>Feature sequence01 917 135 gene locus_tag LOCUS_00010 gene trpC 917 135 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 protein_id gnl|my_center|LOCUS_00010 2863 1169 gene locus_tag LOCUS_00020 gene purH 2863 1169 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122619.1 protein_id gnl|my_center|LOCUS_00020 3897 2977 gene locus_tag LOCUS_00030 3897 2977 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615838.1 protein_id gnl|my_center|LOCUS_00030 3998 4507 gene locus_tag LOCUS_00040 3998 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4593 5207 gene locus_tag LOCUS_00050 4593 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5301 5768 gene locus_tag LOCUS_00060 5301 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6105 6332 gene locus_tag LOCUS_00070 6105 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6917 6378 gene locus_tag LOCUS_00080 gene smpB 6917 6378 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615559.1 protein_id gnl|my_center|LOCUS_00080 7030 8250 gene locus_tag LOCUS_00090 7030 8250 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615968.1 protein_id gnl|my_center|LOCUS_00090 8266 10623 gene locus_tag LOCUS_00100 8266 10623 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146514631.1 protein_id gnl|my_center|LOCUS_00100 10824 12434 gene locus_tag LOCUS_00110 10824 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12437 14083 gene locus_tag LOCUS_00120 12437 14083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16262 14358 gene locus_tag LOCUS_00130 16262 14358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921289.1 protein_id gnl|my_center|LOCUS_00130 16575 17501 gene locus_tag LOCUS_00140 16575 17501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17716 17435 gene locus_tag LOCUS_00150 17716 17435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18134 17832 gene locus_tag LOCUS_00160 18134 17832 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327966.1 protein_id gnl|my_center|LOCUS_00160 18485 18138 gene locus_tag LOCUS_00170 18485 18138 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_00170 18570 18830 gene locus_tag LOCUS_00180 18570 18830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333356.1 protein_id gnl|my_center|LOCUS_00180 18962 19891 gene locus_tag LOCUS_00190 gene thyX 18962 19891 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_00190 19968 20399 gene locus_tag LOCUS_00200 19968 20399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21724 20483 gene locus_tag LOCUS_00210 21724 20483 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_00210 22305 21721 gene locus_tag LOCUS_00220 22305 21721 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333306.1 protein_id gnl|my_center|LOCUS_00220 22678 22391 gene locus_tag LOCUS_00230 22678 22391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23554 22712 gene locus_tag LOCUS_00240 23554 22712 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333044.1 protein_id gnl|my_center|LOCUS_00240 24351 23551 gene locus_tag LOCUS_00250 24351 23551 CDS product DUF4465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667002.1 protein_id gnl|my_center|LOCUS_00250 25190 24348 gene locus_tag LOCUS_00260 25190 24348 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120930.1 protein_id gnl|my_center|LOCUS_00260 26475 26547 gene locus_tag LOCUS_t00010 26475 26547 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26614 26928 gene locus_tag LOCUS_00270 26614 26928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27703 27017 gene locus_tag LOCUS_00280 27703 27017 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967261.1 protein_id gnl|my_center|LOCUS_00280 29222 27717 gene locus_tag LOCUS_00290 29222 27717 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869326.1 protein_id gnl|my_center|LOCUS_00290 31062 29227 gene locus_tag LOCUS_00300 31062 29227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 32978 31059 gene locus_tag LOCUS_00310 32978 31059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33195 33959 gene locus_tag LOCUS_00320 33195 33959 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667138.1 protein_id gnl|my_center|LOCUS_00320 34051 35346 gene locus_tag LOCUS_00330 34051 35346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35343 35795 gene locus_tag LOCUS_00340 35343 35795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35792 36919 gene locus_tag LOCUS_00350 35792 36919 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_00350 36916 38460 gene locus_tag LOCUS_00360 36916 38460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38489 39151 gene locus_tag LOCUS_00370 38489 39151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 40008 39139 gene locus_tag LOCUS_00380 40008 39139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 41066 40005 gene locus_tag LOCUS_00390 41066 40005 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533312.1 protein_id gnl|my_center|LOCUS_00390 41329 42456 gene locus_tag LOCUS_00400 41329 42456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42571 42906 gene locus_tag LOCUS_00410 42571 42906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 43167 45032 gene locus_tag LOCUS_00420 43167 45032 CDS product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266869.1 protein_id gnl|my_center|LOCUS_00420 46236 45040 gene locus_tag LOCUS_00430 46236 45040 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_00430 46336 47298 gene locus_tag LOCUS_00440 46336 47298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 47295 48101 gene locus_tag LOCUS_00450 47295 48101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 48313 48708 gene locus_tag LOCUS_00460 48313 48708 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_00460 48699 49334 gene locus_tag LOCUS_00470 48699 49334 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_00470 49368 49862 gene locus_tag LOCUS_00480 49368 49862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 49888 51159 gene locus_tag LOCUS_00490 gene nuoD 49888 51159 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_00490 51156 51653 gene locus_tag LOCUS_00500 gene nuoE 51156 51653 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969256.1 protein_id gnl|my_center|LOCUS_00500 51655 53010 gene locus_tag LOCUS_00510 gene nuoF 51655 53010 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_00510 53241 54890 gene locus_tag LOCUS_00520 53241 54890 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_00520 54887 56161 gene locus_tag LOCUS_00530 gene nuoH 54887 56161 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_00530 56158 56691 gene locus_tag LOCUS_00540 56158 56691 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_00540 56688 57521 gene locus_tag LOCUS_00550 56688 57521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 57533 58027 gene locus_tag LOCUS_00560 57533 58027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 58069 60360 gene locus_tag LOCUS_00570 gene nuoL 58069 60360 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_00570 60403 62064 gene locus_tag LOCUS_00580 60403 62064 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061939.1 protein_id gnl|my_center|LOCUS_00580 62061 63833 gene locus_tag LOCUS_00590 62061 63833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 63830 64918 gene locus_tag LOCUS_00600 63830 64918 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122045.1 protein_id gnl|my_center|LOCUS_00600 65740 64955 gene locus_tag LOCUS_00610 65740 64955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 66519 65731 gene locus_tag LOCUS_00620 66519 65731 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_00620 67793 66519 gene locus_tag LOCUS_00630 gene lpxB 67793 66519 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921562.1 protein_id gnl|my_center|LOCUS_00630 68374 67928 gene locus_tag LOCUS_00640 68374 67928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327803.1 protein_id gnl|my_center|LOCUS_00640 69828 68482 gene locus_tag LOCUS_00650 69828 68482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 69890 71134 gene locus_tag LOCUS_00660 69890 71134 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_00660 71134 71484 gene locus_tag LOCUS_00670 71134 71484 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167581.1 protein_id gnl|my_center|LOCUS_00670 72120 71542 gene locus_tag LOCUS_00680 gene cyaB 72120 71542 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 protein_id gnl|my_center|LOCUS_00680 72001 72816 gene locus_tag LOCUS_00690 72001 72816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 73897 72764 gene locus_tag LOCUS_00700 73897 72764 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120858.1 protein_id gnl|my_center|LOCUS_00700 74011 74637 gene locus_tag LOCUS_00710 74011 74637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 74822 77368 gene locus_tag LOCUS_00720 74822 77368 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_00720 77671 78552 gene locus_tag LOCUS_00730 77671 78552 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_00730 78572 79435 gene locus_tag LOCUS_00740 78572 79435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_00740 79432 80499 gene locus_tag LOCUS_00750 79432 80499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 81004 80504 gene locus_tag LOCUS_00760 81004 80504 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 protein_id gnl|my_center|LOCUS_00760 83373 81037 gene locus_tag LOCUS_00770 83373 81037 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_00770 84255 87410 gene locus_tag LOCUS_00780 gene cphA 84255 87410 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_00780 87750 89456 gene locus_tag LOCUS_00790 87750 89456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 89610 90827 gene locus_tag LOCUS_00800 89610 90827 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037385982.1 protein_id gnl|my_center|LOCUS_00800 90861 91769 gene locus_tag LOCUS_00810 90861 91769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 91766 92632 gene locus_tag LOCUS_00820 91766 92632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 93077 92667 gene locus_tag LOCUS_00830 93077 92667 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_00830 93307 93074 gene locus_tag LOCUS_00840 93307 93074 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143788.1 protein_id gnl|my_center|LOCUS_00840 94758 93775 gene locus_tag LOCUS_00850 94758 93775 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122009.1 protein_id gnl|my_center|LOCUS_00850 96119 94755 gene locus_tag LOCUS_00860 96119 94755 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791093.1 protein_id gnl|my_center|LOCUS_00860 97060 96116 gene locus_tag LOCUS_00870 97060 96116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 97265 98350 gene locus_tag LOCUS_00880 97265 98350 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_00880 98482 99528 gene locus_tag LOCUS_00890 98482 99528 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_00890 99569 100426 gene locus_tag LOCUS_00900 99569 100426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 100426 101184 gene locus_tag LOCUS_00910 100426 101184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 101181 102095 gene locus_tag LOCUS_00920 101181 102095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 102089 103171 gene locus_tag LOCUS_00930 102089 103171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 103156 103887 gene locus_tag LOCUS_00940 103156 103887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 103917 107597 gene locus_tag LOCUS_00950 103917 107597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 107662 109155 gene locus_tag LOCUS_00960 107662 109155 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_00960 109487 109269 gene locus_tag LOCUS_00970 109487 109269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 109870 109481 gene locus_tag LOCUS_00980 109870 109481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 110123 109824 gene locus_tag LOCUS_00990 110123 109824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 110854 111087 gene locus_tag LOCUS_01000 110854 111087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 111068 111406 gene locus_tag LOCUS_01010 111068 111406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 111732 111487 gene locus_tag LOCUS_01020 111732 111487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 113724 111760 gene locus_tag LOCUS_01030 113724 111760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 113859 114905 gene locus_tag LOCUS_01040 113859 114905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 115542 114988 gene locus_tag LOCUS_01050 115542 114988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 115892 115557 gene locus_tag LOCUS_01060 115892 115557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 116127 118265 gene locus_tag LOCUS_01070 116127 118265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 119921 118452 gene locus_tag LOCUS_01080 119921 118452 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_01080 123047 119925 gene locus_tag LOCUS_01090 123047 119925 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_01090 123794 123282 gene locus_tag LOCUS_01100 123794 123282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 123872 124795 gene locus_tag LOCUS_01110 123872 124795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 124780 125634 gene locus_tag LOCUS_01120 124780 125634 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_01120 125663 126898 gene locus_tag LOCUS_01130 125663 126898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118845.1 protein_id gnl|my_center|LOCUS_01130 127105 126794 gene locus_tag LOCUS_01140 127105 126794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 127913 127476 gene locus_tag LOCUS_01150 127913 127476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 129453 127972 gene locus_tag LOCUS_01160 gene glgA 129453 127972 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121026.1 protein_id gnl|my_center|LOCUS_01160 129528 130175 gene locus_tag LOCUS_01170 129528 130175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615698.1 protein_id gnl|my_center|LOCUS_01170 132356 130197 gene locus_tag LOCUS_01180 132356 130197 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_01180 132463 133878 gene locus_tag LOCUS_01190 gene argH 132463 133878 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227775.1 protein_id gnl|my_center|LOCUS_01190 133857 135950 gene locus_tag LOCUS_01200 133857 135950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 135922 136980 gene locus_tag LOCUS_01210 135922 136980 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434800.1 protein_id gnl|my_center|LOCUS_01210 138046 137114 gene locus_tag LOCUS_01220 gene lipA 138046 137114 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665013.1 protein_id gnl|my_center|LOCUS_01220 138818 138036 gene locus_tag LOCUS_01230 gene lipB 138818 138036 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_01230 138980 139606 gene locus_tag LOCUS_01240 138980 139606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 143675 139635 gene locus_tag LOCUS_01250 143675 139635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334944.1 protein_id gnl|my_center|LOCUS_01250 143699 145072 gene locus_tag LOCUS_01260 143699 145072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 145922 145140 gene locus_tag LOCUS_01270 145922 145140 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642892.1 protein_id gnl|my_center|LOCUS_01270 146097 145939 gene locus_tag LOCUS_01280 146097 145939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 147018 146158 gene locus_tag LOCUS_01290 147018 146158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 148833 147046 gene locus_tag LOCUS_01300 148833 147046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 149092 148835 gene locus_tag LOCUS_01310 149092 148835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 150093 149116 gene locus_tag LOCUS_01320 150093 149116 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665997.1 protein_id gnl|my_center|LOCUS_01320 150183 151937 gene locus_tag LOCUS_01330 150183 151937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 152597 151956 gene locus_tag LOCUS_01340 152597 151956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 154470 152608 gene locus_tag LOCUS_01350 154470 152608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 154673 156787 gene locus_tag LOCUS_01360 gene metG 154673 156787 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120499.1 protein_id gnl|my_center|LOCUS_01360 156882 157346 gene locus_tag LOCUS_01370 156882 157346 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 protein_id gnl|my_center|LOCUS_01370 157451 158392 gene locus_tag LOCUS_01380 gene epmA 157451 158392 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921800.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01380 158047 158140 gene locus_tag LOCUS_t00020 158047 158140 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 158981 158373 gene locus_tag LOCUS_01390 158981 158373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 159577 158990 gene locus_tag LOCUS_01400 159577 158990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 161416 159590 gene locus_tag LOCUS_01410 161416 159590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 162660 161488 gene locus_tag LOCUS_01420 162660 161488 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_01420 163539 162763 gene locus_tag LOCUS_01430 gene hisF 163539 162763 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325161.1 protein_id gnl|my_center|LOCUS_01430 164396 163539 gene locus_tag LOCUS_01440 164396 163539 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120018.1 protein_id gnl|my_center|LOCUS_01440 164698 164462 gene locus_tag LOCUS_01450 gene thiS 164698 164462 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_01450 165306 164722 gene locus_tag LOCUS_01460 165306 164722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 167068 165341 gene locus_tag LOCUS_01470 167068 165341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 167264 168964 gene locus_tag LOCUS_01480 167264 168964 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_01480 169027 170568 gene locus_tag LOCUS_01490 169027 170568 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287286.1 protein_id gnl|my_center|LOCUS_01490 171805 170915 gene locus_tag LOCUS_01500 171805 170915 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921963.1 protein_id gnl|my_center|LOCUS_01500 171954 173150 gene locus_tag LOCUS_01510 171954 173150 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669535.1 protein_id gnl|my_center|LOCUS_01510 173157 173972 gene locus_tag LOCUS_01520 173157 173972 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_01520 174844 174023 gene locus_tag LOCUS_01530 174844 174023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 175228 174881 gene locus_tag LOCUS_01540 175228 174881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328915.1 protein_id gnl|my_center|LOCUS_01540 175362 176504 gene locus_tag LOCUS_01550 gene nadA 175362 176504 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_01550 177158 176523 gene locus_tag LOCUS_01560 177158 176523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 180013 177254 gene locus_tag LOCUS_01570 180013 177254 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_01570 180279 181220 gene locus_tag LOCUS_01580 180279 181220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 182767 181247 gene locus_tag LOCUS_01590 182767 181247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 183999 183019 gene locus_tag LOCUS_01600 183999 183019 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_01600 184688 183999 gene locus_tag LOCUS_01610 184688 183999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 185754 184738 gene locus_tag LOCUS_01620 gene floA 185754 184738 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327694.1 protein_id gnl|my_center|LOCUS_01620 186428 185823 gene locus_tag LOCUS_01630 186428 185823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 188623 186443 gene locus_tag LOCUS_01640 188623 186443 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921569.1 protein_id gnl|my_center|LOCUS_01640 188724 189278 gene locus_tag LOCUS_01650 gene pyrE 188724 189278 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846080.1 protein_id gnl|my_center|LOCUS_01650 189404 191236 gene locus_tag LOCUS_01660 189404 191236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 191249 192079 gene locus_tag LOCUS_01670 191249 192079 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229478.1 protein_id gnl|my_center|LOCUS_01670 192461 192012 gene locus_tag LOCUS_01680 192461 192012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 193075 192458 gene locus_tag LOCUS_01690 193075 192458 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_01690 193136 195982 gene locus_tag LOCUS_01700 193136 195982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01700 193252 193179 gene locus_tag LOCUS_t00030 193252 193179 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 196061 199486 gene locus_tag LOCUS_01710 196061 199486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01710 200775 199543 gene locus_tag LOCUS_01720 200775 199543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 201330 200836 gene locus_tag LOCUS_01730 201330 200836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 201747 201331 gene locus_tag LOCUS_01740 201747 201331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 201640 201894 gene locus_tag LOCUS_01750 201640 201894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 202520 213346 gene locus_tag LOCUS_01760 202520 213346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 214418 213399 gene locus_tag LOCUS_01770 214418 213399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022102.1 protein_id gnl|my_center|LOCUS_01770 214479 215531 gene locus_tag LOCUS_01780 214479 215531 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_01780 216414 215509 gene locus_tag LOCUS_01790 216414 215509 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_01790 216337 216519 gene locus_tag LOCUS_01800 216337 216519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 216682 217518 gene locus_tag LOCUS_01810 216682 217518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 217708 218163 gene locus_tag LOCUS_01820 217708 218163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 218193 219200 gene locus_tag LOCUS_01830 gene hflK 218193 219200 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_01830 219212 220240 gene locus_tag LOCUS_01840 gene hflC 219212 220240 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_01840 220319 221041 gene locus_tag LOCUS_01850 220319 221041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 221071 221143 gene locus_tag LOCUS_t00040 221071 221143 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 222793 221381 gene locus_tag LOCUS_01860 222793 221381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 >Feature sequence02 519 238 gene locus_tag LOCUS_01870 519 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 966 592 gene locus_tag LOCUS_01880 966 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 2174 1371 gene locus_tag LOCUS_01890 2174 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 2735 2268 gene locus_tag LOCUS_01900 2735 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 3077 2844 gene locus_tag LOCUS_01910 3077 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 4365 3370 gene locus_tag LOCUS_01920 4365 3370 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_01920 6217 4544 gene locus_tag LOCUS_01930 gene ettA 6217 4544 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329503.1 protein_id gnl|my_center|LOCUS_01930 6360 7226 gene locus_tag LOCUS_01940 6360 7226 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_01940 7256 7693 gene locus_tag LOCUS_01950 7256 7693 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256843.1 protein_id gnl|my_center|LOCUS_01950 7728 8735 gene locus_tag LOCUS_01960 7728 8735 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_01960 9982 8852 gene locus_tag LOCUS_01970 gene hpnH 9982 8852 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_01970 12195 9979 gene locus_tag LOCUS_01980 gene shc 12195 9979 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_01980 13582 12386 gene locus_tag LOCUS_01990 13582 12386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 14219 13632 gene locus_tag LOCUS_02000 14219 13632 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_02000 15158 14550 gene locus_tag LOCUS_02010 15158 14550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921915.1 protein_id gnl|my_center|LOCUS_02010 16854 15163 gene locus_tag LOCUS_02020 16854 15163 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_02020 18405 17113 gene locus_tag LOCUS_02030 18405 17113 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_02030 19415 18402 gene locus_tag LOCUS_02040 19415 18402 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922725.1 protein_id gnl|my_center|LOCUS_02040 19841 19452 gene locus_tag LOCUS_02050 19841 19452 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_02050 19896 20567 gene locus_tag LOCUS_02060 gene queC 19896 20567 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463447.1 protein_id gnl|my_center|LOCUS_02060 20584 21285 gene locus_tag LOCUS_02070 20584 21285 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921555.1 protein_id gnl|my_center|LOCUS_02070 22611 21592 gene locus_tag LOCUS_02080 22611 21592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 23756 22662 gene locus_tag LOCUS_02090 gene waaF 23756 22662 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526219.1 protein_id gnl|my_center|LOCUS_02090 27393 23809 gene locus_tag LOCUS_02100 27393 23809 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_02100 28055 27390 gene locus_tag LOCUS_02110 28055 27390 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_02110 28538 28089 gene locus_tag LOCUS_02120 28538 28089 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_02120 28832 28554 gene locus_tag LOCUS_02130 gene rpsR 28832 28554 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236620859.1 protein_id gnl|my_center|LOCUS_02130 29397 29008 gene locus_tag LOCUS_02140 29397 29008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 29961 29887 gene locus_tag LOCUS_t00050 29961 29887 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 30285 30007 gene locus_tag LOCUS_02150 30285 30007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 30482 30300 gene locus_tag LOCUS_02160 30482 30300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 32258 30615 gene locus_tag LOCUS_02170 32258 30615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 32717 32271 gene locus_tag LOCUS_02180 32717 32271 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_02180 33638 32721 gene locus_tag LOCUS_02190 33638 32721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 34522 33944 gene locus_tag LOCUS_02200 34522 33944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329453.1 protein_id gnl|my_center|LOCUS_02200 35850 34723 gene locus_tag LOCUS_02210 35850 34723 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329274.1 protein_id gnl|my_center|LOCUS_02210 36351 35995 gene locus_tag LOCUS_02220 36351 35995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 38431 36395 gene locus_tag LOCUS_02230 38431 36395 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325434.1 protein_id gnl|my_center|LOCUS_02230 38475 38548 gene locus_tag LOCUS_t00060 38475 38548 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 38619 38691 gene locus_tag LOCUS_t00070 38619 38691 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 38833 39246 gene locus_tag LOCUS_02240 38833 39246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 39341 41188 gene locus_tag LOCUS_02250 gene typA 39341 41188 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324768.1 protein_id gnl|my_center|LOCUS_02250 41985 41221 gene locus_tag LOCUS_02260 41985 41221 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_02260 43574 42042 gene locus_tag LOCUS_02270 43574 42042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 43801 43995 gene locus_tag LOCUS_02280 gene rpsU 43801 43995 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338941.1 protein_id gnl|my_center|LOCUS_02280 45169 44114 gene locus_tag LOCUS_02290 45169 44114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 46210 45383 gene locus_tag LOCUS_02300 46210 45383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 47605 46664 gene locus_tag LOCUS_02310 gene nadC 47605 46664 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921990.1 protein_id gnl|my_center|LOCUS_02310 47759 48151 gene locus_tag LOCUS_02320 47759 48151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 48162 50231 gene locus_tag LOCUS_02330 gene uvrB 48162 50231 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 protein_id gnl|my_center|LOCUS_02330 50274 51380 gene locus_tag LOCUS_02340 50274 51380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 52366 51413 gene locus_tag LOCUS_02350 52366 51413 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919474.1 protein_id gnl|my_center|LOCUS_02350 53410 52460 gene locus_tag LOCUS_02360 53410 52460 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_02360 54945 53419 gene locus_tag LOCUS_02370 54945 53419 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_02370 55191 55994 gene locus_tag LOCUS_02380 55191 55994 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 protein_id gnl|my_center|LOCUS_02380 56297 56031 gene locus_tag LOCUS_02390 56297 56031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 56723 56795 gene locus_tag LOCUS_t00080 56723 56795 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 56920 58026 gene locus_tag LOCUS_02400 56920 58026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 59019 58030 gene locus_tag LOCUS_02410 gene corA 59019 58030 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_02410 59236 59484 gene locus_tag LOCUS_02420 59236 59484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 59615 60055 gene locus_tag LOCUS_02430 59615 60055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 60063 61106 gene locus_tag LOCUS_02440 gene atpB 60063 61106 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327177.1 protein_id gnl|my_center|LOCUS_02440 61331 61651 gene locus_tag LOCUS_02450 61331 61651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 61792 62496 gene locus_tag LOCUS_02460 61792 62496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 62531 63169 gene locus_tag LOCUS_02470 gene atpH 62531 63169 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403676.1 protein_id gnl|my_center|LOCUS_02470 63129 64679 gene locus_tag LOCUS_02480 gene atpA 63129 64679 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334261.1 protein_id gnl|my_center|LOCUS_02480 64714 65601 gene locus_tag LOCUS_02490 gene atpG 64714 65601 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122671.1 protein_id gnl|my_center|LOCUS_02490 65709 67175 gene locus_tag LOCUS_02500 gene atpD 65709 67175 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122672.1 protein_id gnl|my_center|LOCUS_02500 67201 67644 gene locus_tag LOCUS_02510 67201 67644 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327186.1 protein_id gnl|my_center|LOCUS_02510 68687 67686 gene locus_tag LOCUS_02520 68687 67686 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_02520 69686 68967 gene locus_tag LOCUS_02530 gene hisA 69686 68967 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327023.1 protein_id gnl|my_center|LOCUS_02530 70423 69821 gene locus_tag LOCUS_02540 gene hisH 70423 69821 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333911.1 protein_id gnl|my_center|LOCUS_02540 71333 70470 gene locus_tag LOCUS_02550 71333 70470 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921566.1 protein_id gnl|my_center|LOCUS_02550 72694 71540 gene locus_tag LOCUS_02560 72694 71540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 73248 72691 gene locus_tag LOCUS_02570 73248 72691 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119378.1 protein_id gnl|my_center|LOCUS_02570 74804 73302 gene locus_tag LOCUS_02580 gene aroE 74804 73302 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_02580 76661 74847 gene locus_tag LOCUS_02590 gene mutL 76661 74847 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390696.1 protein_id gnl|my_center|LOCUS_02590 78115 76643 gene locus_tag LOCUS_02600 78115 76643 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_02600 78999 78244 gene locus_tag LOCUS_02610 78999 78244 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656119.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02610 81129 79036 gene locus_tag LOCUS_02620 gene pnp 81129 79036 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037246149.1 protein_id gnl|my_center|LOCUS_02620 81636 81367 gene locus_tag LOCUS_02630 gene rpsO 81636 81367 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329975.1 protein_id gnl|my_center|LOCUS_02630 82951 81863 gene locus_tag LOCUS_02640 82951 81863 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921799.1 protein_id gnl|my_center|LOCUS_02640 84445 83084 gene locus_tag LOCUS_02650 84445 83084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 85741 84554 gene locus_tag LOCUS_02660 gene aroC 85741 84554 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_02660 86698 85778 gene locus_tag LOCUS_02670 86698 85778 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_02670 90190 86960 gene locus_tag LOCUS_02680 90190 86960 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922671.1 protein_id gnl|my_center|LOCUS_02680 91997 90222 gene locus_tag LOCUS_02690 91997 90222 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123477.1 protein_id gnl|my_center|LOCUS_02690 92764 91982 gene locus_tag LOCUS_02700 92764 91982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 92863 93993 gene locus_tag LOCUS_02710 92863 93993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 95698 94010 gene locus_tag LOCUS_02720 95698 94010 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_02720 96627 95695 gene locus_tag LOCUS_02730 96627 95695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 96858 97829 gene locus_tag LOCUS_02740 96858 97829 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122566.1 protein_id gnl|my_center|LOCUS_02740 97826 98971 gene locus_tag LOCUS_02750 97826 98971 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324953.1 protein_id gnl|my_center|LOCUS_02750 100091 99282 gene locus_tag LOCUS_02760 100091 99282 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095420.1 protein_id gnl|my_center|LOCUS_02760 100222 100148 gene locus_tag LOCUS_t00090 100222 100148 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 101208 100420 gene locus_tag LOCUS_02770 101208 100420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 101337 101864 gene locus_tag LOCUS_02780 101337 101864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 102879 101851 gene locus_tag LOCUS_02790 102879 101851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 103708 103097 gene locus_tag LOCUS_02800 103708 103097 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037422.1 protein_id gnl|my_center|LOCUS_02800 104069 105187 gene locus_tag LOCUS_02810 104069 105187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 105219 106796 gene locus_tag LOCUS_02820 gene gltX 105219 106796 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922083.1 protein_id gnl|my_center|LOCUS_02820 106874 108724 gene locus_tag LOCUS_02830 106874 108724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 108815 109717 gene locus_tag LOCUS_02840 108815 109717 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_02840 109916 111019 gene locus_tag LOCUS_02850 gene recA 109916 111019 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813294.1 protein_id gnl|my_center|LOCUS_02850 111233 113845 gene locus_tag LOCUS_02860 gene alaS 111233 113845 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121911.1 protein_id gnl|my_center|LOCUS_02860 114379 113858 gene locus_tag LOCUS_02870 gene tpx 114379 113858 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326977.1 protein_id gnl|my_center|LOCUS_02870 114403 114774 gene locus_tag LOCUS_02880 114403 114774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 114771 115799 gene locus_tag LOCUS_02890 114771 115799 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_02890 115827 116123 gene locus_tag LOCUS_02900 115827 116123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 116204 117367 gene locus_tag LOCUS_02910 116204 117367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 117458 118390 gene locus_tag LOCUS_02920 117458 118390 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_02920 118871 118554 gene locus_tag LOCUS_02930 gene rpsT 118871 118554 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771970.1 protein_id gnl|my_center|LOCUS_02930 120364 118925 gene locus_tag LOCUS_02940 120364 118925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 120644 122206 gene locus_tag LOCUS_02950 gene cobA 120644 122206 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121206.1 protein_id gnl|my_center|LOCUS_02950 122351 123076 gene locus_tag LOCUS_02960 122351 123076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 123264 123079 gene locus_tag LOCUS_02970 123264 123079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 123413 123919 gene locus_tag LOCUS_02980 gene coaD 123413 123919 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122863.1 protein_id gnl|my_center|LOCUS_02980 125049 123970 gene locus_tag LOCUS_02990 125049 123970 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_02990 125657 125046 gene locus_tag LOCUS_03000 125657 125046 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_03000 125882 127435 gene locus_tag LOCUS_03010 gene trpE 125882 127435 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_03010 127432 128331 gene locus_tag LOCUS_03020 127432 128331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 129751 128348 gene locus_tag LOCUS_03030 129751 128348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 129905 130408 gene locus_tag LOCUS_03040 129905 130408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328133.1 protein_id gnl|my_center|LOCUS_03040 131516 130683 gene locus_tag LOCUS_03050 gene trpA 131516 130683 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921878.1 protein_id gnl|my_center|LOCUS_03050 132791 131517 gene locus_tag LOCUS_03060 gene trpB 132791 131517 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324127.1 protein_id gnl|my_center|LOCUS_03060 132929 133774 gene locus_tag LOCUS_03070 132929 133774 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121456.1 protein_id gnl|my_center|LOCUS_03070 133885 134883 gene locus_tag LOCUS_03080 133885 134883 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814616.1 protein_id gnl|my_center|LOCUS_03080 134903 136087 gene locus_tag LOCUS_03090 gene thiO 134903 136087 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_03090 136783 136121 gene locus_tag LOCUS_03100 136783 136121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 137507 136776 gene locus_tag LOCUS_03110 137507 136776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 138001 137522 gene locus_tag LOCUS_03120 138001 137522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 138409 142017 gene locus_tag LOCUS_03130 gene metH 138409 142017 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922281.1 protein_id gnl|my_center|LOCUS_03130 142171 143055 gene locus_tag LOCUS_03140 gene xerD 142171 143055 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921953.1 protein_id gnl|my_center|LOCUS_03140 143554 143072 gene locus_tag LOCUS_03150 143554 143072 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327445.1 protein_id gnl|my_center|LOCUS_03150 144001 143558 gene locus_tag LOCUS_03160 144001 143558 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327446.1 protein_id gnl|my_center|LOCUS_03160 144865 144008 gene locus_tag LOCUS_03170 144865 144008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 146060 144930 gene locus_tag LOCUS_03180 146060 144930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 149446 146126 gene locus_tag LOCUS_03190 149446 146126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922202.1 protein_id gnl|my_center|LOCUS_03190 151215 149542 gene locus_tag LOCUS_03200 gene serA 151215 149542 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326392.1 protein_id gnl|my_center|LOCUS_03200 152394 151273 gene locus_tag LOCUS_03210 gene serC 152394 151273 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434814.1 protein_id gnl|my_center|LOCUS_03210 153317 152484 gene locus_tag LOCUS_03220 153317 152484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 153727 153470 gene locus_tag LOCUS_03230 153727 153470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 155168 154512 gene locus_tag LOCUS_03240 155168 154512 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325534.1 protein_id gnl|my_center|LOCUS_03240 156141 155329 gene locus_tag LOCUS_03250 156141 155329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 156616 156230 gene locus_tag LOCUS_03260 gene gcvH 156616 156230 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 protein_id gnl|my_center|LOCUS_03260 157746 156646 gene locus_tag LOCUS_03270 gene gcvT 157746 156646 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121468.1 protein_id gnl|my_center|LOCUS_03270 160031 157956 gene locus_tag LOCUS_03280 160031 157956 CDS product VacB/RNase II family 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121841.1 protein_id gnl|my_center|LOCUS_03280 161229 160180 gene locus_tag LOCUS_03290 161229 160180 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_03290 161330 162835 gene locus_tag LOCUS_03300 gene proS 161330 162835 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_03300 163176 164369 gene locus_tag LOCUS_03310 163176 164369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 164379 165965 gene locus_tag LOCUS_03320 164379 165965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 166724 165975 gene locus_tag LOCUS_03330 166724 165975 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340094.1 protein_id gnl|my_center|LOCUS_03330 167986 166784 gene locus_tag LOCUS_03340 167986 166784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 168369 167983 gene locus_tag LOCUS_03350 168369 167983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 171101 168420 gene locus_tag LOCUS_03360 171101 168420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 172532 171210 gene locus_tag LOCUS_03370 gene nusA 172532 171210 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120487.1 protein_id gnl|my_center|LOCUS_03370 174107 172782 gene locus_tag LOCUS_03380 174107 172782 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_03380 175175 174192 gene locus_tag LOCUS_03390 175175 174192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 176517 175276 gene locus_tag LOCUS_03400 gene fabF 176517 175276 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_03400 176765 176529 gene locus_tag LOCUS_03410 176765 176529 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 protein_id gnl|my_center|LOCUS_03410 177773 176985 gene locus_tag LOCUS_03420 gene fabG 177773 176985 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_03420 178732 177800 gene locus_tag LOCUS_03430 gene fabD 178732 177800 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117846.1 protein_id gnl|my_center|LOCUS_03430 178915 178736 gene locus_tag LOCUS_03440 gene rpmF 178915 178736 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402828.1 protein_id gnl|my_center|LOCUS_03440 180026 179004 gene locus_tag LOCUS_03450 gene ruvB 180026 179004 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331968.1 protein_id gnl|my_center|LOCUS_03450 180917 180282 gene locus_tag LOCUS_03460 180917 180282 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326966.1 protein_id gnl|my_center|LOCUS_03460 181456 180914 gene locus_tag LOCUS_03470 gene ruvC 181456 180914 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 protein_id gnl|my_center|LOCUS_03470 182006 181933 gene locus_tag LOCUS_t00100 182006 181933 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 184826 182097 gene locus_tag LOCUS_03480 184826 182097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 185089 185637 gene locus_tag LOCUS_03490 185089 185637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 185791 187347 gene locus_tag LOCUS_03500 185791 187347 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 protein_id gnl|my_center|LOCUS_03500 187425 189002 gene locus_tag LOCUS_03510 gene crtI 187425 189002 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_03510 189010 189825 gene locus_tag LOCUS_03520 189010 189825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 189822 190982 gene locus_tag LOCUS_03530 189822 190982 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922473.1 protein_id gnl|my_center|LOCUS_03530 192276 191071 gene locus_tag LOCUS_03540 192276 191071 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040295.1 protein_id gnl|my_center|LOCUS_03540 192815 192249 gene locus_tag LOCUS_03550 gene purE 192815 192249 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_03550 192857 193915 gene locus_tag LOCUS_03560 192857 193915 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_03560 194846 193935 gene locus_tag LOCUS_03570 194846 193935 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_03570 195041 196249 gene locus_tag LOCUS_03580 195041 196249 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121030.1 protein_id gnl|my_center|LOCUS_03580 196250 197176 gene locus_tag LOCUS_03590 196250 197176 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_03590 197179 198291 gene locus_tag LOCUS_03600 197179 198291 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_03600 198641 198360 gene locus_tag LOCUS_03610 198641 198360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 199702 198920 gene locus_tag LOCUS_03620 199702 198920 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329167.1 protein_id gnl|my_center|LOCUS_03620 200236 199802 gene locus_tag LOCUS_03630 gene arfB 200236 199802 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_03630 200443 201267 gene locus_tag LOCUS_03640 200443 201267 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228703.1 protein_id gnl|my_center|LOCUS_03640 202221 201298 gene locus_tag LOCUS_03650 202221 201298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923059.1 protein_id gnl|my_center|LOCUS_03650 202428 204263 gene locus_tag LOCUS_03660 202428 204263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 207800 204309 gene locus_tag LOCUS_03670 207800 204309 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117884.1 protein_id gnl|my_center|LOCUS_03670 208204 207977 gene locus_tag LOCUS_03680 208204 207977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 209199 208201 gene locus_tag LOCUS_03690 gene rsmA 209199 208201 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922514.1 protein_id gnl|my_center|LOCUS_03690 209897 209196 gene locus_tag LOCUS_03700 209897 209196 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 protein_id gnl|my_center|LOCUS_03700 210015 211304 gene locus_tag LOCUS_03710 gene eno 210015 211304 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123706.1 protein_id gnl|my_center|LOCUS_03710 211371 211709 gene locus_tag LOCUS_03720 211371 211709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 212293 211730 gene locus_tag LOCUS_03730 212293 211730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 214266 212557 gene locus_tag LOCUS_03740 214266 212557 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_03740 215697 214270 gene locus_tag LOCUS_03750 215697 214270 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247553.1 protein_id gnl|my_center|LOCUS_03750 216759 216019 gene locus_tag LOCUS_03760 216759 216019 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336481.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence03 1 2487 gene locus_tag LOCUS_03770 1 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 3781 2540 gene locus_tag LOCUS_03780 gene fabF 3781 2540 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_03780 4613 3933 gene locus_tag LOCUS_03790 4613 3933 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_03790 4800 5447 gene locus_tag LOCUS_03800 4800 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 5566 6702 gene locus_tag LOCUS_03810 5566 6702 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_03810 6699 8621 gene locus_tag LOCUS_03820 6699 8621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03820 8614 11004 gene locus_tag LOCUS_03830 8614 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 11046 12230 gene locus_tag LOCUS_03840 11046 12230 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_03840 12504 13601 gene locus_tag LOCUS_03850 12504 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 13896 14225 gene locus_tag LOCUS_03860 13896 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 15312 14398 gene locus_tag LOCUS_03870 15312 14398 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616128.1 protein_id gnl|my_center|LOCUS_03870 16979 15483 gene locus_tag LOCUS_03880 16979 15483 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_03880 19321 16973 gene locus_tag LOCUS_03890 19321 16973 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119132.1 protein_id gnl|my_center|LOCUS_03890 20770 19790 gene locus_tag LOCUS_03900 20770 19790 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921398.1 protein_id gnl|my_center|LOCUS_03900 20932 22371 gene locus_tag LOCUS_03910 20932 22371 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_03910 22558 23385 gene locus_tag LOCUS_03920 22558 23385 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_03920 23409 24662 gene locus_tag LOCUS_03930 23409 24662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 24724 25197 gene locus_tag LOCUS_03940 24724 25197 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_03940 25798 25385 gene locus_tag LOCUS_03950 25798 25385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 26003 25788 gene locus_tag LOCUS_03960 26003 25788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 26410 26553 gene locus_tag LOCUS_03970 26410 26553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 29620 26558 gene locus_tag LOCUS_03980 29620 26558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 30029 29613 gene locus_tag LOCUS_03990 30029 29613 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_03990 30742 30026 gene locus_tag LOCUS_04000 30742 30026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 33996 30739 gene locus_tag LOCUS_04010 33996 30739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 36811 34073 gene locus_tag LOCUS_04020 36811 34073 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392406.1 protein_id gnl|my_center|LOCUS_04020 37119 38126 gene locus_tag LOCUS_04030 37119 38126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 38140 39096 gene locus_tag LOCUS_04040 38140 39096 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_04040 42364 39179 gene locus_tag LOCUS_04050 42364 39179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 42254 42532 gene locus_tag LOCUS_04060 42254 42532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 42932 43159 gene locus_tag LOCUS_04070 42932 43159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 43156 43557 gene locus_tag LOCUS_04080 43156 43557 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249840.1 protein_id gnl|my_center|LOCUS_04080 43812 44867 gene locus_tag LOCUS_04090 43812 44867 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400558.1 protein_id gnl|my_center|LOCUS_04090 45592 44885 gene locus_tag LOCUS_04100 45592 44885 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226658.1 protein_id gnl|my_center|LOCUS_04100 46361 46008 gene locus_tag LOCUS_04110 46361 46008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 46743 46327 gene locus_tag LOCUS_04120 46743 46327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 47664 46954 gene locus_tag LOCUS_04130 47664 46954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 48063 48314 gene locus_tag LOCUS_04140 gene yefM 48063 48314 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259256.1 protein_id gnl|my_center|LOCUS_04140 48311 48568 gene locus_tag LOCUS_04150 gene yoeB 48311 48568 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_04150 48995 49207 gene locus_tag LOCUS_04160 48995 49207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 52047 49252 gene locus_tag LOCUS_04170 52047 49252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921842.1 protein_id gnl|my_center|LOCUS_04170 54258 52051 gene locus_tag LOCUS_04180 54258 52051 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120349.1 protein_id gnl|my_center|LOCUS_04180 55646 54255 gene locus_tag LOCUS_04190 55646 54255 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_04190 55750 56556 gene locus_tag LOCUS_04200 55750 56556 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118984.1 protein_id gnl|my_center|LOCUS_04200 56985 56629 gene locus_tag LOCUS_04210 56985 56629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 58700 56982 gene locus_tag LOCUS_04220 58700 56982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 59324 58890 gene locus_tag LOCUS_04230 59324 58890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 60400 59336 gene locus_tag LOCUS_04240 60400 59336 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 protein_id gnl|my_center|LOCUS_04240 64065 60397 gene locus_tag LOCUS_04250 64065 60397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 64405 64211 gene locus_tag LOCUS_04260 64405 64211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 64449 64700 gene locus_tag LOCUS_04270 64449 64700 CDS product type II toxin-antitoxin system Y4mF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875278.1 protein_id gnl|my_center|LOCUS_04270 67518 64768 gene locus_tag LOCUS_04280 67518 64768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 68849 67515 gene locus_tag LOCUS_04290 68849 67515 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_04290 71554 68846 gene locus_tag LOCUS_04300 71554 68846 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_04300 72726 71551 gene locus_tag LOCUS_04310 72726 71551 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_04310 72698 72880 gene locus_tag LOCUS_04320 72698 72880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 73074 74105 gene locus_tag LOCUS_04330 73074 74105 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188711.1 protein_id gnl|my_center|LOCUS_04330 77101 74429 gene locus_tag LOCUS_04340 77101 74429 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_04340 78246 77098 gene locus_tag LOCUS_04350 78246 77098 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_04350 79651 79238 gene locus_tag LOCUS_04360 79651 79238 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094555.1 protein_id gnl|my_center|LOCUS_04360 80133 79651 gene locus_tag LOCUS_04370 80133 79651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 81891 80353 gene locus_tag LOCUS_04380 81891 80353 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 protein_id gnl|my_center|LOCUS_04380 82015 82326 gene locus_tag LOCUS_04390 82015 82326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400556.1 protein_id gnl|my_center|LOCUS_04390 82387 82878 gene locus_tag LOCUS_04400 82387 82878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 82975 84531 gene locus_tag LOCUS_04410 82975 84531 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262019.1 protein_id gnl|my_center|LOCUS_04410 84599 84946 gene locus_tag LOCUS_04420 84599 84946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 84957 85625 gene locus_tag LOCUS_04430 84957 85625 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_04430 85838 85611 gene locus_tag LOCUS_04440 85838 85611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 86147 87007 gene locus_tag LOCUS_04450 86147 87007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 87076 88338 gene locus_tag LOCUS_04460 87076 88338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 88338 89156 gene locus_tag LOCUS_04470 88338 89156 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_04470 91308 89197 gene locus_tag LOCUS_04480 91308 89197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 91507 92061 gene locus_tag LOCUS_04490 gene fae 91507 92061 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122249.1 protein_id gnl|my_center|LOCUS_04490 93112 92171 gene locus_tag LOCUS_04500 93112 92171 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526198.1 protein_id gnl|my_center|LOCUS_04500 93148 94416 gene locus_tag LOCUS_04510 93148 94416 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118020.1 protein_id gnl|my_center|LOCUS_04510 94413 95828 gene locus_tag LOCUS_04520 94413 95828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921337.1 protein_id gnl|my_center|LOCUS_04520 95858 96040 gene locus_tag LOCUS_04530 95858 96040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 96189 97922 gene locus_tag LOCUS_04540 96189 97922 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066137.1 protein_id gnl|my_center|LOCUS_04540 98443 98078 gene locus_tag LOCUS_04550 98443 98078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 98980 98462 gene locus_tag LOCUS_04560 98980 98462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 99155 99243 gene locus_tag LOCUS_t00110 99155 99243 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 99374 99829 gene locus_tag LOCUS_04570 99374 99829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 102055 100733 gene locus_tag LOCUS_04580 102055 100733 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_04580 104815 102065 gene locus_tag LOCUS_04590 gene ppc 104815 102065 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_04590 105140 106633 gene locus_tag LOCUS_04600 105140 106633 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_04600 107101 106709 gene locus_tag LOCUS_04610 107101 106709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 107682 107005 gene locus_tag LOCUS_04620 107682 107005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 108581 107862 gene locus_tag LOCUS_04630 108581 107862 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 protein_id gnl|my_center|LOCUS_04630 110150 108603 gene locus_tag LOCUS_04640 110150 108603 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339151.1 protein_id gnl|my_center|LOCUS_04640 110367 111119 gene locus_tag LOCUS_04650 gene rnc 110367 111119 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120177.1 protein_id gnl|my_center|LOCUS_04650 111370 113661 gene locus_tag LOCUS_04660 111370 113661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 114871 113882 gene locus_tag LOCUS_04670 114871 113882 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259367.1 protein_id gnl|my_center|LOCUS_04670 117624 114868 gene locus_tag LOCUS_04680 117624 114868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 118734 117673 gene locus_tag LOCUS_04690 118734 117673 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_04690 120127 118916 gene locus_tag LOCUS_04700 120127 118916 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118415.1 protein_id gnl|my_center|LOCUS_04700 121735 120251 gene locus_tag LOCUS_04710 121735 120251 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_04710 124659 121753 gene locus_tag LOCUS_04720 124659 121753 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117969.1 protein_id gnl|my_center|LOCUS_04720 125050 126399 gene locus_tag LOCUS_04730 125050 126399 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_04730 127445 126624 gene locus_tag LOCUS_04740 127445 126624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057419.1 protein_id gnl|my_center|LOCUS_04740 128878 127586 gene locus_tag LOCUS_04750 128878 127586 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 protein_id gnl|my_center|LOCUS_04750 130020 128872 gene locus_tag LOCUS_04760 gene dgoD 130020 128872 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267367.1 protein_id gnl|my_center|LOCUS_04760 130667 130017 gene locus_tag LOCUS_04770 130667 130017 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244779.1 protein_id gnl|my_center|LOCUS_04770 131658 130660 gene locus_tag LOCUS_04780 131658 130660 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194214.1 protein_id gnl|my_center|LOCUS_04780 131747 132763 gene locus_tag LOCUS_04790 131747 132763 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921881.1 protein_id gnl|my_center|LOCUS_04790 133833 132760 gene locus_tag LOCUS_04800 133833 132760 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_04800 134597 133974 gene locus_tag LOCUS_04810 134597 133974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 135946 134657 gene locus_tag LOCUS_04820 135946 134657 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_04820 138620 135972 gene locus_tag LOCUS_04830 138620 135972 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120136.1 protein_id gnl|my_center|LOCUS_04830 140399 138810 gene locus_tag LOCUS_04840 140399 138810 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921847.1 protein_id gnl|my_center|LOCUS_04840 140552 142150 gene locus_tag LOCUS_04850 140552 142150 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118026.1 protein_id gnl|my_center|LOCUS_04850 143437 142166 gene locus_tag LOCUS_04860 143437 142166 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_04860 143786 144427 gene locus_tag LOCUS_04870 143786 144427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 144424 145224 gene locus_tag LOCUS_04880 144424 145224 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_04880 145552 146499 gene locus_tag LOCUS_04890 145552 146499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 147760 146477 gene locus_tag LOCUS_04900 147760 146477 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_04900 150488 147807 gene locus_tag LOCUS_04910 150488 147807 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120136.1 protein_id gnl|my_center|LOCUS_04910 150575 152842 gene locus_tag LOCUS_04920 150575 152842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 152990 155056 gene locus_tag LOCUS_04930 152990 155056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 157368 155092 gene locus_tag LOCUS_04940 157368 155092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 158652 157624 gene locus_tag LOCUS_04950 158652 157624 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615454.1 protein_id gnl|my_center|LOCUS_04950 159190 158720 gene locus_tag LOCUS_04960 159190 158720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 162732 159628 gene locus_tag LOCUS_04970 162732 159628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 163007 164701 gene locus_tag LOCUS_04980 163007 164701 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_04980 165197 164616 gene locus_tag LOCUS_04990 165197 164616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 165441 165187 gene locus_tag LOCUS_05000 165441 165187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 167042 165537 gene locus_tag LOCUS_05010 167042 165537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 168656 167085 gene locus_tag LOCUS_05020 168656 167085 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_05020 169379 168957 gene locus_tag LOCUS_05030 169379 168957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 169678 169385 gene locus_tag LOCUS_05040 169678 169385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 170978 169950 gene locus_tag LOCUS_05050 170978 169950 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_05050 171074 173089 gene locus_tag LOCUS_05060 171074 173089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 173242 175626 gene locus_tag LOCUS_05070 173242 175626 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_05070 175623 177104 gene locus_tag LOCUS_05080 175623 177104 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_05080 177789 177094 gene locus_tag LOCUS_05090 177789 177094 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921987.1 protein_id gnl|my_center|LOCUS_05090 178652 177858 gene locus_tag LOCUS_05100 178652 177858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 179032 179505 gene locus_tag LOCUS_05110 179032 179505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 179683 181086 gene locus_tag LOCUS_05120 179683 181086 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921758.1 protein_id gnl|my_center|LOCUS_05120 181137 184280 gene locus_tag LOCUS_05130 181137 184280 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_05130 184305 184790 gene locus_tag LOCUS_05140 184305 184790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 184872 185660 gene locus_tag LOCUS_05150 184872 185660 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_05150 185820 186029 gene locus_tag LOCUS_05160 185820 186029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 186814 186374 gene locus_tag LOCUS_05170 186814 186374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 187114 188388 gene locus_tag LOCUS_05180 187114 188388 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_05180 190790 188487 gene locus_tag LOCUS_05190 190790 188487 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_05190 191186 190959 gene locus_tag LOCUS_05200 191186 190959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 191728 192180 gene locus_tag LOCUS_05210 191728 192180 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 protein_id gnl|my_center|LOCUS_05210 192996 192265 gene locus_tag LOCUS_05220 192996 192265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 193355 194260 gene locus_tag LOCUS_05230 193355 194260 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_05230 194883 194494 gene locus_tag LOCUS_05240 194883 194494 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330460.1 protein_id gnl|my_center|LOCUS_05240 >Feature sequence04 2537 3004 gene locus_tag LOCUS_05250 2537 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3165 3860 gene locus_tag LOCUS_05260 3165 3860 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_05260 3911 5344 gene locus_tag LOCUS_05270 3911 5344 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_05270 6663 5515 gene locus_tag LOCUS_05280 6663 5515 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044915.1 protein_id gnl|my_center|LOCUS_05280 7611 6664 gene locus_tag LOCUS_05290 7611 6664 CDS product glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028148.1 protein_id gnl|my_center|LOCUS_05290 8777 8073 gene locus_tag LOCUS_05300 8777 8073 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_05300 10373 9693 gene locus_tag LOCUS_05310 10373 9693 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_05310 10763 11872 gene locus_tag LOCUS_05320 10763 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 12635 11781 gene locus_tag LOCUS_05330 12635 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 13044 13682 gene locus_tag LOCUS_05340 gene rdgB 13044 13682 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921833.1 protein_id gnl|my_center|LOCUS_05340 14790 13639 gene locus_tag LOCUS_05350 14790 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 14841 15989 gene locus_tag LOCUS_05360 14841 15989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 16080 17123 gene locus_tag LOCUS_05370 16080 17123 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970085.1 protein_id gnl|my_center|LOCUS_05370 17195 17728 gene locus_tag LOCUS_05380 17195 17728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 17738 18493 gene locus_tag LOCUS_05390 17738 18493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 18797 19246 gene locus_tag LOCUS_05400 18797 19246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 20644 19271 gene locus_tag LOCUS_05410 20644 19271 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840191.1 protein_id gnl|my_center|LOCUS_05410 20740 20829 gene locus_tag LOCUS_t00120 20740 20829 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21854 20973 gene locus_tag LOCUS_05420 21854 20973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 22746 23546 gene locus_tag LOCUS_05430 22746 23546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 24131 23907 gene locus_tag LOCUS_05440 24131 23907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 24646 24266 gene locus_tag LOCUS_05450 24646 24266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 24974 24636 gene locus_tag LOCUS_05460 24974 24636 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_05460 25403 24984 gene locus_tag LOCUS_05470 25403 24984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 25886 26104 gene locus_tag LOCUS_05480 25886 26104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 27220 26282 gene locus_tag LOCUS_05490 gene nhaR 27220 26282 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_05490 27346 27711 gene locus_tag LOCUS_05500 27346 27711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 27871 28080 gene locus_tag LOCUS_05510 27871 28080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 29520 28087 gene locus_tag LOCUS_05520 29520 28087 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_05520 32581 29525 gene locus_tag LOCUS_05530 32581 29525 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_05530 32850 33830 gene locus_tag LOCUS_05540 32850 33830 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_05540 35035 34118 gene locus_tag LOCUS_05550 35035 34118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 35907 35524 gene locus_tag LOCUS_05560 35907 35524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 36194 37666 gene locus_tag LOCUS_05570 gene ffh 36194 37666 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_05570 37871 38353 gene locus_tag LOCUS_05580 37871 38353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 38385 39083 gene locus_tag LOCUS_05590 gene trmD 38385 39083 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123923.1 protein_id gnl|my_center|LOCUS_05590 39080 39514 gene locus_tag LOCUS_05600 gene rplS 39080 39514 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 protein_id gnl|my_center|LOCUS_05600 39532 39903 gene locus_tag LOCUS_05610 39532 39903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 41066 39996 gene locus_tag LOCUS_05620 41066 39996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 41443 41904 gene locus_tag LOCUS_05630 41443 41904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 42741 41941 gene locus_tag LOCUS_05640 gene panB 42741 41941 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122138.1 protein_id gnl|my_center|LOCUS_05640 43484 42738 gene locus_tag LOCUS_05650 43484 42738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 43674 43746 gene locus_tag LOCUS_t00130 43674 43746 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 43844 45337 gene locus_tag LOCUS_05660 gene tig 43844 45337 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330527.1 protein_id gnl|my_center|LOCUS_05660 45379 45996 gene locus_tag LOCUS_05670 45379 45996 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327156.1 protein_id gnl|my_center|LOCUS_05670 46000 46614 gene locus_tag LOCUS_05680 gene clpP 46000 46614 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327157.1 protein_id gnl|my_center|LOCUS_05680 46663 47610 gene locus_tag LOCUS_05690 46663 47610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 48674 47658 gene locus_tag LOCUS_05700 gene gap 48674 47658 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_05700 48883 49614 gene locus_tag LOCUS_05710 48883 49614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_05710 49611 50933 gene locus_tag LOCUS_05720 49611 50933 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_05720 50949 52541 gene locus_tag LOCUS_05730 50949 52541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 52569 53261 gene locus_tag LOCUS_05740 52569 53261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 53251 53871 gene locus_tag LOCUS_05750 53251 53871 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615406.1 protein_id gnl|my_center|LOCUS_05750 54011 54805 gene locus_tag LOCUS_05760 54011 54805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 54808 56109 gene locus_tag LOCUS_05770 gene urtA 54808 56109 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_05770 56096 56770 gene locus_tag LOCUS_05780 56096 56770 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963877.1 protein_id gnl|my_center|LOCUS_05780 56775 57980 gene locus_tag LOCUS_05790 56775 57980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327711.1 protein_id gnl|my_center|LOCUS_05790 60377 58047 gene locus_tag LOCUS_05800 60377 58047 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121893.1 protein_id gnl|my_center|LOCUS_05800 61643 60579 gene locus_tag LOCUS_05810 61643 60579 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275314.1 protein_id gnl|my_center|LOCUS_05810 61623 62114 gene locus_tag LOCUS_05820 61623 62114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326944.1 protein_id gnl|my_center|LOCUS_05820 63338 62352 gene locus_tag LOCUS_05830 63338 62352 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_05830 63380 64228 gene locus_tag LOCUS_05840 63380 64228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 64675 64241 gene locus_tag LOCUS_05850 64675 64241 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_05850 64926 64672 gene locus_tag LOCUS_05860 64926 64672 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680062.1 protein_id gnl|my_center|LOCUS_05860 64967 65449 gene locus_tag LOCUS_05870 64967 65449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 67091 65394 gene locus_tag LOCUS_05880 67091 65394 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940541.1 protein_id gnl|my_center|LOCUS_05880 67524 67096 gene locus_tag LOCUS_05890 67524 67096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 73710 67651 gene locus_tag LOCUS_05900 73710 67651 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_05900 73970 76024 gene locus_tag LOCUS_05910 73970 76024 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236934.1 protein_id gnl|my_center|LOCUS_05910 76249 79455 gene locus_tag LOCUS_05920 76249 79455 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_05920 79499 80992 gene locus_tag LOCUS_05930 79499 80992 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_05930 81030 84419 gene locus_tag LOCUS_05940 81030 84419 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263915.1 protein_id gnl|my_center|LOCUS_05940 84416 85930 gene locus_tag LOCUS_05950 84416 85930 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919715.1 protein_id gnl|my_center|LOCUS_05950 86102 87202 gene locus_tag LOCUS_05960 gene tal 86102 87202 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_05960 87199 88854 gene locus_tag LOCUS_05970 gene pgi 87199 88854 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_05970 89939 88824 gene locus_tag LOCUS_05980 89939 88824 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537693.1 protein_id gnl|my_center|LOCUS_05980 92417 90426 gene locus_tag LOCUS_05990 92417 90426 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_05990 92872 92696 gene locus_tag LOCUS_06000 92872 92696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 93240 93455 gene locus_tag LOCUS_06010 93240 93455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 93452 93706 gene locus_tag LOCUS_06020 93452 93706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 93886 93728 gene locus_tag LOCUS_06030 93886 93728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 94429 94169 gene locus_tag LOCUS_06040 94429 94169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 94631 94422 gene locus_tag LOCUS_06050 94631 94422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 94790 94708 gene locus_tag LOCUS_t00140 94790 94708 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 94917 96161 gene locus_tag LOCUS_06060 94917 96161 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921696.1 protein_id gnl|my_center|LOCUS_06060 96253 97131 gene locus_tag LOCUS_06070 gene metF 96253 97131 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615859.1 protein_id gnl|my_center|LOCUS_06070 97840 97304 gene locus_tag LOCUS_06080 97840 97304 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_06080 98366 97827 gene locus_tag LOCUS_06090 98366 97827 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169876.1 protein_id gnl|my_center|LOCUS_06090 99325 98462 gene locus_tag LOCUS_06100 99325 98462 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837919.1 protein_id gnl|my_center|LOCUS_06100 99863 100993 gene locus_tag LOCUS_06110 99863 100993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 100990 101868 gene locus_tag LOCUS_06120 gene panC 100990 101868 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973078.1 protein_id gnl|my_center|LOCUS_06120 102129 103235 gene locus_tag LOCUS_06130 102129 103235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 103232 103504 gene locus_tag LOCUS_06140 103232 103504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 103549 103776 gene locus_tag LOCUS_06150 103549 103776 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228586.1 protein_id gnl|my_center|LOCUS_06150 103977 106502 gene locus_tag LOCUS_06160 103977 106502 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921616.1 protein_id gnl|my_center|LOCUS_06160 106579 107823 gene locus_tag LOCUS_06170 106579 107823 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120906.1 protein_id gnl|my_center|LOCUS_06170 108356 108081 gene locus_tag LOCUS_06180 108356 108081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 109360 108356 gene locus_tag LOCUS_06190 gene ilvC 109360 108356 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339869.1 protein_id gnl|my_center|LOCUS_06190 109985 109428 gene locus_tag LOCUS_06200 gene ilvN 109985 109428 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339870.1 protein_id gnl|my_center|LOCUS_06200 110252 111058 gene locus_tag LOCUS_06210 gene rpsB 110252 111058 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 protein_id gnl|my_center|LOCUS_06210 111221 112060 gene locus_tag LOCUS_06220 gene tsf 111221 112060 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_06220 112104 112838 gene locus_tag LOCUS_06230 gene pyrH 112104 112838 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261659.1 protein_id gnl|my_center|LOCUS_06230 112835 114793 gene locus_tag LOCUS_06240 112835 114793 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_06240 114918 115478 gene locus_tag LOCUS_06250 gene frr 114918 115478 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_06250 115497 116261 gene locus_tag LOCUS_06260 115497 116261 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_06260 116258 118393 gene locus_tag LOCUS_06270 116258 118393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 118417 119478 gene locus_tag LOCUS_06280 118417 119478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 120955 119501 gene locus_tag LOCUS_06290 120955 119501 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922918.1 protein_id gnl|my_center|LOCUS_06290 123411 121000 gene locus_tag LOCUS_06300 123411 121000 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_06300 123659 126445 gene locus_tag LOCUS_06310 gene ppdK 123659 126445 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_06310 126775 128070 gene locus_tag LOCUS_06320 126775 128070 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_06320 128636 128100 gene locus_tag LOCUS_06330 128636 128100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 128756 129988 gene locus_tag LOCUS_06340 128756 129988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 131054 130128 gene locus_tag LOCUS_06350 131054 130128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 131713 131531 gene locus_tag LOCUS_06360 131713 131531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 132282 131788 gene locus_tag LOCUS_06370 132282 131788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 133580 132573 gene locus_tag LOCUS_06380 133580 132573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 134466 133795 gene locus_tag LOCUS_06390 gene rsmG 134466 133795 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334161.1 protein_id gnl|my_center|LOCUS_06390 136640 134466 gene locus_tag LOCUS_06400 136640 134466 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_06400 138610 136865 gene locus_tag LOCUS_06410 138610 136865 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921618.1 protein_id gnl|my_center|LOCUS_06410 138797 139465 gene locus_tag LOCUS_06420 138797 139465 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922279.1 protein_id gnl|my_center|LOCUS_06420 139512 141275 gene locus_tag LOCUS_06430 139512 141275 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122500.1 protein_id gnl|my_center|LOCUS_06430 143149 141596 gene locus_tag LOCUS_06440 143149 141596 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085806.1 protein_id gnl|my_center|LOCUS_06440 143407 144165 gene locus_tag LOCUS_06450 143407 144165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 145013 144126 gene locus_tag LOCUS_06460 145013 144126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 147020 145062 gene locus_tag LOCUS_06470 147020 145062 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921802.1 protein_id gnl|my_center|LOCUS_06470 147623 147048 gene locus_tag LOCUS_06480 147623 147048 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_06480 147707 148111 gene locus_tag LOCUS_06490 147707 148111 CDS product DUF2237 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923332.1 protein_id gnl|my_center|LOCUS_06490 148145 148906 gene locus_tag LOCUS_06500 148145 148906 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009567369.1 protein_id gnl|my_center|LOCUS_06500 149260 148928 gene locus_tag LOCUS_06510 149260 148928 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_06510 149784 149356 gene locus_tag LOCUS_06520 149784 149356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 149916 150605 gene locus_tag LOCUS_06530 149916 150605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 151728 150784 gene locus_tag LOCUS_06540 151728 150784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 152119 152343 gene locus_tag LOCUS_06550 152119 152343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 153651 152659 gene locus_tag LOCUS_06560 153651 152659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 153983 154852 gene locus_tag LOCUS_06570 153983 154852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 155167 155388 gene locus_tag LOCUS_06580 155167 155388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 155372 156112 gene locus_tag LOCUS_06590 155372 156112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 156139 157527 gene locus_tag LOCUS_06600 156139 157527 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039770.1 protein_id gnl|my_center|LOCUS_06600 157553 158485 gene locus_tag LOCUS_06610 157553 158485 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256676.1 protein_id gnl|my_center|LOCUS_06610 158492 159271 gene locus_tag LOCUS_06620 158492 159271 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122697.1 protein_id gnl|my_center|LOCUS_06620 161098 159320 gene locus_tag LOCUS_06630 161098 159320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 161927 161172 gene locus_tag LOCUS_06640 161927 161172 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403350.1 protein_id gnl|my_center|LOCUS_06640 165558 161986 gene locus_tag LOCUS_06650 165558 161986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 166816 165740 gene locus_tag LOCUS_06660 166816 165740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 166886 167773 gene locus_tag LOCUS_06670 166886 167773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 167770 169044 gene locus_tag LOCUS_06680 gene hemA 167770 169044 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334460.1 protein_id gnl|my_center|LOCUS_06680 170209 169109 gene locus_tag LOCUS_06690 170209 169109 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037252469.1 protein_id gnl|my_center|LOCUS_06690 171416 170328 gene locus_tag LOCUS_06700 171416 170328 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339548.1 protein_id gnl|my_center|LOCUS_06700 172369 171590 gene locus_tag LOCUS_06710 172369 171590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 173300 172542 gene locus_tag LOCUS_06720 173300 172542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 175005 173539 gene locus_tag LOCUS_06730 175005 173539 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_06730 177595 175031 gene locus_tag LOCUS_06740 177595 175031 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_06740 177884 178417 gene locus_tag LOCUS_06750 177884 178417 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869796.1 protein_id gnl|my_center|LOCUS_06750 178527 179783 gene locus_tag LOCUS_06760 178527 179783 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 protein_id gnl|my_center|LOCUS_06760 180856 179711 gene locus_tag LOCUS_06770 gene waaF 180856 179711 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_06770 183866 180870 gene locus_tag LOCUS_06780 183866 180870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 184167 185297 gene locus_tag LOCUS_06790 184167 185297 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122949.1 protein_id gnl|my_center|LOCUS_06790 185342 185794 gene locus_tag LOCUS_06800 gene rpiB 185342 185794 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_06800 186973 185840 gene locus_tag LOCUS_06810 186973 185840 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_06810 188252 187218 gene locus_tag LOCUS_06820 188252 187218 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_06820 189743 188478 gene locus_tag LOCUS_06830 189743 188478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_06830 191368 189914 gene locus_tag LOCUS_06840 191368 189914 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_06840 191681 191358 gene locus_tag LOCUS_06850 191681 191358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence05 1020 484 gene locus_tag LOCUS_06860 1020 484 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084585.1 protein_id gnl|my_center|LOCUS_06860 1159 4428 gene locus_tag LOCUS_06870 gene carB 1159 4428 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123580.1 protein_id gnl|my_center|LOCUS_06870 4762 7257 gene locus_tag LOCUS_06880 4762 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 7551 7315 gene locus_tag LOCUS_06890 7551 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 7439 8638 gene locus_tag LOCUS_06900 7439 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 8717 9634 gene locus_tag LOCUS_06910 8717 9634 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937854.1 protein_id gnl|my_center|LOCUS_06910 9635 10744 gene locus_tag LOCUS_06920 9635 10744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 protein_id gnl|my_center|LOCUS_06920 10741 12093 gene locus_tag LOCUS_06930 10741 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 12097 12807 gene locus_tag LOCUS_06940 12097 12807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937857.1 protein_id gnl|my_center|LOCUS_06940 12926 14767 gene locus_tag LOCUS_06950 gene recQ 12926 14767 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921919.1 protein_id gnl|my_center|LOCUS_06950 16255 15131 gene locus_tag LOCUS_06960 gene aroB 16255 15131 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846185.1 protein_id gnl|my_center|LOCUS_06960 16485 16258 gene locus_tag LOCUS_06970 16485 16258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 16599 17141 gene locus_tag LOCUS_06980 16599 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 17230 18099 gene locus_tag LOCUS_06990 17230 18099 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_06990 18362 18033 gene locus_tag LOCUS_07000 18362 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 18636 20327 gene locus_tag LOCUS_07010 18636 20327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 20351 20593 gene locus_tag LOCUS_07020 gene rpmA 20351 20593 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_07020 20632 21639 gene locus_tag LOCUS_07030 gene obgE 20632 21639 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324342.1 protein_id gnl|my_center|LOCUS_07030 21636 22469 gene locus_tag LOCUS_07040 21636 22469 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118958.1 protein_id gnl|my_center|LOCUS_07040 22570 22989 gene locus_tag LOCUS_07050 22570 22989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 23054 24838 gene locus_tag LOCUS_07060 gene argS 23054 24838 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816530.1 protein_id gnl|my_center|LOCUS_07060 26098 24857 gene locus_tag LOCUS_07070 26098 24857 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_07070 26350 27387 gene locus_tag LOCUS_07080 26350 27387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 27459 28187 gene locus_tag LOCUS_07090 27459 28187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 28307 29137 gene locus_tag LOCUS_07100 28307 29137 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928888.1 protein_id gnl|my_center|LOCUS_07100 29407 31521 gene locus_tag LOCUS_07110 gene fusA 29407 31521 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121593.1 protein_id gnl|my_center|LOCUS_07110 33524 31668 gene locus_tag LOCUS_07120 33524 31668 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120247.1 protein_id gnl|my_center|LOCUS_07120 33619 34365 gene locus_tag LOCUS_07130 33619 34365 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921820.1 protein_id gnl|my_center|LOCUS_07130 34698 35024 gene locus_tag LOCUS_07140 gene rpsJ 34698 35024 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_07140 35239 36078 gene locus_tag LOCUS_07150 gene rplC 35239 36078 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121602.1 protein_id gnl|my_center|LOCUS_07150 36075 36863 gene locus_tag LOCUS_07160 gene rplD 36075 36863 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326797.1 protein_id gnl|my_center|LOCUS_07160 36867 37187 gene locus_tag LOCUS_07170 gene rplW 36867 37187 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326798.1 protein_id gnl|my_center|LOCUS_07170 37203 38060 gene locus_tag LOCUS_07180 gene rplB 37203 38060 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121603.1 protein_id gnl|my_center|LOCUS_07180 38125 38412 gene locus_tag LOCUS_07190 gene rpsS 38125 38412 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326800.1 protein_id gnl|my_center|LOCUS_07190 38426 38761 gene locus_tag LOCUS_07200 gene rplV 38426 38761 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121604.1 protein_id gnl|my_center|LOCUS_07200 38790 39485 gene locus_tag LOCUS_07210 gene rpsC 38790 39485 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326802.1 protein_id gnl|my_center|LOCUS_07210 39424 39840 gene locus_tag LOCUS_07220 gene rplP 39424 39840 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_07220 39852 40139 gene locus_tag LOCUS_07230 39852 40139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 40155 40517 gene locus_tag LOCUS_07240 gene rpsQ 40155 40517 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812390.1 protein_id gnl|my_center|LOCUS_07240 40514 40882 gene locus_tag LOCUS_07250 gene rplN 40514 40882 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326806.1 protein_id gnl|my_center|LOCUS_07250 40882 41235 gene locus_tag LOCUS_07260 gene rplX 40882 41235 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_07260 41274 41891 gene locus_tag LOCUS_07270 gene rplE 41274 41891 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173391575.1 protein_id gnl|my_center|LOCUS_07270 42172 42567 gene locus_tag LOCUS_07280 gene rpsH 42172 42567 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326810.1 protein_id gnl|my_center|LOCUS_07280 42587 43132 gene locus_tag LOCUS_07290 gene rplF 42587 43132 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121609.1 protein_id gnl|my_center|LOCUS_07290 43195 43563 gene locus_tag LOCUS_07300 gene rplR 43195 43563 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_07300 43703 44179 gene locus_tag LOCUS_07310 gene rpsE 43703 44179 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326813.1 protein_id gnl|my_center|LOCUS_07310 44215 44730 gene locus_tag LOCUS_07320 gene rplO 44215 44730 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326814.1 protein_id gnl|my_center|LOCUS_07320 44865 46226 gene locus_tag LOCUS_07330 gene secY 44865 46226 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326816.1 protein_id gnl|my_center|LOCUS_07330 46310 46885 gene locus_tag LOCUS_07340 46310 46885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 46988 47752 gene locus_tag LOCUS_07350 gene map 46988 47752 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_07350 48114 48497 gene locus_tag LOCUS_07360 gene rpsM 48114 48497 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123828.1 protein_id gnl|my_center|LOCUS_07360 48595 48972 gene locus_tag LOCUS_07370 gene rpsK 48595 48972 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 protein_id gnl|my_center|LOCUS_07370 49047 49673 gene locus_tag LOCUS_07380 gene rpsD 49047 49673 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459108.1 protein_id gnl|my_center|LOCUS_07380 49748 50737 gene locus_tag LOCUS_07390 49748 50737 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_07390 50809 51405 gene locus_tag LOCUS_07400 50809 51405 CDS product L17 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123829.1 protein_id gnl|my_center|LOCUS_07400 51630 53345 gene locus_tag LOCUS_07410 51630 53345 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_07410 53450 54727 gene locus_tag LOCUS_07420 53450 54727 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_07420 54730 56181 gene locus_tag LOCUS_07430 54730 56181 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_07430 56324 58246 gene locus_tag LOCUS_07440 gene speA 56324 58246 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119511.1 protein_id gnl|my_center|LOCUS_07440 58709 60772 gene locus_tag LOCUS_07450 gene nadE 58709 60772 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_07450 60863 61780 gene locus_tag LOCUS_07460 60863 61780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 61881 62366 gene locus_tag LOCUS_07470 61881 62366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_07470 62507 63184 gene locus_tag LOCUS_07480 62507 63184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 63153 64736 gene locus_tag LOCUS_07490 gene pckA 63153 64736 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 protein_id gnl|my_center|LOCUS_07490 65127 65696 gene locus_tag LOCUS_07500 65127 65696 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_07500 66724 65705 gene locus_tag LOCUS_07510 66724 65705 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_07510 68481 66721 gene locus_tag LOCUS_07520 68481 66721 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143571.1 protein_id gnl|my_center|LOCUS_07520 70322 68547 gene locus_tag LOCUS_07530 70322 68547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 70541 73411 gene locus_tag LOCUS_07540 gene gyrA 70541 73411 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922184.1 protein_id gnl|my_center|LOCUS_07540 73426 74742 gene locus_tag LOCUS_07550 73426 74742 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_07550 74993 77512 gene locus_tag LOCUS_07560 74993 77512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 77878 78996 gene locus_tag LOCUS_07570 gene tgt 77878 78996 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778950.1 protein_id gnl|my_center|LOCUS_07570 79110 79430 gene locus_tag LOCUS_07580 79110 79430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 79464 82394 gene locus_tag LOCUS_07590 79464 82394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 82462 83553 gene locus_tag LOCUS_07600 82462 83553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 84437 83550 gene locus_tag LOCUS_07610 84437 83550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 84690 86684 gene locus_tag LOCUS_07620 84690 86684 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 protein_id gnl|my_center|LOCUS_07620 87668 87009 gene locus_tag LOCUS_07630 87668 87009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816208.1 protein_id gnl|my_center|LOCUS_07630 87908 88993 gene locus_tag LOCUS_07640 gene tilS 87908 88993 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615481.1 protein_id gnl|my_center|LOCUS_07640 90675 88987 gene locus_tag LOCUS_07650 90675 88987 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_07650 90866 94132 gene locus_tag LOCUS_07660 90866 94132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 94238 95122 gene locus_tag LOCUS_07670 gene dapF 94238 95122 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_07670 95160 95978 gene locus_tag LOCUS_07680 95160 95978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 96718 96035 gene locus_tag LOCUS_07690 96718 96035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 97737 99122 gene locus_tag LOCUS_07700 97737 99122 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921445.1 protein_id gnl|my_center|LOCUS_07700 100066 99191 gene locus_tag LOCUS_07710 100066 99191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 101013 100063 gene locus_tag LOCUS_07720 101013 100063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 102949 101024 gene locus_tag LOCUS_07730 gene dxs 102949 101024 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325559.1 protein_id gnl|my_center|LOCUS_07730 103970 102978 gene locus_tag LOCUS_07740 103970 102978 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118683.1 protein_id gnl|my_center|LOCUS_07740 104424 104011 gene locus_tag LOCUS_07750 104424 104011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 105636 104428 gene locus_tag LOCUS_07760 gene xseA 105636 104428 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119437.1 protein_id gnl|my_center|LOCUS_07760 105794 107038 gene locus_tag LOCUS_07770 105794 107038 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_07770 108433 107195 gene locus_tag LOCUS_07780 108433 107195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 108572 109471 gene locus_tag LOCUS_07790 108572 109471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 109673 111910 gene locus_tag LOCUS_07800 109673 111910 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_07800 113000 112122 gene locus_tag LOCUS_07810 113000 112122 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065121.1 protein_id gnl|my_center|LOCUS_07810 113479 113000 gene locus_tag LOCUS_07820 gene ruvX 113479 113000 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331673.1 protein_id gnl|my_center|LOCUS_07820 114566 113472 gene locus_tag LOCUS_07830 114566 113472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 115645 114563 gene locus_tag LOCUS_07840 115645 114563 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_07840 117158 115701 gene locus_tag LOCUS_07850 117158 115701 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_07850 118199 117327 gene locus_tag LOCUS_07860 118199 117327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 119384 118206 gene locus_tag LOCUS_07870 gene metK 119384 118206 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331112.1 protein_id gnl|my_center|LOCUS_07870 120810 119476 gene locus_tag LOCUS_07880 120810 119476 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_07880 124335 121021 gene locus_tag LOCUS_07890 124335 121021 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260976.1 protein_id gnl|my_center|LOCUS_07890 124549 125358 gene locus_tag LOCUS_07900 124549 125358 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_07900 126462 125359 gene locus_tag LOCUS_07910 gene trpD 126462 125359 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117897.1 protein_id gnl|my_center|LOCUS_07910 126558 127496 gene locus_tag LOCUS_07920 126558 127496 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324951.1 protein_id gnl|my_center|LOCUS_07920 127980 127627 gene locus_tag LOCUS_07930 127980 127627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 129242 128121 gene locus_tag LOCUS_07940 129242 128121 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615740.1 protein_id gnl|my_center|LOCUS_07940 129840 129409 gene locus_tag LOCUS_07950 129840 129409 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324538.1 protein_id gnl|my_center|LOCUS_07950 131521 130055 gene locus_tag LOCUS_07960 131521 130055 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 protein_id gnl|my_center|LOCUS_07960 131940 131521 gene locus_tag LOCUS_07970 131940 131521 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 protein_id gnl|my_center|LOCUS_07970 133127 131955 gene locus_tag LOCUS_07980 133127 131955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 134242 133124 gene locus_tag LOCUS_07990 134242 133124 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_07990 135917 134472 gene locus_tag LOCUS_08000 135917 134472 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_08000 137047 135917 gene locus_tag LOCUS_08010 137047 135917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_08010 137555 137079 gene locus_tag LOCUS_08020 137555 137079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 137775 138377 gene locus_tag LOCUS_08030 137775 138377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615841.1 protein_id gnl|my_center|LOCUS_08030 138400 140181 gene locus_tag LOCUS_08040 138400 140181 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 protein_id gnl|my_center|LOCUS_08040 140663 142534 gene locus_tag LOCUS_08050 gene mnmG 140663 142534 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427787.1 protein_id gnl|my_center|LOCUS_08050 142531 143880 gene locus_tag LOCUS_08060 142531 143880 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_08060 144461 143892 gene locus_tag LOCUS_08070 144461 143892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 144857 146770 gene locus_tag LOCUS_08080 144857 146770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 147063 147638 gene locus_tag LOCUS_08090 147063 147638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 147683 149152 gene locus_tag LOCUS_08100 gene leuC 147683 149152 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_08100 149180 149806 gene locus_tag LOCUS_08110 gene leuD 149180 149806 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330456.1 protein_id gnl|my_center|LOCUS_08110 149810 150856 gene locus_tag LOCUS_08120 149810 150856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 150870 151199 gene locus_tag LOCUS_08130 150870 151199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 152449 151397 gene locus_tag LOCUS_08140 gene bioB 152449 151397 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326296.1 protein_id gnl|my_center|LOCUS_08140 152591 153691 gene locus_tag LOCUS_08150 152591 153691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 153688 155052 gene locus_tag LOCUS_08160 153688 155052 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_08160 155577 155059 gene locus_tag LOCUS_08170 155577 155059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 157359 155806 gene locus_tag LOCUS_08180 157359 155806 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118026.1 protein_id gnl|my_center|LOCUS_08180 158105 157746 gene locus_tag LOCUS_08190 158105 157746 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338472.1 protein_id gnl|my_center|LOCUS_08190 159687 158116 gene locus_tag LOCUS_08200 159687 158116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 161174 159708 gene locus_tag LOCUS_08210 161174 159708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332518.1 protein_id gnl|my_center|LOCUS_08210 162551 161256 gene locus_tag LOCUS_08220 162551 161256 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_08220 163840 162641 gene locus_tag LOCUS_08230 163840 162641 CDS product DUF1570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665225.1 protein_id gnl|my_center|LOCUS_08230 164057 164758 gene locus_tag LOCUS_08240 164057 164758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 165070 166644 gene locus_tag LOCUS_08250 165070 166644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 166716 167645 gene locus_tag LOCUS_08260 166716 167645 CDS product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615923.1 protein_id gnl|my_center|LOCUS_08260 167993 170725 gene locus_tag LOCUS_08270 gene polA 167993 170725 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_08270 170794 171441 gene locus_tag LOCUS_08280 170794 171441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 171684 173078 gene locus_tag LOCUS_08290 gene rho 171684 173078 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813585.1 protein_id gnl|my_center|LOCUS_08290 173086 173631 gene locus_tag LOCUS_08300 gene ribE 173086 173631 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258065.1 protein_id gnl|my_center|LOCUS_08300 173628 174053 gene locus_tag LOCUS_08310 gene nusB 173628 174053 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326965.1 protein_id gnl|my_center|LOCUS_08310 174081 175085 gene locus_tag LOCUS_08320 gene ftsY 174081 175085 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331084.1 protein_id gnl|my_center|LOCUS_08320 175316 176794 gene locus_tag LOCUS_08330 175316 176794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 177165 178139 gene locus_tag LOCUS_08340 177165 178139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence06 425 15 gene locus_tag LOCUS_08350 425 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 903 1376 gene locus_tag LOCUS_08360 903 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1420 1638 gene locus_tag LOCUS_08370 gene csrA 1420 1638 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_08370 1654 2091 gene locus_tag LOCUS_08380 1654 2091 CDS product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831496.1 protein_id gnl|my_center|LOCUS_08380 2419 3606 gene locus_tag LOCUS_08390 2419 3606 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_08390 3716 3789 gene locus_tag LOCUS_t00150 3716 3789 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3878 3959 gene locus_tag LOCUS_t00160 3878 3959 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3979 4049 gene locus_tag LOCUS_t00170 3979 4049 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4143 4215 gene locus_tag LOCUS_t00180 4143 4215 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4353 5552 gene locus_tag LOCUS_08400 gene tuf 4353 5552 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121621.1 protein_id gnl|my_center|LOCUS_08400 5673 5746 gene locus_tag LOCUS_t00190 5673 5746 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 5792 6274 gene locus_tag LOCUS_08410 gene secE 5792 6274 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324991.1 protein_id gnl|my_center|LOCUS_08410 6297 7091 gene locus_tag LOCUS_08420 gene nusG 6297 7091 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324992.1 protein_id gnl|my_center|LOCUS_08420 7169 7594 gene locus_tag LOCUS_08430 gene rplK 7169 7594 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324993.1 protein_id gnl|my_center|LOCUS_08430 7707 8369 gene locus_tag LOCUS_08440 gene rplA 7707 8369 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324457.1 protein_id gnl|my_center|LOCUS_08440 8384 8923 gene locus_tag LOCUS_08450 gene rplJ 8384 8923 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 protein_id gnl|my_center|LOCUS_08450 9047 9463 gene locus_tag LOCUS_08460 gene rplL 9047 9463 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324459.1 protein_id gnl|my_center|LOCUS_08460 9663 13421 gene locus_tag LOCUS_08470 gene rpoB 9663 13421 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340662.1 protein_id gnl|my_center|LOCUS_08470 13527 17870 gene locus_tag LOCUS_08480 gene rpoC 13527 17870 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333812.1 protein_id gnl|my_center|LOCUS_08480 18092 19009 gene locus_tag LOCUS_08490 18092 19009 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222939.1 protein_id gnl|my_center|LOCUS_08490 19042 20175 gene locus_tag LOCUS_08500 19042 20175 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_08500 22103 20244 gene locus_tag LOCUS_08510 gene polX 22103 20244 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615613.1 protein_id gnl|my_center|LOCUS_08510 23412 22198 gene locus_tag LOCUS_08520 23412 22198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 24311 23691 gene locus_tag LOCUS_08530 24311 23691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 24772 24308 gene locus_tag LOCUS_08540 24772 24308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 25863 24769 gene locus_tag LOCUS_08550 25863 24769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121229.1 protein_id gnl|my_center|LOCUS_08550 26214 25918 gene locus_tag LOCUS_08560 26214 25918 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326741.1 protein_id gnl|my_center|LOCUS_08560 26392 28806 gene locus_tag LOCUS_08570 26392 28806 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123700.1 protein_id gnl|my_center|LOCUS_08570 29899 28958 gene locus_tag LOCUS_08580 29899 28958 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_08580 30962 29910 gene locus_tag LOCUS_08590 gene gmd 30962 29910 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941289.1 protein_id gnl|my_center|LOCUS_08590 31742 31026 gene locus_tag LOCUS_08600 31742 31026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 33943 31814 gene locus_tag LOCUS_08610 33943 31814 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_08610 35256 34150 gene locus_tag LOCUS_08620 35256 34150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 36274 35273 gene locus_tag LOCUS_08630 36274 35273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 36292 37302 gene locus_tag LOCUS_08640 36292 37302 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140943.1 protein_id gnl|my_center|LOCUS_08640 37871 37281 gene locus_tag LOCUS_08650 37871 37281 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327748.1 protein_id gnl|my_center|LOCUS_08650 38937 37861 gene locus_tag LOCUS_08660 38937 37861 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_08660 39233 39862 gene locus_tag LOCUS_08670 39233 39862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 39932 40135 gene locus_tag LOCUS_08680 39932 40135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 40474 40040 gene locus_tag LOCUS_08690 40474 40040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 40615 41703 gene locus_tag LOCUS_08700 40615 41703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326644.1 protein_id gnl|my_center|LOCUS_08700 42530 43255 gene locus_tag LOCUS_08710 42530 43255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 43382 43308 gene locus_tag LOCUS_t00200 43382 43308 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 43563 44168 gene locus_tag LOCUS_08720 43563 44168 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327679.1 protein_id gnl|my_center|LOCUS_08720 44248 44318 gene locus_tag LOCUS_t00210 44248 44318 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 44509 45621 gene locus_tag LOCUS_08730 44509 45621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 45639 46631 gene locus_tag LOCUS_08740 45639 46631 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922223.1 protein_id gnl|my_center|LOCUS_08740 47666 46671 gene locus_tag LOCUS_08750 47666 46671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 47810 49168 gene locus_tag LOCUS_08760 47810 49168 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333174.1 protein_id gnl|my_center|LOCUS_08760 49234 49911 gene locus_tag LOCUS_08770 gene uppS 49234 49911 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328291.1 protein_id gnl|my_center|LOCUS_08770 49908 50867 gene locus_tag LOCUS_08780 49908 50867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 51253 52191 gene locus_tag LOCUS_08790 51253 52191 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_08790 52188 54701 gene locus_tag LOCUS_08800 52188 54701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 54701 55234 gene locus_tag LOCUS_08810 54701 55234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 55231 56535 gene locus_tag LOCUS_08820 55231 56535 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119979.1 protein_id gnl|my_center|LOCUS_08820 56599 58632 gene locus_tag LOCUS_08830 56599 58632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 58647 59216 gene locus_tag LOCUS_08840 58647 59216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 59452 60327 gene locus_tag LOCUS_08850 gene folP 59452 60327 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120943.1 protein_id gnl|my_center|LOCUS_08850 60394 61653 gene locus_tag LOCUS_08860 60394 61653 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121351.1 protein_id gnl|my_center|LOCUS_08860 61884 63947 gene locus_tag LOCUS_08870 61884 63947 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 protein_id gnl|my_center|LOCUS_08870 64021 64341 gene locus_tag LOCUS_08880 64021 64341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 64424 65569 gene locus_tag LOCUS_08890 64424 65569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 75281 65781 gene locus_tag LOCUS_08900 75281 65781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 75928 75422 gene locus_tag LOCUS_08910 75928 75422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 75890 76606 gene locus_tag LOCUS_08920 75890 76606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 77522 76632 gene locus_tag LOCUS_08930 77522 76632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 78501 77524 gene locus_tag LOCUS_08940 78501 77524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 79938 78586 gene locus_tag LOCUS_08950 79938 78586 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096882.1 protein_id gnl|my_center|LOCUS_08950 81482 79935 gene locus_tag LOCUS_08960 81482 79935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 82271 81540 gene locus_tag LOCUS_08970 82271 81540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 82848 82351 gene locus_tag LOCUS_08980 82848 82351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 83202 82936 gene locus_tag LOCUS_08990 83202 82936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 84055 83264 gene locus_tag LOCUS_09000 84055 83264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 84487 84978 gene locus_tag LOCUS_09010 84487 84978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 85043 85462 gene locus_tag LOCUS_09020 85043 85462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 87131 85617 gene locus_tag LOCUS_09030 87131 85617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09030 88372 87431 gene locus_tag LOCUS_09040 88372 87431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 88654 89574 gene locus_tag LOCUS_09050 88654 89574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 90281 89739 gene locus_tag LOCUS_09060 90281 89739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 90964 90527 gene locus_tag LOCUS_09070 90964 90527 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_09070 91218 90961 gene locus_tag LOCUS_09080 91218 90961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 95152 91304 gene locus_tag LOCUS_09090 95152 91304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 95947 95270 gene locus_tag LOCUS_09100 95947 95270 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_09100 97512 95944 gene locus_tag LOCUS_09110 97512 95944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 98131 97793 gene locus_tag LOCUS_09120 98131 97793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 98013 101357 gene locus_tag LOCUS_09130 98013 101357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 101351 102430 gene locus_tag LOCUS_09140 101351 102430 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_09140 102427 102891 gene locus_tag LOCUS_09150 102427 102891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 103382 106282 gene locus_tag LOCUS_09160 103382 106282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 106276 107814 gene locus_tag LOCUS_09170 106276 107814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_09170 108230 109420 gene locus_tag LOCUS_09180 108230 109420 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035313.1 protein_id gnl|my_center|LOCUS_09180 110192 110371 gene locus_tag LOCUS_09190 110192 110371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 113109 111238 gene locus_tag LOCUS_09200 113109 111238 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869365.1 protein_id gnl|my_center|LOCUS_09200 113197 114258 gene locus_tag LOCUS_09210 113197 114258 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_09210 114888 114370 gene locus_tag LOCUS_09220 114888 114370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 115138 116235 gene locus_tag LOCUS_09230 115138 116235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 117428 116286 gene locus_tag LOCUS_09240 gene carA 117428 116286 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921837.1 protein_id gnl|my_center|LOCUS_09240 119018 117552 gene locus_tag LOCUS_09250 119018 117552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 119758 119066 gene locus_tag LOCUS_09260 119758 119066 CDS product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816911.1 protein_id gnl|my_center|LOCUS_09260 121299 120058 gene locus_tag LOCUS_09270 121299 120058 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 protein_id gnl|my_center|LOCUS_09270 122728 121874 gene locus_tag LOCUS_09280 122728 121874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 124386 123316 gene locus_tag LOCUS_09290 gene mutY 124386 123316 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117840.1 protein_id gnl|my_center|LOCUS_09290 124456 124965 gene locus_tag LOCUS_09300 124456 124965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 124962 125603 gene locus_tag LOCUS_09310 gene tmk 124962 125603 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939417.1 protein_id gnl|my_center|LOCUS_09310 125625 126677 gene locus_tag LOCUS_09320 125625 126677 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122947.1 protein_id gnl|my_center|LOCUS_09320 126982 129714 gene locus_tag LOCUS_09330 126982 129714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 130083 130679 gene locus_tag LOCUS_09340 130083 130679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 130828 132240 gene locus_tag LOCUS_09350 gene fumC 130828 132240 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889251.1 protein_id gnl|my_center|LOCUS_09350 132309 133418 gene locus_tag LOCUS_09360 132309 133418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 134018 133680 gene locus_tag LOCUS_09370 134018 133680 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919834.1 protein_id gnl|my_center|LOCUS_09370 134377 136431 gene locus_tag LOCUS_09380 134377 136431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 136538 137827 gene locus_tag LOCUS_09390 136538 137827 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_09390 137908 138648 gene locus_tag LOCUS_09400 137908 138648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 138696 140099 gene locus_tag LOCUS_09410 138696 140099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 141717 140323 gene locus_tag LOCUS_09420 141717 140323 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_09420 141928 144096 gene locus_tag LOCUS_09430 141928 144096 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328585.1 protein_id gnl|my_center|LOCUS_09430 144114 145217 gene locus_tag LOCUS_09440 gene ribD 144114 145217 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence07 607 966 gene locus_tag LOCUS_09450 607 966 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888481.1 protein_id gnl|my_center|LOCUS_09450 998 1669 gene locus_tag LOCUS_09460 998 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1960 2805 gene locus_tag LOCUS_09470 1960 2805 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 protein_id gnl|my_center|LOCUS_09470 2881 3693 gene locus_tag LOCUS_09480 2881 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 3850 4335 gene locus_tag LOCUS_09490 3850 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 4325 4504 gene locus_tag LOCUS_09500 4325 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 4905 4833 gene locus_tag LOCUS_t00220 4905 4833 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5165 6634 gene locus_tag LOCUS_09510 gene gnd 5165 6634 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119037.1 protein_id gnl|my_center|LOCUS_09510 6636 7418 gene locus_tag LOCUS_09520 6636 7418 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_09520 7804 7382 gene locus_tag LOCUS_09530 7804 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 7791 9251 gene locus_tag LOCUS_09540 gene zwf 7791 9251 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335201.1 protein_id gnl|my_center|LOCUS_09540 9248 10294 gene locus_tag LOCUS_09550 9248 10294 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118292.1 protein_id gnl|my_center|LOCUS_09550 11583 10345 gene locus_tag LOCUS_09560 gene queG 11583 10345 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_09560 11737 12495 gene locus_tag LOCUS_09570 11737 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 12900 14834 gene locus_tag LOCUS_09580 12900 14834 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328238.1 protein_id gnl|my_center|LOCUS_09580 15107 16186 gene locus_tag LOCUS_09590 15107 16186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 16183 17247 gene locus_tag LOCUS_09600 gene dusB 16183 17247 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334998.1 protein_id gnl|my_center|LOCUS_09600 17315 18043 gene locus_tag LOCUS_09610 17315 18043 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329801.1 protein_id gnl|my_center|LOCUS_09610 18136 18759 gene locus_tag LOCUS_09620 18136 18759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 18818 19693 gene locus_tag LOCUS_09630 gene sufC 18818 19693 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329802.1 protein_id gnl|my_center|LOCUS_09630 19737 21149 gene locus_tag LOCUS_09640 gene sufB 19737 21149 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_09640 21153 22559 gene locus_tag LOCUS_09650 gene sufD 21153 22559 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_09650 22556 23359 gene locus_tag LOCUS_09660 22556 23359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 23398 24513 gene locus_tag LOCUS_09670 23398 24513 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123514.1 protein_id gnl|my_center|LOCUS_09670 24521 25582 gene locus_tag LOCUS_09680 24521 25582 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261424.1 protein_id gnl|my_center|LOCUS_09680 25579 26289 gene locus_tag LOCUS_09690 25579 26289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 27865 26462 gene locus_tag LOCUS_09700 27865 26462 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119759.1 protein_id gnl|my_center|LOCUS_09700 28073 30049 gene locus_tag LOCUS_09710 28073 30049 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921710.1 protein_id gnl|my_center|LOCUS_09710 31024 30545 gene locus_tag LOCUS_09720 31024 30545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 32340 31048 gene locus_tag LOCUS_09730 32340 31048 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_09730 33344 32340 gene locus_tag LOCUS_09740 33344 32340 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327421.1 protein_id gnl|my_center|LOCUS_09740 33511 34650 gene locus_tag LOCUS_09750 33511 34650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 36168 34687 gene locus_tag LOCUS_09760 36168 34687 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_09760 36451 37182 gene locus_tag LOCUS_09770 36451 37182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_09770 37179 39692 gene locus_tag LOCUS_09780 37179 39692 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207316850.1 protein_id gnl|my_center|LOCUS_09780 39828 40415 gene locus_tag LOCUS_09790 39828 40415 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946938.1 protein_id gnl|my_center|LOCUS_09790 40412 41083 gene locus_tag LOCUS_09800 40412 41083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 41080 41778 gene locus_tag LOCUS_09810 41080 41778 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228697.1 protein_id gnl|my_center|LOCUS_09810 43246 41768 gene locus_tag LOCUS_09820 43246 41768 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582544.1 protein_id gnl|my_center|LOCUS_09820 43653 43243 gene locus_tag LOCUS_09830 43653 43243 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_09830 43820 43747 gene locus_tag LOCUS_t00230 43820 43747 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44989 43916 gene locus_tag LOCUS_09840 44989 43916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 45135 45671 gene locus_tag LOCUS_09850 45135 45671 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_09850 46981 45731 gene locus_tag LOCUS_09860 46981 45731 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_09860 48069 47041 gene locus_tag LOCUS_09870 48069 47041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 48258 48100 gene locus_tag LOCUS_09880 48258 48100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 49670 48435 gene locus_tag LOCUS_09890 gene ilvA 49670 48435 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_09890 50310 49693 gene locus_tag LOCUS_09900 50310 49693 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_09900 50432 52474 gene locus_tag LOCUS_09910 50432 52474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 52897 55671 gene locus_tag LOCUS_09920 52897 55671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 55732 57945 gene locus_tag LOCUS_09930 55732 57945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 58109 60247 gene locus_tag LOCUS_09940 58109 60247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 61159 60293 gene locus_tag LOCUS_09950 61159 60293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 61293 61847 gene locus_tag LOCUS_09960 61293 61847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 61864 62157 gene locus_tag LOCUS_09970 61864 62157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 62994 62104 gene locus_tag LOCUS_09980 62994 62104 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_09980 65280 63049 gene locus_tag LOCUS_09990 65280 63049 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_09990 66255 65308 gene locus_tag LOCUS_10000 66255 65308 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616119.1 protein_id gnl|my_center|LOCUS_10000 68353 66266 gene locus_tag LOCUS_10010 68353 66266 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922336.1 protein_id gnl|my_center|LOCUS_10010 68752 68420 gene locus_tag LOCUS_10020 68752 68420 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442716.1 protein_id gnl|my_center|LOCUS_10020 70027 68873 gene locus_tag LOCUS_10030 70027 68873 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809384.1 protein_id gnl|my_center|LOCUS_10030 70851 70024 gene locus_tag LOCUS_10040 70851 70024 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221995.1 protein_id gnl|my_center|LOCUS_10040 71762 70848 gene locus_tag LOCUS_10050 71762 70848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 71939 72301 gene locus_tag LOCUS_10060 71939 72301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 73766 72372 gene locus_tag LOCUS_10070 73766 72372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 73929 75599 gene locus_tag LOCUS_10080 73929 75599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615466.1 protein_id gnl|my_center|LOCUS_10080 76317 75586 gene locus_tag LOCUS_10090 76317 75586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 76541 77113 gene locus_tag LOCUS_10100 76541 77113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 77250 78374 gene locus_tag LOCUS_10110 77250 78374 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922041.1 protein_id gnl|my_center|LOCUS_10110 79144 78416 gene locus_tag LOCUS_10120 79144 78416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 79976 79149 gene locus_tag LOCUS_10130 79976 79149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 80232 79978 gene locus_tag LOCUS_10140 80232 79978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 81680 80271 gene locus_tag LOCUS_10150 81680 80271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 83392 81695 gene locus_tag LOCUS_10160 83392 81695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 83931 83443 gene locus_tag LOCUS_10170 83931 83443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 84627 83959 gene locus_tag LOCUS_10180 84627 83959 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120692.1 protein_id gnl|my_center|LOCUS_10180 85803 84859 gene locus_tag LOCUS_10190 gene mdh 85803 84859 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_10190 87285 85936 gene locus_tag LOCUS_10200 87285 85936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 88346 87282 gene locus_tag LOCUS_10210 88346 87282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 88621 88343 gene locus_tag LOCUS_10220 88621 88343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 89151 88633 gene locus_tag LOCUS_10230 89151 88633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 89762 89151 gene locus_tag LOCUS_10240 89762 89151 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123491.1 protein_id gnl|my_center|LOCUS_10240 89923 90123 gene locus_tag LOCUS_10250 89923 90123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 90803 90315 gene locus_tag LOCUS_10260 90803 90315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 91822 90851 gene locus_tag LOCUS_10270 91822 90851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 92854 91853 gene locus_tag LOCUS_10280 gene cyoE 92854 91853 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123497.1 protein_id gnl|my_center|LOCUS_10280 93864 92851 gene locus_tag LOCUS_10290 93864 92851 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123498.1 protein_id gnl|my_center|LOCUS_10290 95901 94078 gene locus_tag LOCUS_10300 gene ctaD 95901 94078 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142160.1 protein_id gnl|my_center|LOCUS_10300 96730 95930 gene locus_tag LOCUS_10310 96730 95930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 98020 96773 gene locus_tag LOCUS_10320 98020 96773 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122077.1 protein_id gnl|my_center|LOCUS_10320 98894 98034 gene locus_tag LOCUS_10330 98894 98034 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_10330 99702 98905 gene locus_tag LOCUS_10340 99702 98905 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_10340 104324 99756 gene locus_tag LOCUS_10350 104324 99756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 105685 104360 gene locus_tag LOCUS_10360 105685 104360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 106468 105695 gene locus_tag LOCUS_10370 106468 105695 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_10370 107541 106483 gene locus_tag LOCUS_10380 107541 106483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 107849 109150 gene locus_tag LOCUS_10390 gene purD 107849 109150 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334006.1 protein_id gnl|my_center|LOCUS_10390 109147 110157 gene locus_tag LOCUS_10400 109147 110157 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427765.1 protein_id gnl|my_center|LOCUS_10400 111258 110185 gene locus_tag LOCUS_10410 111258 110185 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_10410 112086 111751 gene locus_tag LOCUS_10420 112086 111751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 112350 112970 gene locus_tag LOCUS_10430 112350 112970 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_10430 113326 113054 gene locus_tag LOCUS_10440 113326 113054 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_10440 113583 114242 gene locus_tag LOCUS_10450 113583 114242 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335404.1 protein_id gnl|my_center|LOCUS_10450 115169 114249 gene locus_tag LOCUS_10460 115169 114249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 115669 115166 gene locus_tag LOCUS_10470 115669 115166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 116680 115742 gene locus_tag LOCUS_10480 116680 115742 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_10480 116705 117064 gene locus_tag LOCUS_10490 gene nirD 116705 117064 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_10490 117749 117039 gene locus_tag LOCUS_10500 117749 117039 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 protein_id gnl|my_center|LOCUS_10500 119196 117760 gene locus_tag LOCUS_10510 119196 117760 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921298.1 protein_id gnl|my_center|LOCUS_10510 119372 119193 gene locus_tag LOCUS_10520 119372 119193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 119374 120579 gene locus_tag LOCUS_10530 119374 120579 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_10530 121214 121630 gene locus_tag LOCUS_10540 121214 121630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 121680 122186 gene locus_tag LOCUS_10550 121680 122186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 122323 122835 gene locus_tag LOCUS_10560 122323 122835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 124332 122902 gene locus_tag LOCUS_10570 124332 122902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 125529 124399 gene locus_tag LOCUS_10580 125529 124399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 126789 125557 gene locus_tag LOCUS_10590 126789 125557 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_10590 127617 126868 gene locus_tag LOCUS_10600 127617 126868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_10600 128780 127644 gene locus_tag LOCUS_10610 128780 127644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926879.1 protein_id gnl|my_center|LOCUS_10610 129986 128790 gene locus_tag LOCUS_10620 129986 128790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 131068 129983 gene locus_tag LOCUS_10630 131068 129983 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_10630 132912 131068 gene locus_tag LOCUS_10640 132912 131068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 136466 132912 gene locus_tag LOCUS_10650 136466 132912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 137497 136469 gene locus_tag LOCUS_10660 137497 136469 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_10660 138297 137494 gene locus_tag LOCUS_10670 138297 137494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 138537 139562 gene locus_tag LOCUS_10680 gene tatC 138537 139562 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338730.1 protein_id gnl|my_center|LOCUS_10680 140057 139527 gene locus_tag LOCUS_10690 140057 139527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 140203 140289 gene locus_tag LOCUS_t00240 140203 140289 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 140459 140689 gene locus_tag LOCUS_10700 140459 140689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 140803 142788 gene locus_tag LOCUS_10710 140803 142788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence08 1210 383 gene locus_tag LOCUS_10720 1210 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1292 2098 gene locus_tag LOCUS_10730 1292 2098 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_10730 2169 2921 gene locus_tag LOCUS_10740 2169 2921 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_10740 2867 4537 gene locus_tag LOCUS_10750 2867 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_10750 4731 6179 gene locus_tag LOCUS_10760 4731 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 6182 7846 gene locus_tag LOCUS_10770 6182 7846 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616258.1 protein_id gnl|my_center|LOCUS_10770 9645 7885 gene locus_tag LOCUS_10780 9645 7885 CDS product NADPH-dependent assimilatory sulfite reductase hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327402.1 protein_id gnl|my_center|LOCUS_10780 9726 10349 gene locus_tag LOCUS_10790 9726 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 10346 10789 gene locus_tag LOCUS_10800 10346 10789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 10789 11406 gene locus_tag LOCUS_10810 10789 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 11388 12449 gene locus_tag LOCUS_10820 11388 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 13507 12461 gene locus_tag LOCUS_10830 13507 12461 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_10830 14221 13553 gene locus_tag LOCUS_10840 14221 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 15126 14278 gene locus_tag LOCUS_10850 15126 14278 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_10850 16763 15273 gene locus_tag LOCUS_10860 16763 15273 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_10860 19593 16768 gene locus_tag LOCUS_10870 19593 16768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 19830 21026 gene locus_tag LOCUS_10880 19830 21026 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256990.1 protein_id gnl|my_center|LOCUS_10880 21031 21798 gene locus_tag LOCUS_10890 21031 21798 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224232.1 protein_id gnl|my_center|LOCUS_10890 23238 21826 gene locus_tag LOCUS_10900 gene glnA 23238 21826 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_10900 23666 23271 gene locus_tag LOCUS_10910 23666 23271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 25886 23865 gene locus_tag LOCUS_10920 gene thrS 25886 23865 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_10920 26094 26168 gene locus_tag LOCUS_t00250 26094 26168 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26475 26200 gene locus_tag LOCUS_10930 26475 26200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 26947 26501 gene locus_tag LOCUS_10940 26947 26501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 28765 26972 gene locus_tag LOCUS_10950 28765 26972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 28927 29484 gene locus_tag LOCUS_10960 28927 29484 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173534.1 protein_id gnl|my_center|LOCUS_10960 29549 30814 gene locus_tag LOCUS_10970 29549 30814 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_10970 32180 30852 gene locus_tag LOCUS_10980 32180 30852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 32492 32764 gene locus_tag LOCUS_10990 32492 32764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442631.1 protein_id gnl|my_center|LOCUS_10990 33648 32815 gene locus_tag LOCUS_11000 33648 32815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 33716 34585 gene locus_tag LOCUS_11010 33716 34585 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390590.1 protein_id gnl|my_center|LOCUS_11010 34590 35810 gene locus_tag LOCUS_11020 34590 35810 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_11020 35858 36169 gene locus_tag LOCUS_11030 35858 36169 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704380.1 protein_id gnl|my_center|LOCUS_11030 36191 40474 gene locus_tag LOCUS_11040 36191 40474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 40749 40498 gene locus_tag LOCUS_11050 40749 40498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 40786 42045 gene locus_tag LOCUS_11060 40786 42045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 42811 42077 gene locus_tag LOCUS_11070 42811 42077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 44718 42865 gene locus_tag LOCUS_11080 gene lepB 44718 42865 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442624.1 protein_id gnl|my_center|LOCUS_11080 45410 44778 gene locus_tag LOCUS_11090 45410 44778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 45391 45900 gene locus_tag LOCUS_11100 45391 45900 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404532.1 protein_id gnl|my_center|LOCUS_11100 45914 46885 gene locus_tag LOCUS_11110 45914 46885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_11110 46888 47421 gene locus_tag LOCUS_11120 46888 47421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 47491 47901 gene locus_tag LOCUS_11130 47491 47901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 48171 49658 gene locus_tag LOCUS_11140 48171 49658 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616218.1 protein_id gnl|my_center|LOCUS_11140 49664 50698 gene locus_tag LOCUS_11150 49664 50698 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921437.1 protein_id gnl|my_center|LOCUS_11150 51095 52906 gene locus_tag LOCUS_11160 gene lepA 51095 52906 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118463.1 protein_id gnl|my_center|LOCUS_11160 54275 53055 gene locus_tag LOCUS_11170 54275 53055 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_11170 54979 54299 gene locus_tag LOCUS_11180 54979 54299 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530139.1 protein_id gnl|my_center|LOCUS_11180 57150 55012 gene locus_tag LOCUS_11190 57150 55012 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435048.1 protein_id gnl|my_center|LOCUS_11190 58250 57150 gene locus_tag LOCUS_11200 58250 57150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 58493 60577 gene locus_tag LOCUS_11210 gene ftsH 58493 60577 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120515.1 protein_id gnl|my_center|LOCUS_11210 60808 60987 gene locus_tag LOCUS_11220 60808 60987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 61092 61493 gene locus_tag LOCUS_11230 61092 61493 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337214.1 protein_id gnl|my_center|LOCUS_11230 62454 61549 gene locus_tag LOCUS_11240 62454 61549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 63597 62782 gene locus_tag LOCUS_11250 63597 62782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 64564 63653 gene locus_tag LOCUS_11260 gene lpxI 64564 63653 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_11260 65633 64578 gene locus_tag LOCUS_11270 gene lpxD 65633 64578 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922341.1 protein_id gnl|my_center|LOCUS_11270 66166 65696 gene locus_tag LOCUS_11280 66166 65696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_11280 66614 66261 gene locus_tag LOCUS_11290 66614 66261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 67422 66676 gene locus_tag LOCUS_11300 67422 66676 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_11300 68420 67422 gene locus_tag LOCUS_11310 68420 67422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 68682 70274 gene locus_tag LOCUS_11320 68682 70274 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 protein_id gnl|my_center|LOCUS_11320 71167 70295 gene locus_tag LOCUS_11330 71167 70295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 71916 71203 gene locus_tag LOCUS_11340 71916 71203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 72623 73375 gene locus_tag LOCUS_11350 72623 73375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 74448 73441 gene locus_tag LOCUS_11360 74448 73441 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_11360 74600 75487 gene locus_tag LOCUS_11370 74600 75487 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922686.1 protein_id gnl|my_center|LOCUS_11370 76867 75557 gene locus_tag LOCUS_11380 gene zigA 76867 75557 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446171.1 protein_id gnl|my_center|LOCUS_11380 77041 78051 gene locus_tag LOCUS_11390 77041 78051 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922391.1 protein_id gnl|my_center|LOCUS_11390 78745 78083 gene locus_tag LOCUS_11400 78745 78083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 78764 80320 gene locus_tag LOCUS_11410 78764 80320 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922119.1 protein_id gnl|my_center|LOCUS_11410 80514 81425 gene locus_tag LOCUS_11420 gene cysD 80514 81425 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 protein_id gnl|my_center|LOCUS_11420 81672 83606 gene locus_tag LOCUS_11430 gene cysN 81672 83606 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121644.1 protein_id gnl|my_center|LOCUS_11430 83606 84142 gene locus_tag LOCUS_11440 gene mog 83606 84142 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 protein_id gnl|my_center|LOCUS_11440 85219 84206 gene locus_tag LOCUS_11450 gene hemB 85219 84206 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921457.1 protein_id gnl|my_center|LOCUS_11450 85764 85246 gene locus_tag LOCUS_11460 gene queD 85764 85246 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264135.1 protein_id gnl|my_center|LOCUS_11460 86633 85791 gene locus_tag LOCUS_11470 86633 85791 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_11470 86916 86674 gene locus_tag LOCUS_11480 86916 86674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 87541 87050 gene locus_tag LOCUS_11490 gene hisI 87541 87050 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_11490 87771 89075 gene locus_tag LOCUS_11500 87771 89075 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_11500 89839 89153 gene locus_tag LOCUS_11510 gene aqpZ 89839 89153 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262065.1 protein_id gnl|my_center|LOCUS_11510 90337 89960 gene locus_tag LOCUS_11520 90337 89960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 90899 90369 gene locus_tag LOCUS_11530 90899 90369 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844498.1 protein_id gnl|my_center|LOCUS_11530 91033 92043 gene locus_tag LOCUS_11540 gene galT 91033 92043 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_11540 92268 94388 gene locus_tag LOCUS_11550 92268 94388 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_11550 95100 94402 gene locus_tag LOCUS_11560 95100 94402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 95224 95439 gene locus_tag LOCUS_11570 95224 95439 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053680.1 protein_id gnl|my_center|LOCUS_11570 95448 97538 gene locus_tag LOCUS_11580 95448 97538 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326708.1 protein_id gnl|my_center|LOCUS_11580 97552 97731 gene locus_tag LOCUS_11590 97552 97731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 100434 97747 gene locus_tag LOCUS_11600 100434 97747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 102761 100431 gene locus_tag LOCUS_11610 102761 100431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 103916 102798 gene locus_tag LOCUS_11620 103916 102798 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921976.1 protein_id gnl|my_center|LOCUS_11620 104601 104089 gene locus_tag LOCUS_11630 104601 104089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 105641 104832 gene locus_tag LOCUS_11640 105641 104832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 105864 107252 gene locus_tag LOCUS_11650 105864 107252 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427766.1 protein_id gnl|my_center|LOCUS_11650 107292 108269 gene locus_tag LOCUS_11660 gene wbpB 107292 108269 CDS product UDP-N-acetyl-2-amino-2-deoxy-D-glucuronate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113428.1 protein_id gnl|my_center|LOCUS_11660 108271 110100 gene locus_tag LOCUS_11670 108271 110100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 110109 111305 gene locus_tag LOCUS_11680 110109 111305 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208048.1 protein_id gnl|my_center|LOCUS_11680 111403 112755 gene locus_tag LOCUS_11690 111403 112755 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172046.1 protein_id gnl|my_center|LOCUS_11690 112752 113993 gene locus_tag LOCUS_11700 112752 113993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 113977 115188 gene locus_tag LOCUS_11710 113977 115188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 115191 117068 gene locus_tag LOCUS_11720 gene asnB 115191 117068 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_11720 117228 118523 gene locus_tag LOCUS_11730 117228 118523 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_11730 118558 119583 gene locus_tag LOCUS_11740 118558 119583 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057042.1 protein_id gnl|my_center|LOCUS_11740 120510 119593 gene locus_tag LOCUS_11750 120510 119593 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_11750 121081 120554 gene locus_tag LOCUS_11760 121081 120554 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257362.1 protein_id gnl|my_center|LOCUS_11760 121745 121089 gene locus_tag LOCUS_11770 121745 121089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 125911 121745 gene locus_tag LOCUS_11780 125911 121745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence09 1487 186 gene locus_tag LOCUS_11790 1487 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 2602 1736 gene locus_tag LOCUS_11800 2602 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 3564 2794 gene locus_tag LOCUS_11810 3564 2794 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_11810 6506 3564 gene locus_tag LOCUS_11820 gene purL 6506 3564 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_11820 7311 6490 gene locus_tag LOCUS_11830 7311 6490 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930098.1 protein_id gnl|my_center|LOCUS_11830 7520 8587 gene locus_tag LOCUS_11840 7520 8587 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401898.1 protein_id gnl|my_center|LOCUS_11840 8713 9504 gene locus_tag LOCUS_11850 8713 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 10896 9550 gene locus_tag LOCUS_11860 10896 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 11456 11001 gene locus_tag LOCUS_11870 11456 11001 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192119.1 protein_id gnl|my_center|LOCUS_11870 13264 11468 gene locus_tag LOCUS_11880 13264 11468 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_11880 13437 14060 gene locus_tag LOCUS_11890 13437 14060 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940745.1 protein_id gnl|my_center|LOCUS_11890 14447 15493 gene locus_tag LOCUS_11900 14447 15493 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_11900 15508 16140 gene locus_tag LOCUS_11910 15508 16140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 16328 16603 gene locus_tag LOCUS_11920 16328 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 17498 16728 gene locus_tag LOCUS_11930 17498 16728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 17763 18677 gene locus_tag LOCUS_11940 17763 18677 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_11940 18825 19154 gene locus_tag LOCUS_11950 18825 19154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 19345 20073 gene locus_tag LOCUS_11960 19345 20073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 20499 20218 gene locus_tag LOCUS_11970 20499 20218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 20610 21542 gene locus_tag LOCUS_11980 20610 21542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 21610 21834 gene locus_tag LOCUS_11990 21610 21834 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_11990 21831 22205 gene locus_tag LOCUS_12000 21831 22205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 22271 22654 gene locus_tag LOCUS_12010 22271 22654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 22702 22627 gene locus_tag LOCUS_t00260 22702 22627 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23805 22780 gene locus_tag LOCUS_12020 23805 22780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 24173 23904 gene locus_tag LOCUS_12030 24173 23904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 25212 24448 gene locus_tag LOCUS_12040 25212 24448 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121230.1 protein_id gnl|my_center|LOCUS_12040 25102 26358 gene locus_tag LOCUS_12050 25102 26358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 26389 26841 gene locus_tag LOCUS_12060 26389 26841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 27681 26845 gene locus_tag LOCUS_12070 27681 26845 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_12070 28298 27735 gene locus_tag LOCUS_12080 28298 27735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 28473 30845 gene locus_tag LOCUS_12090 28473 30845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 31008 31328 gene locus_tag LOCUS_12100 gene raiA 31008 31328 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328917.1 protein_id gnl|my_center|LOCUS_12100 31388 31864 gene locus_tag LOCUS_12110 31388 31864 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_12110 31882 32196 gene locus_tag LOCUS_12120 31882 32196 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332233.1 protein_id gnl|my_center|LOCUS_12120 32423 34162 gene locus_tag LOCUS_12130 gene ptsP 32423 34162 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_12130 34220 35848 gene locus_tag LOCUS_12140 34220 35848 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_12140 35978 36352 gene locus_tag LOCUS_12150 gene rplU 35978 36352 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325148.1 protein_id gnl|my_center|LOCUS_12150 38302 36413 gene locus_tag LOCUS_12160 38302 36413 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_12160 38410 38820 gene locus_tag LOCUS_12170 38410 38820 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_12170 38880 40229 gene locus_tag LOCUS_12180 38880 40229 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_12180 40290 40364 gene locus_tag LOCUS_t00270 40290 40364 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 41639 40380 gene locus_tag LOCUS_12190 41639 40380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 43189 41669 gene locus_tag LOCUS_12200 43189 41669 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_12200 43456 44205 gene locus_tag LOCUS_12210 43456 44205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 44429 46114 gene locus_tag LOCUS_12220 44429 46114 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_12220 46147 46452 gene locus_tag LOCUS_12230 46147 46452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 47869 46721 gene locus_tag LOCUS_12240 47869 46721 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867719.1 protein_id gnl|my_center|LOCUS_12240 49271 47940 gene locus_tag LOCUS_12250 49271 47940 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007341012.1 protein_id gnl|my_center|LOCUS_12250 49723 52221 gene locus_tag LOCUS_12260 49723 52221 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426223.1 protein_id gnl|my_center|LOCUS_12260 52521 52300 gene locus_tag LOCUS_12270 gene infA 52521 52300 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328023.1 protein_id gnl|my_center|LOCUS_12270 53601 52591 gene locus_tag LOCUS_12280 gene prfB 53601 52591 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146392543.1 protein_id gnl|my_center|LOCUS_12280 54963 53830 gene locus_tag LOCUS_12290 gene dprA 54963 53830 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 protein_id gnl|my_center|LOCUS_12290 55470 55075 gene locus_tag LOCUS_12300 55470 55075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 56849 55569 gene locus_tag LOCUS_12310 gene lysA 56849 55569 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103031.1 protein_id gnl|my_center|LOCUS_12310 58599 56896 gene locus_tag LOCUS_12320 58599 56896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 58730 59638 gene locus_tag LOCUS_12330 58730 59638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 61509 59650 gene locus_tag LOCUS_12340 61509 59650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 61690 62973 gene locus_tag LOCUS_12350 61690 62973 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120806.1 protein_id gnl|my_center|LOCUS_12350 62984 63850 gene locus_tag LOCUS_12360 62984 63850 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329752.1 protein_id gnl|my_center|LOCUS_12360 63847 64923 gene locus_tag LOCUS_12370 63847 64923 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_12370 65030 65518 gene locus_tag LOCUS_12380 65030 65518 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532413.1 protein_id gnl|my_center|LOCUS_12380 65556 66731 gene locus_tag LOCUS_12390 65556 66731 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_12390 66856 67644 gene locus_tag LOCUS_12400 66856 67644 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270259.1 protein_id gnl|my_center|LOCUS_12400 67770 69056 gene locus_tag LOCUS_12410 67770 69056 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_12410 70251 68992 gene locus_tag LOCUS_12420 70251 68992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 70958 70446 gene locus_tag LOCUS_12430 70958 70446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 71225 74737 gene locus_tag LOCUS_12440 71225 74737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 75851 74640 gene locus_tag LOCUS_12450 75851 74640 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402885.1 protein_id gnl|my_center|LOCUS_12450 76829 75864 gene locus_tag LOCUS_12460 76829 75864 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_12460 77275 77931 gene locus_tag LOCUS_12470 77275 77931 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_12470 78215 78568 gene locus_tag LOCUS_12480 78215 78568 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122082.1 protein_id gnl|my_center|LOCUS_12480 78676 79236 gene locus_tag LOCUS_12490 78676 79236 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_12490 79287 80717 gene locus_tag LOCUS_12500 79287 80717 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_12500 80720 81595 gene locus_tag LOCUS_12510 80720 81595 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922402.1 protein_id gnl|my_center|LOCUS_12510 81632 81907 gene locus_tag LOCUS_12520 81632 81907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 82357 81962 gene locus_tag LOCUS_12530 82357 81962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 82693 82388 gene locus_tag LOCUS_12540 82693 82388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 86318 82845 gene locus_tag LOCUS_12550 86318 82845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 86507 88375 gene locus_tag LOCUS_12560 gene asnB 86507 88375 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533108.1 protein_id gnl|my_center|LOCUS_12560 88430 89221 gene locus_tag LOCUS_12570 88430 89221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 90123 89278 gene locus_tag LOCUS_12580 90123 89278 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_12580 90895 90134 gene locus_tag LOCUS_12590 90895 90134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 91932 91096 gene locus_tag LOCUS_12600 91932 91096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 94045 92204 gene locus_tag LOCUS_12610 94045 92204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 94231 94956 gene locus_tag LOCUS_12620 94231 94956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 95767 94982 gene locus_tag LOCUS_12630 95767 94982 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173676.1 protein_id gnl|my_center|LOCUS_12630 96677 95817 gene locus_tag LOCUS_12640 96677 95817 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_12640 97581 96760 gene locus_tag LOCUS_12650 97581 96760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 97923 99116 gene locus_tag LOCUS_12660 97923 99116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 99270 99491 gene locus_tag LOCUS_12670 gene acpP 99270 99491 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381096.1 protein_id gnl|my_center|LOCUS_12670 99488 100849 gene locus_tag LOCUS_12680 gene fabF 99488 100849 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706107.1 protein_id gnl|my_center|LOCUS_12680 100890 101642 gene locus_tag LOCUS_12690 100890 101642 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970076.1 protein_id gnl|my_center|LOCUS_12690 101798 101723 gene locus_tag LOCUS_t00280 101798 101723 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 103277 101898 gene locus_tag LOCUS_12700 103277 101898 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_12700 103678 103283 gene locus_tag LOCUS_12710 103678 103283 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_12710 103905 103675 gene locus_tag LOCUS_12720 103905 103675 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142728.1 protein_id gnl|my_center|LOCUS_12720 105724 103937 gene locus_tag LOCUS_12730 gene recJ 105724 103937 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_12730 105892 106386 gene locus_tag LOCUS_12740 105892 106386 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117815.1 protein_id gnl|my_center|LOCUS_12740 106469 107809 gene locus_tag LOCUS_12750 gene hisS 106469 107809 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117814.1 protein_id gnl|my_center|LOCUS_12750 108999 107881 gene locus_tag LOCUS_12760 108999 107881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 109114 109812 gene locus_tag LOCUS_12770 109114 109812 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331623.1 protein_id gnl|my_center|LOCUS_12770 111459 109858 gene locus_tag LOCUS_12780 111459 109858 CDS product family 2A encapsulin nanocompartment cargo protein cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729903.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence10 <1 996 gene locus_tag LOCUS_12790 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922172.1:DUF1559 domain-containing protein 1512 1024 gene locus_tag LOCUS_12800 1512 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1898 5464 gene locus_tag LOCUS_12810 1898 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 5541 5813 gene locus_tag LOCUS_12820 5541 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 5951 7600 gene locus_tag LOCUS_12830 5951 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 8092 7718 gene locus_tag LOCUS_12840 8092 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 9184 8198 gene locus_tag LOCUS_12850 9184 8198 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_12850 9483 9178 gene locus_tag LOCUS_12860 9483 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 10118 9603 gene locus_tag LOCUS_12870 10118 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 10435 11775 gene locus_tag LOCUS_12880 10435 11775 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_12880 13986 11830 gene locus_tag LOCUS_12890 13986 11830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 15475 14636 gene locus_tag LOCUS_12900 15475 14636 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390557.1 protein_id gnl|my_center|LOCUS_12900 16838 15480 gene locus_tag LOCUS_12910 gene xylE 16838 15480 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_12910 18070 16856 gene locus_tag LOCUS_12920 18070 16856 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_12920 18210 19520 gene locus_tag LOCUS_12930 gene hemL 18210 19520 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_12930 19517 21043 gene locus_tag LOCUS_12940 19517 21043 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088347.1 protein_id gnl|my_center|LOCUS_12940 21084 21857 gene locus_tag LOCUS_12950 21084 21857 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803797.1 protein_id gnl|my_center|LOCUS_12950 21854 22705 gene locus_tag LOCUS_12960 21854 22705 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 protein_id gnl|my_center|LOCUS_12960 23882 22725 gene locus_tag LOCUS_12970 23882 22725 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668699.1 protein_id gnl|my_center|LOCUS_12970 24750 25058 gene locus_tag LOCUS_12980 24750 25058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 25299 27410 gene locus_tag LOCUS_12990 25299 27410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 27607 28299 gene locus_tag LOCUS_13000 27607 28299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 30277 28358 gene locus_tag LOCUS_13010 30277 28358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 31870 30560 gene locus_tag LOCUS_13020 31870 30560 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_13020 32723 31896 gene locus_tag LOCUS_13030 32723 31896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 35044 32726 gene locus_tag LOCUS_13040 35044 32726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 36502 35315 gene locus_tag LOCUS_13050 36502 35315 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_13050 36681 36983 gene locus_tag LOCUS_13060 36681 36983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 37971 37036 gene locus_tag LOCUS_13070 37971 37036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 38178 38519 gene locus_tag LOCUS_13080 38178 38519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 38516 39799 gene locus_tag LOCUS_13090 38516 39799 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_13090 40614 39808 gene locus_tag LOCUS_13100 gene dapB 40614 39808 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123511.1 protein_id gnl|my_center|LOCUS_13100 42016 40607 gene locus_tag LOCUS_13110 gene thrC 42016 40607 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_13110 42302 42700 gene locus_tag LOCUS_13120 42302 42700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 42764 43375 gene locus_tag LOCUS_13130 42764 43375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 43372 44220 gene locus_tag LOCUS_13140 gene hisN 43372 44220 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921412.1 protein_id gnl|my_center|LOCUS_13140 44361 44681 gene locus_tag LOCUS_13150 44361 44681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 44694 44996 gene locus_tag LOCUS_13160 gene gatC 44694 44996 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_13160 45038 46522 gene locus_tag LOCUS_13170 gene gatA 45038 46522 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119740.1 protein_id gnl|my_center|LOCUS_13170 46525 48015 gene locus_tag LOCUS_13180 gene gatB 46525 48015 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122965.1 protein_id gnl|my_center|LOCUS_13180 48061 48840 gene locus_tag LOCUS_13190 48061 48840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 48837 50198 gene locus_tag LOCUS_13200 gene bioA 48837 50198 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_13200 51242 50244 gene locus_tag LOCUS_13210 51242 50244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 53399 51261 gene locus_tag LOCUS_13220 53399 51261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 54697 53396 gene locus_tag LOCUS_13230 54697 53396 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118102.1 protein_id gnl|my_center|LOCUS_13230 55909 55208 gene locus_tag LOCUS_13240 55909 55208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 56005 56397 gene locus_tag LOCUS_13250 56005 56397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 56535 57749 gene locus_tag LOCUS_13260 56535 57749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 57878 59968 gene locus_tag LOCUS_13270 57878 59968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 59968 62655 gene locus_tag LOCUS_13280 59968 62655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 62652 62900 gene locus_tag LOCUS_13290 62652 62900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 65752 62807 gene locus_tag LOCUS_13300 65752 62807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 66915 66055 gene locus_tag LOCUS_13310 gene prmC 66915 66055 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_13310 68023 66926 gene locus_tag LOCUS_13320 gene prfA 68023 66926 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328933.1 protein_id gnl|my_center|LOCUS_13320 68300 68046 gene locus_tag LOCUS_13330 gene rpmE 68300 68046 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328932.1 protein_id gnl|my_center|LOCUS_13330 70242 68494 gene locus_tag LOCUS_13340 70242 68494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664385.1 protein_id gnl|my_center|LOCUS_13340 71036 70239 gene locus_tag LOCUS_13350 gene kdsA 71036 70239 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 protein_id gnl|my_center|LOCUS_13350 71699 71772 gene locus_tag LOCUS_t00290 71699 71772 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 71835 73172 gene locus_tag LOCUS_13360 71835 73172 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332711.1 protein_id gnl|my_center|LOCUS_13360 73367 74485 gene locus_tag LOCUS_13370 73367 74485 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327172.1 protein_id gnl|my_center|LOCUS_13370 76776 74773 gene locus_tag LOCUS_13380 76776 74773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 77193 76786 gene locus_tag LOCUS_13390 77193 76786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 77482 77183 gene locus_tag LOCUS_13400 77482 77183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 77585 79936 gene locus_tag LOCUS_13410 77585 79936 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118530.1 protein_id gnl|my_center|LOCUS_13410 81965 79974 gene locus_tag LOCUS_13420 81965 79974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121814.1 protein_id gnl|my_center|LOCUS_13420 83485 82259 gene locus_tag LOCUS_13430 83485 82259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 84723 83509 gene locus_tag LOCUS_13440 84723 83509 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326489.1 protein_id gnl|my_center|LOCUS_13440 86296 84734 gene locus_tag LOCUS_13450 gene pyk 86296 84734 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908243.1 protein_id gnl|my_center|LOCUS_13450 86453 87313 gene locus_tag LOCUS_13460 86453 87313 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113772.1 protein_id gnl|my_center|LOCUS_13460 87423 88742 gene locus_tag LOCUS_13470 gene xylA 87423 88742 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_13470 88762 89832 gene locus_tag LOCUS_13480 88762 89832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 92458 89798 gene locus_tag LOCUS_13490 gene glnD 92458 89798 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325417.1 protein_id gnl|my_center|LOCUS_13490 92975 92436 gene locus_tag LOCUS_13500 92975 92436 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_13500 93018 94199 gene locus_tag LOCUS_13510 93018 94199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 94196 95008 gene locus_tag LOCUS_13520 gene proC 94196 95008 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921679.1 protein_id gnl|my_center|LOCUS_13520 95216 95028 gene locus_tag LOCUS_13530 95216 95028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 95729 95310 gene locus_tag LOCUS_13540 95729 95310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 95843 96172 gene locus_tag LOCUS_13550 gene trxA 95843 96172 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_13550 97795 96245 gene locus_tag LOCUS_13560 97795 96245 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121117.1 protein_id gnl|my_center|LOCUS_13560 98190 99701 gene locus_tag LOCUS_13570 98190 99701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 99830 100468 gene locus_tag LOCUS_13580 99830 100468 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_13580 101197 100607 gene locus_tag LOCUS_13590 101197 100607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 102701 101226 gene locus_tag LOCUS_13600 gene guaB 102701 101226 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325011.1 protein_id gnl|my_center|LOCUS_13600 102903 103592 gene locus_tag LOCUS_13610 102903 103592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_13610 103640 104572 gene locus_tag LOCUS_13620 103640 104572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence11 9460 4184 gene locus_tag LOCUS_13630 9460 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 10634 9819 gene locus_tag LOCUS_13640 10634 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 11945 10848 gene locus_tag LOCUS_13650 11945 10848 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_13650 13076 11988 gene locus_tag LOCUS_13660 13076 11988 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525170.1 protein_id gnl|my_center|LOCUS_13660 14252 13269 gene locus_tag LOCUS_13670 14252 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 15002 14373 gene locus_tag LOCUS_13680 15002 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 15157 14975 gene locus_tag LOCUS_13690 15157 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 17993 15405 gene locus_tag LOCUS_13700 gene hrpB 17993 15405 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921689.1 protein_id gnl|my_center|LOCUS_13700 18578 18084 gene locus_tag LOCUS_13710 18578 18084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 19713 18622 gene locus_tag LOCUS_13720 19713 18622 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_13720 19830 20972 gene locus_tag LOCUS_13730 gene solA 19830 20972 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_13730 21019 22383 gene locus_tag LOCUS_13740 21019 22383 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_13740 22442 23707 gene locus_tag LOCUS_13750 22442 23707 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_13750 24772 24044 gene locus_tag LOCUS_13760 24772 24044 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038272.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13760 25109 25288 gene locus_tag LOCUS_13770 25109 25288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 26764 25328 gene locus_tag LOCUS_13780 26764 25328 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948368.1 protein_id gnl|my_center|LOCUS_13780 27555 27274 gene locus_tag LOCUS_13790 27555 27274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 29180 27552 gene locus_tag LOCUS_13800 29180 27552 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_13800 29663 29382 gene locus_tag LOCUS_13810 29663 29382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 32612 29835 gene locus_tag LOCUS_13820 32612 29835 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124854.1 protein_id gnl|my_center|LOCUS_13820 33775 32621 gene locus_tag LOCUS_13830 33775 32621 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124855.1 protein_id gnl|my_center|LOCUS_13830 34422 33772 gene locus_tag LOCUS_13840 34422 33772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 35626 34472 gene locus_tag LOCUS_13850 gene yjiB 35626 34472 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_13850 35961 35686 gene locus_tag LOCUS_13860 35961 35686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 36473 35973 gene locus_tag LOCUS_13870 36473 35973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 36587 36886 gene locus_tag LOCUS_13880 36587 36886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 37169 37462 gene locus_tag LOCUS_13890 37169 37462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 37788 37492 gene locus_tag LOCUS_13900 37788 37492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 38961 37879 gene locus_tag LOCUS_13910 38961 37879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 39093 42044 gene locus_tag LOCUS_13920 39093 42044 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_13920 42242 43279 gene locus_tag LOCUS_13930 gene xylA 42242 43279 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730977.1 protein_id gnl|my_center|LOCUS_13930 43290 44519 gene locus_tag LOCUS_13940 43290 44519 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459824.1 protein_id gnl|my_center|LOCUS_13940 44527 45492 gene locus_tag LOCUS_13950 44527 45492 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140504.1 protein_id gnl|my_center|LOCUS_13950 46619 45696 gene locus_tag LOCUS_13960 46619 45696 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_13960 46873 47310 gene locus_tag LOCUS_13970 46873 47310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 47408 47632 gene locus_tag LOCUS_13980 47408 47632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 47808 48302 gene locus_tag LOCUS_13990 47808 48302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 48519 49286 gene locus_tag LOCUS_14000 48519 49286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 50296 49586 gene locus_tag LOCUS_14010 50296 49586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 51014 50424 gene locus_tag LOCUS_14020 51014 50424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 51648 51382 gene locus_tag LOCUS_14030 51648 51382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 52061 51717 gene locus_tag LOCUS_14040 52061 51717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 52627 52412 gene locus_tag LOCUS_14050 52627 52412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 52920 52711 gene locus_tag LOCUS_14060 52920 52711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 53088 53321 gene locus_tag LOCUS_14070 53088 53321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 53311 53742 gene locus_tag LOCUS_14080 53311 53742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 54060 53860 gene locus_tag LOCUS_14090 54060 53860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 54814 55104 gene locus_tag LOCUS_14100 54814 55104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 55483 57477 gene locus_tag LOCUS_14110 55483 57477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 57587 57823 gene locus_tag LOCUS_14120 57587 57823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 58327 58100 gene locus_tag LOCUS_14130 58327 58100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 58343 59197 gene locus_tag LOCUS_14140 58343 59197 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537580.1 protein_id gnl|my_center|LOCUS_14140 60300 59212 gene locus_tag LOCUS_14150 60300 59212 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_14150 61630 60314 gene locus_tag LOCUS_14160 gene gntT 61630 60314 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174795.1 protein_id gnl|my_center|LOCUS_14160 62299 61634 gene locus_tag LOCUS_14170 62299 61634 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_14170 62775 62302 gene locus_tag LOCUS_14180 62775 62302 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_14180 63570 64877 gene locus_tag LOCUS_14190 gene ltrA 63570 64877 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118084.1 protein_id gnl|my_center|LOCUS_14190 65041 66477 gene locus_tag LOCUS_14200 65041 66477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 66505 68277 gene locus_tag LOCUS_14210 66505 68277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14210 68563 68739 gene locus_tag LOCUS_14220 68563 68739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 68750 69364 gene locus_tag LOCUS_14230 68750 69364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 69599 69859 gene locus_tag LOCUS_14240 69599 69859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 69852 71075 gene locus_tag LOCUS_14250 69852 71075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 71356 71269 gene locus_tag LOCUS_t00300 71356 71269 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 72728 71433 gene locus_tag LOCUS_14260 gene chrA 72728 71433 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206681.1 protein_id gnl|my_center|LOCUS_14260 72860 73057 gene locus_tag LOCUS_14270 72860 73057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 75740 73092 gene locus_tag LOCUS_14280 gene clpB 75740 73092 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922205.1 protein_id gnl|my_center|LOCUS_14280 77736 75826 gene locus_tag LOCUS_14290 gene dnaK 77736 75826 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326035.1 protein_id gnl|my_center|LOCUS_14290 77893 79065 gene locus_tag LOCUS_14300 gene pheA 77893 79065 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546845.1 protein_id gnl|my_center|LOCUS_14300 79176 79952 gene locus_tag LOCUS_14310 gene tpiA 79176 79952 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_14310 80087 80659 gene locus_tag LOCUS_14320 80087 80659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 80681 81562 gene locus_tag LOCUS_14330 80681 81562 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_14330 81608 82228 gene locus_tag LOCUS_14340 gene gmk 81608 82228 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326728.1 protein_id gnl|my_center|LOCUS_14340 82225 82488 gene locus_tag LOCUS_14350 82225 82488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 82488 83054 gene locus_tag LOCUS_14360 82488 83054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14360 83086 83718 gene locus_tag LOCUS_14370 83086 83718 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121990.1 protein_id gnl|my_center|LOCUS_14370 83946 84956 gene locus_tag LOCUS_14380 gene argC 83946 84956 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118924.1 protein_id gnl|my_center|LOCUS_14380 85180 86403 gene locus_tag LOCUS_14390 gene argJ 85180 86403 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119260.1 protein_id gnl|my_center|LOCUS_14390 86528 86881 gene locus_tag LOCUS_14400 86528 86881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 86912 87295 gene locus_tag LOCUS_14410 86912 87295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 87329 88159 gene locus_tag LOCUS_14420 87329 88159 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121000.1 protein_id gnl|my_center|LOCUS_14420 88219 89640 gene locus_tag LOCUS_14430 88219 89640 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922613.1 protein_id gnl|my_center|LOCUS_14430 89753 93205 gene locus_tag LOCUS_14440 gene ileS 89753 93205 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434976.1 protein_id gnl|my_center|LOCUS_14440 93296 93886 gene locus_tag LOCUS_14450 gene purN 93296 93886 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_14450 93906 94427 gene locus_tag LOCUS_14460 93906 94427 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615596.1 protein_id gnl|my_center|LOCUS_14460 94438 95040 gene locus_tag LOCUS_14470 94438 95040 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087162.1 protein_id gnl|my_center|LOCUS_14470 95266 96864 gene locus_tag LOCUS_14480 95266 96864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 96889 97611 gene locus_tag LOCUS_14490 96889 97611 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977081.1 protein_id gnl|my_center|LOCUS_14490 98361 97645 gene locus_tag LOCUS_14500 98361 97645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 99044 98574 gene locus_tag LOCUS_14510 99044 98574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 100141 99041 gene locus_tag LOCUS_14520 100141 99041 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119341.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence12 1149 688 gene locus_tag LOCUS_14530 gene greA 1149 688 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339475.1 protein_id gnl|my_center|LOCUS_14530 1965 1258 gene locus_tag LOCUS_14540 1965 1258 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326094.1 protein_id gnl|my_center|LOCUS_14540 3778 2051 gene locus_tag LOCUS_14550 3778 2051 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_14550 5767 3878 gene locus_tag LOCUS_14560 5767 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 6428 5955 gene locus_tag LOCUS_14570 6428 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 6397 6651 gene locus_tag LOCUS_14580 6397 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 7296 6547 gene locus_tag LOCUS_14590 7296 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 8880 7342 gene locus_tag LOCUS_14600 8880 7342 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_14600 9021 11804 gene locus_tag LOCUS_14610 9021 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 11801 12520 gene locus_tag LOCUS_14620 11801 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 13251 12670 gene locus_tag LOCUS_14630 13251 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 13439 13816 gene locus_tag LOCUS_14640 13439 13816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 13848 16967 gene locus_tag LOCUS_14650 13848 16967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 17937 16999 gene locus_tag LOCUS_14660 17937 16999 CDS product lactate/malate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_14660 18887 17991 gene locus_tag LOCUS_14670 18887 17991 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_14670 19317 18931 gene locus_tag LOCUS_14680 19317 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 20108 19356 gene locus_tag LOCUS_14690 20108 19356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 20397 20134 gene locus_tag LOCUS_14700 20397 20134 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118934.1 protein_id gnl|my_center|LOCUS_14700 21886 20411 gene locus_tag LOCUS_14710 21886 20411 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_14710 22256 21948 gene locus_tag LOCUS_14720 22256 21948 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_14720 23497 22256 gene locus_tag LOCUS_14730 23497 22256 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118936.1 protein_id gnl|my_center|LOCUS_14730 23884 23615 gene locus_tag LOCUS_14740 23884 23615 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324357.1 protein_id gnl|my_center|LOCUS_14740 24229 23945 gene locus_tag LOCUS_14750 24229 23945 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_14750 25070 24357 gene locus_tag LOCUS_14760 25070 24357 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 protein_id gnl|my_center|LOCUS_14760 25888 25067 gene locus_tag LOCUS_14770 25888 25067 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_14770 26311 26682 gene locus_tag LOCUS_14780 26311 26682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 29215 26723 gene locus_tag LOCUS_14790 29215 26723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 29535 32585 gene locus_tag LOCUS_14800 29535 32585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 33502 32855 gene locus_tag LOCUS_14810 33502 32855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 33888 33595 gene locus_tag LOCUS_14820 33888 33595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 34619 34876 gene locus_tag LOCUS_14830 34619 34876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 35137 36996 gene locus_tag LOCUS_14840 35137 36996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 37403 38020 gene locus_tag LOCUS_14850 37403 38020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 38295 39845 gene locus_tag LOCUS_14860 38295 39845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 39908 40990 gene locus_tag LOCUS_14870 39908 40990 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922840.1 protein_id gnl|my_center|LOCUS_14870 41028 41921 gene locus_tag LOCUS_14880 41028 41921 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_14880 41918 44089 gene locus_tag LOCUS_14890 41918 44089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 44086 46254 gene locus_tag LOCUS_14900 44086 46254 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_14900 46287 47534 gene locus_tag LOCUS_14910 46287 47534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 47531 51337 gene locus_tag LOCUS_14920 47531 51337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 51346 53580 gene locus_tag LOCUS_14930 51346 53580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 53577 57152 gene locus_tag LOCUS_14940 53577 57152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 57798 57499 gene locus_tag LOCUS_14950 57798 57499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 57706 60600 gene locus_tag LOCUS_14960 57706 60600 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_14960 60609 62054 gene locus_tag LOCUS_14970 60609 62054 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_14970 62075 65170 gene locus_tag LOCUS_14980 62075 65170 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146849598.1 protein_id gnl|my_center|LOCUS_14980 65191 66636 gene locus_tag LOCUS_14990 65191 66636 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_14990 67968 66709 gene locus_tag LOCUS_15000 67968 66709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 69231 68041 gene locus_tag LOCUS_15010 69231 68041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 69456 70886 gene locus_tag LOCUS_15020 69456 70886 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_15020 70927 75051 gene locus_tag LOCUS_15030 70927 75051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 75051 76505 gene locus_tag LOCUS_15040 75051 76505 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767100.1 protein_id gnl|my_center|LOCUS_15040 76549 77958 gene locus_tag LOCUS_15050 76549 77958 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_15050 78017 80266 gene locus_tag LOCUS_15060 78017 80266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 80724 80395 gene locus_tag LOCUS_15070 80724 80395 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_15070 80931 80737 gene locus_tag LOCUS_15080 80931 80737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 81221 81054 gene locus_tag LOCUS_15090 81221 81054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 81789 81586 gene locus_tag LOCUS_15100 81789 81586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 81736 81939 gene locus_tag LOCUS_15110 81736 81939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 82299 82105 gene locus_tag LOCUS_15120 82299 82105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 82596 82324 gene locus_tag LOCUS_15130 82596 82324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 83064 82873 gene locus_tag LOCUS_15140 83064 82873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 83021 87319 gene locus_tag LOCUS_15150 83021 87319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 87351 88430 gene locus_tag LOCUS_15160 87351 88430 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922391.1 protein_id gnl|my_center|LOCUS_15160 88427 88897 gene locus_tag LOCUS_15170 88427 88897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 90689 89583 gene locus_tag LOCUS_15180 90689 89583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence13 <1 4370 gene locus_tag LOCUS_15190 <1 4370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086495.1:VCBS domain-containing protein 4878 4414 gene locus_tag LOCUS_15200 4878 4414 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_15200 5447 4926 gene locus_tag LOCUS_15210 5447 4926 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333887.1 protein_id gnl|my_center|LOCUS_15210 6011 5487 gene locus_tag LOCUS_15220 6011 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 8273 6060 gene locus_tag LOCUS_15230 gene glgX 8273 6060 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_15230 8303 9439 gene locus_tag LOCUS_15240 gene purM 8303 9439 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922559.1 protein_id gnl|my_center|LOCUS_15240 11941 9497 gene locus_tag LOCUS_15250 11941 9497 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123470.1 protein_id gnl|my_center|LOCUS_15250 13197 12082 gene locus_tag LOCUS_15260 13197 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 13346 16042 gene locus_tag LOCUS_15270 13346 16042 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840071.1 protein_id gnl|my_center|LOCUS_15270 16039 16383 gene locus_tag LOCUS_15280 16039 16383 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065843.1 protein_id gnl|my_center|LOCUS_15280 16421 16804 gene locus_tag LOCUS_15290 16421 16804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 18084 16876 gene locus_tag LOCUS_15300 18084 16876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 18336 18166 gene locus_tag LOCUS_15310 18336 18166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 18642 18352 gene locus_tag LOCUS_15320 18642 18352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 19166 18648 gene locus_tag LOCUS_15330 19166 18648 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337437.1 protein_id gnl|my_center|LOCUS_15330 20341 19163 gene locus_tag LOCUS_15340 gene dnaJ 20341 19163 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122091.1 protein_id gnl|my_center|LOCUS_15340 22093 20474 gene locus_tag LOCUS_15350 gene groL 22093 20474 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330146.1 protein_id gnl|my_center|LOCUS_15350 22471 22166 gene locus_tag LOCUS_15360 gene groES 22471 22166 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330007.1 protein_id gnl|my_center|LOCUS_15360 24242 22527 gene locus_tag LOCUS_15370 gene groL 24242 22527 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615436.1 protein_id gnl|my_center|LOCUS_15370 25520 24459 gene locus_tag LOCUS_15380 25520 24459 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922921.1 protein_id gnl|my_center|LOCUS_15380 25721 26989 gene locus_tag LOCUS_15390 25721 26989 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328879.1 protein_id gnl|my_center|LOCUS_15390 27018 28247 gene locus_tag LOCUS_15400 27018 28247 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122076.1 protein_id gnl|my_center|LOCUS_15400 28293 30056 gene locus_tag LOCUS_15410 28293 30056 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_15410 30076 30417 gene locus_tag LOCUS_15420 30076 30417 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122473.1 protein_id gnl|my_center|LOCUS_15420 31268 30441 gene locus_tag LOCUS_15430 31268 30441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 31528 35925 gene locus_tag LOCUS_15440 31528 35925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 36362 35961 gene locus_tag LOCUS_15450 36362 35961 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_15450 39534 36451 gene locus_tag LOCUS_15460 39534 36451 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427762.1 protein_id gnl|my_center|LOCUS_15460 41189 39621 gene locus_tag LOCUS_15470 gene cimA 41189 39621 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332450.1 protein_id gnl|my_center|LOCUS_15470 43949 41202 gene locus_tag LOCUS_15480 43949 41202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 44113 44658 gene locus_tag LOCUS_15490 44113 44658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 44693 45646 gene locus_tag LOCUS_15500 44693 45646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 47150 45690 gene locus_tag LOCUS_15510 47150 45690 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_15510 50416 47186 gene locus_tag LOCUS_15520 50416 47186 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_15520 52192 50621 gene locus_tag LOCUS_15530 52192 50621 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121409.1 protein_id gnl|my_center|LOCUS_15530 53269 52388 gene locus_tag LOCUS_15540 gene truB 53269 52388 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_15540 54786 53254 gene locus_tag LOCUS_15550 54786 53254 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187771.1 protein_id gnl|my_center|LOCUS_15550 56048 55056 gene locus_tag LOCUS_15560 56048 55056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 56488 58419 gene locus_tag LOCUS_15570 56488 58419 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921424.1 protein_id gnl|my_center|LOCUS_15570 58433 59770 gene locus_tag LOCUS_15580 gene hemL 58433 59770 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331929.1 protein_id gnl|my_center|LOCUS_15580 60511 60233 gene locus_tag LOCUS_15590 60511 60233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 61537 60827 gene locus_tag LOCUS_15600 61537 60827 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387954.1 protein_id gnl|my_center|LOCUS_15600 61652 62557 gene locus_tag LOCUS_15610 61652 62557 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530991.1 protein_id gnl|my_center|LOCUS_15610 62650 64116 gene locus_tag LOCUS_15620 gene cls 62650 64116 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_15620 64204 64908 gene locus_tag LOCUS_15630 64204 64908 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405783.1 protein_id gnl|my_center|LOCUS_15630 64938 65507 gene locus_tag LOCUS_15640 64938 65507 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087656.1 protein_id gnl|my_center|LOCUS_15640 65579 66199 gene locus_tag LOCUS_15650 gene mtnC 65579 66199 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147428.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15650 66232 67458 gene locus_tag LOCUS_15660 66232 67458 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_15660 67572 67913 gene locus_tag LOCUS_15670 67572 67913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 68004 68780 gene locus_tag LOCUS_15680 68004 68780 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339994.1 protein_id gnl|my_center|LOCUS_15680 68777 70015 gene locus_tag LOCUS_15690 68777 70015 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922187.1 protein_id gnl|my_center|LOCUS_15690 71492 70548 gene locus_tag LOCUS_15700 71492 70548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 71588 73552 gene locus_tag LOCUS_15710 71588 73552 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 protein_id gnl|my_center|LOCUS_15710 73549 74943 gene locus_tag LOCUS_15720 73549 74943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 75492 74989 gene locus_tag LOCUS_15730 75492 74989 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326691.1 protein_id gnl|my_center|LOCUS_15730 76647 75541 gene locus_tag LOCUS_15740 76647 75541 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150678942.1 protein_id gnl|my_center|LOCUS_15740 78600 76810 gene locus_tag LOCUS_15750 78600 76810 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332595.1 protein_id gnl|my_center|LOCUS_15750 78840 80159 gene locus_tag LOCUS_15760 78840 80159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 80181 82256 gene locus_tag LOCUS_15770 80181 82256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 82299 85916 gene locus_tag LOCUS_15780 82299 85916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 86151 87980 gene locus_tag LOCUS_15790 86151 87980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence14 <1 693 gene locus_tag LOCUS_15800 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615454.1:DUF1559 domain-containing protein 705 1376 gene locus_tag LOCUS_15810 705 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1396 1656 gene locus_tag LOCUS_15820 1396 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2484 1867 gene locus_tag LOCUS_15830 gene nadD 2484 1867 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_15830 2521 4818 gene locus_tag LOCUS_15840 gene priA 2521 4818 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922147.1 protein_id gnl|my_center|LOCUS_15840 5200 6957 gene locus_tag LOCUS_15850 5200 6957 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922444.1 protein_id gnl|my_center|LOCUS_15850 6972 7463 gene locus_tag LOCUS_15860 gene rnhA 6972 7463 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326294.1 protein_id gnl|my_center|LOCUS_15860 7499 9571 gene locus_tag LOCUS_15870 gene recG 7499 9571 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921377.1 protein_id gnl|my_center|LOCUS_15870 11014 9890 gene locus_tag LOCUS_15880 gene mqnE 11014 9890 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339462.1 protein_id gnl|my_center|LOCUS_15880 12048 11113 gene locus_tag LOCUS_15890 gene ubiA 12048 11113 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_15890 12659 12045 gene locus_tag LOCUS_15900 12659 12045 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119018.1 protein_id gnl|my_center|LOCUS_15900 13407 12652 gene locus_tag LOCUS_15910 gene ubiE 13407 12652 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_15910 13458 14246 gene locus_tag LOCUS_15920 13458 14246 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_15920 14307 15953 gene locus_tag LOCUS_15930 14307 15953 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_15930 15981 16811 gene locus_tag LOCUS_15940 15981 16811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 17692 17033 gene locus_tag LOCUS_15950 17692 17033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 17784 18737 gene locus_tag LOCUS_15960 17784 18737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 18781 20166 gene locus_tag LOCUS_15970 gene hisD 18781 20166 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118440.1 protein_id gnl|my_center|LOCUS_15970 20308 21393 gene locus_tag LOCUS_15980 gene hisC 20308 21393 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_15980 21413 22009 gene locus_tag LOCUS_15990 gene hisB 21413 22009 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325657.1 protein_id gnl|my_center|LOCUS_15990 23369 22059 gene locus_tag LOCUS_16000 23369 22059 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198907.1 protein_id gnl|my_center|LOCUS_16000 24861 23488 gene locus_tag LOCUS_16010 gene accC 24861 23488 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_16010 25375 24899 gene locus_tag LOCUS_16020 gene accB 25375 24899 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328900.1 protein_id gnl|my_center|LOCUS_16020 25581 26489 gene locus_tag LOCUS_16030 25581 26489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 27193 26498 gene locus_tag LOCUS_16040 gene pdeM 27193 26498 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_16040 29747 27213 gene locus_tag LOCUS_16050 29747 27213 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104887.1 protein_id gnl|my_center|LOCUS_16050 31405 29744 gene locus_tag LOCUS_16060 31405 29744 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036483.1 protein_id gnl|my_center|LOCUS_16060 32526 31402 gene locus_tag LOCUS_16070 32526 31402 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104885.1 protein_id gnl|my_center|LOCUS_16070 32954 32613 gene locus_tag LOCUS_16080 32954 32613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 35236 33578 gene locus_tag LOCUS_16090 35236 33578 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943196.1 protein_id gnl|my_center|LOCUS_16090 35455 36342 gene locus_tag LOCUS_16100 35455 36342 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121793.1 protein_id gnl|my_center|LOCUS_16100 36416 37375 gene locus_tag LOCUS_16110 36416 37375 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_16110 37503 37988 gene locus_tag LOCUS_16120 37503 37988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 37985 40030 gene locus_tag LOCUS_16130 37985 40030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 41614 40379 gene locus_tag LOCUS_16140 41614 40379 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324149.1 protein_id gnl|my_center|LOCUS_16140 41766 44774 gene locus_tag LOCUS_16150 41766 44774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 44771 45787 gene locus_tag LOCUS_16160 gene aroF 44771 45787 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_16160 46793 45825 gene locus_tag LOCUS_16170 46793 45825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16170 47209 46754 gene locus_tag LOCUS_16180 47209 46754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 47327 48646 gene locus_tag LOCUS_16190 47327 48646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616020.1 protein_id gnl|my_center|LOCUS_16190 48879 50216 gene locus_tag LOCUS_16200 gene thiC 48879 50216 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326663.1 protein_id gnl|my_center|LOCUS_16200 50674 50213 gene locus_tag LOCUS_16210 50674 50213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 52320 50704 gene locus_tag LOCUS_16220 gene cysS 52320 50704 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921769.1 protein_id gnl|my_center|LOCUS_16220 52813 52334 gene locus_tag LOCUS_16230 gene ispF 52813 52334 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921639.1 protein_id gnl|my_center|LOCUS_16230 52864 53901 gene locus_tag LOCUS_16240 52864 53901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327241.1 protein_id gnl|my_center|LOCUS_16240 53898 54770 gene locus_tag LOCUS_16250 53898 54770 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333288.1 protein_id gnl|my_center|LOCUS_16250 55160 55978 gene locus_tag LOCUS_16260 55160 55978 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333289.1 protein_id gnl|my_center|LOCUS_16260 56074 57417 gene locus_tag LOCUS_16270 56074 57417 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259854.1 protein_id gnl|my_center|LOCUS_16270 57414 57620 gene locus_tag LOCUS_16280 57414 57620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 57706 58569 gene locus_tag LOCUS_16290 57706 58569 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_16290 58589 59521 gene locus_tag LOCUS_16300 58589 59521 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666219.1 protein_id gnl|my_center|LOCUS_16300 59545 60390 gene locus_tag LOCUS_16310 59545 60390 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_16310 61482 60403 gene locus_tag LOCUS_16320 61482 60403 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_16320 62048 61590 gene locus_tag LOCUS_16330 62048 61590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 62185 64137 gene locus_tag LOCUS_16340 gene flhA 62185 64137 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816614.1 protein_id gnl|my_center|LOCUS_16340 64264 65058 gene locus_tag LOCUS_16350 64264 65058 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_16350 65398 65682 gene locus_tag LOCUS_16360 65398 65682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 65783 66346 gene locus_tag LOCUS_16370 65783 66346 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334911.1 protein_id gnl|my_center|LOCUS_16370 67792 66350 gene locus_tag LOCUS_16380 gene purB 67792 66350 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_16380 68901 67789 gene locus_tag LOCUS_16390 68901 67789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 70789 69026 gene locus_tag LOCUS_16400 70789 69026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 71127 71348 gene locus_tag LOCUS_16410 71127 71348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 71383 72672 gene locus_tag LOCUS_16420 gene clpX 71383 72672 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324828.1 protein_id gnl|my_center|LOCUS_16420 73550 72825 gene locus_tag LOCUS_16430 gene deoC 73550 72825 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_16430 74662 73547 gene locus_tag LOCUS_16440 74662 73547 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_16440 75848 74667 gene locus_tag LOCUS_16450 75848 74667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 77294 76014 gene locus_tag LOCUS_16460 77294 76014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 77935 77291 gene locus_tag LOCUS_16470 77935 77291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 77835 78113 gene locus_tag LOCUS_16480 77835 78113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 79378 78101 gene locus_tag LOCUS_16490 79378 78101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 79576 80673 gene locus_tag LOCUS_16500 79576 80673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 81757 80621 gene locus_tag LOCUS_16510 gene pdxA 81757 80621 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393087.1 protein_id gnl|my_center|LOCUS_16510 81911 82468 gene locus_tag LOCUS_16520 81911 82468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 83538 82519 gene locus_tag LOCUS_16530 83538 82519 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_16530 84327 83608 gene locus_tag LOCUS_16540 84327 83608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 84787 85632 gene locus_tag LOCUS_16550 84787 85632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 <87195 86297 gene locus_tag LOCUS_16560 <87195 86297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922391.1:DUF1559 domain-containing protein >Feature sequence15 706 293 gene locus_tag LOCUS_16570 706 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1375 812 gene locus_tag LOCUS_16580 1375 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2749 1430 gene locus_tag LOCUS_16590 gene gntT 2749 1430 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099097.1 protein_id gnl|my_center|LOCUS_16590 2840 3316 gene locus_tag LOCUS_16600 2840 3316 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 protein_id gnl|my_center|LOCUS_16600 3687 3965 gene locus_tag LOCUS_16610 3687 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4115 4438 gene locus_tag LOCUS_16620 4115 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 4447 4794 gene locus_tag LOCUS_16630 4447 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 5795 5076 gene locus_tag LOCUS_16640 5795 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 6618 5773 gene locus_tag LOCUS_16650 6618 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 7133 7846 gene locus_tag LOCUS_16660 7133 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 8361 8068 gene locus_tag LOCUS_16670 8361 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 8832 8590 gene locus_tag LOCUS_16680 8832 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 9176 9101 gene locus_tag LOCUS_t00310 9176 9101 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9274 10212 gene locus_tag LOCUS_16690 gene pyrF 9274 10212 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_16690 12228 10585 gene locus_tag LOCUS_16700 12228 10585 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_16700 12697 12236 gene locus_tag LOCUS_16710 gene ndk 12697 12236 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123449.1 protein_id gnl|my_center|LOCUS_16710 13286 12825 gene locus_tag LOCUS_16720 13286 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 13346 15298 gene locus_tag LOCUS_16730 gene ftsH 13346 15298 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325413.1 protein_id gnl|my_center|LOCUS_16730 15298 15603 gene locus_tag LOCUS_16740 15298 15603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 16396 15665 gene locus_tag LOCUS_16750 gene surE 16396 15665 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_16750 17271 16393 gene locus_tag LOCUS_16760 17271 16393 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939505.1 protein_id gnl|my_center|LOCUS_16760 17437 18345 gene locus_tag LOCUS_16770 gene dapA 17437 18345 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921565.1 protein_id gnl|my_center|LOCUS_16770 18516 20849 gene locus_tag LOCUS_16780 18516 20849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 20836 22044 gene locus_tag LOCUS_16790 20836 22044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 23129 22053 gene locus_tag LOCUS_16800 23129 22053 CDS product beta-ribofuranosylaminobenzene 5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119640.1 protein_id gnl|my_center|LOCUS_16800 23827 23243 gene locus_tag LOCUS_16810 23827 23243 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 protein_id gnl|my_center|LOCUS_16810 23911 25338 gene locus_tag LOCUS_16820 23911 25338 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118487.1 protein_id gnl|my_center|LOCUS_16820 25335 26909 gene locus_tag LOCUS_16830 gene pabB 25335 26909 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_16830 26906 27562 gene locus_tag LOCUS_16840 26906 27562 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497769.1 protein_id gnl|my_center|LOCUS_16840 28565 27810 gene locus_tag LOCUS_16850 28565 27810 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120816.1 protein_id gnl|my_center|LOCUS_16850 30247 28562 gene locus_tag LOCUS_16860 30247 28562 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615865.1 protein_id gnl|my_center|LOCUS_16860 30423 31718 gene locus_tag LOCUS_16870 30423 31718 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921970.1 protein_id gnl|my_center|LOCUS_16870 31754 32893 gene locus_tag LOCUS_16880 31754 32893 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120921.1 protein_id gnl|my_center|LOCUS_16880 33370 35400 gene locus_tag LOCUS_16890 33370 35400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 36374 36210 gene locus_tag LOCUS_16900 36374 36210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 36665 36387 gene locus_tag LOCUS_16910 36665 36387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 36861 37127 gene locus_tag LOCUS_16920 36861 37127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 37942 37199 gene locus_tag LOCUS_16930 37942 37199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_16930 38201 38383 gene locus_tag LOCUS_16940 38201 38383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 39768 38581 gene locus_tag LOCUS_16950 gene rho 39768 38581 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330229.1 protein_id gnl|my_center|LOCUS_16950 39667 39999 gene locus_tag LOCUS_16960 39667 39999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 40588 42096 gene locus_tag LOCUS_16970 40588 42096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 43664 42093 gene locus_tag LOCUS_16980 gene glpK 43664 42093 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261933.1 protein_id gnl|my_center|LOCUS_16980 45455 43668 gene locus_tag LOCUS_16990 45455 43668 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311972.1 protein_id gnl|my_center|LOCUS_16990 45517 46629 gene locus_tag LOCUS_17000 45517 46629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 48273 47131 gene locus_tag LOCUS_17010 48273 47131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 48686 48369 gene locus_tag LOCUS_17020 48686 48369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 49444 48683 gene locus_tag LOCUS_17030 49444 48683 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870611.1 protein_id gnl|my_center|LOCUS_17030 50031 49441 gene locus_tag LOCUS_17040 50031 49441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 50121 51719 gene locus_tag LOCUS_17050 50121 51719 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_17050 51722 52996 gene locus_tag LOCUS_17060 51722 52996 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665238.1 protein_id gnl|my_center|LOCUS_17060 53483 54202 gene locus_tag LOCUS_17070 53483 54202 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065433.1 protein_id gnl|my_center|LOCUS_17070 54617 54219 gene locus_tag LOCUS_17080 54617 54219 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_17080 54856 54614 gene locus_tag LOCUS_17090 54856 54614 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_17090 55075 57960 gene locus_tag LOCUS_17100 55075 57960 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120395.1 protein_id gnl|my_center|LOCUS_17100 57957 61244 gene locus_tag LOCUS_17110 57957 61244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 61349 61266 gene locus_tag LOCUS_t00320 61349 61266 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 61499 62938 gene locus_tag LOCUS_17120 61499 62938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 62935 64206 gene locus_tag LOCUS_17130 62935 64206 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122407.1 protein_id gnl|my_center|LOCUS_17130 65239 64226 gene locus_tag LOCUS_17140 65239 64226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 66647 65250 gene locus_tag LOCUS_17150 66647 65250 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816828.1 protein_id gnl|my_center|LOCUS_17150 67101 67418 gene locus_tag LOCUS_17160 67101 67418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327740.1 protein_id gnl|my_center|LOCUS_17160 71200 67433 gene locus_tag LOCUS_17170 71200 67433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 71135 71497 gene locus_tag LOCUS_17180 71135 71497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 73000 71735 gene locus_tag LOCUS_17190 73000 71735 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615619.1 protein_id gnl|my_center|LOCUS_17190 73105 74469 gene locus_tag LOCUS_17200 73105 74469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 74466 75365 gene locus_tag LOCUS_17210 74466 75365 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_17210 76538 75378 gene locus_tag LOCUS_17220 76538 75378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 76618 77121 gene locus_tag LOCUS_17230 76618 77121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 77313 79382 gene locus_tag LOCUS_17240 77313 79382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 <80643 79447 gene locus_tag LOCUS_17250 <80643 79447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117884.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence16 436 272 gene locus_tag LOCUS_17260 436 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 538 945 gene locus_tag LOCUS_17270 538 945 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123177.1 protein_id gnl|my_center|LOCUS_17270 1335 1108 gene locus_tag LOCUS_17280 1335 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2292 1516 gene locus_tag LOCUS_17290 2292 1516 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013294890.1 protein_id gnl|my_center|LOCUS_17290 2676 2407 gene locus_tag LOCUS_17300 2676 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3134 3322 gene locus_tag LOCUS_17310 3134 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3675 3442 gene locus_tag LOCUS_17320 3675 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 6312 3871 gene locus_tag LOCUS_17330 6312 3871 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858944.1 protein_id gnl|my_center|LOCUS_17330 6713 6309 gene locus_tag LOCUS_17340 6713 6309 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404728.1 protein_id gnl|my_center|LOCUS_17340 7121 6876 gene locus_tag LOCUS_17350 7121 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 7444 7223 gene locus_tag LOCUS_17360 7444 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 8227 7877 gene locus_tag LOCUS_17370 8227 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 9361 8405 gene locus_tag LOCUS_17380 9361 8405 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_17380 9735 9358 gene locus_tag LOCUS_17390 9735 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 9706 9984 gene locus_tag LOCUS_17400 9706 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 10413 10186 gene locus_tag LOCUS_17410 10413 10186 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403415.1 protein_id gnl|my_center|LOCUS_17410 10693 10442 gene locus_tag LOCUS_17420 10693 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 10989 10690 gene locus_tag LOCUS_17430 10989 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 11122 14991 gene locus_tag LOCUS_17440 11122 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 15017 16267 gene locus_tag LOCUS_17450 15017 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 17646 16279 gene locus_tag LOCUS_17460 17646 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 18116 17643 gene locus_tag LOCUS_17470 18116 17643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 20404 18185 gene locus_tag LOCUS_17480 20404 18185 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_17480 20555 20929 gene locus_tag LOCUS_17490 20555 20929 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 protein_id gnl|my_center|LOCUS_17490 20931 21257 gene locus_tag LOCUS_17500 20931 21257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 21494 21742 gene locus_tag LOCUS_17510 21494 21742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 21739 21951 gene locus_tag LOCUS_17520 21739 21951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 21987 22211 gene locus_tag LOCUS_17530 21987 22211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 22272 22733 gene locus_tag LOCUS_17540 22272 22733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 22755 22985 gene locus_tag LOCUS_17550 22755 22985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 23142 24782 gene locus_tag LOCUS_17560 23142 24782 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_17560 24952 25212 gene locus_tag LOCUS_17570 24952 25212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 25401 25592 gene locus_tag LOCUS_17580 25401 25592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 25567 26121 gene locus_tag LOCUS_17590 25567 26121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 26292 26143 gene locus_tag LOCUS_17600 26292 26143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 26621 26295 gene locus_tag LOCUS_17610 26621 26295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 26679 26990 gene locus_tag LOCUS_17620 26679 26990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 27260 27012 gene locus_tag LOCUS_17630 27260 27012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 27366 27740 gene locus_tag LOCUS_17640 27366 27740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 27967 27737 gene locus_tag LOCUS_17650 27967 27737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 29173 28019 gene locus_tag LOCUS_17660 29173 28019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 29308 29235 gene locus_tag LOCUS_t00330 29308 29235 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30009 29383 gene locus_tag LOCUS_17670 30009 29383 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122508.1 protein_id gnl|my_center|LOCUS_17670 31344 30103 gene locus_tag LOCUS_17680 gene fabF 31344 30103 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057708.1 protein_id gnl|my_center|LOCUS_17680 32111 31341 gene locus_tag LOCUS_17690 32111 31341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 32449 32183 gene locus_tag LOCUS_17700 32449 32183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 32543 32974 gene locus_tag LOCUS_17710 32543 32974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 33836 32940 gene locus_tag LOCUS_17720 33836 32940 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921666.1 protein_id gnl|my_center|LOCUS_17720 33726 33935 gene locus_tag LOCUS_17730 33726 33935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 36959 33981 gene locus_tag LOCUS_17740 36959 33981 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121181.1 protein_id gnl|my_center|LOCUS_17740 37947 37003 gene locus_tag LOCUS_17750 37947 37003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 38163 38987 gene locus_tag LOCUS_17760 38163 38987 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_17760 40766 39534 gene locus_tag LOCUS_17770 40766 39534 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339017.1 protein_id gnl|my_center|LOCUS_17770 41634 40780 gene locus_tag LOCUS_17780 41634 40780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329547.1 protein_id gnl|my_center|LOCUS_17780 41756 42964 gene locus_tag LOCUS_17790 gene ribA 41756 42964 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123761.1 protein_id gnl|my_center|LOCUS_17790 43080 45065 gene locus_tag LOCUS_17800 43080 45065 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_17800 45105 46094 gene locus_tag LOCUS_17810 45105 46094 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546375.1 protein_id gnl|my_center|LOCUS_17810 46091 47170 gene locus_tag LOCUS_17820 46091 47170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 47231 48310 gene locus_tag LOCUS_17830 47231 48310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_17830 48307 49398 gene locus_tag LOCUS_17840 48307 49398 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_17840 49468 50319 gene locus_tag LOCUS_17850 49468 50319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 50458 53049 gene locus_tag LOCUS_17860 50458 53049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 53925 53065 gene locus_tag LOCUS_17870 53925 53065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 54267 55331 gene locus_tag LOCUS_17880 54267 55331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120503.1 protein_id gnl|my_center|LOCUS_17880 55759 57384 gene locus_tag LOCUS_17890 55759 57384 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_17890 57375 58709 gene locus_tag LOCUS_17900 57375 58709 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_17900 59660 58737 gene locus_tag LOCUS_17910 59660 58737 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798219.1 protein_id gnl|my_center|LOCUS_17910 61018 59714 gene locus_tag LOCUS_17920 61018 59714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 62674 61100 gene locus_tag LOCUS_17930 62674 61100 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_17930 62908 64041 gene locus_tag LOCUS_17940 62908 64041 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018642187.1 protein_id gnl|my_center|LOCUS_17940 64515 64075 gene locus_tag LOCUS_17950 64515 64075 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_17950 64633 65511 gene locus_tag LOCUS_17960 64633 65511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 65992 67638 gene locus_tag LOCUS_17970 65992 67638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921352.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17970 68175 67762 gene locus_tag LOCUS_17980 gene mscL 68175 67762 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728855.1 protein_id gnl|my_center|LOCUS_17980 68514 70340 gene locus_tag LOCUS_17990 68514 70340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 71391 70375 gene locus_tag LOCUS_18000 71391 70375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 72672 71653 gene locus_tag LOCUS_18010 gene gmd 72672 71653 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_18010 73303 72704 gene locus_tag LOCUS_18020 73303 72704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 73889 74935 gene locus_tag LOCUS_18030 73889 74935 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940253.1 protein_id gnl|my_center|LOCUS_18030 76134 74980 gene locus_tag LOCUS_18040 76134 74980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 77483 76224 gene locus_tag LOCUS_18050 77483 76224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 79128 77584 gene locus_tag LOCUS_18060 79128 77584 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229439.1 protein_id gnl|my_center|LOCUS_18060 79363 79743 gene locus_tag LOCUS_18070 79363 79743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence17 2035 512 gene locus_tag LOCUS_18080 gene rpoN 2035 512 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435015.1 protein_id gnl|my_center|LOCUS_18080 2869 2270 gene locus_tag LOCUS_18090 gene recR 2869 2270 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327785.1 protein_id gnl|my_center|LOCUS_18090 4751 2862 gene locus_tag LOCUS_18100 4751 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 4978 7422 gene locus_tag LOCUS_18110 gene mutS 4978 7422 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121304.1 protein_id gnl|my_center|LOCUS_18110 9887 7605 gene locus_tag LOCUS_18120 9887 7605 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 protein_id gnl|my_center|LOCUS_18120 10077 10646 gene locus_tag LOCUS_18130 10077 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328536.1 protein_id gnl|my_center|LOCUS_18130 10778 12124 gene locus_tag LOCUS_18140 10778 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 12145 12648 gene locus_tag LOCUS_18150 12145 12648 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257521.1 protein_id gnl|my_center|LOCUS_18150 12739 12813 gene locus_tag LOCUS_t00340 12739 12813 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12909 13187 gene locus_tag LOCUS_18160 12909 13187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 13171 13599 gene locus_tag LOCUS_18170 13171 13599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 13809 14027 gene locus_tag LOCUS_18180 13809 14027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 14493 14173 gene locus_tag LOCUS_18190 14493 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 15179 14490 gene locus_tag LOCUS_18200 15179 14490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 15875 15537 gene locus_tag LOCUS_18210 15875 15537 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142157.1 protein_id gnl|my_center|LOCUS_18210 16218 15889 gene locus_tag LOCUS_18220 16218 15889 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142158.1 protein_id gnl|my_center|LOCUS_18220 18347 16626 gene locus_tag LOCUS_18230 18347 16626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 19006 18515 gene locus_tag LOCUS_18240 19006 18515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 20046 19060 gene locus_tag LOCUS_18250 20046 19060 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330953.1 protein_id gnl|my_center|LOCUS_18250 21368 20322 gene locus_tag LOCUS_18260 21368 20322 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707766.1 protein_id gnl|my_center|LOCUS_18260 22972 21374 gene locus_tag LOCUS_18270 22972 21374 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_18270 24122 23001 gene locus_tag LOCUS_18280 gene galK 24122 23001 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816804.1 protein_id gnl|my_center|LOCUS_18280 25884 24259 gene locus_tag LOCUS_18290 25884 24259 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_18290 26155 27333 gene locus_tag LOCUS_18300 gene nagC 26155 27333 CDS product DNA-binding transcriptional regulator NagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187578.1 protein_id gnl|my_center|LOCUS_18300 28871 27390 gene locus_tag LOCUS_18310 28871 27390 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333818.1 protein_id gnl|my_center|LOCUS_18310 31372 28868 gene locus_tag LOCUS_18320 31372 28868 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616039.1 protein_id gnl|my_center|LOCUS_18320 35083 31754 gene locus_tag LOCUS_18330 35083 31754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 35800 36294 gene locus_tag LOCUS_18340 35800 36294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 36272 37852 gene locus_tag LOCUS_18350 36272 37852 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_18350 38704 38489 gene locus_tag LOCUS_18360 38704 38489 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_18360 39944 39306 gene locus_tag LOCUS_18370 39944 39306 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525272.1 protein_id gnl|my_center|LOCUS_18370 41800 39959 gene locus_tag LOCUS_18380 41800 39959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 43198 41861 gene locus_tag LOCUS_18390 43198 41861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 46704 43195 gene locus_tag LOCUS_18400 46704 43195 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877559.1 protein_id gnl|my_center|LOCUS_18400 50842 46763 gene locus_tag LOCUS_18410 50842 46763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 52885 51242 gene locus_tag LOCUS_18420 52885 51242 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037499.1 protein_id gnl|my_center|LOCUS_18420 54150 53203 gene locus_tag LOCUS_18430 54150 53203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 54388 54170 gene locus_tag LOCUS_18440 54388 54170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 54387 55076 gene locus_tag LOCUS_18450 54387 55076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence18 1127 3037 gene locus_tag LOCUS_18460 1127 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 3024 5336 gene locus_tag LOCUS_18470 3024 5336 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862443.1 protein_id gnl|my_center|LOCUS_18470 6412 6167 gene locus_tag LOCUS_18480 6412 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 6300 6758 gene locus_tag LOCUS_18490 6300 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 7331 8443 gene locus_tag LOCUS_18500 gene dnaN 7331 8443 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427747.1 protein_id gnl|my_center|LOCUS_18500 8454 8786 gene locus_tag LOCUS_18510 8454 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 8843 11323 gene locus_tag LOCUS_18520 8843 11323 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247075.1 protein_id gnl|my_center|LOCUS_18520 12236 11415 gene locus_tag LOCUS_18530 12236 11415 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921650.1 protein_id gnl|my_center|LOCUS_18530 12392 13639 gene locus_tag LOCUS_18540 12392 13639 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_18540 13697 14521 gene locus_tag LOCUS_18550 13697 14521 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817305.1 protein_id gnl|my_center|LOCUS_18550 14535 14987 gene locus_tag LOCUS_18560 14535 14987 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_18560 15108 16040 gene locus_tag LOCUS_18570 15108 16040 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 protein_id gnl|my_center|LOCUS_18570 16272 17114 gene locus_tag LOCUS_18580 16272 17114 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_18580 17162 18193 gene locus_tag LOCUS_18590 17162 18193 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_18590 20462 18174 gene locus_tag LOCUS_18600 20462 18174 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921616.1 protein_id gnl|my_center|LOCUS_18600 20633 21838 gene locus_tag LOCUS_18610 20633 21838 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 protein_id gnl|my_center|LOCUS_18610 23048 21915 gene locus_tag LOCUS_18620 23048 21915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 26860 23807 gene locus_tag LOCUS_18630 26860 23807 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_18630 27315 27872 gene locus_tag LOCUS_18640 27315 27872 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939219.1 protein_id gnl|my_center|LOCUS_18640 27891 28364 gene locus_tag LOCUS_18650 27891 28364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 29755 28412 gene locus_tag LOCUS_18660 29755 28412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 29953 31482 gene locus_tag LOCUS_18670 29953 31482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 32559 31519 gene locus_tag LOCUS_18680 32559 31519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 33784 32603 gene locus_tag LOCUS_18690 33784 32603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 34024 34884 gene locus_tag LOCUS_18700 34024 34884 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869560.1 protein_id gnl|my_center|LOCUS_18700 35980 34829 gene locus_tag LOCUS_18710 35980 34829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 36724 37941 gene locus_tag LOCUS_18720 36724 37941 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_18720 37981 38703 gene locus_tag LOCUS_18730 37981 38703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 38714 42637 gene locus_tag LOCUS_18740 38714 42637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 43997 42564 gene locus_tag LOCUS_18750 43997 42564 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_18750 45207 43981 gene locus_tag LOCUS_18760 gene bioF 45207 43981 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_18760 45694 45215 gene locus_tag LOCUS_18770 45694 45215 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939688.1 protein_id gnl|my_center|LOCUS_18770 47148 45802 gene locus_tag LOCUS_18780 47148 45802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 48605 47820 gene locus_tag LOCUS_18790 48605 47820 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192015.1 protein_id gnl|my_center|LOCUS_18790 49915 48602 gene locus_tag LOCUS_18800 49915 48602 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389166.1 protein_id gnl|my_center|LOCUS_18800 50165 51805 gene locus_tag LOCUS_18810 50165 51805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 51814 52404 gene locus_tag LOCUS_18820 51814 52404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 53125 52388 gene locus_tag LOCUS_18830 53125 52388 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_18830 55177 53177 gene locus_tag LOCUS_18840 55177 53177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 56149 55268 gene locus_tag LOCUS_18850 gene sucD 56149 55268 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_18850 57354 56170 gene locus_tag LOCUS_18860 gene sucC 57354 56170 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327386.1 protein_id gnl|my_center|LOCUS_18860 58284 57376 gene locus_tag LOCUS_18870 58284 57376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 59327 58317 gene locus_tag LOCUS_18880 59327 58317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 59476 59973 gene locus_tag LOCUS_18890 59476 59973 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_18890 59980 60984 gene locus_tag LOCUS_18900 gene rfbA 59980 60984 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706707.1 protein_id gnl|my_center|LOCUS_18900 60956 61750 gene locus_tag LOCUS_18910 gene rfbD 60956 61750 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_18910 61770 62840 gene locus_tag LOCUS_18920 gene rfbB 61770 62840 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035864.1 protein_id gnl|my_center|LOCUS_18920 62830 63552 gene locus_tag LOCUS_18930 62830 63552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 63696 64790 gene locus_tag LOCUS_18940 63696 64790 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121410.1 protein_id gnl|my_center|LOCUS_18940 65030 68578 gene locus_tag LOCUS_18950 65030 68578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 68622 69791 gene locus_tag LOCUS_18960 68622 69791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 69772 70038 gene locus_tag LOCUS_18970 69772 70038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 70026 70769 gene locus_tag LOCUS_18980 70026 70769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 71219 70800 gene locus_tag LOCUS_18990 71219 70800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 71115 72068 gene locus_tag LOCUS_19000 71115 72068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 73453 72182 gene locus_tag LOCUS_19010 73453 72182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 73669 73989 gene locus_tag LOCUS_19020 73669 73989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 73971 76220 gene locus_tag LOCUS_19030 73971 76220 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169250172.1 protein_id gnl|my_center|LOCUS_19030 76280 76516 gene locus_tag LOCUS_19040 76280 76516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 76510 76854 gene locus_tag LOCUS_19050 gene mazF6 76510 76854 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410010.1 protein_id gnl|my_center|LOCUS_19050 77120 78286 gene locus_tag LOCUS_19060 77120 78286 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence19 449 712 gene locus_tag LOCUS_19070 449 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 709 2748 gene locus_tag LOCUS_19080 gene ligA 709 2748 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122894.1 protein_id gnl|my_center|LOCUS_19080 3820 2798 gene locus_tag LOCUS_19090 gene waaC 3820 2798 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_19090 5193 4165 gene locus_tag LOCUS_19100 5193 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 5210 7561 gene locus_tag LOCUS_19110 5210 7561 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_19110 9852 8092 gene locus_tag LOCUS_19120 9852 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120678.1 protein_id gnl|my_center|LOCUS_19120 12326 9870 gene locus_tag LOCUS_19130 12326 9870 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_19130 14782 12323 gene locus_tag LOCUS_19140 14782 12323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 16107 14800 gene locus_tag LOCUS_19150 16107 14800 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_19150 17588 16215 gene locus_tag LOCUS_19160 17588 16215 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_19160 19698 17824 gene locus_tag LOCUS_19170 19698 17824 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_19170 19756 21123 gene locus_tag LOCUS_19180 gene glmM 19756 21123 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922275.1 protein_id gnl|my_center|LOCUS_19180 22542 21196 gene locus_tag LOCUS_19190 22542 21196 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815961.1 protein_id gnl|my_center|LOCUS_19190 22751 25885 gene locus_tag LOCUS_19200 22751 25885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 25875 27395 gene locus_tag LOCUS_19210 25875 27395 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_19210 27392 28306 gene locus_tag LOCUS_19220 27392 28306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 29586 28408 gene locus_tag LOCUS_19230 29586 28408 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_19230 31296 29788 gene locus_tag LOCUS_19240 31296 29788 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_19240 31856 33310 gene locus_tag LOCUS_19250 31856 33310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 33546 33995 gene locus_tag LOCUS_19260 gene infC 33546 33995 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329878.1 protein_id gnl|my_center|LOCUS_19260 34031 34234 gene locus_tag LOCUS_19270 gene rpmI 34031 34234 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332031.1 protein_id gnl|my_center|LOCUS_19270 34465 34842 gene locus_tag LOCUS_19280 gene rplT 34465 34842 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332030.1 protein_id gnl|my_center|LOCUS_19280 34847 35860 gene locus_tag LOCUS_19290 gene pheS 34847 35860 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121253.1 protein_id gnl|my_center|LOCUS_19290 35864 37906 gene locus_tag LOCUS_19300 gene pheT 35864 37906 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663007.1 protein_id gnl|my_center|LOCUS_19300 40620 38254 gene locus_tag LOCUS_19310 40620 38254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 41786 40893 gene locus_tag LOCUS_19320 gene fhcD 41786 40893 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334456.1 protein_id gnl|my_center|LOCUS_19320 41911 44346 gene locus_tag LOCUS_19330 41911 44346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 44552 45166 gene locus_tag LOCUS_19340 44552 45166 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_19340 45172 45414 gene locus_tag LOCUS_19350 45172 45414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 45621 46484 gene locus_tag LOCUS_19360 45621 46484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 47946 46603 gene locus_tag LOCUS_19370 47946 46603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 48205 49488 gene locus_tag LOCUS_19380 gene glgC 48205 49488 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_19380 49512 50810 gene locus_tag LOCUS_19390 49512 50810 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447220.1 protein_id gnl|my_center|LOCUS_19390 51111 50929 gene locus_tag LOCUS_19400 51111 50929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 51607 51206 gene locus_tag LOCUS_19410 51607 51206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 52671 51601 gene locus_tag LOCUS_19420 52671 51601 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_19420 55124 52722 gene locus_tag LOCUS_19430 55124 52722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 56740 55616 gene locus_tag LOCUS_19440 gene cytR 56740 55616 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216730.1 protein_id gnl|my_center|LOCUS_19440 56975 58867 gene locus_tag LOCUS_19450 56975 58867 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_19450 58864 63561 gene locus_tag LOCUS_19460 58864 63561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 65404 64007 gene locus_tag LOCUS_19470 65404 64007 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120813.1 protein_id gnl|my_center|LOCUS_19470 65590 66774 gene locus_tag LOCUS_19480 65590 66774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 66806 67162 gene locus_tag LOCUS_19490 66806 67162 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119951.1 protein_id gnl|my_center|LOCUS_19490 68579 67638 gene locus_tag LOCUS_19500 gene accD 68579 67638 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327662.1 protein_id gnl|my_center|LOCUS_19500 69270 68653 gene locus_tag LOCUS_19510 69270 68653 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332332.1 protein_id gnl|my_center|LOCUS_19510 70034 69303 gene locus_tag LOCUS_19520 gene rpe 70034 69303 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_19520 70202 73369 gene locus_tag LOCUS_19530 70202 73369 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142749.1 protein_id gnl|my_center|LOCUS_19530 72035 72123 gene locus_tag LOCUS_t00350 72035 72123 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 73464 74438 gene locus_tag LOCUS_19540 gene pstS 73464 74438 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_19540 74469 77180 gene locus_tag LOCUS_19550 74469 77180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 77170 78843 gene locus_tag LOCUS_19560 gene pstA 77170 78843 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence20 <1 2012 gene locus_tag LOCUS_19570 <1 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037400800.1:calcium-binding protein 1903 3681 gene locus_tag LOCUS_19580 1903 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 3946 4467 gene locus_tag LOCUS_19590 3946 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 5143 4514 gene locus_tag LOCUS_19600 5143 4514 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_19600 5570 6382 gene locus_tag LOCUS_19610 5570 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 7318 6410 gene locus_tag LOCUS_19620 7318 6410 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526198.1 protein_id gnl|my_center|LOCUS_19620 7588 8523 gene locus_tag LOCUS_19630 7588 8523 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_19630 8680 9855 gene locus_tag LOCUS_19640 8680 9855 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_19640 9906 11879 gene locus_tag LOCUS_19650 9906 11879 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_19650 11888 12916 gene locus_tag LOCUS_19660 11888 12916 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_19660 13035 13790 gene locus_tag LOCUS_19670 13035 13790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 13783 15054 gene locus_tag LOCUS_19680 13783 15054 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_19680 15187 15426 gene locus_tag LOCUS_19690 15187 15426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 15861 15532 gene locus_tag LOCUS_19700 15861 15532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 15812 16687 gene locus_tag LOCUS_19710 15812 16687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 18011 16698 gene locus_tag LOCUS_19720 18011 16698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 19340 18543 gene locus_tag LOCUS_19730 19340 18543 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943288.1 protein_id gnl|my_center|LOCUS_19730 19440 20174 gene locus_tag LOCUS_19740 19440 20174 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943289.1 protein_id gnl|my_center|LOCUS_19740 20164 20892 gene locus_tag LOCUS_19750 20164 20892 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943290.1 protein_id gnl|my_center|LOCUS_19750 20904 21932 gene locus_tag LOCUS_19760 20904 21932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 21929 24184 gene locus_tag LOCUS_19770 gene ovoA 21929 24184 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_19770 24234 25775 gene locus_tag LOCUS_19780 24234 25775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 26992 25769 gene locus_tag LOCUS_19790 26992 25769 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337640.1 protein_id gnl|my_center|LOCUS_19790 27102 28409 gene locus_tag LOCUS_19800 gene aroA 27102 28409 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332883.1 protein_id gnl|my_center|LOCUS_19800 28943 28680 gene locus_tag LOCUS_19810 28943 28680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 29153 30118 gene locus_tag LOCUS_19820 29153 30118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 30115 30867 gene locus_tag LOCUS_19830 30115 30867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_19830 30882 32681 gene locus_tag LOCUS_19840 30882 32681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 32800 33597 gene locus_tag LOCUS_19850 32800 33597 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_19850 33627 34823 gene locus_tag LOCUS_19860 gene mqnC 33627 34823 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_19860 34844 36076 gene locus_tag LOCUS_19870 34844 36076 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_19870 36953 36084 gene locus_tag LOCUS_19880 gene hisG 36953 36084 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329831.1 protein_id gnl|my_center|LOCUS_19880 37325 36975 gene locus_tag LOCUS_19890 37325 36975 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391340.1 protein_id gnl|my_center|LOCUS_19890 37329 38309 gene locus_tag LOCUS_19900 gene miaA 37329 38309 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_19900 39126 39872 gene locus_tag LOCUS_19910 39126 39872 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_19910 40535 39888 gene locus_tag LOCUS_19920 40535 39888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 40740 43007 gene locus_tag LOCUS_19930 gene glgB 40740 43007 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324338.1 protein_id gnl|my_center|LOCUS_19930 45224 43017 gene locus_tag LOCUS_19940 45224 43017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 45382 48150 gene locus_tag LOCUS_19950 45382 48150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 48837 48418 gene locus_tag LOCUS_19960 gene acpS 48837 48418 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324752.1 protein_id gnl|my_center|LOCUS_19960 49898 48834 gene locus_tag LOCUS_19970 gene trpS 49898 48834 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_19970 50886 49888 gene locus_tag LOCUS_19980 50886 49888 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332287.1 protein_id gnl|my_center|LOCUS_19980 51186 51566 gene locus_tag LOCUS_19990 51186 51566 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328824.1 protein_id gnl|my_center|LOCUS_19990 51702 51920 gene locus_tag LOCUS_20000 51702 51920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 52351 51926 gene locus_tag LOCUS_20010 52351 51926 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_20010 53510 52356 gene locus_tag LOCUS_20020 53510 52356 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_20020 55006 53513 gene locus_tag LOCUS_20030 55006 53513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 55222 55010 gene locus_tag LOCUS_20040 55222 55010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 58259 55266 gene locus_tag LOCUS_20050 58259 55266 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903811.1 protein_id gnl|my_center|LOCUS_20050 58752 58249 gene locus_tag LOCUS_20060 58752 58249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 59504 58755 gene locus_tag LOCUS_20070 59504 58755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 60183 59593 gene locus_tag LOCUS_20080 gene folE 60183 59593 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336701.1 protein_id gnl|my_center|LOCUS_20080 60886 60194 gene locus_tag LOCUS_20090 60886 60194 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327343.1 protein_id gnl|my_center|LOCUS_20090 61327 60926 gene locus_tag LOCUS_20100 61327 60926 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056975.1 protein_id gnl|my_center|LOCUS_20100 61388 62128 gene locus_tag LOCUS_20110 gene nth 61388 62128 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_20110 62196 62807 gene locus_tag LOCUS_20120 gene dcd 62196 62807 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_20120 62814 63008 gene locus_tag LOCUS_20130 62814 63008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 63051 64820 gene locus_tag LOCUS_20140 gene aspS 63051 64820 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121776.1 protein_id gnl|my_center|LOCUS_20140 64875 65075 gene locus_tag LOCUS_20150 64875 65075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 66035 65082 gene locus_tag LOCUS_20160 66035 65082 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887392.1 protein_id gnl|my_center|LOCUS_20160 66124 66197 gene locus_tag LOCUS_t00360 66124 66197 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 66470 66219 gene locus_tag LOCUS_20170 66470 66219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 66680 67480 gene locus_tag LOCUS_20180 66680 67480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 67894 67508 gene locus_tag LOCUS_20190 67894 67508 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331599.1 protein_id gnl|my_center|LOCUS_20190 68020 68520 gene locus_tag LOCUS_20200 68020 68520 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327088.1 protein_id gnl|my_center|LOCUS_20200 69345 68587 gene locus_tag LOCUS_20210 69345 68587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence21 935 426 gene locus_tag LOCUS_20220 935 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 1557 2582 gene locus_tag LOCUS_20230 1557 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2700 4055 gene locus_tag LOCUS_20240 2700 4055 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_20240 4197 4439 gene locus_tag LOCUS_20250 4197 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 5844 4459 gene locus_tag LOCUS_20260 gene lpdA 5844 4459 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119002.1 protein_id gnl|my_center|LOCUS_20260 7315 6032 gene locus_tag LOCUS_20270 gene odhB 7315 6032 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970379.1 protein_id gnl|my_center|LOCUS_20270 10285 7343 gene locus_tag LOCUS_20280 10285 7343 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338417.1 protein_id gnl|my_center|LOCUS_20280 11642 10308 gene locus_tag LOCUS_20290 11642 10308 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119355.1 protein_id gnl|my_center|LOCUS_20290 14507 11697 gene locus_tag LOCUS_20300 gene aceE 14507 11697 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_20300 16097 14676 gene locus_tag LOCUS_20310 gene lpdA 16097 14676 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_20310 16261 17808 gene locus_tag LOCUS_20320 16261 17808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 17868 17949 gene locus_tag LOCUS_t00370 17868 17949 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19207 18254 gene locus_tag LOCUS_20330 19207 18254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 19400 23785 gene locus_tag LOCUS_20340 19400 23785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 24104 23790 gene locus_tag LOCUS_20350 24104 23790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 24231 25250 gene locus_tag LOCUS_20360 gene lpxA 24231 25250 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690880.1 protein_id gnl|my_center|LOCUS_20360 26853 25585 gene locus_tag LOCUS_20370 26853 25585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 27066 28436 gene locus_tag LOCUS_20380 gene urtA 27066 28436 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_20380 28458 30518 gene locus_tag LOCUS_20390 28458 30518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 30604 31122 gene locus_tag LOCUS_20400 30604 31122 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106290.1 protein_id gnl|my_center|LOCUS_20400 31119 32489 gene locus_tag LOCUS_20410 31119 32489 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113845.1 protein_id gnl|my_center|LOCUS_20410 32486 33199 gene locus_tag LOCUS_20420 32486 33199 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525366.1 protein_id gnl|my_center|LOCUS_20420 33217 35646 gene locus_tag LOCUS_20430 33217 35646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 35643 36644 gene locus_tag LOCUS_20440 gene wspF 35643 36644 CDS product Wsp signal transduction system protein-glutamate methylesterase WspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092534.1 protein_id gnl|my_center|LOCUS_20440 38446 36974 gene locus_tag LOCUS_20450 38446 36974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 40366 38447 gene locus_tag LOCUS_20460 40366 38447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 42020 40512 gene locus_tag LOCUS_20470 42020 40512 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037250650.1 protein_id gnl|my_center|LOCUS_20470 42109 42792 gene locus_tag LOCUS_20480 gene bshB1 42109 42792 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_20480 43033 43266 gene locus_tag LOCUS_20490 43033 43266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 43283 44197 gene locus_tag LOCUS_20500 gene xerC 43283 44197 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_20500 45261 44578 gene locus_tag LOCUS_20510 45261 44578 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_20510 46495 45536 gene locus_tag LOCUS_20520 gene hemC 46495 45536 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 protein_id gnl|my_center|LOCUS_20520 47103 46537 gene locus_tag LOCUS_20530 47103 46537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 47104 47334 gene locus_tag LOCUS_20540 47104 47334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 47546 48676 gene locus_tag LOCUS_20550 47546 48676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 48863 49303 gene locus_tag LOCUS_20560 48863 49303 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198267.1 protein_id gnl|my_center|LOCUS_20560 49364 49648 gene locus_tag LOCUS_20570 49364 49648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 50292 49711 gene locus_tag LOCUS_20580 50292 49711 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_20580 51115 50342 gene locus_tag LOCUS_20590 51115 50342 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_20590 51595 51146 gene locus_tag LOCUS_20600 51595 51146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 53213 51633 gene locus_tag LOCUS_20610 gene nuoN 53213 51633 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 protein_id gnl|my_center|LOCUS_20610 55036 53243 gene locus_tag LOCUS_20620 55036 53243 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258760.1 protein_id gnl|my_center|LOCUS_20620 57480 55051 gene locus_tag LOCUS_20630 gene nuoL 57480 55051 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902441.1 protein_id gnl|my_center|LOCUS_20630 57896 57510 gene locus_tag LOCUS_20640 gene nuoK 57896 57510 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_20640 58597 57893 gene locus_tag LOCUS_20650 58597 57893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 59823 58594 gene locus_tag LOCUS_20660 gene nuoH 59823 58594 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_20660 61520 60312 gene locus_tag LOCUS_20670 61520 60312 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_20670 62123 61593 gene locus_tag LOCUS_20680 62123 61593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 62772 62155 gene locus_tag LOCUS_20690 62772 62155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 63405 62878 gene locus_tag LOCUS_20700 63405 62878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 63714 63986 gene locus_tag LOCUS_20710 63714 63986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 64191 64264 gene locus_tag LOCUS_t00380 64191 64264 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 64288 65337 gene locus_tag LOCUS_20720 64288 65337 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121766.1 protein_id gnl|my_center|LOCUS_20720 65344 66012 gene locus_tag LOCUS_20730 65344 66012 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921958.1 protein_id gnl|my_center|LOCUS_20730 66009 66980 gene locus_tag LOCUS_20740 66009 66980 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119033.1 protein_id gnl|my_center|LOCUS_20740 67538 67029 gene locus_tag LOCUS_20750 67538 67029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence22 343 2145 gene locus_tag LOCUS_20760 343 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2163 2561 gene locus_tag LOCUS_20770 2163 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 4350 2587 gene locus_tag LOCUS_20780 4350 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 5042 4542 gene locus_tag LOCUS_20790 5042 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 5219 6178 gene locus_tag LOCUS_20800 5219 6178 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_20800 7586 6303 gene locus_tag LOCUS_20810 7586 6303 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_20810 8428 7583 gene locus_tag LOCUS_20820 8428 7583 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256104.1 protein_id gnl|my_center|LOCUS_20820 9228 8425 gene locus_tag LOCUS_20830 9228 8425 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_20830 10055 9228 gene locus_tag LOCUS_20840 10055 9228 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_20840 9957 10289 gene locus_tag LOCUS_20850 9957 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 10338 10955 gene locus_tag LOCUS_20860 10338 10955 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008654974.1 protein_id gnl|my_center|LOCUS_20860 10963 12210 gene locus_tag LOCUS_20870 10963 12210 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_20870 12194 13468 gene locus_tag LOCUS_20880 12194 13468 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122283.1 protein_id gnl|my_center|LOCUS_20880 13476 14966 gene locus_tag LOCUS_20890 13476 14966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 15624 14986 gene locus_tag LOCUS_20900 15624 14986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 16780 15704 gene locus_tag LOCUS_20910 16780 15704 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120182.1 protein_id gnl|my_center|LOCUS_20910 17637 16777 gene locus_tag LOCUS_20920 gene lpxA 17637 16777 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328498.1 protein_id gnl|my_center|LOCUS_20920 18455 17667 gene locus_tag LOCUS_20930 gene lpxC 18455 17667 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615542.1 protein_id gnl|my_center|LOCUS_20930 18458 18703 gene locus_tag LOCUS_20940 18458 18703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 19307 18657 gene locus_tag LOCUS_20950 19307 18657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 21496 19466 gene locus_tag LOCUS_20960 21496 19466 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327900.1 protein_id gnl|my_center|LOCUS_20960 21636 22448 gene locus_tag LOCUS_20970 21636 22448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 22477 23496 gene locus_tag LOCUS_20980 22477 23496 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327669.1 protein_id gnl|my_center|LOCUS_20980 24264 23434 gene locus_tag LOCUS_20990 24264 23434 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703807.1 protein_id gnl|my_center|LOCUS_20990 25952 24261 gene locus_tag LOCUS_21000 25952 24261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 26140 28050 gene locus_tag LOCUS_21010 26140 28050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 29608 28145 gene locus_tag LOCUS_21020 29608 28145 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123471.1 protein_id gnl|my_center|LOCUS_21020 31997 29631 gene locus_tag LOCUS_21030 31997 29631 CDS product YidC/Oxa1 family insertase periplasmic-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615850.1 protein_id gnl|my_center|LOCUS_21030 32892 32122 gene locus_tag LOCUS_21040 32892 32122 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_21040 33007 33708 gene locus_tag LOCUS_21050 gene tsaB 33007 33708 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122994.1 protein_id gnl|my_center|LOCUS_21050 33776 37225 gene locus_tag LOCUS_21060 33776 37225 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122837.1 protein_id gnl|my_center|LOCUS_21060 38304 37660 gene locus_tag LOCUS_21070 gene msrA 38304 37660 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_21070 38786 38301 gene locus_tag LOCUS_21080 38786 38301 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207579.1 protein_id gnl|my_center|LOCUS_21080 38961 40052 gene locus_tag LOCUS_21090 gene ychF 38961 40052 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037200879.1 protein_id gnl|my_center|LOCUS_21090 43860 40570 gene locus_tag LOCUS_21100 43860 40570 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118092.1 protein_id gnl|my_center|LOCUS_21100 45277 43871 gene locus_tag LOCUS_21110 45277 43871 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120479.1 protein_id gnl|my_center|LOCUS_21110 46011 45274 gene locus_tag LOCUS_21120 46011 45274 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073379.1 protein_id gnl|my_center|LOCUS_21120 48034 46757 gene locus_tag LOCUS_21130 48034 46757 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_21130 49527 48034 gene locus_tag LOCUS_21140 49527 48034 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118024.1 protein_id gnl|my_center|LOCUS_21140 50710 49625 gene locus_tag LOCUS_21150 50710 49625 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_21150 51138 50707 gene locus_tag LOCUS_21160 51138 50707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 51869 51135 gene locus_tag LOCUS_21170 51869 51135 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 protein_id gnl|my_center|LOCUS_21170 53148 51889 gene locus_tag LOCUS_21180 53148 51889 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_21180 53519 53187 gene locus_tag LOCUS_21190 53519 53187 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_21190 53676 55856 gene locus_tag LOCUS_21200 53676 55856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 57067 55901 gene locus_tag LOCUS_21210 57067 55901 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_21210 57775 57143 gene locus_tag LOCUS_21220 57775 57143 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence23 1303 335 gene locus_tag LOCUS_21230 1303 335 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338657.1 protein_id gnl|my_center|LOCUS_21230 2224 1379 gene locus_tag LOCUS_21240 2224 1379 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338658.1 protein_id gnl|my_center|LOCUS_21240 3003 2221 gene locus_tag LOCUS_21250 gene truA 3003 2221 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_21250 4040 3000 gene locus_tag LOCUS_21260 4040 3000 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122477.1 protein_id gnl|my_center|LOCUS_21260 5065 4037 gene locus_tag LOCUS_21270 5065 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 5637 5062 gene locus_tag LOCUS_21280 5637 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 7082 5892 gene locus_tag LOCUS_21290 7082 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 8515 7253 gene locus_tag LOCUS_21300 8515 7253 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923038.1 protein_id gnl|my_center|LOCUS_21300 9244 8528 gene locus_tag LOCUS_21310 9244 8528 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122630.1 protein_id gnl|my_center|LOCUS_21310 10374 9436 gene locus_tag LOCUS_21320 10374 9436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_21320 12647 10371 gene locus_tag LOCUS_21330 12647 10371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 12970 12644 gene locus_tag LOCUS_21340 12970 12644 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_21340 16047 12967 gene locus_tag LOCUS_21350 16047 12967 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615874.1 protein_id gnl|my_center|LOCUS_21350 17556 16060 gene locus_tag LOCUS_21360 17556 16060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 17821 19365 gene locus_tag LOCUS_21370 17821 19365 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922561.1 protein_id gnl|my_center|LOCUS_21370 19727 19380 gene locus_tag LOCUS_21380 19727 19380 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327264.1 protein_id gnl|my_center|LOCUS_21380 21532 19988 gene locus_tag LOCUS_21390 gene amt 21532 19988 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_21390 21847 23232 gene locus_tag LOCUS_21400 21847 23232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 23924 23187 gene locus_tag LOCUS_21410 23924 23187 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973520.1 protein_id gnl|my_center|LOCUS_21410 25996 23936 gene locus_tag LOCUS_21420 25996 23936 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260110.1 protein_id gnl|my_center|LOCUS_21420 27048 26029 gene locus_tag LOCUS_21430 27048 26029 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922058.1 protein_id gnl|my_center|LOCUS_21430 28862 27045 gene locus_tag LOCUS_21440 28862 27045 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922881.1 protein_id gnl|my_center|LOCUS_21440 30103 28862 gene locus_tag LOCUS_21450 30103 28862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 31261 30110 gene locus_tag LOCUS_21460 31261 30110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 33184 31385 gene locus_tag LOCUS_21470 33184 31385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 35400 33181 gene locus_tag LOCUS_21480 35400 33181 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921470.1 protein_id gnl|my_center|LOCUS_21480 37925 35442 gene locus_tag LOCUS_21490 37925 35442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 40208 37953 gene locus_tag LOCUS_21500 40208 37953 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921453.1 protein_id gnl|my_center|LOCUS_21500 41092 40217 gene locus_tag LOCUS_21510 41092 40217 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_21510 42131 41082 gene locus_tag LOCUS_21520 42131 41082 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_21520 43284 42205 gene locus_tag LOCUS_21530 43284 42205 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_21530 48333 43294 gene locus_tag LOCUS_21540 48333 43294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 48579 48908 gene locus_tag LOCUS_21550 48579 48908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 49099 49026 gene locus_tag LOCUS_t00390 49099 49026 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 50777 49203 gene locus_tag LOCUS_21560 50777 49203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 51531 50812 gene locus_tag LOCUS_21570 51531 50812 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404487.1 protein_id gnl|my_center|LOCUS_21570 51605 52171 gene locus_tag LOCUS_21580 51605 52171 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921444.1 protein_id gnl|my_center|LOCUS_21580 52332 52252 gene locus_tag LOCUS_r00010 52332 52252 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 68 percent of the 5S ribosomal RNA >Feature sequence24 1284 208 gene locus_tag LOCUS_21590 gene queA 1284 208 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120320.1 protein_id gnl|my_center|LOCUS_21590 1335 1469 gene locus_tag LOCUS_21600 1335 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 1875 1585 gene locus_tag LOCUS_21610 1875 1585 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_21610 2156 1872 gene locus_tag LOCUS_21620 2156 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2316 2909 gene locus_tag LOCUS_21630 2316 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 3697 3191 gene locus_tag LOCUS_21640 3697 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 4893 3691 gene locus_tag LOCUS_21650 4893 3691 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119407.1 protein_id gnl|my_center|LOCUS_21650 7109 4932 gene locus_tag LOCUS_21660 7109 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 8589 7291 gene locus_tag LOCUS_21670 8589 7291 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_21670 11377 8615 gene locus_tag LOCUS_21680 11377 8615 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120136.1 protein_id gnl|my_center|LOCUS_21680 12330 11386 gene locus_tag LOCUS_21690 12330 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 12902 12369 gene locus_tag LOCUS_21700 12902 12369 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_21700 16251 13003 gene locus_tag LOCUS_21710 16251 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 18027 16414 gene locus_tag LOCUS_21720 18027 16414 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921847.1 protein_id gnl|my_center|LOCUS_21720 19138 18182 gene locus_tag LOCUS_21730 19138 18182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 20613 19135 gene locus_tag LOCUS_21740 20613 19135 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_21740 21719 20760 gene locus_tag LOCUS_21750 21719 20760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 22306 21716 gene locus_tag LOCUS_21760 22306 21716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 22802 22524 gene locus_tag LOCUS_21770 22802 22524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 23060 24667 gene locus_tag LOCUS_21780 23060 24667 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_21780 24852 25460 gene locus_tag LOCUS_21790 24852 25460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 25655 28777 gene locus_tag LOCUS_21800 25655 28777 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922491.1 protein_id gnl|my_center|LOCUS_21800 28787 30274 gene locus_tag LOCUS_21810 28787 30274 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_21810 31753 30284 gene locus_tag LOCUS_21820 31753 30284 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_21820 31812 33551 gene locus_tag LOCUS_21830 31812 33551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 34935 33580 gene locus_tag LOCUS_21840 34935 33580 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731065.1 protein_id gnl|my_center|LOCUS_21840 34840 35160 gene locus_tag LOCUS_21850 34840 35160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 36070 35189 gene locus_tag LOCUS_21860 36070 35189 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_21860 36143 37435 gene locus_tag LOCUS_21870 36143 37435 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_21870 37425 39422 gene locus_tag LOCUS_21880 gene yagF 37425 39422 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_21880 39571 39966 gene locus_tag LOCUS_21890 39571 39966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 42000 40546 gene locus_tag LOCUS_21900 42000 40546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 43378 41990 gene locus_tag LOCUS_21910 43378 41990 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_21910 46765 43433 gene locus_tag LOCUS_21920 46765 43433 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108640.1 protein_id gnl|my_center|LOCUS_21920 47034 46762 gene locus_tag LOCUS_21930 47034 46762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 47639 50152 gene locus_tag LOCUS_21940 47639 50152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 49804 49920 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51239 50427 gene locus_tag LOCUS_21950 51239 50427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence25 <1 2545 gene locus_tag LOCUS_21960 <1 2545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126622031.1:autotransporter-associated beta strand repeat-containing protein 3475 2696 gene locus_tag LOCUS_21970 3475 2696 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975830.1 protein_id gnl|my_center|LOCUS_21970 4590 3472 gene locus_tag LOCUS_21980 4590 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 6484 5102 gene locus_tag LOCUS_21990 6484 5102 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969475.1 protein_id gnl|my_center|LOCUS_21990 8022 6487 gene locus_tag LOCUS_22000 8022 6487 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969474.1 protein_id gnl|my_center|LOCUS_22000 8281 8132 gene locus_tag LOCUS_22010 8281 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 8500 8321 gene locus_tag LOCUS_22020 8500 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 8742 8981 gene locus_tag LOCUS_22030 8742 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 10366 9422 gene locus_tag LOCUS_22040 10366 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 10556 10386 gene locus_tag LOCUS_22050 10556 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 10607 11992 gene locus_tag LOCUS_22060 10607 11992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 11989 13359 gene locus_tag LOCUS_22070 11989 13359 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123058.1 protein_id gnl|my_center|LOCUS_22070 13449 13970 gene locus_tag LOCUS_22080 13449 13970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 14093 15367 gene locus_tag LOCUS_22090 14093 15367 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921634.1 protein_id gnl|my_center|LOCUS_22090 15342 16223 gene locus_tag LOCUS_22100 15342 16223 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724514.1 protein_id gnl|my_center|LOCUS_22100 16448 17317 gene locus_tag LOCUS_22110 16448 17317 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328629.1 protein_id gnl|my_center|LOCUS_22110 17321 17845 gene locus_tag LOCUS_22120 17321 17845 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_22120 17988 18959 gene locus_tag LOCUS_22130 gene floA 17988 18959 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327752.1 protein_id gnl|my_center|LOCUS_22130 19166 19414 gene locus_tag LOCUS_22140 19166 19414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 19642 20328 gene locus_tag LOCUS_22150 19642 20328 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393500.1 protein_id gnl|my_center|LOCUS_22150 20402 21877 gene locus_tag LOCUS_22160 20402 21877 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_22160 22472 21924 gene locus_tag LOCUS_22170 22472 21924 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566468.1 protein_id gnl|my_center|LOCUS_22170 24243 22486 gene locus_tag LOCUS_22180 24243 22486 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123461.1 protein_id gnl|my_center|LOCUS_22180 24561 24283 gene locus_tag LOCUS_22190 24561 24283 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331648.1 protein_id gnl|my_center|LOCUS_22190 26208 24577 gene locus_tag LOCUS_22200 26208 24577 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_22200 29298 26239 gene locus_tag LOCUS_22210 29298 26239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 30523 29381 gene locus_tag LOCUS_22220 30523 29381 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919889.1 protein_id gnl|my_center|LOCUS_22220 31998 30616 gene locus_tag LOCUS_22230 31998 30616 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_22230 32250 34091 gene locus_tag LOCUS_22240 32250 34091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 34220 36988 gene locus_tag LOCUS_22250 34220 36988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 37008 39407 gene locus_tag LOCUS_22260 37008 39407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 39420 40844 gene locus_tag LOCUS_22270 39420 40844 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_22270 40984 42240 gene locus_tag LOCUS_22280 40984 42240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_22280 43559 42321 gene locus_tag LOCUS_22290 gene galK 43559 42321 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292299.1 protein_id gnl|my_center|LOCUS_22290 43585 44742 gene locus_tag LOCUS_22300 43585 44742 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_22300 44952 45251 gene locus_tag LOCUS_22310 44952 45251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 46874 45276 gene locus_tag LOCUS_22320 46874 45276 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922192.1 protein_id gnl|my_center|LOCUS_22320 46952 48238 gene locus_tag LOCUS_22330 46952 48238 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_22330 48288 48764 gene locus_tag LOCUS_22340 48288 48764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence26 1423 992 gene locus_tag LOCUS_22350 1423 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 1588 2139 gene locus_tag LOCUS_22360 1588 2139 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938353.1 protein_id gnl|my_center|LOCUS_22360 3354 2155 gene locus_tag LOCUS_22370 gene lhgO 3354 2155 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_22370 4775 3369 gene locus_tag LOCUS_22380 4775 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 7131 6376 gene locus_tag LOCUS_22390 7131 6376 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_22390 8208 7216 gene locus_tag LOCUS_22400 8208 7216 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_22400 8128 8385 gene locus_tag LOCUS_22410 8128 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 9631 8597 gene locus_tag LOCUS_22420 9631 8597 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090704.1 protein_id gnl|my_center|LOCUS_22420 10307 9645 gene locus_tag LOCUS_22430 10307 9645 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088180.1 protein_id gnl|my_center|LOCUS_22430 12012 10327 gene locus_tag LOCUS_22440 12012 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 12938 12009 gene locus_tag LOCUS_22450 12938 12009 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088175.1 protein_id gnl|my_center|LOCUS_22450 13765 12935 gene locus_tag LOCUS_22460 13765 12935 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 protein_id gnl|my_center|LOCUS_22460 14754 13762 gene locus_tag LOCUS_22470 gene rfbB 14754 13762 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877832.1 protein_id gnl|my_center|LOCUS_22470 15834 14812 gene locus_tag LOCUS_22480 15834 14812 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771860.1 protein_id gnl|my_center|LOCUS_22480 16412 15831 gene locus_tag LOCUS_22490 16412 15831 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088168.1 protein_id gnl|my_center|LOCUS_22490 17838 16462 gene locus_tag LOCUS_22500 17838 16462 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088170.1 protein_id gnl|my_center|LOCUS_22500 18298 19533 gene locus_tag LOCUS_22510 18298 19533 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088166.1 protein_id gnl|my_center|LOCUS_22510 19581 20252 gene locus_tag LOCUS_22520 19581 20252 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084311.1 protein_id gnl|my_center|LOCUS_22520 20309 21067 gene locus_tag LOCUS_22530 20309 21067 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967051.1 protein_id gnl|my_center|LOCUS_22530 21597 21974 gene locus_tag LOCUS_22540 21597 21974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 22447 22899 gene locus_tag LOCUS_22550 22447 22899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 22899 23420 gene locus_tag LOCUS_22560 22899 23420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 23983 23459 gene locus_tag LOCUS_22570 23983 23459 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088181.1 protein_id gnl|my_center|LOCUS_22570 25215 24391 gene locus_tag LOCUS_22580 25215 24391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22580 26135 25212 gene locus_tag LOCUS_22590 26135 25212 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771849.1 protein_id gnl|my_center|LOCUS_22590 26240 28150 gene locus_tag LOCUS_22600 26240 28150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 28868 28134 gene locus_tag LOCUS_22610 28868 28134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 30033 28939 gene locus_tag LOCUS_22620 30033 28939 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_22620 30492 30055 gene locus_tag LOCUS_22630 30492 30055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 30600 30845 gene locus_tag LOCUS_22640 30600 30845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 32161 30794 gene locus_tag LOCUS_22650 gene rfbH 32161 30794 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_22650 33279 32158 gene locus_tag LOCUS_22660 gene rfbG 33279 32158 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_22660 34055 33279 gene locus_tag LOCUS_22670 gene rfbF 34055 33279 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_22670 34470 34270 gene locus_tag LOCUS_22680 34470 34270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 34739 35428 gene locus_tag LOCUS_22690 34739 35428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 35430 36566 gene locus_tag LOCUS_22700 35430 36566 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_22700 36737 38668 gene locus_tag LOCUS_22710 gene acs 36737 38668 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124127.1 protein_id gnl|my_center|LOCUS_22710 39884 38775 gene locus_tag LOCUS_22720 39884 38775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 40111 42627 gene locus_tag LOCUS_22730 40111 42627 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_22730 45453 42670 gene locus_tag LOCUS_22740 45453 42670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 45620 46276 gene locus_tag LOCUS_22750 45620 46276 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_22750 46382 47344 gene locus_tag LOCUS_22760 gene cysK 46382 47344 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence27 683 841 gene locus_tag LOCUS_22770 gene rpmG 683 841 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324504.1 protein_id gnl|my_center|LOCUS_22770 1975 884 gene locus_tag LOCUS_22780 1975 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 3062 1980 gene locus_tag LOCUS_22790 gene lpxK 3062 1980 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_22790 3252 6083 gene locus_tag LOCUS_22800 3252 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22800 6932 6624 gene locus_tag LOCUS_22810 6932 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 6921 7196 gene locus_tag LOCUS_22820 6921 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 7202 8899 gene locus_tag LOCUS_22830 gene nadB 7202 8899 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_22830 9179 9355 gene locus_tag LOCUS_22840 9179 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 9352 9573 gene locus_tag LOCUS_22850 9352 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 9737 10480 gene locus_tag LOCUS_22860 9737 10480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_22860 10665 13430 gene locus_tag LOCUS_22870 10665 13430 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921396.1 protein_id gnl|my_center|LOCUS_22870 13482 15104 gene locus_tag LOCUS_22880 13482 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 15232 16266 gene locus_tag LOCUS_22890 15232 16266 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921954.1 protein_id gnl|my_center|LOCUS_22890 16624 18435 gene locus_tag LOCUS_22900 gene pepF 16624 18435 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122658.1 protein_id gnl|my_center|LOCUS_22900 18594 19943 gene locus_tag LOCUS_22910 gene der 18594 19943 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_22910 20054 21379 gene locus_tag LOCUS_22920 20054 21379 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_22920 21379 22485 gene locus_tag LOCUS_22930 gene ald 21379 22485 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118338.1 protein_id gnl|my_center|LOCUS_22930 22608 23612 gene locus_tag LOCUS_22940 gene mtnA 22608 23612 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_22940 25184 23688 gene locus_tag LOCUS_22950 25184 23688 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922489.1 protein_id gnl|my_center|LOCUS_22950 27615 25267 gene locus_tag LOCUS_22960 27615 25267 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122735.1 protein_id gnl|my_center|LOCUS_22960 28056 31244 gene locus_tag LOCUS_22970 28056 31244 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615526.1 protein_id gnl|my_center|LOCUS_22970 33261 31627 gene locus_tag LOCUS_22980 33261 31627 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923057.1 protein_id gnl|my_center|LOCUS_22980 33421 34071 gene locus_tag LOCUS_22990 33421 34071 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_22990 34107 35075 gene locus_tag LOCUS_23000 34107 35075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666288.1 protein_id gnl|my_center|LOCUS_23000 37220 35142 gene locus_tag LOCUS_23010 gene tkt 37220 35142 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_23010 39542 37416 gene locus_tag LOCUS_23020 39542 37416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 40711 39539 gene locus_tag LOCUS_23030 40711 39539 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103756.1 protein_id gnl|my_center|LOCUS_23030 41757 40756 gene locus_tag LOCUS_23040 41757 40756 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_23040 43458 42274 gene locus_tag LOCUS_23050 43458 42274 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324545.1 protein_id gnl|my_center|LOCUS_23050 44804 43455 gene locus_tag LOCUS_23060 44804 43455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 45058 45699 gene locus_tag LOCUS_23070 45058 45699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 45707 46999 gene locus_tag LOCUS_23080 45707 46999 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence28 1473 136 gene locus_tag LOCUS_23090 1473 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 1704 2912 gene locus_tag LOCUS_23100 1704 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 3481 2999 gene locus_tag LOCUS_23110 3481 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 3600 3527 gene locus_tag LOCUS_t00400 3600 3527 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3765 5399 gene locus_tag LOCUS_23120 3765 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 6005 5781 gene locus_tag LOCUS_23130 6005 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 5979 6680 gene locus_tag LOCUS_23140 5979 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 7385 6747 gene locus_tag LOCUS_23150 7385 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 7613 8647 gene locus_tag LOCUS_23160 7613 8647 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119125.1 protein_id gnl|my_center|LOCUS_23160 9490 8939 gene locus_tag LOCUS_23170 9490 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 9584 10159 gene locus_tag LOCUS_23180 9584 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 10221 10817 gene locus_tag LOCUS_23190 10221 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121172.1 protein_id gnl|my_center|LOCUS_23190 10822 12291 gene locus_tag LOCUS_23200 10822 12291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324153.1 protein_id gnl|my_center|LOCUS_23200 12420 13442 gene locus_tag LOCUS_23210 12420 13442 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119510.1 protein_id gnl|my_center|LOCUS_23210 13600 14307 gene locus_tag LOCUS_23220 13600 14307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 14470 15882 gene locus_tag LOCUS_23230 14470 15882 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_23230 17144 15879 gene locus_tag LOCUS_23240 17144 15879 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_23240 18745 17147 gene locus_tag LOCUS_23250 18745 17147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 19726 18752 gene locus_tag LOCUS_23260 19726 18752 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_23260 19835 20770 gene locus_tag LOCUS_23270 19835 20770 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328910.1 protein_id gnl|my_center|LOCUS_23270 21762 20809 gene locus_tag LOCUS_23280 21762 20809 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817229.1 protein_id gnl|my_center|LOCUS_23280 21955 23643 gene locus_tag LOCUS_23290 21955 23643 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_23290 24531 23752 gene locus_tag LOCUS_23300 24531 23752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 25394 24564 gene locus_tag LOCUS_23310 25394 24564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 25350 26327 gene locus_tag LOCUS_23320 25350 26327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 26738 26388 gene locus_tag LOCUS_23330 26738 26388 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_23330 27883 26822 gene locus_tag LOCUS_23340 27883 26822 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020474717.1 protein_id gnl|my_center|LOCUS_23340 28088 29374 gene locus_tag LOCUS_23350 28088 29374 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_23350 30410 29661 gene locus_tag LOCUS_23360 30410 29661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 31318 30467 gene locus_tag LOCUS_23370 31318 30467 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 protein_id gnl|my_center|LOCUS_23370 32355 31462 gene locus_tag LOCUS_23380 32355 31462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 33989 32748 gene locus_tag LOCUS_23390 33989 32748 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121827.1 protein_id gnl|my_center|LOCUS_23390 34064 34483 gene locus_tag LOCUS_23400 34064 34483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 35368 34715 gene locus_tag LOCUS_23410 35368 34715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 36025 35420 gene locus_tag LOCUS_23420 36025 35420 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705668.1 protein_id gnl|my_center|LOCUS_23420 35981 36589 gene locus_tag LOCUS_23430 gene def 35981 36589 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324462.1 protein_id gnl|my_center|LOCUS_23430 36643 37656 gene locus_tag LOCUS_23440 gene fmt 36643 37656 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123937.1 protein_id gnl|my_center|LOCUS_23440 37847 39340 gene locus_tag LOCUS_23450 gene miaB 37847 39340 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 protein_id gnl|my_center|LOCUS_23450 39399 42515 gene locus_tag LOCUS_23460 39399 42515 CDS product [glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008674544.1 protein_id gnl|my_center|LOCUS_23460 43207 42551 gene locus_tag LOCUS_23470 43207 42551 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_23470 43882 43226 gene locus_tag LOCUS_23480 43882 43226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 44811 43849 gene locus_tag LOCUS_23490 44811 43849 CDS product Brp/Blh family beta-carotene 15,15'-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289439.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23490 45790 45020 gene locus_tag LOCUS_23500 45790 45020 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404249.1 protein_id gnl|my_center|LOCUS_23500 47203 46271 gene locus_tag LOCUS_23510 47203 46271 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145034007.1 protein_id gnl|my_center|LOCUS_23510 47299 47226 gene locus_tag LOCUS_t00410 47299 47226 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence29 98 1576 gene locus_tag LOCUS_23520 98 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 1732 3039 gene locus_tag LOCUS_23530 1732 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 3057 3428 gene locus_tag LOCUS_23540 3057 3428 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_23540 3451 3939 gene locus_tag LOCUS_23550 3451 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 4042 4827 gene locus_tag LOCUS_23560 4042 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 5104 6414 gene locus_tag LOCUS_23570 5104 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 6785 6390 gene locus_tag LOCUS_23580 6785 6390 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765183.1 protein_id gnl|my_center|LOCUS_23580 9671 6873 gene locus_tag LOCUS_23590 9671 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 11338 9809 gene locus_tag LOCUS_23600 11338 9809 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331356.1 protein_id gnl|my_center|LOCUS_23600 11606 12421 gene locus_tag LOCUS_23610 11606 12421 CDS product succinate dehydrogenase cytochrome b558 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922342.1 protein_id gnl|my_center|LOCUS_23610 12427 14424 gene locus_tag LOCUS_23620 gene sdhA 12427 14424 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122818.1 protein_id gnl|my_center|LOCUS_23620 14463 15359 gene locus_tag LOCUS_23630 gene sdhB 14463 15359 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122819.1 protein_id gnl|my_center|LOCUS_23630 15742 17115 gene locus_tag LOCUS_23640 15742 17115 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922057.1 protein_id gnl|my_center|LOCUS_23640 17154 17933 gene locus_tag LOCUS_23650 17154 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 18153 18491 gene locus_tag LOCUS_23660 18153 18491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 19861 18548 gene locus_tag LOCUS_23670 19861 18548 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615779.1 protein_id gnl|my_center|LOCUS_23670 22753 19958 gene locus_tag LOCUS_23680 gene leuS 22753 19958 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122073.1 protein_id gnl|my_center|LOCUS_23680 22918 24531 gene locus_tag LOCUS_23690 22918 24531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 24528 25502 gene locus_tag LOCUS_23700 24528 25502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 26745 25702 gene locus_tag LOCUS_23710 26745 25702 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922490.1 protein_id gnl|my_center|LOCUS_23710 28303 26759 gene locus_tag LOCUS_23720 28303 26759 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528457.1 protein_id gnl|my_center|LOCUS_23720 29517 28300 gene locus_tag LOCUS_23730 29517 28300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 30668 29529 gene locus_tag LOCUS_23740 30668 29529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 31252 30713 gene locus_tag LOCUS_23750 31252 30713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 31492 32514 gene locus_tag LOCUS_23760 31492 32514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 32517 33566 gene locus_tag LOCUS_23770 gene tsaD 32517 33566 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338414.1 protein_id gnl|my_center|LOCUS_23770 35300 33819 gene locus_tag LOCUS_23780 gene dnaB 35300 33819 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118493.1 protein_id gnl|my_center|LOCUS_23780 35923 35375 gene locus_tag LOCUS_23790 gene rplI 35923 35375 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122533.1 protein_id gnl|my_center|LOCUS_23790 36477 35977 gene locus_tag LOCUS_23800 36477 35977 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_23800 36993 36601 gene locus_tag LOCUS_23810 36993 36601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 37636 37079 gene locus_tag LOCUS_23820 gene pth 37636 37079 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122535.1 protein_id gnl|my_center|LOCUS_23820 38338 37700 gene locus_tag LOCUS_23830 38338 37700 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324826.1 protein_id gnl|my_center|LOCUS_23830 39448 38504 gene locus_tag LOCUS_23840 39448 38504 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325730.1 protein_id gnl|my_center|LOCUS_23840 40455 39667 gene locus_tag LOCUS_23850 40455 39667 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121125.1 protein_id gnl|my_center|LOCUS_23850 40548 41657 gene locus_tag LOCUS_23860 40548 41657 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921425.1 protein_id gnl|my_center|LOCUS_23860 42441 41773 gene locus_tag LOCUS_23870 42441 41773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 43092 42535 gene locus_tag LOCUS_23880 43092 42535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence30 1447 401 gene locus_tag LOCUS_23890 1447 401 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092876.1 protein_id gnl|my_center|LOCUS_23890 2540 1503 gene locus_tag LOCUS_23900 gene fba 2540 1503 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333980.1 protein_id gnl|my_center|LOCUS_23900 2687 3112 gene locus_tag LOCUS_23910 2687 3112 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188905.1 protein_id gnl|my_center|LOCUS_23910 4642 3158 gene locus_tag LOCUS_23920 4642 3158 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123371.1 protein_id gnl|my_center|LOCUS_23920 5276 4830 gene locus_tag LOCUS_23930 5276 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 6747 5455 gene locus_tag LOCUS_23940 6747 5455 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 protein_id gnl|my_center|LOCUS_23940 7263 6763 gene locus_tag LOCUS_23950 7263 6763 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326691.1 protein_id gnl|my_center|LOCUS_23950 7718 7332 gene locus_tag LOCUS_23960 7718 7332 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326692.1 protein_id gnl|my_center|LOCUS_23960 8455 7865 gene locus_tag LOCUS_23970 8455 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 8910 9401 gene locus_tag LOCUS_23980 8910 9401 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_23980 9480 10358 gene locus_tag LOCUS_23990 9480 10358 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270512.1 protein_id gnl|my_center|LOCUS_23990 10497 10865 gene locus_tag LOCUS_24000 gene rpsL 10497 10865 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326865.1 protein_id gnl|my_center|LOCUS_24000 10884 11354 gene locus_tag LOCUS_24010 gene rpsG 10884 11354 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 protein_id gnl|my_center|LOCUS_24010 13390 11450 gene locus_tag LOCUS_24020 13390 11450 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_24020 13598 14347 gene locus_tag LOCUS_24030 13598 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 15846 14398 gene locus_tag LOCUS_24040 15846 14398 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228658.1 protein_id gnl|my_center|LOCUS_24040 17560 15851 gene locus_tag LOCUS_24050 17560 15851 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921563.1 protein_id gnl|my_center|LOCUS_24050 19976 17679 gene locus_tag LOCUS_24060 19976 17679 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922366.1 protein_id gnl|my_center|LOCUS_24060 22222 19973 gene locus_tag LOCUS_24070 22222 19973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 23421 22525 gene locus_tag LOCUS_24080 23421 22525 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_24080 24469 23444 gene locus_tag LOCUS_24090 24469 23444 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922840.1 protein_id gnl|my_center|LOCUS_24090 24667 27054 gene locus_tag LOCUS_24100 24667 27054 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815631.1 protein_id gnl|my_center|LOCUS_24100 27340 28806 gene locus_tag LOCUS_24110 27340 28806 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119574.1 protein_id gnl|my_center|LOCUS_24110 28835 29353 gene locus_tag LOCUS_24120 28835 29353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 30581 29553 gene locus_tag LOCUS_24130 30581 29553 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922129.1 protein_id gnl|my_center|LOCUS_24130 31415 30738 gene locus_tag LOCUS_24140 31415 30738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 31720 31511 gene locus_tag LOCUS_24150 31720 31511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 32847 31759 gene locus_tag LOCUS_24160 32847 31759 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027092.1 protein_id gnl|my_center|LOCUS_24160 33740 32844 gene locus_tag LOCUS_24170 gene cysW 33740 32844 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391149.1 protein_id gnl|my_center|LOCUS_24170 34771 33791 gene locus_tag LOCUS_24180 gene cysT 34771 33791 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391148.1 protein_id gnl|my_center|LOCUS_24180 35847 34789 gene locus_tag LOCUS_24190 35847 34789 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_24190 36116 37714 gene locus_tag LOCUS_24200 36116 37714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 37978 38901 gene locus_tag LOCUS_24210 gene cysK 37978 38901 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267110.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence31 1640 150 gene locus_tag LOCUS_24220 1640 150 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435082.1 protein_id gnl|my_center|LOCUS_24220 5415 1738 gene locus_tag LOCUS_24230 gene dnaE 5415 1738 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119187.1 protein_id gnl|my_center|LOCUS_24230 5440 5507 gene locus_tag LOCUS_t00420 5440 5507 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7025 5901 gene locus_tag LOCUS_24240 7025 5901 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_24240 7839 7246 gene locus_tag LOCUS_24250 7839 7246 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635400.1 protein_id gnl|my_center|LOCUS_24250 7857 8822 gene locus_tag LOCUS_24260 7857 8822 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144155.1 protein_id gnl|my_center|LOCUS_24260 10327 8897 gene locus_tag LOCUS_24270 10327 8897 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077027088.1 protein_id gnl|my_center|LOCUS_24270 11165 10377 gene locus_tag LOCUS_24280 11165 10377 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928448.1 protein_id gnl|my_center|LOCUS_24280 12843 11452 gene locus_tag LOCUS_24290 12843 11452 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_24290 14037 12961 gene locus_tag LOCUS_24300 14037 12961 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_24300 14868 14140 gene locus_tag LOCUS_24310 14868 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 15027 16181 gene locus_tag LOCUS_24320 15027 16181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065399.1 protein_id gnl|my_center|LOCUS_24320 16166 17458 gene locus_tag LOCUS_24330 16166 17458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 19219 17459 gene locus_tag LOCUS_24340 19219 17459 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_24340 19622 19236 gene locus_tag LOCUS_24350 19622 19236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 19781 20428 gene locus_tag LOCUS_24360 19781 20428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 20467 20799 gene locus_tag LOCUS_24370 20467 20799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 21219 20845 gene locus_tag LOCUS_24380 21219 20845 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329331.1 protein_id gnl|my_center|LOCUS_24380 21100 22545 gene locus_tag LOCUS_24390 gene serS 21100 22545 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118185.1 protein_id gnl|my_center|LOCUS_24390 24593 22953 gene locus_tag LOCUS_24400 24593 22953 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326414.1 protein_id gnl|my_center|LOCUS_24400 24781 24696 gene locus_tag LOCUS_t00430 24781 24696 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25448 24846 gene locus_tag LOCUS_24410 25448 24846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 25560 27755 gene locus_tag LOCUS_24420 gene fadB 25560 27755 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091204.1 protein_id gnl|my_center|LOCUS_24420 27790 28992 gene locus_tag LOCUS_24430 gene fadA 27790 28992 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863541.1 protein_id gnl|my_center|LOCUS_24430 28989 32615 gene locus_tag LOCUS_24440 28989 32615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 33991 32909 gene locus_tag LOCUS_24450 33991 32909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 34140 34886 gene locus_tag LOCUS_24460 34140 34886 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340410.1 protein_id gnl|my_center|LOCUS_24460 37145 34905 gene locus_tag LOCUS_24470 37145 34905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 37389 38864 gene locus_tag LOCUS_24480 gene hemG 37389 38864 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122777.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence32 2134 887 gene locus_tag LOCUS_24490 2134 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 3533 2379 gene locus_tag LOCUS_24500 gene arsB 3533 2379 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_24500 3707 3952 gene locus_tag LOCUS_24510 3707 3952 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197795.1 protein_id gnl|my_center|LOCUS_24510 4050 6665 gene locus_tag LOCUS_24520 4050 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 8758 6716 gene locus_tag LOCUS_24530 8758 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 13082 9069 gene locus_tag LOCUS_24540 13082 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 13746 13087 gene locus_tag LOCUS_24550 13746 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 14326 14751 gene locus_tag LOCUS_24560 14326 14751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 15584 14787 gene locus_tag LOCUS_24570 15584 14787 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990818.1 protein_id gnl|my_center|LOCUS_24570 15938 16171 gene locus_tag LOCUS_24580 15938 16171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 16410 16192 gene locus_tag LOCUS_24590 16410 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 16656 16492 gene locus_tag LOCUS_24600 16656 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 17564 16920 gene locus_tag LOCUS_24610 17564 16920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 17781 18608 gene locus_tag LOCUS_24620 17781 18608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 18785 19456 gene locus_tag LOCUS_24630 gene mqnB 18785 19456 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118202.1 protein_id gnl|my_center|LOCUS_24630 19453 20286 gene locus_tag LOCUS_24640 19453 20286 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123510.1 protein_id gnl|my_center|LOCUS_24640 20552 20322 gene locus_tag LOCUS_24650 20552 20322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 22190 21279 gene locus_tag LOCUS_24660 22190 21279 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_24660 23549 22224 gene locus_tag LOCUS_24670 23549 22224 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_24670 23788 25083 gene locus_tag LOCUS_24680 23788 25083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 25479 25982 gene locus_tag LOCUS_24690 25479 25982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 27327 26476 gene locus_tag LOCUS_24700 27327 26476 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 protein_id gnl|my_center|LOCUS_24700 27709 28257 gene locus_tag LOCUS_24710 27709 28257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 28342 28734 gene locus_tag LOCUS_24720 28342 28734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 29182 29484 gene locus_tag LOCUS_24730 29182 29484 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266256.1 protein_id gnl|my_center|LOCUS_24730 29481 30689 gene locus_tag LOCUS_24740 29481 30689 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200876.1 protein_id gnl|my_center|LOCUS_24740 31034 31735 gene locus_tag LOCUS_24750 31034 31735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 32152 33492 gene locus_tag LOCUS_24760 32152 33492 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039725284.1 protein_id gnl|my_center|LOCUS_24760 33699 35015 gene locus_tag LOCUS_24770 33699 35015 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922245.1 protein_id gnl|my_center|LOCUS_24770 35516 35229 gene locus_tag LOCUS_24780 35516 35229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 37521 35908 gene locus_tag LOCUS_24790 37521 35908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence33 459 1382 gene locus_tag LOCUS_24800 459 1382 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_24800 1379 1519 gene locus_tag LOCUS_24810 1379 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 1560 2588 gene locus_tag LOCUS_24820 1560 2588 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_24820 2575 3594 gene locus_tag LOCUS_24830 2575 3594 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_24830 3693 3914 gene locus_tag LOCUS_24840 3693 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 4048 4130 gene locus_tag LOCUS_t00440 4048 4130 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5098 4226 gene locus_tag LOCUS_24850 5098 4226 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_24850 5260 7173 gene locus_tag LOCUS_24860 gene zwf 5260 7173 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_24860 7602 7201 gene locus_tag LOCUS_24870 7602 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 7890 9962 gene locus_tag LOCUS_24880 7890 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 10099 12285 gene locus_tag LOCUS_24890 10099 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 14218 12335 gene locus_tag LOCUS_24900 14218 12335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 14340 17060 gene locus_tag LOCUS_24910 14340 17060 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_24910 17103 18848 gene locus_tag LOCUS_24920 gene nuoF 17103 18848 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_24920 18853 21399 gene locus_tag LOCUS_24930 18853 21399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 23435 22017 gene locus_tag LOCUS_24940 23435 22017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 25077 23449 gene locus_tag LOCUS_24950 25077 23449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 26115 25081 gene locus_tag LOCUS_24960 26115 25081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 26333 27838 gene locus_tag LOCUS_24970 26333 27838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 27874 29379 gene locus_tag LOCUS_24980 27874 29379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 33341 29376 gene locus_tag LOCUS_24990 33341 29376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 34477 33536 gene locus_tag LOCUS_25000 34477 33536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 <37551 34539 gene locus_tag LOCUS_25010 <37551 34539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966116.1:FecR domain-containing protein >Feature sequence34 305 42 gene locus_tag LOCUS_25020 305 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 359 1267 gene locus_tag LOCUS_25030 gene rsmH 359 1267 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121784.1 protein_id gnl|my_center|LOCUS_25030 1907 2629 gene locus_tag LOCUS_25040 1907 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 3685 2738 gene locus_tag LOCUS_25050 3685 2738 CDS product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_25050 4014 4715 gene locus_tag LOCUS_25060 4014 4715 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728735.1 protein_id gnl|my_center|LOCUS_25060 4748 5431 gene locus_tag LOCUS_25070 4748 5431 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332043.1 protein_id gnl|my_center|LOCUS_25070 5442 6404 gene locus_tag LOCUS_25080 5442 6404 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328412.1 protein_id gnl|my_center|LOCUS_25080 7943 6960 gene locus_tag LOCUS_25090 7943 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 14613 8167 gene locus_tag LOCUS_25100 14613 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 18101 14610 gene locus_tag LOCUS_25110 18101 14610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 19174 18350 gene locus_tag LOCUS_25120 19174 18350 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921300.1 protein_id gnl|my_center|LOCUS_25120 19246 19944 gene locus_tag LOCUS_25130 19246 19944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 20165 21418 gene locus_tag LOCUS_25140 20165 21418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 21465 24896 gene locus_tag LOCUS_25150 21465 24896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 25795 25334 gene locus_tag LOCUS_25160 25795 25334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 26942 25824 gene locus_tag LOCUS_25170 26942 25824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 27110 29374 gene locus_tag LOCUS_25180 27110 29374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 30193 29369 gene locus_tag LOCUS_25190 30193 29369 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333120.1 protein_id gnl|my_center|LOCUS_25190 30289 30921 gene locus_tag LOCUS_25200 30289 30921 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_25200 31323 30955 gene locus_tag LOCUS_25210 31323 30955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 31474 31926 gene locus_tag LOCUS_25220 31474 31926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 32211 33548 gene locus_tag LOCUS_25230 32211 33548 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121818.1 protein_id gnl|my_center|LOCUS_25230 33801 34307 gene locus_tag LOCUS_25240 33801 34307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 34790 34554 gene locus_tag LOCUS_25250 34790 34554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence35 3841 2873 gene locus_tag LOCUS_25260 3841 2873 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_25260 4018 6720 gene locus_tag LOCUS_25270 4018 6720 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120136.1 protein_id gnl|my_center|LOCUS_25270 6749 8017 gene locus_tag LOCUS_25280 6749 8017 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_25280 8215 8385 gene locus_tag LOCUS_25290 8215 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 8389 8949 gene locus_tag LOCUS_25300 8389 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 9207 10979 gene locus_tag LOCUS_25310 gene ilvB 9207 10979 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_25310 12417 11047 gene locus_tag LOCUS_25320 12417 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 14321 12441 gene locus_tag LOCUS_25330 14321 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 15958 14318 gene locus_tag LOCUS_25340 15958 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 18093 15976 gene locus_tag LOCUS_25350 gene pilM 18093 15976 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119060.1 protein_id gnl|my_center|LOCUS_25350 18827 18342 gene locus_tag LOCUS_25360 18827 18342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 19881 19606 gene locus_tag LOCUS_25370 19881 19606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 20100 23318 gene locus_tag LOCUS_25380 20100 23318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008670336.1 protein_id gnl|my_center|LOCUS_25380 23315 24214 gene locus_tag LOCUS_25390 23315 24214 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528860.1 protein_id gnl|my_center|LOCUS_25390 24250 25155 gene locus_tag LOCUS_25400 24250 25155 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921623.1 protein_id gnl|my_center|LOCUS_25400 25194 26024 gene locus_tag LOCUS_25410 25194 26024 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119258.1 protein_id gnl|my_center|LOCUS_25410 26137 27951 gene locus_tag LOCUS_25420 26137 27951 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327691.1 protein_id gnl|my_center|LOCUS_25420 29361 28576 gene locus_tag LOCUS_25430 29361 28576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 30203 29484 gene locus_tag LOCUS_25440 30203 29484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 30331 32364 gene locus_tag LOCUS_25450 30331 32364 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921839.1 protein_id gnl|my_center|LOCUS_25450 32525 33823 gene locus_tag LOCUS_25460 32525 33823 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812397.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence36 21371 19743 gene locus_tag LOCUS_25470 gene groL 21371 19743 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325911.1 protein_id gnl|my_center|LOCUS_25470 21762 21439 gene locus_tag LOCUS_25480 21762 21439 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325910.1 protein_id gnl|my_center|LOCUS_25480 22151 22504 gene locus_tag LOCUS_25490 22151 22504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 22566 23015 gene locus_tag LOCUS_25500 22566 23015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 23064 23136 gene locus_tag LOCUS_t00450 23064 23136 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 23487 23284 gene locus_tag LOCUS_25510 23487 23284 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517660.1 protein_id gnl|my_center|LOCUS_25510 25858 23843 gene locus_tag LOCUS_25520 25858 23843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 28139 27951 gene locus_tag LOCUS_25530 28139 27951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 28463 28236 gene locus_tag LOCUS_25540 28463 28236 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392021.1 protein_id gnl|my_center|LOCUS_25540 28676 28467 gene locus_tag LOCUS_25550 28676 28467 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024015.1 protein_id gnl|my_center|LOCUS_25550 28939 29175 gene locus_tag LOCUS_25560 28939 29175 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258326.1 protein_id gnl|my_center|LOCUS_25560 29172 29561 gene locus_tag LOCUS_25570 29172 29561 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_25570 30181 29864 gene locus_tag LOCUS_25580 30181 29864 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402966.1 protein_id gnl|my_center|LOCUS_25580 30680 30946 gene locus_tag LOCUS_25590 30680 30946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 31284 30943 gene locus_tag LOCUS_25600 31284 30943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence37 2249 831 gene locus_tag LOCUS_25610 2249 831 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922918.1 protein_id gnl|my_center|LOCUS_25610 4813 2252 gene locus_tag LOCUS_25620 4813 2252 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118036.1 protein_id gnl|my_center|LOCUS_25620 6957 5041 gene locus_tag LOCUS_25630 6957 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 7134 9956 gene locus_tag LOCUS_25640 7134 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 10026 10400 gene locus_tag LOCUS_25650 10026 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 12018 10366 gene locus_tag LOCUS_25660 12018 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 12202 13422 gene locus_tag LOCUS_25670 12202 13422 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_25670 13868 14485 gene locus_tag LOCUS_25680 13868 14485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 15746 14559 gene locus_tag LOCUS_25690 15746 14559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 16407 15751 gene locus_tag LOCUS_25700 16407 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 17248 16427 gene locus_tag LOCUS_25710 17248 16427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 18324 17245 gene locus_tag LOCUS_25720 18324 17245 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922070.1 protein_id gnl|my_center|LOCUS_25720 18834 18499 gene locus_tag LOCUS_25730 18834 18499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 19353 18931 gene locus_tag LOCUS_25740 19353 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 19627 19358 gene locus_tag LOCUS_25750 19627 19358 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_25750 19753 19932 gene locus_tag LOCUS_25760 19753 19932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 19987 20349 gene locus_tag LOCUS_25770 19987 20349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 20699 20313 gene locus_tag LOCUS_25780 20699 20313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 22264 21152 gene locus_tag LOCUS_25790 22264 21152 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983707.1 protein_id gnl|my_center|LOCUS_25790 22633 25584 gene locus_tag LOCUS_25800 22633 25584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 25572 26534 gene locus_tag LOCUS_25810 25572 26534 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_25810 26531 26965 gene locus_tag LOCUS_25820 26531 26965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 26962 29094 gene locus_tag LOCUS_25830 26962 29094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence38 739 398 gene locus_tag LOCUS_25840 739 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 1709 774 gene locus_tag LOCUS_25850 1709 774 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_25850 2642 1806 gene locus_tag LOCUS_25860 2642 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 3250 2660 gene locus_tag LOCUS_25870 3250 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 4695 3313 gene locus_tag LOCUS_25880 gene rimO 4695 3313 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922374.1 protein_id gnl|my_center|LOCUS_25880 5889 4780 gene locus_tag LOCUS_25890 gene ispG 5889 4780 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 protein_id gnl|my_center|LOCUS_25890 6004 6492 gene locus_tag LOCUS_25900 6004 6492 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660073.1 protein_id gnl|my_center|LOCUS_25900 9482 6552 gene locus_tag LOCUS_25910 gene gcvP 9482 6552 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115850.1 protein_id gnl|my_center|LOCUS_25910 11151 9757 gene locus_tag LOCUS_25920 11151 9757 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_25920 12824 11202 gene locus_tag LOCUS_25930 12824 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 12980 13054 gene locus_tag LOCUS_t00460 12980 13054 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13574 13056 gene locus_tag LOCUS_25940 13574 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 14884 13694 gene locus_tag LOCUS_25950 14884 13694 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107578.1 protein_id gnl|my_center|LOCUS_25950 14795 15019 gene locus_tag LOCUS_25960 14795 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 15852 15445 gene locus_tag LOCUS_25970 15852 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 16874 15888 gene locus_tag LOCUS_25980 16874 15888 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330953.1 protein_id gnl|my_center|LOCUS_25980 18709 16880 gene locus_tag LOCUS_25990 18709 16880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 19523 19149 gene locus_tag LOCUS_26000 19523 19149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 19759 20085 gene locus_tag LOCUS_26010 19759 20085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 20073 20558 gene locus_tag LOCUS_26020 20073 20558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 21116 20631 gene locus_tag LOCUS_26030 21116 20631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 21938 21729 gene locus_tag LOCUS_26040 21938 21729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 22894 22223 gene locus_tag LOCUS_26050 22894 22223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333116.1 protein_id gnl|my_center|LOCUS_26050 26828 22914 gene locus_tag LOCUS_26060 26828 22914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 28158 26863 gene locus_tag LOCUS_26070 28158 26863 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_26070 <28965 28110 gene locus_tag LOCUS_26080 <28965 28110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120136.1:DUF1592 domain-containing protein >Feature sequence39 1571 747 gene locus_tag LOCUS_26090 1571 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2522 1827 gene locus_tag LOCUS_26100 2522 1827 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120970.1 protein_id gnl|my_center|LOCUS_26100 2716 3390 gene locus_tag LOCUS_26110 2716 3390 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_26110 3383 4843 gene locus_tag LOCUS_26120 3383 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 5123 10795 gene locus_tag LOCUS_26130 5123 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 11215 10982 gene locus_tag LOCUS_26140 11215 10982 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_26140 11427 12410 gene locus_tag LOCUS_26150 11427 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 12407 13156 gene locus_tag LOCUS_26160 12407 13156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 13243 13746 gene locus_tag LOCUS_26170 13243 13746 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340070.1 protein_id gnl|my_center|LOCUS_26170 14084 15340 gene locus_tag LOCUS_26180 14084 15340 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121115.1 protein_id gnl|my_center|LOCUS_26180 15376 16545 gene locus_tag LOCUS_26190 15376 16545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 17806 16619 gene locus_tag LOCUS_26200 17806 16619 CDS product BtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_26200 19420 18044 gene locus_tag LOCUS_26210 19420 18044 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275393.1 protein_id gnl|my_center|LOCUS_26210 20978 19470 gene locus_tag LOCUS_26220 20978 19470 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_26220 24155 20982 gene locus_tag LOCUS_26230 24155 20982 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121858.1 protein_id gnl|my_center|LOCUS_26230 25591 24152 gene locus_tag LOCUS_26240 25591 24152 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118989.1 protein_id gnl|my_center|LOCUS_26240 <27321 25606 gene locus_tag LOCUS_26250 <27321 25606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615954.1:DUF1553 domain-containing protein >Feature sequence40 772 1683 gene locus_tag LOCUS_26260 772 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2028 1702 gene locus_tag LOCUS_26270 2028 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2166 2840 gene locus_tag LOCUS_26280 2166 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 2865 3104 gene locus_tag LOCUS_26290 2865 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 4153 3113 gene locus_tag LOCUS_26300 gene rlmN 4153 3113 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922584.1 protein_id gnl|my_center|LOCUS_26300 4267 4482 gene locus_tag LOCUS_26310 4267 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 4560 5549 gene locus_tag LOCUS_26320 gene ispE 4560 5549 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122808.1 protein_id gnl|my_center|LOCUS_26320 5658 6089 gene locus_tag LOCUS_26330 5658 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 7377 6520 gene locus_tag LOCUS_26340 gene ilvE 7377 6520 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_26340 8119 7406 gene locus_tag LOCUS_26350 8119 7406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331945.1 protein_id gnl|my_center|LOCUS_26350 9794 8112 gene locus_tag LOCUS_26360 9794 8112 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121144.1 protein_id gnl|my_center|LOCUS_26360 11421 9889 gene locus_tag LOCUS_26370 gene lysS 11421 9889 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672011.1 protein_id gnl|my_center|LOCUS_26370 11508 11873 gene locus_tag LOCUS_26380 11508 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 12398 11877 gene locus_tag LOCUS_26390 12398 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 12619 14322 gene locus_tag LOCUS_26400 12619 14322 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940935.1 protein_id gnl|my_center|LOCUS_26400 14719 15612 gene locus_tag LOCUS_26410 14719 15612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 15614 16465 gene locus_tag LOCUS_26420 15614 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 16722 16462 gene locus_tag LOCUS_26430 16722 16462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 16679 16852 gene locus_tag LOCUS_26440 16679 16852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 18243 16930 gene locus_tag LOCUS_26450 18243 16930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 19331 18240 gene locus_tag LOCUS_26460 19331 18240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 20024 19332 gene locus_tag LOCUS_26470 20024 19332 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071927869.1 protein_id gnl|my_center|LOCUS_26470 20270 24553 gene locus_tag LOCUS_26480 20270 24553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 24701 24546 gene locus_tag LOCUS_26490 24701 24546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26490 25111 25368 gene locus_tag LOCUS_26500 25111 25368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 26089 26370 gene locus_tag LOCUS_26510 26089 26370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence41 691 1269 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq accggcttgcagaccgtgtag 1879 2577 gene locus_tag LOCUS_26520 1879 2577 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615797.1 protein_id gnl|my_center|LOCUS_26520 2708 5008 gene locus_tag LOCUS_26530 2708 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 5005 5682 gene locus_tag LOCUS_26540 gene cmk 5005 5682 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122796.1 protein_id gnl|my_center|LOCUS_26540 5679 6377 gene locus_tag LOCUS_26550 5679 6377 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_26550 9585 6436 gene locus_tag LOCUS_26560 9585 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 9826 11322 gene locus_tag LOCUS_26570 9826 11322 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119613.1 protein_id gnl|my_center|LOCUS_26570 11829 11392 gene locus_tag LOCUS_26580 11829 11392 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117915.1 protein_id gnl|my_center|LOCUS_26580 12589 11852 gene locus_tag LOCUS_26590 12589 11852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 12797 14287 gene locus_tag LOCUS_26600 12797 14287 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921863.1 protein_id gnl|my_center|LOCUS_26600 14744 14268 gene locus_tag LOCUS_26610 14744 14268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 16702 14753 gene locus_tag LOCUS_26620 16702 14753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 protein_id gnl|my_center|LOCUS_26620 17891 16986 gene locus_tag LOCUS_26630 gene folD 17891 16986 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922068.1 protein_id gnl|my_center|LOCUS_26630 18208 17888 gene locus_tag LOCUS_26640 18208 17888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 19848 18223 gene locus_tag LOCUS_26650 19848 18223 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_26650 20264 21331 gene locus_tag LOCUS_26660 20264 21331 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257835.1 protein_id gnl|my_center|LOCUS_26660 21432 22328 gene locus_tag LOCUS_26670 21432 22328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 23960 22407 gene locus_tag LOCUS_26680 23960 22407 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391179.1 protein_id gnl|my_center|LOCUS_26680 24988 24008 gene locus_tag LOCUS_26690 24988 24008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 25973 25017 gene locus_tag LOCUS_26700 25973 25017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 26380 26583 gene locus_tag LOCUS_26710 26380 26583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence42 501 566 gene locus_tag LOCUS_t00470 501 566 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 754 1314 gene locus_tag LOCUS_26720 754 1314 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_26720 1311 2867 gene locus_tag LOCUS_26730 1311 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2864 4132 gene locus_tag LOCUS_26740 2864 4132 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_26740 4519 4178 gene locus_tag LOCUS_26750 4519 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 5546 4572 gene locus_tag LOCUS_26760 5546 4572 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_26760 6722 5577 gene locus_tag LOCUS_26770 6722 5577 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119407.1 protein_id gnl|my_center|LOCUS_26770 11609 6948 gene locus_tag LOCUS_26780 11609 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 11940 13349 gene locus_tag LOCUS_26790 11940 13349 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921597.1 protein_id gnl|my_center|LOCUS_26790 13346 15628 gene locus_tag LOCUS_26800 13346 15628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 15625 17640 gene locus_tag LOCUS_26810 15625 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 17930 18778 gene locus_tag LOCUS_26820 17930 18778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 19596 18823 gene locus_tag LOCUS_26830 19596 18823 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_26830 23013 19660 gene locus_tag LOCUS_26840 23013 19660 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_26840 24253 23024 gene locus_tag LOCUS_26850 24253 23024 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140777.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence43 479 1318 gene locus_tag LOCUS_26860 479 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339871.1 protein_id gnl|my_center|LOCUS_26860 1711 2889 gene locus_tag LOCUS_26870 gene hemW 1711 2889 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122512.1 protein_id gnl|my_center|LOCUS_26870 4352 2898 gene locus_tag LOCUS_26880 4352 2898 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127254.1 protein_id gnl|my_center|LOCUS_26880 4713 4363 gene locus_tag LOCUS_26890 4713 4363 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434762.1 protein_id gnl|my_center|LOCUS_26890 5914 4745 gene locus_tag LOCUS_26900 5914 4745 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_26900 6213 6647 gene locus_tag LOCUS_26910 gene rplM 6213 6647 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328021.1 protein_id gnl|my_center|LOCUS_26910 6722 7144 gene locus_tag LOCUS_26920 gene rpsI 6722 7144 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122781.1 protein_id gnl|my_center|LOCUS_26920 7417 8115 gene locus_tag LOCUS_26930 7417 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 9104 8109 gene locus_tag LOCUS_26940 9104 8109 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339548.1 protein_id gnl|my_center|LOCUS_26940 9353 10288 gene locus_tag LOCUS_26950 9353 10288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_26950 10358 12184 gene locus_tag LOCUS_26960 10358 12184 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325469.1 protein_id gnl|my_center|LOCUS_26960 12181 13725 gene locus_tag LOCUS_26970 12181 13725 CDS product IRE (iron responsive element) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922846.1 protein_id gnl|my_center|LOCUS_26970 15068 13764 gene locus_tag LOCUS_26980 15068 13764 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259655.1 protein_id gnl|my_center|LOCUS_26980 16243 15086 gene locus_tag LOCUS_26990 gene proB 16243 15086 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331575.1 protein_id gnl|my_center|LOCUS_26990 16590 18044 gene locus_tag LOCUS_27000 16590 18044 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327245.1 protein_id gnl|my_center|LOCUS_27000 18812 18093 gene locus_tag LOCUS_27010 gene trmB 18812 18093 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334207.1 protein_id gnl|my_center|LOCUS_27010 19357 18818 gene locus_tag LOCUS_27020 19357 18818 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_27020 20070 19570 gene locus_tag LOCUS_27030 20070 19570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 21726 20167 gene locus_tag LOCUS_27040 21726 20167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 23343 21886 gene locus_tag LOCUS_27050 23343 21886 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921382.1 protein_id gnl|my_center|LOCUS_27050 <25039 23467 gene locus_tag LOCUS_27060 <25039 23467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921382.1:terpene cyclase/mutase family protein >Feature sequence44 693 22 gene locus_tag LOCUS_27070 693 22 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230121.1 protein_id gnl|my_center|LOCUS_27070 864 1865 gene locus_tag LOCUS_27080 gene mch 864 1865 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145084390.1 protein_id gnl|my_center|LOCUS_27080 1870 2853 gene locus_tag LOCUS_27090 1870 2853 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922006.1 protein_id gnl|my_center|LOCUS_27090 3095 3571 gene locus_tag LOCUS_27100 3095 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 4074 4496 gene locus_tag LOCUS_27110 4074 4496 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327289.1 protein_id gnl|my_center|LOCUS_27110 4509 5678 gene locus_tag LOCUS_27120 gene rsgA 4509 5678 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119119.1 protein_id gnl|my_center|LOCUS_27120 5675 7063 gene locus_tag LOCUS_27130 gene hflX 5675 7063 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_27130 7098 7910 gene locus_tag LOCUS_27140 7098 7910 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_27140 7907 8308 gene locus_tag LOCUS_27150 7907 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 9427 8537 gene locus_tag LOCUS_27160 9427 8537 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_27160 10133 9636 gene locus_tag LOCUS_27170 gene fae 10133 9636 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326305.1 protein_id gnl|my_center|LOCUS_27170 10299 11474 gene locus_tag LOCUS_27180 10299 11474 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532032.1 protein_id gnl|my_center|LOCUS_27180 11982 11533 gene locus_tag LOCUS_27190 gene rimI 11982 11533 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017535.1 protein_id gnl|my_center|LOCUS_27190 12287 13999 gene locus_tag LOCUS_27200 12287 13999 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120288.1 protein_id gnl|my_center|LOCUS_27200 13996 17655 gene locus_tag LOCUS_27210 gene smc 13996 17655 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014795041.1 protein_id gnl|my_center|LOCUS_27210 18093 18665 gene locus_tag LOCUS_27220 18093 18665 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_27220 18795 19250 gene locus_tag LOCUS_27230 gene moaC 18795 19250 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417293.1 protein_id gnl|my_center|LOCUS_27230 19739 19269 gene locus_tag LOCUS_27240 gene nrdR 19739 19269 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence45 1945 266 gene locus_tag LOCUS_27250 gene ilvD 1945 266 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922486.1 protein_id gnl|my_center|LOCUS_27250 2016 2636 gene locus_tag LOCUS_27260 2016 2636 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922484.1 protein_id gnl|my_center|LOCUS_27260 2942 2673 gene locus_tag LOCUS_27270 2942 2673 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191739.1 protein_id gnl|my_center|LOCUS_27270 2941 4605 gene locus_tag LOCUS_27280 2941 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 5434 4664 gene locus_tag LOCUS_27290 gene surE 5434 4664 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201557.1 protein_id gnl|my_center|LOCUS_27290 5521 7092 gene locus_tag LOCUS_27300 gene guaA 5521 7092 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_27300 8791 7109 gene locus_tag LOCUS_27310 8791 7109 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615587.1 protein_id gnl|my_center|LOCUS_27310 8912 9583 gene locus_tag LOCUS_27320 8912 9583 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_27320 9564 11003 gene locus_tag LOCUS_27330 9564 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 11000 11770 gene locus_tag LOCUS_27340 11000 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 13151 11757 gene locus_tag LOCUS_27350 gene hpnE 13151 11757 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 protein_id gnl|my_center|LOCUS_27350 14005 13148 gene locus_tag LOCUS_27360 gene hpnD 14005 13148 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_27360 14943 14002 gene locus_tag LOCUS_27370 gene hpnC 14943 14002 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061007.1 protein_id gnl|my_center|LOCUS_27370 15075 16028 gene locus_tag LOCUS_27380 gene ispH 15075 16028 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_27380 16993 16625 gene locus_tag LOCUS_27390 16993 16625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 17410 17075 gene locus_tag LOCUS_27400 17410 17075 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941369.1 protein_id gnl|my_center|LOCUS_27400 17832 17536 gene locus_tag LOCUS_27410 17832 17536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 18053 17829 gene locus_tag LOCUS_27420 18053 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 18547 18254 gene locus_tag LOCUS_27430 18547 18254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 18762 18544 gene locus_tag LOCUS_27440 18762 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 19241 19011 gene locus_tag LOCUS_27450 19241 19011 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898525.1 protein_id gnl|my_center|LOCUS_27450 19584 19243 gene locus_tag LOCUS_27460 19584 19243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 19922 19695 gene locus_tag LOCUS_27470 19922 19695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 20245 19919 gene locus_tag LOCUS_27480 20245 19919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 >Feature sequence46 945 1151 gene locus_tag LOCUS_27490 945 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 1310 1131 gene locus_tag LOCUS_27500 1310 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 2081 1341 gene locus_tag LOCUS_27510 2081 1341 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618822.1 protein_id gnl|my_center|LOCUS_27510 2321 2145 gene locus_tag LOCUS_27520 2321 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 4474 2564 gene locus_tag LOCUS_27530 4474 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 4777 4553 gene locus_tag LOCUS_27540 4777 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 6161 4842 gene locus_tag LOCUS_27550 6161 4842 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_27550 6618 7784 gene locus_tag LOCUS_27560 6618 7784 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_27560 7864 8667 gene locus_tag LOCUS_27570 7864 8667 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_27570 8699 9628 gene locus_tag LOCUS_27580 8699 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 9794 12499 gene locus_tag LOCUS_27590 9794 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 12853 14265 gene locus_tag LOCUS_27600 12853 14265 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_27600 14503 19437 gene locus_tag LOCUS_27610 14503 19437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 >Feature sequence47 660 136 gene locus_tag LOCUS_27620 gene msrB 660 136 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813871.1 protein_id gnl|my_center|LOCUS_27620 1850 717 gene locus_tag LOCUS_27630 1850 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 1912 2520 gene locus_tag LOCUS_27640 1912 2520 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334179.1 protein_id gnl|my_center|LOCUS_27640 2655 3014 gene locus_tag LOCUS_27650 2655 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 3044 4747 gene locus_tag LOCUS_27660 3044 4747 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_27660 5005 6549 gene locus_tag LOCUS_27670 5005 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 6606 8324 gene locus_tag LOCUS_27680 6606 8324 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_27680 8429 9757 gene locus_tag LOCUS_27690 8429 9757 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329380.1 protein_id gnl|my_center|LOCUS_27690 9754 10611 gene locus_tag LOCUS_27700 9754 10611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 10608 11564 gene locus_tag LOCUS_27710 10608 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 11561 12604 gene locus_tag LOCUS_27720 11561 12604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 12616 15705 gene locus_tag LOCUS_27730 12616 15705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 15812 17008 gene locus_tag LOCUS_27740 15812 17008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 >Feature sequence48 889 320 gene locus_tag LOCUS_27750 gene efp 889 320 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814655.1 protein_id gnl|my_center|LOCUS_27750 1014 2045 gene locus_tag LOCUS_27760 gene epmB 1014 2045 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_27760 2147 3040 gene locus_tag LOCUS_27770 2147 3040 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664024.1 protein_id gnl|my_center|LOCUS_27770 3926 3120 gene locus_tag LOCUS_27780 gene kdsB 3926 3120 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123860.1 protein_id gnl|my_center|LOCUS_27780 3979 5868 gene locus_tag LOCUS_27790 gene glmS 3979 5868 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 protein_id gnl|my_center|LOCUS_27790 6021 6104 gene locus_tag LOCUS_t00480 6021 6104 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6224 6297 gene locus_tag LOCUS_t00490 6224 6297 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6431 8071 gene locus_tag LOCUS_27800 6431 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 9922 8117 gene locus_tag LOCUS_27810 9922 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 11759 9951 gene locus_tag LOCUS_27820 11759 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 12732 11854 gene locus_tag LOCUS_27830 12732 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 13689 12805 gene locus_tag LOCUS_27840 gene gluQRS 13689 12805 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_27840 14354 13686 gene locus_tag LOCUS_27850 14354 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 14568 16658 gene locus_tag LOCUS_27860 gene fusA 14568 16658 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120445.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence49 733 4290 gene locus_tag LOCUS_27870 733 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 4499 5188 gene locus_tag LOCUS_27880 4499 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 5189 5698 gene locus_tag LOCUS_27890 5189 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 6335 6054 gene locus_tag LOCUS_27900 6335 6054 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727964.1 protein_id gnl|my_center|LOCUS_27900 6463 7080 gene locus_tag LOCUS_27910 6463 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 8089 7475 gene locus_tag LOCUS_27920 8089 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27920 8277 8065 gene locus_tag LOCUS_27930 8277 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 9972 8455 gene locus_tag LOCUS_27940 9972 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 10510 9986 gene locus_tag LOCUS_27950 10510 9986 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_27950 10418 10615 gene locus_tag LOCUS_27960 10418 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 10688 11653 gene locus_tag LOCUS_27970 10688 11653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 11742 14990 gene locus_tag LOCUS_27980 11742 14990 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122437.1 protein_id gnl|my_center|LOCUS_27980 >Feature sequence50 743 192 gene locus_tag LOCUS_27990 743 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 712 861 gene locus_tag LOCUS_28000 712 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 1483 896 gene locus_tag LOCUS_28010 1483 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 1940 1545 gene locus_tag LOCUS_28020 1940 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 3108 2005 gene locus_tag LOCUS_28030 3108 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 3249 3824 gene locus_tag LOCUS_28040 3249 3824 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_28040 3836 5743 gene locus_tag LOCUS_28050 3836 5743 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_28050 5736 7022 gene locus_tag LOCUS_28060 5736 7022 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044915.1 protein_id gnl|my_center|LOCUS_28060 7023 8069 gene locus_tag LOCUS_28070 7023 8069 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 protein_id gnl|my_center|LOCUS_28070 8096 8719 gene locus_tag LOCUS_28080 8096 8719 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 protein_id gnl|my_center|LOCUS_28080 8716 8979 gene locus_tag LOCUS_28090 8716 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 8976 10340 gene locus_tag LOCUS_28100 8976 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 10415 10753 gene locus_tag LOCUS_28110 10415 10753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 10735 11142 gene locus_tag LOCUS_28120 10735 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 11216 11947 gene locus_tag LOCUS_28130 11216 11947 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284930.1 protein_id gnl|my_center|LOCUS_28130 13186 11957 gene locus_tag LOCUS_28140 13186 11957 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_28140 13506 13183 gene locus_tag LOCUS_28150 13506 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 13859 14086 gene locus_tag LOCUS_28160 13859 14086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 14857 14558 gene locus_tag LOCUS_28170 14857 14558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence51 1650 631 gene locus_tag LOCUS_28180 1650 631 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_28180 2079 6413 gene locus_tag LOCUS_28190 2079 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 6395 7135 gene locus_tag LOCUS_28200 gene ispD 6395 7135 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122160.1 protein_id gnl|my_center|LOCUS_28200 7156 8433 gene locus_tag LOCUS_28210 gene tyrS 7156 8433 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_28210 8546 8863 gene locus_tag LOCUS_28220 8546 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 9606 8920 gene locus_tag LOCUS_28230 9606 8920 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922323.1 protein_id gnl|my_center|LOCUS_28230 11222 9603 gene locus_tag LOCUS_28240 11222 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615709.1 protein_id gnl|my_center|LOCUS_28240 11298 12203 gene locus_tag LOCUS_28250 gene prpB 11298 12203 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112517.1 protein_id gnl|my_center|LOCUS_28250 12227 13399 gene locus_tag LOCUS_28260 12227 13399 CDS product bifunctional 2-methylcitrate synthase/citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013797.1 protein_id gnl|my_center|LOCUS_28260 14500 13433 gene locus_tag LOCUS_28270 14500 13433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence52 1063 2265 gene locus_tag LOCUS_28280 1063 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 2311 3441 gene locus_tag LOCUS_28290 2311 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 8018 3780 gene locus_tag LOCUS_28300 8018 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 8293 8057 gene locus_tag LOCUS_28310 8293 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 8937 8290 gene locus_tag LOCUS_28320 8937 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 9224 8952 gene locus_tag LOCUS_28330 9224 8952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 9422 10336 gene locus_tag LOCUS_28340 9422 10336 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333051.1 protein_id gnl|my_center|LOCUS_28340 11078 10392 gene locus_tag LOCUS_28350 11078 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 11190 13034 gene locus_tag LOCUS_28360 11190 13034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence53 640 374 gene locus_tag LOCUS_28370 640 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 971 630 gene locus_tag LOCUS_28380 971 630 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_28380 2053 1352 gene locus_tag LOCUS_28390 2053 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 2881 2252 gene locus_tag LOCUS_28400 2881 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 3014 4105 gene locus_tag LOCUS_28410 3014 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 4197 5369 gene locus_tag LOCUS_28420 4197 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 5549 7063 gene locus_tag LOCUS_28430 5549 7063 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922249.1 protein_id gnl|my_center|LOCUS_28430 7798 7046 gene locus_tag LOCUS_28440 7798 7046 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122393.1 protein_id gnl|my_center|LOCUS_28440 7901 8356 gene locus_tag LOCUS_28450 7901 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 8368 9489 gene locus_tag LOCUS_28460 8368 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 9489 11003 gene locus_tag LOCUS_28470 9489 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 11008 11691 gene locus_tag LOCUS_28480 11008 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 11716 12702 gene locus_tag LOCUS_28490 11716 12702 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_28490 13445 12612 gene locus_tag LOCUS_28500 13445 12612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence54 415 924 gene locus_tag LOCUS_28510 415 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 1073 1228 gene locus_tag LOCUS_28520 1073 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 1279 1779 gene locus_tag LOCUS_28530 1279 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_28530 2268 2591 gene locus_tag LOCUS_28540 2268 2591 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_28540 2701 2973 gene locus_tag LOCUS_28550 2701 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3038 3304 gene locus_tag LOCUS_28560 3038 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 3443 4060 gene locus_tag LOCUS_28570 3443 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 4448 4717 gene locus_tag LOCUS_28580 4448 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 4864 5481 gene locus_tag LOCUS_28590 4864 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 5641 5856 gene locus_tag LOCUS_28600 5641 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 5853 6134 gene locus_tag LOCUS_28610 5853 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 6245 7024 gene locus_tag LOCUS_28620 6245 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057419.1 protein_id gnl|my_center|LOCUS_28620 7115 9997 gene locus_tag LOCUS_28630 7115 9997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 10222 11787 gene locus_tag LOCUS_28640 10222 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 11875 12663 gene locus_tag LOCUS_28650 11875 12663 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219159941.1 protein_id gnl|my_center|LOCUS_28650 >Feature sequence55 1317 598 gene locus_tag LOCUS_28660 1317 598 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326130.1 protein_id gnl|my_center|LOCUS_28660 2391 1336 gene locus_tag LOCUS_28670 2391 1336 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922157.1 protein_id gnl|my_center|LOCUS_28670 2679 3821 gene locus_tag LOCUS_28680 2679 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667978.1 protein_id gnl|my_center|LOCUS_28680 4239 3895 gene locus_tag LOCUS_28690 4239 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 6369 4333 gene locus_tag LOCUS_28700 6369 4333 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090696.1 protein_id gnl|my_center|LOCUS_28700 6495 7550 gene locus_tag LOCUS_28710 6495 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 7583 8245 gene locus_tag LOCUS_28720 gene cysC 7583 8245 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332129.1 protein_id gnl|my_center|LOCUS_28720 8833 8300 gene locus_tag LOCUS_28730 8833 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 10597 9011 gene locus_tag LOCUS_28740 10597 9011 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328293.1 protein_id gnl|my_center|LOCUS_28740 11023 11544 gene locus_tag LOCUS_28750 11023 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 11541 12533 gene locus_tag LOCUS_28760 11541 12533 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326204.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence56 <1 960 gene locus_tag LOCUS_28770 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_150556097.1:autotransporter outer membrane beta-barrel domain-containing protein 1142 990 gene locus_tag LOCUS_28780 1142 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 1197 1949 gene locus_tag LOCUS_28790 1197 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 1949 2398 gene locus_tag LOCUS_28800 1949 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 2529 5924 gene locus_tag LOCUS_28810 gene mfd 2529 5924 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_28810 5896 7440 gene locus_tag LOCUS_28820 5896 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 7661 9139 gene locus_tag LOCUS_28830 7661 9139 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_28830 9732 9226 gene locus_tag LOCUS_28840 gene tadA 9732 9226 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325362.1 protein_id gnl|my_center|LOCUS_28840 9869 10495 gene locus_tag LOCUS_28850 9869 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921922.1 protein_id gnl|my_center|LOCUS_28850 10510 10680 gene locus_tag LOCUS_28860 10510 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 10703 11560 gene locus_tag LOCUS_28870 10703 11560 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327663.1 protein_id gnl|my_center|LOCUS_28870 11728 11979 gene locus_tag LOCUS_28880 11728 11979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 >Feature sequence57 376 813 gene locus_tag LOCUS_28890 376 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 853 2196 gene locus_tag LOCUS_28900 853 2196 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921544.1 protein_id gnl|my_center|LOCUS_28900 3077 2691 gene locus_tag LOCUS_28910 3077 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326218.1 protein_id gnl|my_center|LOCUS_28910 5381 3198 gene locus_tag LOCUS_28920 5381 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 5944 7707 gene locus_tag LOCUS_28930 5944 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 8029 9258 gene locus_tag LOCUS_28940 8029 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28940 9258 10364 gene locus_tag LOCUS_28950 9258 10364 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583801.1 protein_id gnl|my_center|LOCUS_28950 10402 11400 gene locus_tag LOCUS_28960 10402 11400 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_28960 11528 11343 gene locus_tag LOCUS_28970 11528 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 11815 12171 gene locus_tag LOCUS_28980 11815 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 >Feature sequence58 569 811 gene locus_tag LOCUS_28990 569 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 974 780 gene locus_tag LOCUS_29000 974 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 1283 1606 gene locus_tag LOCUS_29010 1283 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 2142 2399 gene locus_tag LOCUS_29020 2142 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 2531 2749 gene locus_tag LOCUS_29030 2531 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 2746 3000 gene locus_tag LOCUS_29040 2746 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 3455 3213 gene locus_tag LOCUS_29050 3455 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 3527 3886 gene locus_tag LOCUS_29060 3527 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 4026 5099 gene locus_tag LOCUS_29070 4026 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 5402 6217 gene locus_tag LOCUS_29080 5402 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 6168 7106 gene locus_tag LOCUS_29090 6168 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 7028 7402 gene locus_tag LOCUS_29100 7028 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 7445 8422 gene locus_tag LOCUS_29110 7445 8422 CDS product N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans,octacis-undecaprenol 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999466.1 protein_id gnl|my_center|LOCUS_29110 9115 8519 gene locus_tag LOCUS_29120 9115 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 9356 9394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9914 10096 gene locus_tag LOCUS_29130 9914 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 10758 10312 gene locus_tag LOCUS_29140 10758 10312 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142603.1 protein_id gnl|my_center|LOCUS_29140 11000 10758 gene locus_tag LOCUS_29150 11000 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 11318 11037 gene locus_tag LOCUS_29160 11318 11037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 11764 11315 gene locus_tag LOCUS_29170 11764 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence59 1124 2440 gene locus_tag LOCUS_29180 1124 2440 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922459.1 protein_id gnl|my_center|LOCUS_29180 2507 3448 gene locus_tag LOCUS_29190 gene thiL 2507 3448 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121111.1 protein_id gnl|my_center|LOCUS_29190 3468 3983 gene locus_tag LOCUS_29200 gene tsaE 3468 3983 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 protein_id gnl|my_center|LOCUS_29200 4758 3928 gene locus_tag LOCUS_29210 4758 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088451.1 protein_id gnl|my_center|LOCUS_29210 4811 5356 gene locus_tag LOCUS_29220 4811 5356 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_29220 6205 5435 gene locus_tag LOCUS_29230 6205 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 7191 6283 gene locus_tag LOCUS_29240 7191 6283 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846539.1 protein_id gnl|my_center|LOCUS_29240 8804 7287 gene locus_tag LOCUS_29250 8804 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 9877 9185 gene locus_tag LOCUS_29260 9877 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 9761 10015 gene locus_tag LOCUS_29270 9761 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 10956 10045 gene locus_tag LOCUS_29280 10956 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 11682 10996 gene locus_tag LOCUS_29290 11682 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 >Feature sequence60 2679 214 gene locus_tag LOCUS_29300 2679 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 4021 2846 gene locus_tag LOCUS_29310 4021 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 4614 6044 gene locus_tag LOCUS_29320 4614 6044 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813598.1 protein_id gnl|my_center|LOCUS_29320 6211 7047 gene locus_tag LOCUS_29330 6211 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 7175 8134 gene locus_tag LOCUS_29340 gene argB 7175 8134 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335411.1 protein_id gnl|my_center|LOCUS_29340 8160 9380 gene locus_tag LOCUS_29350 8160 9380 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_29350 9438 10349 gene locus_tag LOCUS_29360 gene argF 9438 10349 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921923.1 protein_id gnl|my_center|LOCUS_29360 11056 10412 gene locus_tag LOCUS_29370 11056 10412 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921338.1 protein_id gnl|my_center|LOCUS_29370 >Feature sequence61 1829 501 gene locus_tag LOCUS_29380 1829 501 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_29380 3713 2217 gene locus_tag LOCUS_29390 3713 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29390 3649 4245 gene locus_tag LOCUS_29400 3649 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 4311 4625 gene locus_tag LOCUS_29410 4311 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 5139 7490 gene locus_tag LOCUS_29420 5139 7490 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_29420 7487 8839 gene locus_tag LOCUS_29430 7487 8839 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922962.1 protein_id gnl|my_center|LOCUS_29430 8848 9768 gene locus_tag LOCUS_29440 8848 9768 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_29440 9831 10871 gene locus_tag LOCUS_29450 9831 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence62 2755 4137 gene locus_tag LOCUS_29460 2755 4137 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921382.1 protein_id gnl|my_center|LOCUS_29460 6663 4456 gene locus_tag LOCUS_29470 6663 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 7547 7083 gene locus_tag LOCUS_29480 7547 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 8637 7540 gene locus_tag LOCUS_29490 8637 7540 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119407.1 protein_id gnl|my_center|LOCUS_29490 <10045 8735 gene locus_tag LOCUS_29500 <10045 8735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007337250.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence63 633 124 gene locus_tag LOCUS_29510 633 124 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_29510 1511 630 gene locus_tag LOCUS_29520 1511 630 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922317.1 protein_id gnl|my_center|LOCUS_29520 1686 3836 gene locus_tag LOCUS_29530 gene ppk1 1686 3836 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141500.1 protein_id gnl|my_center|LOCUS_29530 4521 5483 gene locus_tag LOCUS_29540 4521 5483 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_29540 5483 5857 gene locus_tag LOCUS_29550 gene rnpA 5483 5857 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121387.1 protein_id gnl|my_center|LOCUS_29550 5860 6120 gene locus_tag LOCUS_29560 5860 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 6506 6105 gene locus_tag LOCUS_29570 6506 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 7351 6527 gene locus_tag LOCUS_29580 7351 6527 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327143.1 protein_id gnl|my_center|LOCUS_29580 7498 7572 gene locus_tag LOCUS_t00500 7498 7572 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7929 9164 gene locus_tag LOCUS_29590 7929 9164 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954590.1 protein_id gnl|my_center|LOCUS_29590 >Feature sequence64 1758 328 gene locus_tag LOCUS_29600 1758 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 2309 1755 gene locus_tag LOCUS_29610 2309 1755 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122442.1 protein_id gnl|my_center|LOCUS_29610 3253 2447 gene locus_tag LOCUS_29620 3253 2447 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_29620 3891 3250 gene locus_tag LOCUS_29630 3891 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 4009 7314 gene locus_tag LOCUS_29640 4009 7314 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122437.1 protein_id gnl|my_center|LOCUS_29640 7910 7608 gene locus_tag LOCUS_29650 7910 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 8052 7885 gene locus_tag LOCUS_29660 8052 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 >Feature sequence65 1119 3107 gene locus_tag LOCUS_29670 1119 3107 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_29670 3952 3188 gene locus_tag LOCUS_29680 3952 3188 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665551.1 protein_id gnl|my_center|LOCUS_29680 5551 3998 gene locus_tag LOCUS_29690 5551 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 5734 6471 gene locus_tag LOCUS_29700 5734 6471 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_29700 6554 7852 gene locus_tag LOCUS_29710 gene ahcY 6554 7852 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327756.1 protein_id gnl|my_center|LOCUS_29710 >Feature sequence66 1713 220 gene locus_tag LOCUS_29720 1713 220 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_29720 6474 1765 gene locus_tag LOCUS_29730 gene gltB 6474 1765 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_29730 7471 6515 gene locus_tag LOCUS_29740 7471 6515 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_29740 >Feature sequence67 2967 2389 gene locus_tag LOCUS_29750 2967 2389 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_29750 4042 2996 gene locus_tag LOCUS_29760 4042 2996 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922273.1 protein_id gnl|my_center|LOCUS_29760 5247 4426 gene locus_tag LOCUS_29770 5247 4426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195287.1 protein_id gnl|my_center|LOCUS_29770 6160 5240 gene locus_tag LOCUS_29780 6160 5240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810324.1 protein_id gnl|my_center|LOCUS_29780 7332 6157 gene locus_tag LOCUS_29790 7332 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence68 112 462 gene locus_tag LOCUS_29800 112 462 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_29800 473 904 gene locus_tag LOCUS_29810 473 904 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_29810 1894 1043 gene locus_tag LOCUS_29820 1894 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 3631 2213 gene locus_tag LOCUS_29830 3631 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 3732 4517 gene locus_tag LOCUS_29840 3732 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 4669 4875 gene locus_tag LOCUS_29850 4669 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 4872 5246 gene locus_tag LOCUS_29860 4872 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 5893 6336 gene locus_tag LOCUS_29870 5893 6336 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_29870 6922 6837 gene locus_tag LOCUS_t00510 6922 6837 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6889 7245 gene locus_tag LOCUS_29880 6889 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence69 <1 1327 gene locus_tag LOCUS_29890 <1 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000089287.1:MASE1 domain-containing protein 1431 2888 gene locus_tag LOCUS_29900 1431 2888 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_29900 3128 4090 gene locus_tag LOCUS_29910 3128 4090 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 protein_id gnl|my_center|LOCUS_29910 4145 4564 gene locus_tag LOCUS_29920 4145 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 4592 6184 gene locus_tag LOCUS_29930 4592 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118384.1 protein_id gnl|my_center|LOCUS_29930 <7075 6284 gene locus_tag LOCUS_29940 <7075 6284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119041.1:glycerophosphodiester phosphodiesterase >Feature sequence70 1951 1169 gene locus_tag LOCUS_29950 1951 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2064 2618 gene locus_tag LOCUS_29960 gene hpt 2064 2618 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327769.1 protein_id gnl|my_center|LOCUS_29960 2615 3709 gene locus_tag LOCUS_29970 2615 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 5266 3746 gene locus_tag LOCUS_29980 5266 3746 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532027.1 protein_id gnl|my_center|LOCUS_29980 6258 5263 gene locus_tag LOCUS_29990 6258 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 >Feature sequence71 803 1354 gene locus_tag LOCUS_30000 803 1354 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942345.1 protein_id gnl|my_center|LOCUS_30000 1351 2490 gene locus_tag LOCUS_30010 gene dgt 1351 2490 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817450.1 protein_id gnl|my_center|LOCUS_30010 2501 3526 gene locus_tag LOCUS_30020 2501 3526 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_30020 3580 4992 gene locus_tag LOCUS_30030 3580 4992 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence72 542 1864 gene locus_tag LOCUS_30040 542 1864 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_30040 2075 2821 gene locus_tag LOCUS_30050 2075 2821 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118760.1 protein_id gnl|my_center|LOCUS_30050 2814 3899 gene locus_tag LOCUS_30060 2814 3899 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118761.1 protein_id gnl|my_center|LOCUS_30060 4055 4128 gene locus_tag LOCUS_t00520 4055 4128 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4162 4575 gene locus_tag LOCUS_30070 4162 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 5167 4523 gene locus_tag LOCUS_30080 5167 4523 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence73 766 305 gene locus_tag LOCUS_30090 766 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 948 1805 gene locus_tag LOCUS_30100 948 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1845 3392 gene locus_tag LOCUS_30110 1845 3392 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_30110 3464 5053 gene locus_tag LOCUS_30120 3464 5053 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_30120 >Feature sequence74 <1 1407 gene locus_tag LOCUS_30130 <1 1407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein note possible pseudo, frameshifted >Feature sequence75 371 1510 gene locus_tag LOCUS_30140 371 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30140 1435 1683 gene locus_tag LOCUS_30150 1435 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2045 2908 gene locus_tag LOCUS_30160 2045 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 3843 3391 gene locus_tag LOCUS_30170 3843 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 >Feature sequence76 464 874 gene locus_tag LOCUS_30180 464 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 1199 2401 gene locus_tag LOCUS_30190 1199 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 3350 2373 gene locus_tag LOCUS_30200 3350 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 >Feature sequence77 <3712 1164 gene locus_tag LOCUS_30210 <3712 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122713.1:DUF2309 domain-containing protein >Feature sequence78 <1 856 gene locus_tag LOCUS_30220 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066243.1:saccharopine dehydrogenase NADP-binding domain-containing protein 862 1995 gene locus_tag LOCUS_30230 862 1995 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880438.1 protein_id gnl|my_center|LOCUS_30230 3402 2068 gene locus_tag LOCUS_30240 3402 2068 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122163.1 protein_id gnl|my_center|LOCUS_30240 >Feature sequence79 2761 1298 gene locus_tag LOCUS_30250 2761 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence80 >Feature sequence81 <1776 1161 gene locus_tag LOCUS_30260 <1776 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205613.1:ESPR-type extended signal peptide-containing protein >Feature sequence82 <1659 1053 gene locus_tag LOCUS_30270 <1659 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123104.1:PQQ-like beta-propeller repeat protein