag LOCUS_27110 259076 260524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 260602 262056 gene locus_tag LOCUS_27120 260602 262056 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_27120 262126 263103 gene locus_tag LOCUS_27130 gene cas1 262126 263103 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258803.1 protein_id gnl|my_center|LOCUS_27130 263116 264132 gene locus_tag LOCUS_27140 263116 264132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 264129 264602 gene locus_tag LOCUS_27150 264129 264602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 264684 266656 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgagagaacatcatccacgagaacaaggattaagac >Feature sequence04 1379 816 gene locus_tag LOCUS_27160 1379 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2236 1439 gene locus_tag LOCUS_27170 2236 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 2975 2424 gene locus_tag LOCUS_27180 2975 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 3559 3011 gene locus_tag LOCUS_27190 3559 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 4302 3613 gene locus_tag LOCUS_27200 4302 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 4631 4347 gene locus_tag LOCUS_27210 4631 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 5155 4667 gene locus_tag LOCUS_27220 5155 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 5510 5193 gene locus_tag LOCUS_27230 5510 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 6101 5550 gene locus_tag LOCUS_27240 6101 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 6924 6139 gene locus_tag LOCUS_27250 6924 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 7906 6965 gene locus_tag LOCUS_27260 7906 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 8503 7943 gene locus_tag LOCUS_27270 8503 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 9054 8545 gene locus_tag LOCUS_27280 9054 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 10325 9093 gene locus_tag LOCUS_27290 10325 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 11431 10382 gene locus_tag LOCUS_27300 11431 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 12202 11903 gene locus_tag LOCUS_27310 12202 11903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 12632 12381 gene locus_tag LOCUS_27320 12632 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 13643 13338 gene locus_tag LOCUS_27330 13643 13338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 14684 14199 gene locus_tag LOCUS_27340 14684 14199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 15135 14737 gene locus_tag LOCUS_27350 15135 14737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 15198 16757 gene locus_tag LOCUS_27360 15198 16757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 16980 17648 gene locus_tag LOCUS_27370 16980 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 18560 18787 gene locus_tag LOCUS_27380 18560 18787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 18837 19871 gene locus_tag LOCUS_27390 18837 19871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 19902 21329 gene locus_tag LOCUS_27400 19902 21329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 21348 22235 gene locus_tag LOCUS_27410 21348 22235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 22256 22882 gene locus_tag LOCUS_27420 22256 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 22904 23719 gene locus_tag LOCUS_27430 22904 23719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 23814 24464 gene locus_tag LOCUS_27440 23814 24464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 24461 24985 gene locus_tag LOCUS_27450 24461 24985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 24963 25694 gene locus_tag LOCUS_27460 24963 25694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 25691 29875 gene locus_tag LOCUS_27470 25691 29875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 29895 31295 gene locus_tag LOCUS_27480 29895 31295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 31298 32200 gene locus_tag LOCUS_27490 31298 32200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 32197 32514 gene locus_tag LOCUS_27500 32197 32514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 32511 33779 gene locus_tag LOCUS_27510 32511 33779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 33796 36261 gene locus_tag LOCUS_27520 33796 36261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 36343 44376 gene locus_tag LOCUS_27530 36343 44376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 44395 62862 gene locus_tag LOCUS_27540 44395 62862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 62862 64685 gene locus_tag LOCUS_27550 62862 64685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 64682 65038 gene locus_tag LOCUS_27560 64682 65038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 65657 65271 gene locus_tag LOCUS_27570 65657 65271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 65722 66501 gene locus_tag LOCUS_27580 65722 66501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 66498 67520 gene locus_tag LOCUS_27590 66498 67520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 67541 67825 gene locus_tag LOCUS_27600 67541 67825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 67830 70121 gene locus_tag LOCUS_27610 67830 70121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 70128 71747 gene locus_tag LOCUS_27620 70128 71747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 71744 74218 gene locus_tag LOCUS_27630 71744 74218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 74184 74660 gene locus_tag LOCUS_27640 74184 74660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 74635 75042 gene locus_tag LOCUS_27650 74635 75042 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989958.1 protein_id gnl|my_center|LOCUS_27650 75095 75367 gene locus_tag LOCUS_27660 75095 75367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 75345 75842 gene locus_tag LOCUS_27670 75345 75842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 75845 76564 gene locus_tag LOCUS_27680 75845 76564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 76952 76557 gene locus_tag LOCUS_27690 76952 76557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 77265 76957 gene locus_tag LOCUS_27700 77265 76957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 78813 77584 gene locus_tag LOCUS_27710 78813 77584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 79507 79046 gene locus_tag LOCUS_27720 79507 79046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 80404 79565 gene locus_tag LOCUS_27730 80404 79565 CDS product DUF6371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822199.1 protein_id gnl|my_center|LOCUS_27730 80799 80407 gene locus_tag LOCUS_27740 80799 80407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 80819 81511 gene locus_tag LOCUS_27750 80819 81511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 82205 81480 gene locus_tag LOCUS_27760 82205 81480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 82407 82195 gene locus_tag LOCUS_27770 82407 82195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 82948 82391 gene locus_tag LOCUS_27780 82948 82391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 83190 83002 gene locus_tag LOCUS_27790 83190 83002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 83489 83187 gene locus_tag LOCUS_27800 83489 83187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 83944 83450 gene locus_tag LOCUS_27810 83944 83450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 84523 83990 gene locus_tag LOCUS_27820 84523 83990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 85090 84566 gene locus_tag LOCUS_27830 85090 84566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 85768 85133 gene locus_tag LOCUS_27840 85768 85133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence05 2232 310 gene locus_tag LOCUS_27850 2232 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 2918 2229 gene locus_tag LOCUS_27860 2918 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 3766 2918 gene locus_tag LOCUS_27870 3766 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 4364 3936 gene locus_tag LOCUS_27880 4364 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 4762 4358 gene locus_tag LOCUS_27890 4762 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 5934 6908 gene locus_tag LOCUS_27900 5934 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 6920 7288 gene locus_tag LOCUS_27910 6920 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 7428 7721 gene locus_tag LOCUS_27920 7428 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 7783 8571 gene locus_tag LOCUS_27930 7783 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 8568 8885 gene locus_tag LOCUS_27940 8568 8885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 8898 9215 gene locus_tag LOCUS_27950 8898 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 9212 9571 gene locus_tag LOCUS_27960 9212 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 9830 10303 gene locus_tag LOCUS_27970 9830 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 10309 10902 gene locus_tag LOCUS_27980 10309 10902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 10899 11339 gene locus_tag LOCUS_27990 10899 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 11347 11616 gene locus_tag LOCUS_28000 11347 11616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 11779 11624 gene locus_tag LOCUS_28010 11779 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 11774 12994 gene locus_tag LOCUS_28020 11774 12994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 12991 15033 gene locus_tag LOCUS_28030 12991 15033 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108809.1 protein_id gnl|my_center|LOCUS_28030 15030 15440 gene locus_tag LOCUS_28040 15030 15440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 15565 15810 gene locus_tag LOCUS_28050 15565 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 15817 16410 gene locus_tag LOCUS_28060 15817 16410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 16407 16847 gene locus_tag LOCUS_28070 16407 16847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 16855 17124 gene locus_tag LOCUS_28080 16855 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 17287 17132 gene locus_tag LOCUS_28090 17287 17132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 17282 18502 gene locus_tag LOCUS_28100 17282 18502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 18499 20541 gene locus_tag LOCUS_28110 18499 20541 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108809.1 protein_id gnl|my_center|LOCUS_28110 20538 20948 gene locus_tag LOCUS_28120 20538 20948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 20945 22291 gene locus_tag LOCUS_28130 20945 22291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 22288 22692 gene locus_tag LOCUS_28140 22288 22692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 23007 23459 gene locus_tag LOCUS_28150 23007 23459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 23949 24446 gene locus_tag LOCUS_28160 23949 24446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 24471 24821 gene locus_tag LOCUS_28170 24471 24821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 24956 25405 gene locus_tag LOCUS_28180 24956 25405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 25781 25407 gene locus_tag LOCUS_28190 25781 25407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 25944 25741 gene locus_tag LOCUS_28200 25944 25741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 26113 25922 gene locus_tag LOCUS_28210 26113 25922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 26759 26106 gene locus_tag LOCUS_28220 26759 26106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 27319 26756 gene locus_tag LOCUS_28230 27319 26756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 28404 27385 gene locus_tag LOCUS_28240 28404 27385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 28582 28406 gene locus_tag LOCUS_28250 28582 28406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 29196 28600 gene locus_tag LOCUS_28260 29196 28600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 30374 29205 gene locus_tag LOCUS_28270 30374 29205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 31415 30378 gene locus_tag LOCUS_28280 31415 30378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 <34263 31465 gene locus_tag LOCUS_28290 <34263 31465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000082359.1:phage tail tape measure protein >Feature sequence06 1120 818 gene locus_tag LOCUS_28300 1120 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 1779 1435 gene locus_tag LOCUS_28310 1779 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2092 1787 gene locus_tag LOCUS_28320 2092 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 2540 2085 gene locus_tag LOCUS_28330 2540 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 2908 2606 gene locus_tag LOCUS_28340 2908 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 3357 3058 gene locus_tag LOCUS_28350 3357 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 3559 3326 gene locus_tag LOCUS_28360 3559 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 3887 3549 gene locus_tag LOCUS_28370 3887 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 4535 3912 gene locus_tag LOCUS_28380 4535 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 5119 4520 gene locus_tag LOCUS_28390 5119 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 5745 5131 gene locus_tag LOCUS_28400 5745 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 6310 5747 gene locus_tag LOCUS_28410 6310 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 6807 6424 gene locus_tag LOCUS_28420 6807 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 7033 6815 gene locus_tag LOCUS_28430 7033 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 7772 7026 gene locus_tag LOCUS_28440 7772 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 8626 7769 gene locus_tag LOCUS_28450 8626 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 9302 9550 gene locus_tag LOCUS_28460 9302 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 9563 10873 gene locus_tag LOCUS_28470 9563 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 10975 11358 gene locus_tag LOCUS_28480 10975 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 11321 12808 gene locus_tag LOCUS_28490 11321 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 13089 13325 gene locus_tag LOCUS_28500 13089 13325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 13306 13665 gene locus_tag LOCUS_28510 13306 13665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 13635 14048 gene locus_tag LOCUS_28520 13635 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 14169 14618 gene locus_tag LOCUS_28530 14169 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 14623 16299 gene locus_tag LOCUS_28540 14623 16299 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088178.1 protein_id gnl|my_center|LOCUS_28540 16531 17670 gene locus_tag LOCUS_28550 16531 17670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 17734 18414 gene locus_tag LOCUS_28560 17734 18414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 18411 19625 gene locus_tag LOCUS_28570 18411 19625 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938792.1 protein_id gnl|my_center|LOCUS_28570 19711 19920 gene locus_tag LOCUS_28580 19711 19920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 19923 20201 gene locus_tag LOCUS_28590 19923 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 20203 20790 gene locus_tag LOCUS_28600 20203 20790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 20790 21128 gene locus_tag LOCUS_28610 20790 21128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 21125 21637 gene locus_tag LOCUS_28620 21125 21637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 21634 22050 gene locus_tag LOCUS_28630 21634 22050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 22047 22262 gene locus_tag LOCUS_28640 22047 22262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 22288 22713 gene locus_tag LOCUS_28650 22288 22713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 22727 23089 gene locus_tag LOCUS_28660 22727 23089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 23128 23475 gene locus_tag LOCUS_28670 23128 23475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 23468 25939 gene locus_tag LOCUS_28680 23468 25939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 25961 26380 gene locus_tag LOCUS_28690 25961 26380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 26355 26645 gene locus_tag LOCUS_28700 26355 26645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 26645 29953 gene locus_tag LOCUS_28710 26645 29953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 30063 31880 gene locus_tag LOCUS_28720 30063 31880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence07 130 300 gene locus_tag LOCUS_28730 130 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 321 1466 gene locus_tag LOCUS_28740 321 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 1506 2315 gene locus_tag LOCUS_28750 1506 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 2325 3521 gene locus_tag LOCUS_28760 2325 3521 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337207.1 protein_id gnl|my_center|LOCUS_28760 3521 4015 gene locus_tag LOCUS_28770 3521 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 4012 4509 gene locus_tag LOCUS_28780 4012 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 4583 5359 gene locus_tag LOCUS_28790 4583 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 5531 5944 gene locus_tag LOCUS_28800 5531 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 5874 6515 gene locus_tag LOCUS_28810 5874 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 6478 9102 gene locus_tag LOCUS_28820 6478 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 9099 9752 gene locus_tag LOCUS_28830 9099 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 9755 10210 gene locus_tag LOCUS_28840 9755 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 10222 10614 gene locus_tag LOCUS_28850 10222 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 10604 12577 gene locus_tag LOCUS_28860 10604 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 12574 13395 gene locus_tag LOCUS_28870 12574 13395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 13398 15377 gene locus_tag LOCUS_28880 13398 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 15384 15647 gene locus_tag LOCUS_28890 15384 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 15625 15864 gene locus_tag LOCUS_28900 15625 15864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 15861 16280 gene locus_tag LOCUS_28910 15861 16280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 16277 16651 gene locus_tag LOCUS_28920 16277 16651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 16644 16844 gene locus_tag LOCUS_28930 16644 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 16841 17293 gene locus_tag LOCUS_28940 16841 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 17777 17349 gene locus_tag LOCUS_28950 17777 17349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 18210 17764 gene locus_tag LOCUS_28960 18210 17764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 18659 18273 gene locus_tag LOCUS_28970 18659 18273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 19311 18985 gene locus_tag LOCUS_28980 19311 18985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 19744 19493 gene locus_tag LOCUS_28990 19744 19493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 20107 19871 gene locus_tag LOCUS_29000 20107 19871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 20456 20214 gene locus_tag LOCUS_29010 20456 20214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 20766 20479 gene locus_tag LOCUS_29020 20766 20479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 21102 20788 gene locus_tag LOCUS_29030 21102 20788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 21307 21104 gene locus_tag LOCUS_29040 21307 21104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 21582 21295 gene locus_tag LOCUS_29050 21582 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 21791 21585 gene locus_tag LOCUS_29060 21791 21585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 22276 21779 gene locus_tag LOCUS_29070 22276 21779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 22596 22261 gene locus_tag LOCUS_29080 22596 22261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 23338 22688 gene locus_tag LOCUS_29090 23338 22688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 24241 23375 gene locus_tag LOCUS_29100 24241 23375 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229907.1 protein_id gnl|my_center|LOCUS_29100 24506 24225 gene locus_tag LOCUS_29110 24506 24225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 25322 24669 gene locus_tag LOCUS_29120 25322 24669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 26029 26625 gene locus_tag LOCUS_29130 26029 26625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 26629 27339 gene locus_tag LOCUS_29140 26629 27339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 27371 27601 gene locus_tag LOCUS_29150 27371 27601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 27952 29283 gene locus_tag LOCUS_29160 27952 29283 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_29160 29294 29689 gene locus_tag LOCUS_29170 29294 29689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence08 92 484 gene locus_tag LOCUS_29180 92 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 541 1272 gene locus_tag LOCUS_29190 541 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 2225 3202 gene locus_tag LOCUS_29200 2225 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 3352 4557 gene locus_tag LOCUS_29210 3352 4557 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466243.1 protein_id gnl|my_center|LOCUS_29210 4554 5234 gene locus_tag LOCUS_29220 4554 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 5231 6448 gene locus_tag LOCUS_29230 5231 6448 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938792.1 protein_id gnl|my_center|LOCUS_29230 6534 6743 gene locus_tag LOCUS_29240 6534 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 6746 7024 gene locus_tag LOCUS_29250 6746 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 7026 7613 gene locus_tag LOCUS_29260 7026 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 7613 7951 gene locus_tag LOCUS_29270 7613 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 7948 8460 gene locus_tag LOCUS_29280 7948 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 8457 8873 gene locus_tag LOCUS_29290 8457 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 8870 9088 gene locus_tag LOCUS_29300 8870 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 9110 9535 gene locus_tag LOCUS_29310 9110 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 9549 9911 gene locus_tag LOCUS_29320 9549 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 9950 10297 gene locus_tag LOCUS_29330 9950 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 10290 12722 gene locus_tag LOCUS_29340 10290 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 12784 13203 gene locus_tag LOCUS_29350 12784 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 13178 13468 gene locus_tag LOCUS_29360 13178 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 13468 16776 gene locus_tag LOCUS_29370 13468 16776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 16886 17425 gene locus_tag LOCUS_29380 16886 17425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 18209 18760 gene locus_tag LOCUS_29390 18209 18760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 18757 19119 gene locus_tag LOCUS_29400 18757 19119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 19872 19615 gene locus_tag LOCUS_29410 19872 19615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 19941 20199 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctcagaacccatcttccaccacaagaaggattgcgac 22317 20647 gene locus_tag LOCUS_29420 22317 20647 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088178.1 protein_id gnl|my_center|LOCUS_29420 22777 22328 gene locus_tag LOCUS_29430 22777 22328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 23311 22898 gene locus_tag LOCUS_29440 23311 22898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 23640 23281 gene locus_tag LOCUS_29450 23640 23281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 23848 23621 gene locus_tag LOCUS_29460 23848 23621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 24107 23835 gene locus_tag LOCUS_29470 24107 23835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 25947 24133 gene locus_tag LOCUS_29480 25947 24133 CDS product bifunctional DNA primase/helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107640.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence09 685 434 gene locus_tag LOCUS_29490 685 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 3046 692 gene locus_tag LOCUS_29500 3046 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 4584 3043 gene locus_tag LOCUS_29510 4584 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 4990 6666 gene locus_tag LOCUS_29520 4990 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 6786 8267 gene locus_tag LOCUS_29530 6786 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 8292 9764 gene locus_tag LOCUS_29540 8292 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 10894 11496 gene locus_tag LOCUS_29550 gene hisH 10894 11496 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113422.1 protein_id gnl|my_center|LOCUS_29550 11498 12250 gene locus_tag LOCUS_29560 11498 12250 CDS product AglZ/HisF2 family acetamidino modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113421.1 protein_id gnl|my_center|LOCUS_29560 13313 12240 gene locus_tag LOCUS_29570 13313 12240 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_29570 16314 13480 gene locus_tag LOCUS_29580 gene leuS 16314 13480 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_29580 16719 17507 gene locus_tag LOCUS_29590 16719 17507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 17705 19573 gene locus_tag LOCUS_29600 gene yidC 17705 19573 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_29600 20185 19583 gene locus_tag LOCUS_29610 gene def 20185 19583 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_29610 20598 20182 gene locus_tag LOCUS_29620 gene ruvX 20598 20182 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963861.1 protein_id gnl|my_center|LOCUS_29620 21056 20742 gene locus_tag LOCUS_29630 gene rpmA 21056 20742 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759983.1 protein_id gnl|my_center|LOCUS_29630 21397 21089 gene locus_tag LOCUS_29640 21397 21089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 22094 21462 gene locus_tag LOCUS_29650 22094 21462 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_29650 22210 23334 gene locus_tag LOCUS_29660 22210 23334 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 protein_id gnl|my_center|LOCUS_29660 23342 25021 gene locus_tag LOCUS_29670 gene menD 23342 25021 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_29670 25029 25856 gene locus_tag LOCUS_29680 gene menB 25029 25856 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_29680 25865 26779 gene locus_tag LOCUS_29690 25865 26779 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066162.1 protein_id gnl|my_center|LOCUS_29690 >Feature sequence10 800 276 gene locus_tag LOCUS_29700 800 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 994 2340 gene locus_tag LOCUS_29710 994 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 2539 5238 gene locus_tag LOCUS_29720 2539 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 5606 5947 gene locus_tag LOCUS_29730 5606 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 6106 6825 gene locus_tag LOCUS_29740 6106 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 7853 7059 gene locus_tag LOCUS_29750 7853 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 7813 8274 gene locus_tag LOCUS_29760 7813 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 8274 9104 gene locus_tag LOCUS_29770 8274 9104 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057619.1 protein_id gnl|my_center|LOCUS_29770 12832 9116 gene locus_tag LOCUS_29780 12832 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 14379 12829 gene locus_tag LOCUS_29790 14379 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 16593 14902 gene locus_tag LOCUS_29800 16593 14902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 16764 17666 gene locus_tag LOCUS_29810 gene dapA 16764 17666 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_29810 >Feature sequence11 2 6100 gene locus_tag LOCUS_29820 2 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 6102 12848 gene locus_tag LOCUS_29830 6102 12848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 12884 13714 gene locus_tag LOCUS_29840 12884 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 13719 14243 gene locus_tag LOCUS_29850 13719 14243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 14407 14273 gene locus_tag LOCUS_29860 14407 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 14661 15929 gene locus_tag LOCUS_29870 14661 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 15926 16597 gene locus_tag LOCUS_29880 15926 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 16763 16993 gene locus_tag LOCUS_29890 16763 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 17035 17997 gene locus_tag LOCUS_29900 17035 17997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 18505 19602 gene locus_tag LOCUS_29910 18505 19602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 19670 20161 gene locus_tag LOCUS_29920 19670 20161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence12 563 715 gene locus_tag LOCUS_29930 563 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 1053 811 gene locus_tag LOCUS_29940 1053 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 2721 1063 gene locus_tag LOCUS_29950 2721 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 4587 3052 gene locus_tag LOCUS_29960 4587 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 4880 4611 gene locus_tag LOCUS_29970 4880 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 7595 4941 gene locus_tag LOCUS_29980 7595 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 8438 7767 gene locus_tag LOCUS_29990 8438 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 9346 8708 gene locus_tag LOCUS_30000 9346 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 9420 9719 gene locus_tag LOCUS_30010 9420 9719 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361983.1 protein_id gnl|my_center|LOCUS_30010 9688 10149 gene locus_tag LOCUS_30020 9688 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 10342 10515 gene locus_tag LOCUS_30030 10342 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 10854 15359 gene locus_tag LOCUS_30040 10854 15359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 15356 15931 gene locus_tag LOCUS_30050 15356 15931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 <17857 16343 gene locus_tag LOCUS_30060 <17857 16343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583646.1:lipoprotein >Feature sequence13 1198 761 gene locus_tag LOCUS_30070 1198 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 2027 1191 gene locus_tag LOCUS_30080 2027 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 2301 2080 gene locus_tag LOCUS_30090 2301 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 2893 2282 gene locus_tag LOCUS_30100 2893 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3146 2904 gene locus_tag LOCUS_30110 3146 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 3763 3140 gene locus_tag LOCUS_30120 3763 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 4007 3768 gene locus_tag LOCUS_30130 4007 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 4621 4001 gene locus_tag LOCUS_30140 4621 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 12056 4626 gene locus_tag LOCUS_30150 12056 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 >Feature sequence14 >Feature sequence15 1461 931 gene locus_tag LOCUS_30160 1461 931 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814588.1 protein_id gnl|my_center|LOCUS_30160 2217 1855 gene locus_tag LOCUS_30170 2217 1855 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660532.1 protein_id gnl|my_center|LOCUS_30170 2859 2566 gene locus_tag LOCUS_30180 2859 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 4535 2856 gene locus_tag LOCUS_30190 4535 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 5290 4535 gene locus_tag LOCUS_30200 5290 4535 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403622.1 protein_id gnl|my_center|LOCUS_30200 6057 5287 gene locus_tag LOCUS_30210 6057 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204824.1 protein_id gnl|my_center|LOCUS_30210 6899 7180 gene locus_tag LOCUS_30220 6899 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 7180 8229 gene locus_tag LOCUS_30230 7180 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 10039 8474 gene locus_tag LOCUS_30240 10039 8474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 10587 10099 gene locus_tag LOCUS_30250 10587 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 11267 10887 gene locus_tag LOCUS_30260 11267 10887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 12372 11311 gene locus_tag LOCUS_30270 12372 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 >Feature sequence16 1885 272 gene locus_tag LOCUS_30280 1885 272 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058062.1 protein_id gnl|my_center|LOCUS_30280 2918 1830 gene locus_tag LOCUS_30290 2918 1830 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_30290 3545 2922 gene locus_tag LOCUS_30300 gene darT 3545 2922 CDS product toxin-antitoxin system toxin DarT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400548.1 protein_id gnl|my_center|LOCUS_30300 4778 3549 gene locus_tag LOCUS_30310 4778 3549 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058063.1 protein_id gnl|my_center|LOCUS_30310 5775 4768 gene locus_tag LOCUS_30320 5775 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 7548 5893 gene locus_tag LOCUS_30330 7548 5893 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151448733.1 protein_id gnl|my_center|LOCUS_30330 10524 7573 gene locus_tag LOCUS_30340 10524 7573 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058064.1 protein_id gnl|my_center|LOCUS_30340 >Feature sequence17 567 1193 gene locus_tag LOCUS_30350 567 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 1308 2255 gene locus_tag LOCUS_30360 1308 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 2323 3123 gene locus_tag LOCUS_30370 2323 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3163 3999 gene locus_tag LOCUS_30380 3163 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 4012 5286 gene locus_tag LOCUS_30390 4012 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 5519 5833 gene locus_tag LOCUS_30400 5519 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30400 5961 6692 gene locus_tag LOCUS_30410 5961 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30410 6781 7707 gene locus_tag LOCUS_30420 6781 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 7733 11080 gene locus_tag LOCUS_30430 7733 11080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 12240 11170 gene locus_tag LOCUS_30440 12240 11170 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768437.1 protein_id gnl|my_center|LOCUS_30440 >Feature sequence18 >Feature sequence19 1318 50 gene locus_tag LOCUS_30450 1318 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 2783 1341 gene locus_tag LOCUS_30460 2783 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929376.1 protein_id gnl|my_center|LOCUS_30460 3753 2812 gene locus_tag LOCUS_30470 3753 2812 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_30470 4424 3753 gene locus_tag LOCUS_30480 4424 3753 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 protein_id gnl|my_center|LOCUS_30480 5139 4417 gene locus_tag LOCUS_30490 5139 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 6047 5136 gene locus_tag LOCUS_30500 6047 5136 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_30500 6822 6037 gene locus_tag LOCUS_30510 6822 6037 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_30510 7505 6828 gene locus_tag LOCUS_30520 7505 6828 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461004.1 protein_id gnl|my_center|LOCUS_30520 8189 7551 gene locus_tag LOCUS_30530 8189 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 9870 8758 gene locus_tag LOCUS_30540 9870 8758 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824469.1 protein_id gnl|my_center|LOCUS_30540 10750 9872 gene locus_tag LOCUS_30550 10750 9872 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194966.1 protein_id gnl|my_center|LOCUS_30550 11969 10725 gene locus_tag LOCUS_30560 11969 10725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 >Feature sequence20 <1 787 gene locus_tag LOCUS_30570 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963509.1:mannose-1-phosphate guanylyltransferase 886 2070 gene locus_tag LOCUS_30580 886 2070 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_30580 2895 3371 gene locus_tag LOCUS_30590 2895 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 4835 5737 gene locus_tag LOCUS_30600 4835 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30600 5682 6194 gene locus_tag LOCUS_30610 5682 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30610 6424 6152 gene locus_tag LOCUS_30620 6424 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 6888 6481 gene locus_tag LOCUS_30630 6888 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 7064 6885 gene locus_tag LOCUS_30640 7064 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 7351 7109 gene locus_tag LOCUS_30650 7351 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 10085 9615 gene locus_tag LOCUS_30660 10085 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 11283 10075 gene locus_tag LOCUS_30670 11283 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 >Feature sequence21 1320 247 gene locus_tag LOCUS_30680 1320 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30680 1487 2146 gene locus_tag LOCUS_30690 1487 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 3499 2945 gene locus_tag LOCUS_30700 3499 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 4532 3444 gene locus_tag LOCUS_30710 4532 3444 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_30710 5159 4536 gene locus_tag LOCUS_30720 gene darT 5159 4536 CDS product toxin-antitoxin system toxin DarT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400548.1 protein_id gnl|my_center|LOCUS_30720 5723 5163 gene locus_tag LOCUS_30730 5723 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 6471 5737 gene locus_tag LOCUS_30740 6471 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 9498 6547 gene locus_tag LOCUS_30750 9498 6547 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058064.1 protein_id gnl|my_center|LOCUS_30750 >Feature sequence22 9399 10034 gene locus_tag LOCUS_30760 9399 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence23 <1 1011 gene locus_tag LOCUS_30770 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767964.1:phospho-sugar mutase 2563 1124 gene locus_tag LOCUS_30780 2563 1124 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_30780 5744 2577 gene locus_tag LOCUS_30790 5744 2577 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_30790 6931 5996 gene locus_tag LOCUS_30800 6931 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 8230 7067 gene locus_tag LOCUS_30810 8230 7067 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_30810 <9008 8283 gene locus_tag LOCUS_30820 <9008 8283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963512.1:pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase >Feature sequence24 1409 57 gene locus_tag LOCUS_30830 1409 57 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695173.1 protein_id gnl|my_center|LOCUS_30830 2446 1472 gene locus_tag LOCUS_30840 2446 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 3881 2586 gene locus_tag LOCUS_30850 3881 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 4141 5244 gene locus_tag LOCUS_30860 4141 5244 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 protein_id gnl|my_center|LOCUS_30860 6437 5520 gene locus_tag LOCUS_30870 6437 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 6836 6609 gene locus_tag LOCUS_30880 6836 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 7604 6855 gene locus_tag LOCUS_30890 7604 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890