>Feature sequence001 2299 290 gene locus_tag LOCUS_00010 2299 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4738 2336 gene locus_tag LOCUS_00020 4738 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086473.1 protein_id gnl|my_center|LOCUS_00020 5707 4898 gene locus_tag LOCUS_00030 5707 4898 CDS product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096009.1 protein_id gnl|my_center|LOCUS_00030 6325 6669 gene locus_tag LOCUS_00040 gene flhD 6325 6669 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198199.1 protein_id gnl|my_center|LOCUS_00040 6681 7226 gene locus_tag LOCUS_00050 gene flhC 6681 7226 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_00050 7530 8390 gene locus_tag LOCUS_00060 gene motA 7530 8390 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_00060 8394 9332 gene locus_tag LOCUS_00070 gene motB 8394 9332 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811924.1 protein_id gnl|my_center|LOCUS_00070 9418 9804 gene locus_tag LOCUS_00080 gene cheY 9418 9804 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367338.1 protein_id gnl|my_center|LOCUS_00080 9877 10593 gene locus_tag LOCUS_00090 gene cheZ 9877 10593 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524402.1 protein_id gnl|my_center|LOCUS_00090 10623 12656 gene locus_tag LOCUS_00100 10623 12656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13275 12982 gene locus_tag LOCUS_00110 13275 12982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15752 13335 gene locus_tag LOCUS_00120 15752 13335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16060 15749 gene locus_tag LOCUS_00130 gene fliE 16060 15749 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947487.1 protein_id gnl|my_center|LOCUS_00130 16334 17614 gene locus_tag LOCUS_00140 16334 17614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17843 19477 gene locus_tag LOCUS_00150 gene fliF 17843 19477 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_00150 19477 20478 gene locus_tag LOCUS_00160 gene fliG 19477 20478 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_00160 20814 20596 gene locus_tag LOCUS_00170 20814 20596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20704 21132 gene locus_tag LOCUS_00180 20704 21132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21122 22543 gene locus_tag LOCUS_00190 gene fliI 21122 22543 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811843.1 protein_id gnl|my_center|LOCUS_00190 22548 23015 gene locus_tag LOCUS_00200 gene fliJ 22548 23015 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082220.1 protein_id gnl|my_center|LOCUS_00200 >Feature sequence002 684 1580 gene locus_tag LOCUS_00210 684 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 3125 1617 gene locus_tag LOCUS_00220 3125 1617 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_00220 4872 3265 gene locus_tag LOCUS_00230 gene ubiB 4872 3265 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_00230 5491 4907 gene locus_tag LOCUS_00240 5491 4907 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188960.1 protein_id gnl|my_center|LOCUS_00240 6228 5554 gene locus_tag LOCUS_00250 6228 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 7259 6303 gene locus_tag LOCUS_00260 7259 6303 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064917.1 protein_id gnl|my_center|LOCUS_00260 8026 7283 gene locus_tag LOCUS_00270 gene ubiE 8026 7283 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 protein_id gnl|my_center|LOCUS_00270 8449 8033 gene locus_tag LOCUS_00280 8449 8033 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_00280 9083 8595 gene locus_tag LOCUS_00290 9083 8595 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_00290 12673 9080 gene locus_tag LOCUS_00300 gene pilY1 12673 9080 CDS product type 4a pilus biogenesis protein PilY1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115287.1 protein_id gnl|my_center|LOCUS_00300 13225 12695 gene locus_tag LOCUS_00310 13225 12695 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704650.1 protein_id gnl|my_center|LOCUS_00310 14321 13236 gene locus_tag LOCUS_00320 14321 13236 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704649.1 protein_id gnl|my_center|LOCUS_00320 14776 14321 gene locus_tag LOCUS_00330 gene pilV 14776 14321 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946368.1 protein_id gnl|my_center|LOCUS_00330 15378 14785 gene locus_tag LOCUS_00340 15378 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 16088 15531 gene locus_tag LOCUS_00350 16088 15531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 16651 16202 gene locus_tag LOCUS_00360 16651 16202 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_00360 20460 16648 gene locus_tag LOCUS_00370 gene pilY1 20460 16648 CDS product type 4a pilus biogenesis protein PilY1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115287.1 protein_id gnl|my_center|LOCUS_00370 20995 20483 gene locus_tag LOCUS_00380 20995 20483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 21771 21007 gene locus_tag LOCUS_00390 21771 21007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 22445 21822 gene locus_tag LOCUS_00400 22445 21822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 >Feature sequence003 1357 569 gene locus_tag LOCUS_00410 gene ybgF 1357 569 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_00410 1933 1370 gene locus_tag LOCUS_00420 gene pal 1933 1370 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 protein_id gnl|my_center|LOCUS_00420 3228 1951 gene locus_tag LOCUS_00430 gene tolB 3228 1951 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_00430 4116 3340 gene locus_tag LOCUS_00440 4116 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 4549 4118 gene locus_tag LOCUS_00450 gene tolR 4549 4118 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_00450 5226 4558 gene locus_tag LOCUS_00460 gene tolQ 5226 4558 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_00460 5642 5223 gene locus_tag LOCUS_00470 gene ybgC 5642 5223 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 protein_id gnl|my_center|LOCUS_00470 7140 6709 gene locus_tag LOCUS_00480 7140 6709 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_00480 7580 7152 gene locus_tag LOCUS_00490 7580 7152 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_00490 8439 7606 gene locus_tag LOCUS_00500 8439 7606 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206608.1 protein_id gnl|my_center|LOCUS_00500 9230 8529 gene locus_tag LOCUS_00510 9230 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 10357 9329 gene locus_tag LOCUS_00520 gene ruvB 10357 9329 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_00520 11040 10459 gene locus_tag LOCUS_00530 gene ruvA 11040 10459 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_00530 11591 11037 gene locus_tag LOCUS_00540 gene ruvC 11591 11037 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_00540 13186 11636 gene locus_tag LOCUS_00550 gene purH 13186 11636 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_00550 13515 13183 gene locus_tag LOCUS_00560 13515 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 14550 13528 gene locus_tag LOCUS_00570 gene dusB 14550 13528 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995141.1 protein_id gnl|my_center|LOCUS_00570 15760 14630 gene locus_tag LOCUS_00580 15760 14630 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194220.1 protein_id gnl|my_center|LOCUS_00580 16443 15739 gene locus_tag LOCUS_00590 16443 15739 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190139.1 protein_id gnl|my_center|LOCUS_00590 17430 16447 gene locus_tag LOCUS_00600 17430 16447 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540965.1 protein_id gnl|my_center|LOCUS_00600 >Feature sequence004 1520 2263 gene locus_tag LOCUS_00610 1520 2263 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185567.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00610 2402 4813 gene locus_tag LOCUS_00620 2402 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 4865 6655 gene locus_tag LOCUS_00630 4865 6655 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_00630 7065 6715 gene locus_tag LOCUS_00640 7065 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 9245 7062 gene locus_tag LOCUS_00650 9245 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 9420 9665 gene locus_tag LOCUS_00660 9420 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 10037 9759 gene locus_tag LOCUS_00670 10037 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 10383 11624 gene locus_tag LOCUS_00680 10383 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 12923 11751 gene locus_tag LOCUS_00690 12923 11751 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_00690 13521 12928 gene locus_tag LOCUS_00700 13521 12928 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 protein_id gnl|my_center|LOCUS_00700 14380 13535 gene locus_tag LOCUS_00710 14380 13535 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186676.1 protein_id gnl|my_center|LOCUS_00710 14499 14861 gene locus_tag LOCUS_00720 14499 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 14887 15204 gene locus_tag LOCUS_00730 14887 15204 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012248488.1 protein_id gnl|my_center|LOCUS_00730 15653 15207 gene locus_tag LOCUS_00740 15653 15207 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_00740 16302 15658 gene locus_tag LOCUS_00750 gene nth 16302 15658 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185942.1 protein_id gnl|my_center|LOCUS_00750 16937 16299 gene locus_tag LOCUS_00760 gene rsxB 16937 16299 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926953.1 protein_id gnl|my_center|LOCUS_00760 18207 16981 gene locus_tag LOCUS_00770 gene phaZ 18207 16981 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813854.1 protein_id gnl|my_center|LOCUS_00770 >Feature sequence005 <1 515 gene locus_tag LOCUS_00780 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063931.1:ribosome biogenesis GTPase Der 660 893 gene locus_tag LOCUS_00790 gene hfq 660 893 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 protein_id gnl|my_center|LOCUS_00790 902 2059 gene locus_tag LOCUS_00800 gene hflX 902 2059 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_00800 2111 3361 gene locus_tag LOCUS_00810 gene hflK 2111 3361 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_00810 3371 4261 gene locus_tag LOCUS_00820 gene hflC 3371 4261 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_00820 4261 4449 gene locus_tag LOCUS_00830 4261 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 4466 5602 gene locus_tag LOCUS_00840 4466 5602 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_00840 5615 6910 gene locus_tag LOCUS_00850 5615 6910 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534924.1 protein_id gnl|my_center|LOCUS_00850 6907 7452 gene locus_tag LOCUS_00860 6907 7452 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527158.1 protein_id gnl|my_center|LOCUS_00860 7591 7507 gene locus_tag LOCUS_t00010 7591 7507 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7646 10021 gene locus_tag LOCUS_00870 gene rnr 7646 10021 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550537.1 protein_id gnl|my_center|LOCUS_00870 10018 10749 gene locus_tag LOCUS_00880 gene rlmB 10018 10749 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812973.1 protein_id gnl|my_center|LOCUS_00880 10783 11523 gene locus_tag LOCUS_00890 10783 11523 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258788.1 protein_id gnl|my_center|LOCUS_00890 11633 12001 gene locus_tag LOCUS_00900 gene rpsF 11633 12001 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 protein_id gnl|my_center|LOCUS_00900 12014 12304 gene locus_tag LOCUS_00910 12014 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 12314 12580 gene locus_tag LOCUS_00920 gene rpsR 12314 12580 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813094.1 protein_id gnl|my_center|LOCUS_00920 12599 13054 gene locus_tag LOCUS_00930 gene rplI 12599 13054 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191711.1 protein_id gnl|my_center|LOCUS_00930 13090 14478 gene locus_tag LOCUS_00940 13090 14478 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_00940 14459 15163 gene locus_tag LOCUS_00950 14459 15163 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 protein_id gnl|my_center|LOCUS_00950 15225 15599 gene locus_tag LOCUS_00960 15225 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 17267 15687 gene locus_tag LOCUS_00970 17267 15687 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039534.1 protein_id gnl|my_center|LOCUS_00970 17749 17288 gene locus_tag LOCUS_00980 17749 17288 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_00980 18134 17760 gene locus_tag LOCUS_00990 18134 17760 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_00990 >Feature sequence006 1780 200 gene locus_tag LOCUS_01000 1780 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01000 2792 1827 gene locus_tag LOCUS_01010 2792 1827 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_01010 2837 3487 gene locus_tag LOCUS_01020 gene purN 2837 3487 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064038.1 protein_id gnl|my_center|LOCUS_01020 3484 4755 gene locus_tag LOCUS_01030 3484 4755 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522602.1 protein_id gnl|my_center|LOCUS_01030 4900 6099 gene locus_tag LOCUS_01040 4900 6099 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_01040 7229 7062 gene locus_tag LOCUS_01050 gene rpmG 7229 7062 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810296.1 protein_id gnl|my_center|LOCUS_01050 7474 7241 gene locus_tag LOCUS_01060 gene rpmB 7474 7241 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_01060 8263 7586 gene locus_tag LOCUS_01070 gene radC 8263 7586 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_01070 8548 9498 gene locus_tag LOCUS_01080 gene ispH 8548 9498 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_01080 9495 10061 gene locus_tag LOCUS_01090 9495 10061 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 protein_id gnl|my_center|LOCUS_01090 10065 10952 gene locus_tag LOCUS_01100 gene xerD 10065 10952 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809554.1 protein_id gnl|my_center|LOCUS_01100 10973 11452 gene locus_tag LOCUS_01110 gene ybaK 10973 11452 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 protein_id gnl|my_center|LOCUS_01110 11454 12086 gene locus_tag LOCUS_01120 gene plsY 11454 12086 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_01120 13102 12092 gene locus_tag LOCUS_01130 gene tsaD 13102 12092 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 protein_id gnl|my_center|LOCUS_01130 13201 13413 gene locus_tag LOCUS_01140 gene rpsU 13201 13413 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_01140 13428 13874 gene locus_tag LOCUS_01150 13428 13874 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_01150 13904 15661 gene locus_tag LOCUS_01160 gene dnaG 13904 15661 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190679.1 protein_id gnl|my_center|LOCUS_01160 >Feature sequence007 97 891 gene locus_tag LOCUS_01170 97 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 2559 937 gene locus_tag LOCUS_01180 2559 937 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071171.1 protein_id gnl|my_center|LOCUS_01180 3050 2556 gene locus_tag LOCUS_01190 3050 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 3104 3808 gene locus_tag LOCUS_01200 3104 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 4255 3812 gene locus_tag LOCUS_01210 4255 3812 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813677.1 protein_id gnl|my_center|LOCUS_01210 4768 4322 gene locus_tag LOCUS_01220 4768 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 4883 4686 gene locus_tag LOCUS_01230 4883 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 5271 4867 gene locus_tag LOCUS_01240 5271 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 5837 5268 gene locus_tag LOCUS_01250 5837 5268 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_01250 6118 7875 gene locus_tag LOCUS_01260 6118 7875 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814007.1 protein_id gnl|my_center|LOCUS_01260 7875 8366 gene locus_tag LOCUS_01270 gene ilvN 7875 8366 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_01270 8394 9410 gene locus_tag LOCUS_01280 gene ilvC 8394 9410 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185539.1 protein_id gnl|my_center|LOCUS_01280 9410 10129 gene locus_tag LOCUS_01290 9410 10129 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167359087.1 protein_id gnl|my_center|LOCUS_01290 10191 10829 gene locus_tag LOCUS_01300 10191 10829 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531897.1 protein_id gnl|my_center|LOCUS_01300 10835 11671 gene locus_tag LOCUS_01310 gene pssA 10835 11671 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814004.1 protein_id gnl|my_center|LOCUS_01310 11879 13423 gene locus_tag LOCUS_01320 11879 13423 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_01320 13555 13824 gene locus_tag LOCUS_01330 gene rpsO 13555 13824 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_01330 14039 16198 gene locus_tag LOCUS_01340 gene pnp 14039 16198 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821234.1 protein_id gnl|my_center|LOCUS_01340 16208 17215 gene locus_tag LOCUS_01350 16208 17215 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196428.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence008 25 1197 gene locus_tag LOCUS_01360 gene lapB 25 1197 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_01360 1194 1511 gene locus_tag LOCUS_01370 1194 1511 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189725.1 protein_id gnl|my_center|LOCUS_01370 1508 2413 gene locus_tag LOCUS_01380 gene cysM 1508 2413 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813345.1 protein_id gnl|my_center|LOCUS_01380 3994 2468 gene locus_tag LOCUS_01390 3994 2468 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814384.1 protein_id gnl|my_center|LOCUS_01390 4655 4014 gene locus_tag LOCUS_01400 4655 4014 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649445.1 protein_id gnl|my_center|LOCUS_01400 4921 5799 gene locus_tag LOCUS_01410 gene htpX 4921 5799 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_01410 7273 5849 gene locus_tag LOCUS_01420 7273 5849 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926774.1 protein_id gnl|my_center|LOCUS_01420 8978 7251 gene locus_tag LOCUS_01430 8978 7251 CDS product UDP phosphate-alpha-4-amino-4-deoxy-L-arabinose arabinosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521317.1 protein_id gnl|my_center|LOCUS_01430 9342 9040 gene locus_tag LOCUS_01440 9342 9040 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810513.1 protein_id gnl|my_center|LOCUS_01440 10697 9435 gene locus_tag LOCUS_01450 gene rho 10697 9435 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_01450 11107 10781 gene locus_tag LOCUS_01460 gene trxA 11107 10781 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191795.1 protein_id gnl|my_center|LOCUS_01460 11280 14006 gene locus_tag LOCUS_01470 11280 14006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 14003 17278 gene locus_tag LOCUS_01480 gene addA 14003 17278 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921368.1 protein_id gnl|my_center|LOCUS_01480 >Feature sequence009 1580 1017 gene locus_tag LOCUS_01490 1580 1017 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_01490 3016 1658 gene locus_tag LOCUS_01500 gene rsmB 3016 1658 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189046.1 protein_id gnl|my_center|LOCUS_01500 4041 3013 gene locus_tag LOCUS_01510 gene fmt 4041 3013 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549892.1 protein_id gnl|my_center|LOCUS_01510 4544 4038 gene locus_tag LOCUS_01520 gene def 4544 4038 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525852.1 protein_id gnl|my_center|LOCUS_01520 4918 6072 gene locus_tag LOCUS_01530 4918 6072 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_01530 6148 7266 gene locus_tag LOCUS_01540 gene dprA 6148 7266 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_01540 7490 10168 gene locus_tag LOCUS_01550 7490 10168 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_01550 10194 10406 gene locus_tag LOCUS_01560 10194 10406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 10442 11830 gene locus_tag LOCUS_01570 10442 11830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 13081 11855 gene locus_tag LOCUS_01580 13081 11855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 12719 12630 gene locus_tag LOCUS_t00020 12719 12630 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13311 15413 gene locus_tag LOCUS_01590 13311 15413 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_01590 15471 16433 gene locus_tag LOCUS_01600 15471 16433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 16486 16995 gene locus_tag LOCUS_01610 16486 16995 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551114.1 protein_id gnl|my_center|LOCUS_01610 >Feature sequence010 <1 595 gene locus_tag LOCUS_01620 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063921377.1:feruloyl-CoA synthase 644 1822 gene locus_tag LOCUS_01630 644 1822 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191856.1 protein_id gnl|my_center|LOCUS_01630 2155 1823 gene locus_tag LOCUS_01640 2155 1823 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806936.1 protein_id gnl|my_center|LOCUS_01640 2563 2165 gene locus_tag LOCUS_01650 gene rplQ 2563 2165 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197924.1 protein_id gnl|my_center|LOCUS_01650 3613 2633 gene locus_tag LOCUS_01660 gene rpoA 3613 2633 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 protein_id gnl|my_center|LOCUS_01660 4382 3759 gene locus_tag LOCUS_01670 gene rpsD 4382 3759 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806931.1 protein_id gnl|my_center|LOCUS_01670 4900 4493 gene locus_tag LOCUS_01680 gene rpsK 4900 4493 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197937.1 protein_id gnl|my_center|LOCUS_01680 5307 4933 gene locus_tag LOCUS_01690 gene rpsM 5307 4933 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806929.1 protein_id gnl|my_center|LOCUS_01690 5669 5451 gene locus_tag LOCUS_01700 gene infA 5669 5451 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806927.1 protein_id gnl|my_center|LOCUS_01700 7035 5710 gene locus_tag LOCUS_01710 gene secY 7035 5710 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_01710 7506 7057 gene locus_tag LOCUS_01720 gene rplO 7506 7057 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_01720 7693 7520 gene locus_tag LOCUS_01730 gene rpmD 7693 7520 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_01730 8226 7705 gene locus_tag LOCUS_01740 gene rpsE 8226 7705 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 protein_id gnl|my_center|LOCUS_01740 8606 8238 gene locus_tag LOCUS_01750 gene rplR 8606 8238 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806922.1 protein_id gnl|my_center|LOCUS_01750 9158 8625 gene locus_tag LOCUS_01760 gene rplF 9158 8625 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197947.1 protein_id gnl|my_center|LOCUS_01760 9566 9171 gene locus_tag LOCUS_01770 gene rpsH 9566 9171 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806920.1 protein_id gnl|my_center|LOCUS_01770 9883 9578 gene locus_tag LOCUS_01780 gene rpsN 9883 9578 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197948.1 protein_id gnl|my_center|LOCUS_01780 10435 9896 gene locus_tag LOCUS_01790 gene rplE 10435 9896 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202757.1 protein_id gnl|my_center|LOCUS_01790 10773 10456 gene locus_tag LOCUS_01800 gene rplX 10773 10456 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806917.1 protein_id gnl|my_center|LOCUS_01800 11151 10783 gene locus_tag LOCUS_01810 gene rplN 11151 10783 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215434.1 protein_id gnl|my_center|LOCUS_01810 11674 11405 gene locus_tag LOCUS_01820 gene rpsQ 11674 11405 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 protein_id gnl|my_center|LOCUS_01820 11865 11671 gene locus_tag LOCUS_01830 gene rpmC 11865 11671 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199856.1 protein_id gnl|my_center|LOCUS_01830 12301 11879 gene locus_tag LOCUS_01840 gene rplP 12301 11879 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806911.1 protein_id gnl|my_center|LOCUS_01840 13191 12298 gene locus_tag LOCUS_01850 gene rpsC 13191 12298 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_01850 13540 13199 gene locus_tag LOCUS_01860 gene rplV 13540 13199 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925688.1 protein_id gnl|my_center|LOCUS_01860 13841 13551 gene locus_tag LOCUS_01870 gene rpsS 13841 13551 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806908.1 protein_id gnl|my_center|LOCUS_01870 14675 13851 gene locus_tag LOCUS_01880 gene rplB 14675 13851 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806907.1 protein_id gnl|my_center|LOCUS_01880 >Feature sequence011 1061 513 gene locus_tag LOCUS_01890 1061 513 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195829.1 protein_id gnl|my_center|LOCUS_01890 1542 1072 gene locus_tag LOCUS_01900 1542 1072 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815350.1 protein_id gnl|my_center|LOCUS_01900 1857 1615 gene locus_tag LOCUS_01910 gene atpE 1857 1615 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815363.1 protein_id gnl|my_center|LOCUS_01910 2734 1904 gene locus_tag LOCUS_01920 gene atpB 2734 1904 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538602.1 protein_id gnl|my_center|LOCUS_01920 3074 2748 gene locus_tag LOCUS_01930 3074 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 4087 3227 gene locus_tag LOCUS_01940 4087 3227 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_01940 4857 4084 gene locus_tag LOCUS_01950 4857 4084 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 protein_id gnl|my_center|LOCUS_01950 5550 4918 gene locus_tag LOCUS_01960 gene rsmG 5550 4918 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369001.1 protein_id gnl|my_center|LOCUS_01960 7492 5576 gene locus_tag LOCUS_01970 gene mnmG 7492 5576 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818282.1 protein_id gnl|my_center|LOCUS_01970 7382 7690 gene locus_tag LOCUS_01980 7382 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 9093 7687 gene locus_tag LOCUS_01990 9093 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 11086 9248 gene locus_tag LOCUS_02000 11086 9248 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193209.1 protein_id gnl|my_center|LOCUS_02000 11602 11207 gene locus_tag LOCUS_02010 11602 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 11507 12361 gene locus_tag LOCUS_02020 11507 12361 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188904.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02020 12358 13533 gene locus_tag LOCUS_02030 12358 13533 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088284.1 protein_id gnl|my_center|LOCUS_02030 13751 13545 gene locus_tag LOCUS_02040 13751 13545 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812875.1 protein_id gnl|my_center|LOCUS_02040 <14640 14056 gene locus_tag LOCUS_02050 <14640 14056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405317.1:AbrB family transcriptional regulator >Feature sequence012 2164 773 gene locus_tag LOCUS_02060 2164 773 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527508.1 protein_id gnl|my_center|LOCUS_02060 3117 3761 gene locus_tag LOCUS_02070 3117 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 5038 3767 gene locus_tag LOCUS_02080 5038 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 7114 5231 gene locus_tag LOCUS_02090 7114 5231 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_02090 8315 7305 gene locus_tag LOCUS_02100 8315 7305 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268559.1 protein_id gnl|my_center|LOCUS_02100 9142 8321 gene locus_tag LOCUS_02110 9142 8321 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124383.1 protein_id gnl|my_center|LOCUS_02110 10032 9292 gene locus_tag LOCUS_02120 10032 9292 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088744.1 protein_id gnl|my_center|LOCUS_02120 10207 11202 gene locus_tag LOCUS_02130 gene pseB 10207 11202 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869431.1 protein_id gnl|my_center|LOCUS_02130 11199 12362 gene locus_tag LOCUS_02140 gene pseC 11199 12362 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_02140 12359 13255 gene locus_tag LOCUS_02150 12359 13255 CDS product bifunctional regulator KidO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923314.1 protein_id gnl|my_center|LOCUS_02150 13266 14051 gene locus_tag LOCUS_02160 13266 14051 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence013 <1 1173 gene locus_tag LOCUS_02170 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004549958.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ 1170 2063 gene locus_tag LOCUS_02180 1170 2063 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815026.1 protein_id gnl|my_center|LOCUS_02180 2060 2713 gene locus_tag LOCUS_02190 2060 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 3697 2921 gene locus_tag LOCUS_02200 gene zapD 3697 2921 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_02200 4319 3723 gene locus_tag LOCUS_02210 gene coaE 4319 3723 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_02210 5181 4342 gene locus_tag LOCUS_02220 gene pilD 5181 4342 CDS product type IV prepilin peptidase/methyltransferase PilD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112839.1 protein_id gnl|my_center|LOCUS_02220 6459 5230 gene locus_tag LOCUS_02230 6459 5230 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_02230 8239 6494 gene locus_tag LOCUS_02240 gene pilB 8239 6494 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_02240 8470 8394 gene locus_tag LOCUS_t00030 8470 8394 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9501 8491 gene locus_tag LOCUS_02250 gene ispB 9501 8491 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807467.1 protein_id gnl|my_center|LOCUS_02250 9695 10003 gene locus_tag LOCUS_02260 gene rplU 9695 10003 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_02260 10015 10275 gene locus_tag LOCUS_02270 gene rpmA 10015 10275 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194025.1 protein_id gnl|my_center|LOCUS_02270 10340 11389 gene locus_tag LOCUS_02280 gene obgE 10340 11389 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_02280 11392 12510 gene locus_tag LOCUS_02290 gene proB 11392 12510 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_02290 13184 12672 gene locus_tag LOCUS_02300 13184 12672 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence014 999 2000 gene locus_tag LOCUS_02310 999 2000 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_02310 1993 2646 gene locus_tag LOCUS_02320 1993 2646 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929830.1 protein_id gnl|my_center|LOCUS_02320 2628 3008 gene locus_tag LOCUS_02330 2628 3008 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193415.1 protein_id gnl|my_center|LOCUS_02330 3729 2986 gene locus_tag LOCUS_02340 3729 2986 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_02340 4310 3726 gene locus_tag LOCUS_02350 4310 3726 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065087.1 protein_id gnl|my_center|LOCUS_02350 4346 4843 gene locus_tag LOCUS_02360 4346 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 4897 5076 gene locus_tag LOCUS_02370 gene rpmF 4897 5076 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214744.1 protein_id gnl|my_center|LOCUS_02370 5110 6147 gene locus_tag LOCUS_02380 gene plsX 5110 6147 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065089.1 protein_id gnl|my_center|LOCUS_02380 6150 7127 gene locus_tag LOCUS_02390 6150 7127 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447294.1 protein_id gnl|my_center|LOCUS_02390 7144 8082 gene locus_tag LOCUS_02400 gene fabD 7144 8082 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813821.1 protein_id gnl|my_center|LOCUS_02400 8079 8846 gene locus_tag LOCUS_02410 gene fabG 8079 8846 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065092.1 protein_id gnl|my_center|LOCUS_02410 8914 9153 gene locus_tag LOCUS_02420 gene acpP 8914 9153 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_02420 9176 10423 gene locus_tag LOCUS_02430 gene fabF 9176 10423 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_02430 10942 11541 gene locus_tag LOCUS_02440 gene rpoE 10942 11541 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_02440 11546 12154 gene locus_tag LOCUS_02450 11546 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12167 13159 gene locus_tag LOCUS_02460 12167 13159 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence015 628 912 gene locus_tag LOCUS_02470 628 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 1152 1997 gene locus_tag LOCUS_02480 gene mshM 1152 1997 CDS product MSHA fimbrial biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_02480 2015 3814 gene locus_tag LOCUS_02490 2015 3814 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_02490 3830 4900 gene locus_tag LOCUS_02500 3830 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 4908 6602 gene locus_tag LOCUS_02510 4908 6602 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_02510 6599 7810 gene locus_tag LOCUS_02520 gene gspF 6599 7810 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465194.1 protein_id gnl|my_center|LOCUS_02520 7815 9209 gene locus_tag LOCUS_02530 7815 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 9308 9808 gene locus_tag LOCUS_02540 9308 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 9805 10224 gene locus_tag LOCUS_02550 9805 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 10221 10751 gene locus_tag LOCUS_02560 10221 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 10771 11544 gene locus_tag LOCUS_02570 10771 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 11676 12338 gene locus_tag LOCUS_02580 11676 12338 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence016 1442 558 gene locus_tag LOCUS_02590 1442 558 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811915.1 protein_id gnl|my_center|LOCUS_02590 3409 1445 gene locus_tag LOCUS_02600 gene cheA 3409 1445 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039841.1 protein_id gnl|my_center|LOCUS_02600 3814 3452 gene locus_tag LOCUS_02610 3814 3452 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 protein_id gnl|my_center|LOCUS_02610 4226 3837 gene locus_tag LOCUS_02620 4226 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 4404 5573 gene locus_tag LOCUS_02630 4404 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 5594 6232 gene locus_tag LOCUS_02640 gene rqpR 5594 6232 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_02640 8050 6254 gene locus_tag LOCUS_02650 8050 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 10266 8047 gene locus_tag LOCUS_02660 10266 8047 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942572.1 protein_id gnl|my_center|LOCUS_02660 12407 10278 gene locus_tag LOCUS_02670 12407 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 >Feature sequence017 <1 1895 gene locus_tag LOCUS_02680 <1 1895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388721.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 1916 2707 gene locus_tag LOCUS_02690 1916 2707 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088410.1 protein_id gnl|my_center|LOCUS_02690 2765 3241 gene locus_tag LOCUS_02700 2765 3241 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243551.1 protein_id gnl|my_center|LOCUS_02700 3238 4155 gene locus_tag LOCUS_02710 3238 4155 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388723.1 protein_id gnl|my_center|LOCUS_02710 4171 4833 gene locus_tag LOCUS_02720 4171 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 4947 6041 gene locus_tag LOCUS_02730 4947 6041 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392949.1 protein_id gnl|my_center|LOCUS_02730 6055 6603 gene locus_tag LOCUS_02740 6055 6603 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175650.1 protein_id gnl|my_center|LOCUS_02740 7753 6620 gene locus_tag LOCUS_02750 7753 6620 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_02750 7853 8416 gene locus_tag LOCUS_02760 gene dcd 7853 8416 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 protein_id gnl|my_center|LOCUS_02760 8452 9378 gene locus_tag LOCUS_02770 8452 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 9476 10957 gene locus_tag LOCUS_02780 9476 10957 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521883.1 protein_id gnl|my_center|LOCUS_02780 10987 12000 gene locus_tag LOCUS_02790 10987 12000 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788737.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence018 719 102 gene locus_tag LOCUS_02800 719 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 1163 768 gene locus_tag LOCUS_02810 1163 768 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035949.1 protein_id gnl|my_center|LOCUS_02810 2149 1160 gene locus_tag LOCUS_02820 2149 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 2166 3263 gene locus_tag LOCUS_02830 gene rsmI 2166 3263 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196861.1 protein_id gnl|my_center|LOCUS_02830 5305 3278 gene locus_tag LOCUS_02840 5305 3278 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816072.1 protein_id gnl|my_center|LOCUS_02840 6735 5302 gene locus_tag LOCUS_02850 6735 5302 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812393.1 protein_id gnl|my_center|LOCUS_02850 7527 6742 gene locus_tag LOCUS_02860 7527 6742 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815184.1 protein_id gnl|my_center|LOCUS_02860 8638 7577 gene locus_tag LOCUS_02870 8638 7577 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815184.1 protein_id gnl|my_center|LOCUS_02870 9753 8635 gene locus_tag LOCUS_02880 gene rodA 9753 8635 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815198.1 protein_id gnl|my_center|LOCUS_02880 11648 9750 gene locus_tag LOCUS_02890 gene mrdA 11648 9750 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_02890 11876 11724 gene locus_tag LOCUS_02900 11876 11724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 >Feature sequence019 1268 420 gene locus_tag LOCUS_02910 1268 420 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_02910 1561 2700 gene locus_tag LOCUS_02920 gene wecA 1561 2700 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368885.1 protein_id gnl|my_center|LOCUS_02920 2902 4155 gene locus_tag LOCUS_02930 gene murJ 2902 4155 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258283.1 protein_id gnl|my_center|LOCUS_02930 4159 4848 gene locus_tag LOCUS_02940 4159 4848 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545512.1 protein_id gnl|my_center|LOCUS_02940 4882 5994 gene locus_tag LOCUS_02950 4882 5994 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925971.1 protein_id gnl|my_center|LOCUS_02950 6049 7023 gene locus_tag LOCUS_02960 6049 7023 CDS product IS5-like element IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723085.1 protein_id gnl|my_center|LOCUS_02960 7391 8464 gene locus_tag LOCUS_02970 7391 8464 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_02970 8751 9785 gene locus_tag LOCUS_02980 8751 9785 CDS product EpsG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057045.1 protein_id gnl|my_center|LOCUS_02980 >Feature sequence020 6535 4265 gene locus_tag LOCUS_02990 gene pilJ 6535 4265 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_02990 7128 6604 gene locus_tag LOCUS_03000 7128 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 7515 7150 gene locus_tag LOCUS_03010 gene pilH 7515 7150 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 protein_id gnl|my_center|LOCUS_03010 7938 7543 gene locus_tag LOCUS_03020 gene pilG 7938 7543 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_03020 8164 8012 gene locus_tag LOCUS_03030 8164 8012 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186709.1 protein_id gnl|my_center|LOCUS_03030 8455 9651 gene locus_tag LOCUS_03040 gene hemL 8455 9651 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_03040 >Feature sequence021 1237 338 gene locus_tag LOCUS_03050 1237 338 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_03050 1901 1320 gene locus_tag LOCUS_03060 gene orn 1901 1320 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_03060 1981 3240 gene locus_tag LOCUS_03070 1981 3240 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_03070 3251 4153 gene locus_tag LOCUS_03080 gene rsgA 3251 4153 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813309.1 protein_id gnl|my_center|LOCUS_03080 5316 4363 gene locus_tag LOCUS_03090 5316 4363 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_03090 6055 5357 gene locus_tag LOCUS_03100 6055 5357 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550123.1 protein_id gnl|my_center|LOCUS_03100 6470 6078 gene locus_tag LOCUS_03110 gene rplS 6470 6078 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 protein_id gnl|my_center|LOCUS_03110 7330 6482 gene locus_tag LOCUS_03120 gene trmD 7330 6482 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189914.1 protein_id gnl|my_center|LOCUS_03120 7904 7392 gene locus_tag LOCUS_03130 gene rimM 7904 7392 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063944.1 protein_id gnl|my_center|LOCUS_03130 8344 7901 gene locus_tag LOCUS_03140 8344 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 8267 8674 gene locus_tag LOCUS_03150 8267 8674 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189308.1 protein_id gnl|my_center|LOCUS_03150 9787 8708 gene locus_tag LOCUS_03160 9787 8708 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064018.1 protein_id gnl|my_center|LOCUS_03160 <10430 9842 gene locus_tag LOCUS_03170 <10430 9842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525080.1:DUF3501 family protein >Feature sequence022 939 217 gene locus_tag LOCUS_03180 939 217 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_03180 1847 936 gene locus_tag LOCUS_03190 1847 936 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_03190 2946 1837 gene locus_tag LOCUS_03200 2946 1837 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_03200 4256 2943 gene locus_tag LOCUS_03210 4256 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 4353 4757 gene locus_tag LOCUS_03220 4353 4757 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_03220 7103 4770 gene locus_tag LOCUS_03230 gene metE 7103 4770 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 protein_id gnl|my_center|LOCUS_03230 7172 8098 gene locus_tag LOCUS_03240 7172 8098 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_03240 8622 8056 gene locus_tag LOCUS_03250 gene cobC 8622 8056 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424906.1 protein_id gnl|my_center|LOCUS_03250 9437 8619 gene locus_tag LOCUS_03260 9437 8619 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718969.1 protein_id gnl|my_center|LOCUS_03260 <10157 9430 gene locus_tag LOCUS_03270 <10157 9430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193123.1:nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase >Feature sequence023 353 156 gene locus_tag LOCUS_03280 353 156 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815736.1 protein_id gnl|my_center|LOCUS_03280 405 1118 gene locus_tag LOCUS_03290 405 1118 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197992.1 protein_id gnl|my_center|LOCUS_03290 1123 1734 gene locus_tag LOCUS_03300 1123 1734 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553808.1 protein_id gnl|my_center|LOCUS_03300 1853 2869 gene locus_tag LOCUS_03310 1853 2869 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526026.1 protein_id gnl|my_center|LOCUS_03310 2917 3783 gene locus_tag LOCUS_03320 gene cyoE 2917 3783 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815729.1 protein_id gnl|my_center|LOCUS_03320 3806 4390 gene locus_tag LOCUS_03330 3806 4390 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064817.1 protein_id gnl|my_center|LOCUS_03330 5074 4412 gene locus_tag LOCUS_03340 5074 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 6075 5173 gene locus_tag LOCUS_03350 gene rpoH 6075 5173 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195278.1 protein_id gnl|my_center|LOCUS_03350 7124 6216 gene locus_tag LOCUS_03360 7124 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 7801 7121 gene locus_tag LOCUS_03370 7801 7121 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815073.1 protein_id gnl|my_center|LOCUS_03370 >Feature sequence024 <1 1771 gene locus_tag LOCUS_03380 <1 1771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928590.1:zinc-dependent metalloprotease 2296 1772 gene locus_tag LOCUS_03390 2296 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 2733 2293 gene locus_tag LOCUS_03400 2733 2293 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 protein_id gnl|my_center|LOCUS_03400 4269 2776 gene locus_tag LOCUS_03410 4269 2776 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821370.1 protein_id gnl|my_center|LOCUS_03410 4293 5489 gene locus_tag LOCUS_03420 gene lptF 4293 5489 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065108.1 protein_id gnl|my_center|LOCUS_03420 5486 6628 gene locus_tag LOCUS_03430 gene lptG 5486 6628 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 protein_id gnl|my_center|LOCUS_03430 7410 7808 gene locus_tag LOCUS_03440 7410 7808 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199454.1 protein_id gnl|my_center|LOCUS_03440 7597 7606 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7814 8503 gene locus_tag LOCUS_03450 7814 8503 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967809.1 protein_id gnl|my_center|LOCUS_03450 8580 9275 gene locus_tag LOCUS_03460 8580 9275 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123659.1 protein_id gnl|my_center|LOCUS_03460 9581 9291 gene locus_tag LOCUS_03470 9581 9291 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257651.1 protein_id gnl|my_center|LOCUS_03470 9708 9717 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence025 <1 545 gene locus_tag LOCUS_03480 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929968.1:formate-dependent phosphoribosylglycinamide formyltransferase 605 1273 gene locus_tag LOCUS_03490 605 1273 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_03490 3225 1291 gene locus_tag LOCUS_03500 3225 1291 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_03500 4188 3274 gene locus_tag LOCUS_03510 4188 3274 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930515.1 protein_id gnl|my_center|LOCUS_03510 4819 4220 gene locus_tag LOCUS_03520 4819 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 6520 4955 gene locus_tag LOCUS_03530 gene guaA 6520 4955 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 protein_id gnl|my_center|LOCUS_03530 8024 6564 gene locus_tag LOCUS_03540 gene guaB 8024 6564 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_03540 8231 8692 gene locus_tag LOCUS_03550 8231 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 9001 8717 gene locus_tag LOCUS_03560 9001 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 9074 9523 gene locus_tag LOCUS_03570 gene smpB 9074 9523 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811754.1 protein_id gnl|my_center|LOCUS_03570 >Feature sequence026 <1 814 gene locus_tag LOCUS_03580 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730671.1:long-chain fatty acid--CoA ligase 1508 816 gene locus_tag LOCUS_03590 gene dnaQ 1508 816 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_03590 4579 1505 gene locus_tag LOCUS_03600 4579 1505 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 protein_id gnl|my_center|LOCUS_03600 5834 4656 gene locus_tag LOCUS_03610 5834 4656 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_03610 6395 5901 gene locus_tag LOCUS_03620 gene rnhA 6395 5901 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 protein_id gnl|my_center|LOCUS_03620 7240 6392 gene locus_tag LOCUS_03630 7240 6392 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_03630 7274 8044 gene locus_tag LOCUS_03640 gene gloB 7274 8044 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087949.1 protein_id gnl|my_center|LOCUS_03640 9304 9116 gene locus_tag LOCUS_03650 9304 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence027 <1 768 gene locus_tag LOCUS_03660 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338328.1:exonuclease domain-containing protein 783 2228 gene locus_tag LOCUS_03670 783 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 4844 2475 gene locus_tag LOCUS_03680 gene ppsA 4844 2475 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193522.1 protein_id gnl|my_center|LOCUS_03680 4910 5752 gene locus_tag LOCUS_03690 4910 5752 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811765.1 protein_id gnl|my_center|LOCUS_03690 7024 5756 gene locus_tag LOCUS_03700 gene cfaB 7024 5756 CDS product C17 cyclopropane fatty acid synthase CfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114148.1 protein_id gnl|my_center|LOCUS_03700 7901 7071 gene locus_tag LOCUS_03710 7901 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 8515 7898 gene locus_tag LOCUS_03720 gene rnhB 8515 7898 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_03720 9236 8502 gene locus_tag LOCUS_03730 9236 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 >Feature sequence028 962 93 gene locus_tag LOCUS_03740 gene ntrB 962 93 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967199.1 protein_id gnl|my_center|LOCUS_03740 2368 974 gene locus_tag LOCUS_03750 2368 974 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 protein_id gnl|my_center|LOCUS_03750 4395 2602 gene locus_tag LOCUS_03760 gene ptsP 4395 2602 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_03760 4658 4392 gene locus_tag LOCUS_03770 4658 4392 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_03770 5077 4655 gene locus_tag LOCUS_03780 5077 4655 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_03780 6057 5074 gene locus_tag LOCUS_03790 gene gshB 6057 5074 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812603.1 protein_id gnl|my_center|LOCUS_03790 7391 6060 gene locus_tag LOCUS_03800 gene gshA 7391 6060 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_03800 9160 7643 gene locus_tag LOCUS_03810 gene amt 9160 7643 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039591.1 protein_id gnl|my_center|LOCUS_03810 >Feature sequence029 377 583 gene locus_tag LOCUS_03820 377 583 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812875.1 protein_id gnl|my_center|LOCUS_03820 1906 659 gene locus_tag LOCUS_03830 gene icd 1906 659 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_03830 2173 2406 gene locus_tag LOCUS_03840 2173 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 2604 2885 gene locus_tag LOCUS_03850 2604 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 3488 2907 gene locus_tag LOCUS_03860 gene sodB 3488 2907 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931119.1 protein_id gnl|my_center|LOCUS_03860 4949 3579 gene locus_tag LOCUS_03870 gene xseA 4949 3579 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064088.1 protein_id gnl|my_center|LOCUS_03870 5042 5656 gene locus_tag LOCUS_03880 5042 5656 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812889.1 protein_id gnl|my_center|LOCUS_03880 5656 6078 gene locus_tag LOCUS_03890 5656 6078 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_03890 6094 7134 gene locus_tag LOCUS_03900 gene lpxK 6094 7134 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064091.1 protein_id gnl|my_center|LOCUS_03900 7141 7326 gene locus_tag LOCUS_03910 7141 7326 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917997.1 protein_id gnl|my_center|LOCUS_03910 7323 8096 gene locus_tag LOCUS_03920 gene kdsB 7323 8096 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_03920 8520 9173 gene locus_tag LOCUS_03930 gene adk 8520 9173 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence030 932 444 gene locus_tag LOCUS_03940 932 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 1481 1017 gene locus_tag LOCUS_03950 1481 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 2830 1583 gene locus_tag LOCUS_03960 2830 1583 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970031.1 protein_id gnl|my_center|LOCUS_03960 3354 2827 gene locus_tag LOCUS_03970 3354 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 4001 3402 gene locus_tag LOCUS_03980 4001 3402 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_03980 5712 4975 gene locus_tag LOCUS_03990 5712 4975 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_03990 7475 5730 gene locus_tag LOCUS_04000 7475 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 8352 7615 gene locus_tag LOCUS_04010 8352 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 8694 8356 gene locus_tag LOCUS_04020 8694 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 >Feature sequence031 228 806 gene locus_tag LOCUS_04030 gene rfbC 228 806 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257099.1 protein_id gnl|my_center|LOCUS_04030 806 2104 gene locus_tag LOCUS_04040 806 2104 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142200.1 protein_id gnl|my_center|LOCUS_04040 2104 2421 gene locus_tag LOCUS_04050 2104 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 3538 3759 gene locus_tag LOCUS_04060 3538 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 4187 3957 gene locus_tag LOCUS_04070 4187 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 4383 4781 gene locus_tag LOCUS_04080 4383 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 5632 4859 gene locus_tag LOCUS_04090 5632 4859 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142182.1 protein_id gnl|my_center|LOCUS_04090 6973 5642 gene locus_tag LOCUS_04100 6973 5642 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064256.1 protein_id gnl|my_center|LOCUS_04100 8100 6973 gene locus_tag LOCUS_04110 8100 6973 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338283.1 protein_id gnl|my_center|LOCUS_04110 8569 8129 gene locus_tag LOCUS_04120 8569 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence032 1257 2114 gene locus_tag LOCUS_04130 1257 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 3181 4353 gene locus_tag LOCUS_04140 3181 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 4350 5783 gene locus_tag LOCUS_04150 4350 5783 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_04150 5780 7501 gene locus_tag LOCUS_04160 5780 7501 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393370.1 protein_id gnl|my_center|LOCUS_04160 <9097 7546 gene locus_tag LOCUS_04170 <9097 7546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026686154.1:non-ribosomal peptide synthetase >Feature sequence033 133 208 gene locus_tag LOCUS_t00040 133 208 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 248 628 gene locus_tag LOCUS_04180 gene secE 248 628 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806884.1 protein_id gnl|my_center|LOCUS_04180 643 1203 gene locus_tag LOCUS_04190 gene nusG 643 1203 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_04190 1293 1724 gene locus_tag LOCUS_04200 gene rplK 1293 1724 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 protein_id gnl|my_center|LOCUS_04200 1724 2419 gene locus_tag LOCUS_04210 gene rplA 1724 2419 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806887.1 protein_id gnl|my_center|LOCUS_04210 2811 3311 gene locus_tag LOCUS_04220 gene rplJ 2811 3311 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_04220 3370 3750 gene locus_tag LOCUS_04230 gene rplL 3370 3750 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_04230 3959 8062 gene locus_tag LOCUS_04240 gene rpoB 3959 8062 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929573.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence034 <1 666 gene locus_tag LOCUS_04250 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086299.1:thiosulfohydrolase SoxB 704 1243 gene locus_tag LOCUS_04260 704 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 1696 2526 gene locus_tag LOCUS_04270 1696 2526 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929635.1 protein_id gnl|my_center|LOCUS_04270 2616 2900 gene locus_tag LOCUS_04280 2616 2900 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807023.1 protein_id gnl|my_center|LOCUS_04280 2965 3636 gene locus_tag LOCUS_04290 2965 3636 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_04290 3670 5481 gene locus_tag LOCUS_04300 gene aspS 3670 5481 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_04300 5681 6262 gene locus_tag LOCUS_04310 5681 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 6311 7252 gene locus_tag LOCUS_04320 6311 7252 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_04320 7281 7766 gene locus_tag LOCUS_04330 gene nudB 7281 7766 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence035 1038 40 gene locus_tag LOCUS_04340 gene thiL 1038 40 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194308.1 protein_id gnl|my_center|LOCUS_04340 1433 1035 gene locus_tag LOCUS_04350 gene nusB 1433 1035 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808599.1 protein_id gnl|my_center|LOCUS_04350 1950 1468 gene locus_tag LOCUS_04360 gene ribH 1950 1468 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_04360 3124 1952 gene locus_tag LOCUS_04370 gene ribBA 3124 1952 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186115.1 protein_id gnl|my_center|LOCUS_04370 3734 3126 gene locus_tag LOCUS_04380 3734 3126 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_04380 4837 3734 gene locus_tag LOCUS_04390 gene ribD 4837 3734 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527563.1 protein_id gnl|my_center|LOCUS_04390 5382 4933 gene locus_tag LOCUS_04400 5382 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 6005 5538 gene locus_tag LOCUS_04410 gene nrdR 6005 5538 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185666.1 protein_id gnl|my_center|LOCUS_04410 7301 6042 gene locus_tag LOCUS_04420 7301 6042 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_04420 8752 7445 gene locus_tag LOCUS_04430 8752 7445 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400619.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence036 <1 1996 gene locus_tag LOCUS_04440 <1 1996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104232144.1:tetratricopeptide repeat protein 1983 2720 gene locus_tag LOCUS_04450 1983 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 2717 3001 gene locus_tag LOCUS_04460 2717 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3102 3767 gene locus_tag LOCUS_04470 3102 3767 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245835.1 protein_id gnl|my_center|LOCUS_04470 3770 4276 gene locus_tag LOCUS_04480 3770 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4273 4767 gene locus_tag LOCUS_04490 4273 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 4767 5831 gene locus_tag LOCUS_04500 4767 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6349 5924 gene locus_tag LOCUS_04510 6349 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 7426 6446 gene locus_tag LOCUS_04520 7426 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 8975 7431 gene locus_tag LOCUS_04530 8975 7431 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623945.1 protein_id gnl|my_center|LOCUS_04530 >Feature sequence037 <1 928 gene locus_tag LOCUS_04540 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195830.1:F0F1 ATP synthase subunit alpha 948 1829 gene locus_tag LOCUS_04550 gene atpG 948 1829 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_04550 1854 3278 gene locus_tag LOCUS_04560 gene atpD 1854 3278 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064897.1 protein_id gnl|my_center|LOCUS_04560 3348 3761 gene locus_tag LOCUS_04570 3348 3761 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815341.1 protein_id gnl|my_center|LOCUS_04570 3920 6016 gene locus_tag LOCUS_04580 3920 6016 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064497.1 protein_id gnl|my_center|LOCUS_04580 6189 6356 gene locus_tag LOCUS_04590 6189 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 6465 7556 gene locus_tag LOCUS_04600 gene hemE 6465 7556 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815337.1 protein_id gnl|my_center|LOCUS_04600 >Feature sequence038 1359 493 gene locus_tag LOCUS_04610 gene accD 1359 493 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_04610 2195 1356 gene locus_tag LOCUS_04620 gene trpA 2195 1356 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_04620 3415 2195 gene locus_tag LOCUS_04630 gene trpB 3415 2195 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_04630 4055 3420 gene locus_tag LOCUS_04640 4055 3420 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_04640 4837 4052 gene locus_tag LOCUS_04650 gene truA 4837 4052 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 protein_id gnl|my_center|LOCUS_04650 7735 4892 gene locus_tag LOCUS_04660 7735 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 <8824 7955 gene locus_tag LOCUS_04670 <8824 7955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188178.1:aspartate-semialdehyde dehydrogenase >Feature sequence039 426 205 gene locus_tag LOCUS_04680 426 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 430 1215 gene locus_tag LOCUS_04690 430 1215 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124383.1 protein_id gnl|my_center|LOCUS_04690 1215 2231 gene locus_tag LOCUS_04700 1215 2231 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268559.1 protein_id gnl|my_center|LOCUS_04700 2716 4380 gene locus_tag LOCUS_04710 2716 4380 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_04710 4721 5704 gene locus_tag LOCUS_04720 4721 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 7026 5713 gene locus_tag LOCUS_04730 7026 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 8380 7172 gene locus_tag LOCUS_04740 gene wecA 8380 7172 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368885.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence040 892 656 gene locus_tag LOCUS_04750 892 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1214 1065 gene locus_tag LOCUS_04760 1214 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1482 1177 gene locus_tag LOCUS_04770 1482 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 1941 1504 gene locus_tag LOCUS_04780 1941 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 2303 1977 gene locus_tag LOCUS_04790 2303 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2670 2200 gene locus_tag LOCUS_04800 2670 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 3074 2670 gene locus_tag LOCUS_04810 3074 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 3726 3088 gene locus_tag LOCUS_04820 3726 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 4106 3723 gene locus_tag LOCUS_04830 4106 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 4516 4103 gene locus_tag LOCUS_04840 4516 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 5312 4584 gene locus_tag LOCUS_04850 5312 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 5894 5346 gene locus_tag LOCUS_04860 5894 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 6936 5899 gene locus_tag LOCUS_04870 6936 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 7334 6933 gene locus_tag LOCUS_04880 7334 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 >Feature sequence041 1449 811 gene locus_tag LOCUS_04890 1449 811 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_04890 1652 2263 gene locus_tag LOCUS_04900 gene yihA 1652 2263 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521909.1 protein_id gnl|my_center|LOCUS_04900 2384 3400 gene locus_tag LOCUS_04910 gene hemB 2384 3400 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521908.1 protein_id gnl|my_center|LOCUS_04910 3407 3838 gene locus_tag LOCUS_04920 3407 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 3778 4527 gene locus_tag LOCUS_04930 3778 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04930 5338 4547 gene locus_tag LOCUS_04940 5338 4547 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809629.1 protein_id gnl|my_center|LOCUS_04940 6473 5427 gene locus_tag LOCUS_04950 6473 5427 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_04950 7222 6470 gene locus_tag LOCUS_04960 7222 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 >Feature sequence042 716 378 gene locus_tag LOCUS_04970 716 378 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928906.1 protein_id gnl|my_center|LOCUS_04970 2478 760 gene locus_tag LOCUS_04980 gene rpsA 2478 760 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_04980 3257 2595 gene locus_tag LOCUS_04990 gene cmk 3257 2595 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813361.1 protein_id gnl|my_center|LOCUS_04990 4570 3269 gene locus_tag LOCUS_05000 4570 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05000 5427 4567 gene locus_tag LOCUS_05010 5427 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05010 6548 5424 gene locus_tag LOCUS_05020 gene hisC 6548 5424 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_05020 7649 6579 gene locus_tag LOCUS_05030 gene pheA 7649 6579 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813370.1 protein_id gnl|my_center|LOCUS_05030 8137 7649 gene locus_tag LOCUS_05040 8137 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 >Feature sequence043 83 1378 gene locus_tag LOCUS_05050 83 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 1381 2112 gene locus_tag LOCUS_05060 1381 2112 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064314.1 protein_id gnl|my_center|LOCUS_05060 2701 2300 gene locus_tag LOCUS_05070 2701 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3075 2701 gene locus_tag LOCUS_05080 3075 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4342 3050 gene locus_tag LOCUS_05090 4342 3050 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064316.1 protein_id gnl|my_center|LOCUS_05090 6650 4350 gene locus_tag LOCUS_05100 6650 4350 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 protein_id gnl|my_center|LOCUS_05100 6743 7906 gene locus_tag LOCUS_05110 6743 7906 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194932.1 protein_id gnl|my_center|LOCUS_05110 >Feature sequence044 1926 988 gene locus_tag LOCUS_05120 1926 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 4879 1919 gene locus_tag LOCUS_05130 4879 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 6461 4872 gene locus_tag LOCUS_05140 6461 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 7672 6461 gene locus_tag LOCUS_05150 7672 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 >Feature sequence045 1490 750 gene locus_tag LOCUS_05160 1490 750 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_05160 2071 1487 gene locus_tag LOCUS_05170 2071 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194143.1 protein_id gnl|my_center|LOCUS_05170 3459 2068 gene locus_tag LOCUS_05180 gene mpl 3459 2068 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_05180 3585 4247 gene locus_tag LOCUS_05190 3585 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 4244 4783 gene locus_tag LOCUS_05200 4244 4783 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_05200 4904 5347 gene locus_tag LOCUS_05210 gene aroQ 4904 5347 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814953.1 protein_id gnl|my_center|LOCUS_05210 5371 5841 gene locus_tag LOCUS_05220 gene accB 5371 5841 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_05220 5846 7207 gene locus_tag LOCUS_05230 gene accC 5846 7207 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_05230 7218 8108 gene locus_tag LOCUS_05240 gene prmA 7218 8108 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194259.1 protein_id gnl|my_center|LOCUS_05240 >Feature sequence046 436 999 gene locus_tag LOCUS_05250 436 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 1007 2134 gene locus_tag LOCUS_05260 1007 2134 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_05260 2664 2152 gene locus_tag LOCUS_05270 2664 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2897 4177 gene locus_tag LOCUS_05280 2897 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05280 3782 3791 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4111 4851 gene locus_tag LOCUS_05290 4111 4851 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_05290 5089 5014 gene locus_tag LOCUS_t00050 5089 5014 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5404 6609 gene locus_tag LOCUS_05300 5404 6609 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527797.1 protein_id gnl|my_center|LOCUS_05300 6613 7365 gene locus_tag LOCUS_05310 gene dsbC 6613 7365 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064891.1 protein_id gnl|my_center|LOCUS_05310 <8062 7397 gene locus_tag LOCUS_05320 <8062 7397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004549948.1:MltA domain-containing protein >Feature sequence047 1796 675 gene locus_tag LOCUS_05330 1796 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 2924 2013 gene locus_tag LOCUS_05340 2924 2013 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247635.1 protein_id gnl|my_center|LOCUS_05340 3242 3682 gene locus_tag LOCUS_05350 3242 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3686 4156 gene locus_tag LOCUS_05360 gene trmL 3686 4156 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185046.1 protein_id gnl|my_center|LOCUS_05360 4764 4168 gene locus_tag LOCUS_05370 4764 4168 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 protein_id gnl|my_center|LOCUS_05370 5756 4761 gene locus_tag LOCUS_05380 5756 4761 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_05380 6257 5766 gene locus_tag LOCUS_05390 gene secB 6257 5766 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198004.1 protein_id gnl|my_center|LOCUS_05390 6584 6315 gene locus_tag LOCUS_05400 gene grxC 6584 6315 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_05400 7003 6596 gene locus_tag LOCUS_05410 7003 6596 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929909.1 protein_id gnl|my_center|LOCUS_05410 7084 7842 gene locus_tag LOCUS_05420 gene gpmA 7084 7842 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807430.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence048 <1 867 gene locus_tag LOCUS_05430 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931626.1:cytochrome c oxidase subunit I 898 1035 gene locus_tag LOCUS_05440 898 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1032 1616 gene locus_tag LOCUS_05450 1032 1616 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 protein_id gnl|my_center|LOCUS_05450 1619 1840 gene locus_tag LOCUS_05460 1619 1840 CDS product DUF2970 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185261.1 protein_id gnl|my_center|LOCUS_05460 1853 2716 gene locus_tag LOCUS_05470 1853 2716 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815738.1 protein_id gnl|my_center|LOCUS_05470 4385 2793 gene locus_tag LOCUS_05480 4385 2793 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814858.1 protein_id gnl|my_center|LOCUS_05480 5674 4382 gene locus_tag LOCUS_05490 5674 4382 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814861.1 protein_id gnl|my_center|LOCUS_05490 7652 5700 gene locus_tag LOCUS_05500 7652 5700 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814863.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence049 1055 2797 gene locus_tag LOCUS_05510 1055 2797 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258395.1 protein_id gnl|my_center|LOCUS_05510 2993 4108 gene locus_tag LOCUS_05520 gene ald 2993 4108 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_05520 4450 4118 gene locus_tag LOCUS_05530 4450 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05530 5553 4477 gene locus_tag LOCUS_05540 5553 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05540 4493 4502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7196 6525 gene locus_tag LOCUS_05550 7196 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence050 2800 899 gene locus_tag LOCUS_05560 gene ftsH 2800 899 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809623.1 protein_id gnl|my_center|LOCUS_05560 3557 2874 gene locus_tag LOCUS_05570 3557 2874 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809621.1 protein_id gnl|my_center|LOCUS_05570 3578 4000 gene locus_tag LOCUS_05580 3578 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05580 4464 3991 gene locus_tag LOCUS_05590 gene greA 4464 3991 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 protein_id gnl|my_center|LOCUS_05590 <7638 4553 gene locus_tag LOCUS_05600 <7638 4553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193866.1:carbamoyl-phosphate synthase large subunit >Feature sequence051 2016 712 gene locus_tag LOCUS_05610 gene miaB 2016 712 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190165.1 protein_id gnl|my_center|LOCUS_05610 2441 2106 gene locus_tag LOCUS_05620 2441 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2538 2462 gene locus_tag LOCUS_t00060 2538 2462 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4119 2563 gene locus_tag LOCUS_05630 4119 2563 CDS product sensor histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 protein_id gnl|my_center|LOCUS_05630 4910 4203 gene locus_tag LOCUS_05640 4910 4203 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812762.1 protein_id gnl|my_center|LOCUS_05640 5112 6158 gene locus_tag LOCUS_05650 gene recA 5112 6158 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812760.1 protein_id gnl|my_center|LOCUS_05650 6169 6621 gene locus_tag LOCUS_05660 6169 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence052 1255 407 gene locus_tag LOCUS_05670 1255 407 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812407.1 protein_id gnl|my_center|LOCUS_05670 2149 1274 gene locus_tag LOCUS_05680 2149 1274 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_05680 2533 2931 gene locus_tag LOCUS_05690 2533 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05690 3256 3411 gene locus_tag LOCUS_05700 3256 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3810 3385 gene locus_tag LOCUS_05710 3810 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 4228 3833 gene locus_tag LOCUS_05720 4228 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 5217 4399 gene locus_tag LOCUS_05730 5217 4399 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813551.1 protein_id gnl|my_center|LOCUS_05730 5313 6305 gene locus_tag LOCUS_05740 5313 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 6452 7357 gene locus_tag LOCUS_05750 gene hslO 6452 7357 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191092.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence053 <1 1154 gene locus_tag LOCUS_05760 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527208.1:phosphoribosylformylglycinamidine synthase 1249 1755 gene locus_tag LOCUS_05770 1249 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 2577 1810 gene locus_tag LOCUS_05780 2577 1810 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527206.1 protein_id gnl|my_center|LOCUS_05780 2887 2582 gene locus_tag LOCUS_05790 2887 2582 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_05790 3506 2880 gene locus_tag LOCUS_05800 3506 2880 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813872.1 protein_id gnl|my_center|LOCUS_05800 3623 5254 gene locus_tag LOCUS_05810 3623 5254 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_05810 5361 6620 gene locus_tag LOCUS_05820 5361 6620 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_05820 >Feature sequence054 750 325 gene locus_tag LOCUS_05830 gene ndk 750 325 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_05830 2207 852 gene locus_tag LOCUS_05840 gene rlmD 2207 852 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039993.1 protein_id gnl|my_center|LOCUS_05840 2983 2204 gene locus_tag LOCUS_05850 2983 2204 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_05850 3876 2980 gene locus_tag LOCUS_05860 3876 2980 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039995.1 protein_id gnl|my_center|LOCUS_05860 4541 3873 gene locus_tag LOCUS_05870 4541 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 5383 4538 gene locus_tag LOCUS_05880 gene surE 5383 4538 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_05880 5411 5335 gene locus_tag LOCUS_t00070 5411 5335 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5803 5444 gene locus_tag LOCUS_05890 5803 5444 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526841.1 protein_id gnl|my_center|LOCUS_05890 6242 5859 gene locus_tag LOCUS_05900 6242 5859 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812826.1 protein_id gnl|my_center|LOCUS_05900 <7526 6246 gene locus_tag LOCUS_05910 <7526 6246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039594.1:phenylalanine--tRNA ligase subunit beta >Feature sequence055 245 1000 gene locus_tag LOCUS_05920 245 1000 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085532.1 protein_id gnl|my_center|LOCUS_05920 1025 1999 gene locus_tag LOCUS_05930 1025 1999 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064098.1 protein_id gnl|my_center|LOCUS_05930 1996 3426 gene locus_tag LOCUS_05940 gene tcuA 1996 3426 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813511.1 protein_id gnl|my_center|LOCUS_05940 3423 4538 gene locus_tag LOCUS_05950 gene tcuB 3423 4538 CDS product tricarballylate utilization 4Fe-4S protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813507.1 protein_id gnl|my_center|LOCUS_05950 5210 4572 gene locus_tag LOCUS_05960 5210 4572 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194517.1 protein_id gnl|my_center|LOCUS_05960 5908 5207 gene locus_tag LOCUS_05970 5908 5207 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552494.1 protein_id gnl|my_center|LOCUS_05970 6555 6139 gene locus_tag LOCUS_05980 6555 6139 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090571.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence056 2 385 gene locus_tag LOCUS_05990 2 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 1392 397 gene locus_tag LOCUS_06000 1392 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2035 1361 gene locus_tag LOCUS_06010 2035 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 2901 2032 gene locus_tag LOCUS_06020 2901 2032 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_06020 3707 2907 gene locus_tag LOCUS_06030 gene birA 3707 2907 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039011.1 protein_id gnl|my_center|LOCUS_06030 3834 4970 gene locus_tag LOCUS_06040 3834 4970 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038743784.1 protein_id gnl|my_center|LOCUS_06040 4967 5275 gene locus_tag LOCUS_06050 4967 5275 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_06050 5287 5946 gene locus_tag LOCUS_06060 5287 5946 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188999.1 protein_id gnl|my_center|LOCUS_06060 6024 6527 gene locus_tag LOCUS_06070 6024 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 6561 7427 gene locus_tag LOCUS_06080 6561 7427 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence057 446 141 gene locus_tag LOCUS_06090 446 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 1407 466 gene locus_tag LOCUS_06100 gene cas1 1407 466 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_06100 4757 1404 gene locus_tag LOCUS_06110 4757 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5902 5081 gene locus_tag LOCUS_06120 5902 5081 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936644.1 protein_id gnl|my_center|LOCUS_06120 6327 6109 gene locus_tag LOCUS_06130 6327 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6831 6355 gene locus_tag LOCUS_06140 6831 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06140 6995 6726 gene locus_tag LOCUS_06150 6995 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06150 >Feature sequence058 511 1113 gene locus_tag LOCUS_06160 gene wrbA 511 1113 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193704.1 protein_id gnl|my_center|LOCUS_06160 1492 2913 gene locus_tag LOCUS_06170 1492 2913 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808467.1 protein_id gnl|my_center|LOCUS_06170 2960 3397 gene locus_tag LOCUS_06180 2960 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3397 3837 gene locus_tag LOCUS_06190 3397 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 4827 3853 gene locus_tag LOCUS_06200 gene dusA 4827 3853 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812705.1 protein_id gnl|my_center|LOCUS_06200 5036 4824 gene locus_tag LOCUS_06210 5036 4824 CDS product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 protein_id gnl|my_center|LOCUS_06210 5828 5046 gene locus_tag LOCUS_06220 5828 5046 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967317.1 protein_id gnl|my_center|LOCUS_06220 5924 6346 gene locus_tag LOCUS_06230 5924 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525432.1 protein_id gnl|my_center|LOCUS_06230 6343 7203 gene locus_tag LOCUS_06240 6343 7203 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence059 234 243 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2282 1533 gene locus_tag LOCUS_06250 2282 1533 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929763.1 protein_id gnl|my_center|LOCUS_06250 3526 2282 gene locus_tag LOCUS_06260 gene gspF 3526 2282 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 protein_id gnl|my_center|LOCUS_06260 5039 3606 gene locus_tag LOCUS_06270 gene gspE 5039 3606 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533498.1 protein_id gnl|my_center|LOCUS_06270 <7213 5055 gene locus_tag LOCUS_06280 <7213 5055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009315212.1:type II secretion system secretin GspD >Feature sequence060 2220 232 gene locus_tag LOCUS_06290 2220 232 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_06290 3192 2356 gene locus_tag LOCUS_06300 gene mutM 3192 2356 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925978.1 protein_id gnl|my_center|LOCUS_06300 3363 5078 gene locus_tag LOCUS_06310 3363 5078 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_06310 5082 5678 gene locus_tag LOCUS_06320 gene lolB 5082 5678 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818921.1 protein_id gnl|my_center|LOCUS_06320 5675 6532 gene locus_tag LOCUS_06330 gene ispE 5675 6532 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195241.1 protein_id gnl|my_center|LOCUS_06330 6592 6668 gene locus_tag LOCUS_t00080 6592 6668 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence061 1213 725 gene locus_tag LOCUS_06340 1213 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 2484 1219 gene locus_tag LOCUS_06350 2484 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3449 2481 gene locus_tag LOCUS_06360 gene gspK 3449 2481 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204164.1 protein_id gnl|my_center|LOCUS_06360 4062 3451 gene locus_tag LOCUS_06370 4062 3451 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185018.1 protein_id gnl|my_center|LOCUS_06370 4460 4059 gene locus_tag LOCUS_06380 4460 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 4929 4426 gene locus_tag LOCUS_06390 4929 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 5419 4958 gene locus_tag LOCUS_06400 gene gspG 5419 4958 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_06400 5566 6285 gene locus_tag LOCUS_06410 5566 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 6410 6682 gene locus_tag LOCUS_06420 6410 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 6802 6887 gene locus_tag LOCUS_t00090 6802 6887 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6990 7063 gene locus_tag LOCUS_t00100 6990 7063 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence062 369 142 gene locus_tag LOCUS_06430 gene tusA 369 142 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_06430 564 926 gene locus_tag LOCUS_06440 564 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 923 1975 gene locus_tag LOCUS_06450 923 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 3369 1969 gene locus_tag LOCUS_06460 gene cysG 3369 1969 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_06460 4066 3440 gene locus_tag LOCUS_06470 4066 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 5140 4091 gene locus_tag LOCUS_06480 5140 4091 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_06480 <7087 5415 gene locus_tag LOCUS_06490 <7087 5415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404965.1:sulfate permease >Feature sequence063 2 523 gene locus_tag LOCUS_06500 2 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 545 1192 gene locus_tag LOCUS_06510 545 1192 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_06510 1200 1775 gene locus_tag LOCUS_06520 1200 1775 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_06520 1772 3934 gene locus_tag LOCUS_06530 gene pilQ 1772 3934 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_06530 3945 4556 gene locus_tag LOCUS_06540 3945 4556 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806947.1 protein_id gnl|my_center|LOCUS_06540 4577 5668 gene locus_tag LOCUS_06550 gene aroB 4577 5668 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_06550 5665 6798 gene locus_tag LOCUS_06560 5665 6798 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521919.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence064 <1 925 gene locus_tag LOCUS_06570 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258947.1:EamA family transporter 1668 2366 gene locus_tag LOCUS_06580 1668 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 2957 3214 gene locus_tag LOCUS_06590 2957 3214 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_06590 4443 3454 gene locus_tag LOCUS_06600 4443 3454 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203830.1 protein_id gnl|my_center|LOCUS_06600 5849 4440 gene locus_tag LOCUS_06610 5849 4440 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527476.1 protein_id gnl|my_center|LOCUS_06610 <7026 5846 gene locus_tag LOCUS_06620 <7026 5846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393453.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence065 <1 3288 gene locus_tag LOCUS_06630 <1 3288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104355916.1:PAS domain S-box protein 3313 3921 gene locus_tag LOCUS_06640 3313 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 3958 4368 gene locus_tag LOCUS_06650 3958 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 5774 4365 gene locus_tag LOCUS_06660 5774 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence066 663 2345 gene locus_tag LOCUS_06670 663 2345 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205307.1 protein_id gnl|my_center|LOCUS_06670 3360 2374 gene locus_tag LOCUS_06680 3360 2374 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194986.1 protein_id gnl|my_center|LOCUS_06680 4411 3620 gene locus_tag LOCUS_06690 4411 3620 CDS product DUF3025 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527732.1 protein_id gnl|my_center|LOCUS_06690 5451 4393 gene locus_tag LOCUS_06700 gene pyrC 5451 4393 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_06700 6388 5720 gene locus_tag LOCUS_06710 6388 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 7005 6568 gene locus_tag LOCUS_06720 7005 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 6730 6739 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence067 552 1475 gene locus_tag LOCUS_06730 552 1475 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_06730 1561 2568 gene locus_tag LOCUS_06740 1561 2568 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_06740 2570 4636 gene locus_tag LOCUS_06750 gene tgpA 2570 4636 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_06750 4633 5637 gene locus_tag LOCUS_06760 4633 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 6288 5644 gene locus_tag LOCUS_06770 gene maiA 6288 5644 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_06770 <6902 6293 gene locus_tag LOCUS_06780 <6902 6293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812141.1:TRAP transporter large permease >Feature sequence068 561 172 gene locus_tag LOCUS_06790 561 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06790 1011 817 gene locus_tag LOCUS_06800 1011 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2254 1292 gene locus_tag LOCUS_06810 2254 1292 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 protein_id gnl|my_center|LOCUS_06810 2652 2251 gene locus_tag LOCUS_06820 2652 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247553.1 protein_id gnl|my_center|LOCUS_06820 3995 2649 gene locus_tag LOCUS_06830 3995 2649 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063958.1 protein_id gnl|my_center|LOCUS_06830 4077 4994 gene locus_tag LOCUS_06840 4077 4994 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818676.1 protein_id gnl|my_center|LOCUS_06840 5318 6160 gene locus_tag LOCUS_06850 5318 6160 CDS product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194630.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence069 732 902 gene locus_tag LOCUS_06860 732 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 899 1279 gene locus_tag LOCUS_06870 899 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 1346 1618 gene locus_tag LOCUS_06880 1346 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1686 1829 gene locus_tag LOCUS_06890 1686 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 1826 2875 gene locus_tag LOCUS_06900 1826 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2787 3002 gene locus_tag LOCUS_06910 2787 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3900 4292 gene locus_tag LOCUS_06920 3900 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 4453 4716 gene locus_tag LOCUS_06930 4453 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 4733 5131 gene locus_tag LOCUS_06940 4733 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165899999.1 protein_id gnl|my_center|LOCUS_06940 5189 5470 gene locus_tag LOCUS_06950 5189 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 5472 5894 gene locus_tag LOCUS_06960 5472 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 6278 5982 gene locus_tag LOCUS_06970 6278 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 6536 6294 gene locus_tag LOCUS_06980 6536 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence070 3 179 gene locus_tag LOCUS_06990 3 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 897 187 gene locus_tag LOCUS_07000 897 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2008 1046 gene locus_tag LOCUS_07010 gene miaA 2008 1046 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814337.1 protein_id gnl|my_center|LOCUS_07010 3203 1998 gene locus_tag LOCUS_07020 3203 1998 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 protein_id gnl|my_center|LOCUS_07020 4963 3215 gene locus_tag LOCUS_07030 gene mutL 4963 3215 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 protein_id gnl|my_center|LOCUS_07030 5095 5778 gene locus_tag LOCUS_07040 5095 5778 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194375.1 protein_id gnl|my_center|LOCUS_07040 <6830 5806 gene locus_tag LOCUS_07050 <6830 5806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_019247543.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence071 1307 1672 gene locus_tag LOCUS_07060 1307 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 1647 1781 gene locus_tag LOCUS_07070 1647 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1798 2028 gene locus_tag LOCUS_07080 1798 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2062 2256 gene locus_tag LOCUS_07090 2062 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 2291 2500 gene locus_tag LOCUS_07100 2291 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 2552 3040 gene locus_tag LOCUS_07110 2552 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2949 3170 gene locus_tag LOCUS_07120 2949 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 3163 3666 gene locus_tag LOCUS_07130 3163 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 4941 5552 gene locus_tag LOCUS_07140 4941 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 5586 6404 gene locus_tag LOCUS_07150 5586 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence072 <1 1079 gene locus_tag LOCUS_07160 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115063.1:hybrid sensor histidine kinase/response regulator 1082 2119 gene locus_tag LOCUS_07170 1082 2119 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_07170 2402 2411 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2463 3419 gene locus_tag LOCUS_07180 2463 3419 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_07180 3525 6431 gene locus_tag LOCUS_07190 3525 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 >Feature sequence073 101 1579 gene locus_tag LOCUS_07200 101 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 2107 1586 gene locus_tag LOCUS_07210 2107 1586 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_07210 2128 3267 gene locus_tag LOCUS_07220 2128 3267 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535743.1 protein_id gnl|my_center|LOCUS_07220 3264 3767 gene locus_tag LOCUS_07230 3264 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3857 4096 gene locus_tag LOCUS_07240 3857 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 5311 4196 gene locus_tag LOCUS_07250 gene bamC 5311 4196 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930437.1 protein_id gnl|my_center|LOCUS_07250 6218 5325 gene locus_tag LOCUS_07260 gene dapA 6218 5325 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191516.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence074 2057 498 gene locus_tag LOCUS_07270 gene xrtA 2057 498 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_07270 3337 2054 gene locus_tag LOCUS_07280 3337 2054 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_07280 4411 3344 gene locus_tag LOCUS_07290 4411 3344 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_07290 5264 4413 gene locus_tag LOCUS_07300 5264 4413 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_07300 6421 5261 gene locus_tag LOCUS_07310 gene wecB 6421 5261 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence075 3 722 gene locus_tag LOCUS_07320 3 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 1122 1421 gene locus_tag LOCUS_07330 1122 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1430 2704 gene locus_tag LOCUS_07340 1430 2704 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_07340 3332 2721 gene locus_tag LOCUS_07350 3332 2721 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074258.1 protein_id gnl|my_center|LOCUS_07350 3917 3471 gene locus_tag LOCUS_07360 gene dut 3917 3471 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812576.1 protein_id gnl|my_center|LOCUS_07360 5125 3914 gene locus_tag LOCUS_07370 gene coaBC 5125 3914 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928305.1 protein_id gnl|my_center|LOCUS_07370 5629 5129 gene locus_tag LOCUS_07380 gene lspA 5629 5129 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_07380 6604 5630 gene locus_tag LOCUS_07390 6604 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence076 792 406 gene locus_tag LOCUS_07400 792 406 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880209.1 protein_id gnl|my_center|LOCUS_07400 1290 820 gene locus_tag LOCUS_07410 gene gcvH 1290 820 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259335.1 protein_id gnl|my_center|LOCUS_07410 1399 1304 gene locus_tag LOCUS_t00110 1399 1304 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 3310 1409 gene locus_tag LOCUS_07420 gene selB 3310 1409 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187519.1 protein_id gnl|my_center|LOCUS_07420 4743 3307 gene locus_tag LOCUS_07430 gene selA 4743 3307 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187099.1 protein_id gnl|my_center|LOCUS_07430 5672 4746 gene locus_tag LOCUS_07440 gene fdhE 5672 4746 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112347.1 protein_id gnl|my_center|LOCUS_07440 6382 5741 gene locus_tag LOCUS_07450 6382 5741 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551972.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence077 1114 278 gene locus_tag LOCUS_07460 1114 278 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821329.1 protein_id gnl|my_center|LOCUS_07460 1169 3301 gene locus_tag LOCUS_07470 1169 3301 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065079.1 protein_id gnl|my_center|LOCUS_07470 3341 3417 gene locus_tag LOCUS_t00120 3341 3417 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3549 5474 gene locus_tag LOCUS_07480 gene thrS 3549 5474 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812608.1 protein_id gnl|my_center|LOCUS_07480 5553 6023 gene locus_tag LOCUS_07490 gene infC 5553 6023 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446215.1 protein_id gnl|my_center|LOCUS_07490 6141 6338 gene locus_tag LOCUS_07500 gene rpmI 6141 6338 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191477.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence078 <1 584 gene locus_tag LOCUS_07510 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811410.1:DsbE family thiol:disulfide interchange protein 581 1054 gene locus_tag LOCUS_07520 581 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1051 2268 gene locus_tag LOCUS_07530 gene ccmI 1051 2268 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_07530 2398 2970 gene locus_tag LOCUS_07540 2398 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 4520 2991 gene locus_tag LOCUS_07550 4520 2991 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550927.1 protein_id gnl|my_center|LOCUS_07550 4765 5670 gene locus_tag LOCUS_07560 4765 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 6028 5762 gene locus_tag LOCUS_07570 6028 5762 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931105.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence079 443 201 gene locus_tag LOCUS_07580 443 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 930 1238 gene locus_tag LOCUS_07590 930 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 1235 2908 gene locus_tag LOCUS_07600 gene pgi 1235 2908 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_07600 2955 6401 gene locus_tag LOCUS_07610 gene dnaE 2955 6401 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813231.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence080 <1 955 gene locus_tag LOCUS_07620 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000875215.1:GDP-perosamine synthase RfbE/PerA 957 2195 gene locus_tag LOCUS_07630 957 2195 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088747.1 protein_id gnl|my_center|LOCUS_07630 2192 2887 gene locus_tag LOCUS_07640 2192 2887 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096013.1 protein_id gnl|my_center|LOCUS_07640 2884 3522 gene locus_tag LOCUS_07650 2884 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3507 4712 gene locus_tag LOCUS_07660 3507 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence081 1012 584 gene locus_tag LOCUS_07670 gene queF 1012 584 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_07670 1089 4643 gene locus_tag LOCUS_07680 gene smc 1089 4643 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205139.1 protein_id gnl|my_center|LOCUS_07680 4654 5694 gene locus_tag LOCUS_07690 4654 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence082 <1 516 gene locus_tag LOCUS_07700 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807187.1:lysophospholipid acyltransferase family protein 513 1394 gene locus_tag LOCUS_07710 513 1394 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807185.1 protein_id gnl|my_center|LOCUS_07710 1631 2551 gene locus_tag LOCUS_07720 gene dapF 1631 2551 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199067.1 protein_id gnl|my_center|LOCUS_07720 2557 3219 gene locus_tag LOCUS_07730 2557 3219 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199066.1 protein_id gnl|my_center|LOCUS_07730 3221 4195 gene locus_tag LOCUS_07740 gene xerC 3221 4195 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038710.1 protein_id gnl|my_center|LOCUS_07740 4192 5400 gene locus_tag LOCUS_07750 gene rlmI 4192 5400 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence083 127 2229 gene locus_tag LOCUS_07760 127 2229 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521274.1 protein_id gnl|my_center|LOCUS_07760 2236 4071 gene locus_tag LOCUS_07770 2236 4071 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206873.1 protein_id gnl|my_center|LOCUS_07770 4151 4930 gene locus_tag LOCUS_07780 4151 4930 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 protein_id gnl|my_center|LOCUS_07780 4941 5333 gene locus_tag LOCUS_07790 4941 5333 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193935.1 protein_id gnl|my_center|LOCUS_07790 5342 6337 gene locus_tag LOCUS_07800 5342 6337 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192815.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence084 592 519 gene locus_tag LOCUS_t00130 592 519 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 737 662 gene locus_tag LOCUS_t00140 737 662 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1406 786 gene locus_tag LOCUS_07810 gene pgsA 1406 786 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 protein_id gnl|my_center|LOCUS_07810 3243 1357 gene locus_tag LOCUS_07820 gene uvrC 3243 1357 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449735.1 protein_id gnl|my_center|LOCUS_07820 3349 3915 gene locus_tag LOCUS_07830 gene efp 3349 3915 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596051.1 protein_id gnl|my_center|LOCUS_07830 4943 3912 gene locus_tag LOCUS_07840 gene nagZ 4943 3912 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_07840 5341 4943 gene locus_tag LOCUS_07850 gene acpS 5341 4943 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191194.1 protein_id gnl|my_center|LOCUS_07850 6087 5338 gene locus_tag LOCUS_07860 6087 5338 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence085 <1 1226 gene locus_tag LOCUS_07870 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552444.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB 1877 1236 gene locus_tag LOCUS_07880 1877 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2544 1867 gene locus_tag LOCUS_07890 gene pyrE 2544 1867 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929769.1 protein_id gnl|my_center|LOCUS_07890 2566 3342 gene locus_tag LOCUS_07900 2566 3342 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_07900 4153 3344 gene locus_tag LOCUS_07910 4153 3344 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930369.1 protein_id gnl|my_center|LOCUS_07910 4199 5593 gene locus_tag LOCUS_07920 4199 5593 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_07920 6204 5572 gene locus_tag LOCUS_07930 gene metW 6204 5572 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817748.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence086 1227 3908 gene locus_tag LOCUS_07940 1227 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4546 3905 gene locus_tag LOCUS_07950 4546 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 5376 4786 gene locus_tag LOCUS_07960 gene mog 5376 4786 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522377.1 protein_id gnl|my_center|LOCUS_07960 5923 5378 gene locus_tag LOCUS_07970 gene yjgA 5923 5378 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814897.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence087 86 775 gene locus_tag LOCUS_07980 gene pilW 86 775 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227268.1 protein_id gnl|my_center|LOCUS_07980 765 1559 gene locus_tag LOCUS_07990 765 1559 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257722.1 protein_id gnl|my_center|LOCUS_07990 1564 2208 gene locus_tag LOCUS_08000 1564 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08000 2142 2849 gene locus_tag LOCUS_08010 2142 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08010 2857 4164 gene locus_tag LOCUS_08020 gene hisS 2857 4164 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_08020 4173 4808 gene locus_tag LOCUS_08030 4173 4808 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_08030 4822 5961 gene locus_tag LOCUS_08040 gene bamB 4822 5961 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810701.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence088 2189 849 gene locus_tag LOCUS_08050 gene ugpB 2189 849 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039943.1 protein_id gnl|my_center|LOCUS_08050 2471 3358 gene locus_tag LOCUS_08060 gene ubiA 2471 3358 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_08060 4186 3380 gene locus_tag LOCUS_08070 gene proC 4186 3380 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_08070 5469 4729 gene locus_tag LOCUS_08080 5469 4729 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence089 <1 623 gene locus_tag LOCUS_08090 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527811.1:peptide chain release factor 1 613 1419 gene locus_tag LOCUS_08100 gene prmC 613 1419 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929958.1 protein_id gnl|my_center|LOCUS_08100 1663 1983 gene locus_tag LOCUS_08110 gene grxD 1663 1983 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807622.1 protein_id gnl|my_center|LOCUS_08110 1980 2567 gene locus_tag LOCUS_08120 1980 2567 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521981.1 protein_id gnl|my_center|LOCUS_08120 2644 2569 gene locus_tag LOCUS_t00150 2644 2569 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2676 3701 gene locus_tag LOCUS_08130 gene galE 2676 3701 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_08130 4153 3704 gene locus_tag LOCUS_08140 4153 3704 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815821.1 protein_id gnl|my_center|LOCUS_08140 4843 4184 gene locus_tag LOCUS_08150 4843 4184 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_08150 5674 4844 gene locus_tag LOCUS_08160 5674 4844 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815818.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence090 <1 817 gene locus_tag LOCUS_08170 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113717.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase 814 1653 gene locus_tag LOCUS_08180 gene galU 814 1653 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814203.1 protein_id gnl|my_center|LOCUS_08180 3198 2419 gene locus_tag LOCUS_08190 3198 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 3528 3917 gene locus_tag LOCUS_08200 3528 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 3942 4283 gene locus_tag LOCUS_08210 3942 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence091 885 145 gene locus_tag LOCUS_08220 gene ispD 885 145 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813895.1 protein_id gnl|my_center|LOCUS_08220 992 4423 gene locus_tag LOCUS_08230 gene mfd 992 4423 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_08230 4420 5286 gene locus_tag LOCUS_08240 gene serB 4420 5286 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930046.1 protein_id gnl|my_center|LOCUS_08240 <6083 5405 gene locus_tag LOCUS_08250 <6083 5405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521351.1:30S ribosomal protein S12 methylthiotransferase RimO >Feature sequence092 <1 1029 gene locus_tag LOCUS_08260 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003820240.1:aconitate hydratase AcnA 1071 1661 gene locus_tag LOCUS_08270 1071 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1781 2170 gene locus_tag LOCUS_08280 1781 2170 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404838.1 protein_id gnl|my_center|LOCUS_08280 2167 3162 gene locus_tag LOCUS_08290 2167 3162 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_08290 4349 3177 gene locus_tag LOCUS_08300 4349 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 <5980 4575 gene locus_tag LOCUS_08310 <5980 4575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112799.1:cyclic di-GMP receptor MorA >Feature sequence093 1138 71 gene locus_tag LOCUS_08320 1138 71 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193208.1 protein_id gnl|my_center|LOCUS_08320 1917 1177 gene locus_tag LOCUS_08330 1917 1177 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521637.1 protein_id gnl|my_center|LOCUS_08330 2642 1920 gene locus_tag LOCUS_08340 gene aat 2642 1920 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521636.1 protein_id gnl|my_center|LOCUS_08340 3097 2642 gene locus_tag LOCUS_08350 3097 2642 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_08350 3272 3348 gene locus_tag LOCUS_t00160 3272 3348 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3591 4211 gene locus_tag LOCUS_08360 3591 4211 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_08360 4229 5782 gene locus_tag LOCUS_08370 4229 5782 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence094 1905 3065 gene locus_tag LOCUS_08380 1905 3065 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870487.1 protein_id gnl|my_center|LOCUS_08380 4309 3080 gene locus_tag LOCUS_08390 4309 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5804 4407 gene locus_tag LOCUS_08400 5804 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence095 157 1845 gene locus_tag LOCUS_08410 157 1845 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162811005.1 protein_id gnl|my_center|LOCUS_08410 1866 3083 gene locus_tag LOCUS_08420 1866 3083 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073077526.1 protein_id gnl|my_center|LOCUS_08420 3002 3829 gene locus_tag LOCUS_08430 3002 3829 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 protein_id gnl|my_center|LOCUS_08430 5400 3874 gene locus_tag LOCUS_08440 gene ilvA 5400 3874 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence096 880 254 gene locus_tag LOCUS_08450 gene clpP 880 254 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_08450 2216 909 gene locus_tag LOCUS_08460 gene tig 2216 909 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193941.1 protein_id gnl|my_center|LOCUS_08460 2349 2263 gene locus_tag LOCUS_t00170 2349 2263 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2446 2949 gene locus_tag LOCUS_08470 2446 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08470 2930 3256 gene locus_tag LOCUS_08480 2930 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08480 3253 4110 gene locus_tag LOCUS_08490 gene hpnD 3253 4110 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_08490 4113 4472 gene locus_tag LOCUS_08500 4113 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08500 4501 4944 gene locus_tag LOCUS_08510 4501 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4907 5410 gene locus_tag LOCUS_08520 4907 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence097 133 1104 gene locus_tag LOCUS_08530 gene pip 133 1104 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_08530 1105 1890 gene locus_tag LOCUS_08540 1105 1890 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524357.1 protein_id gnl|my_center|LOCUS_08540 1954 2406 gene locus_tag LOCUS_08550 1954 2406 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 protein_id gnl|my_center|LOCUS_08550 3418 3648 gene locus_tag LOCUS_08560 3418 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3600 3797 gene locus_tag LOCUS_08570 3600 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 3838 4953 gene locus_tag LOCUS_08580 gene aroC 3838 4953 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266572.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence098 2 1552 gene locus_tag LOCUS_08590 2 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1575 2258 gene locus_tag LOCUS_08600 1575 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 2759 2304 gene locus_tag LOCUS_08610 2759 2304 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189860.1 protein_id gnl|my_center|LOCUS_08610 <5708 2738 gene locus_tag LOCUS_08620 <5708 2738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930878.1:ATP-dependent RNA helicase HrpA >Feature sequence099 <1 1093 gene locus_tag LOCUS_08630 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202867.1:ABC transporter substrate-binding protein 1152 2141 gene locus_tag LOCUS_08640 1152 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 2144 4828 gene locus_tag LOCUS_08650 2144 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 5292 4993 gene locus_tag LOCUS_08660 5292 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 5597 5292 gene locus_tag LOCUS_08670 5597 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence100 2055 1030 gene locus_tag LOCUS_08680 2055 1030 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813124.1 protein_id gnl|my_center|LOCUS_08680 2116 2703 gene locus_tag LOCUS_08690 2116 2703 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194622.1 protein_id gnl|my_center|LOCUS_08690 3109 3468 gene locus_tag LOCUS_08700 3109 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3849 3565 gene locus_tag LOCUS_08710 3849 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 4675 4301 gene locus_tag LOCUS_08720 4675 4301 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187137.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08720 <5633 4894 gene locus_tag LOCUS_08730 <5633 4894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189298.1:tRNA 2-thiocytidine(32) synthetase TtcA >Feature sequence101 314 1594 gene locus_tag LOCUS_08740 314 1594 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928137.1 protein_id gnl|my_center|LOCUS_08740 1656 2204 gene locus_tag LOCUS_08750 1656 2204 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390014.1 protein_id gnl|my_center|LOCUS_08750 3128 2217 gene locus_tag LOCUS_08760 3128 2217 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_08760 4155 3250 gene locus_tag LOCUS_08770 4155 3250 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_08770 5348 4233 gene locus_tag LOCUS_08780 5348 4233 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence102 547 1152 gene locus_tag LOCUS_08790 547 1152 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_08790 1456 1175 gene locus_tag LOCUS_08800 1456 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1696 5001 gene locus_tag LOCUS_08810 1696 5001 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence103 964 29 gene locus_tag LOCUS_08820 964 29 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957524.1 protein_id gnl|my_center|LOCUS_08820 1488 1096 gene locus_tag LOCUS_08830 1488 1096 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813730.1 protein_id gnl|my_center|LOCUS_08830 2328 1558 gene locus_tag LOCUS_08840 2328 1558 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_08840 2411 4063 gene locus_tag LOCUS_08850 2411 4063 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 protein_id gnl|my_center|LOCUS_08850 4122 4997 gene locus_tag LOCUS_08860 gene purU 4122 4997 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522850.1 protein_id gnl|my_center|LOCUS_08860 5564 5016 gene locus_tag LOCUS_08870 5564 5016 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185716.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence104 450 1526 gene locus_tag LOCUS_08880 450 1526 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_08880 1528 2532 gene locus_tag LOCUS_08890 1528 2532 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_08890 2519 3364 gene locus_tag LOCUS_08900 2519 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 3361 4554 gene locus_tag LOCUS_08910 3361 4554 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216554.1 protein_id gnl|my_center|LOCUS_08910 5212 4574 gene locus_tag LOCUS_08920 5212 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08920 5342 5351 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence105 1576 242 gene locus_tag LOCUS_08930 1576 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 2393 1875 gene locus_tag LOCUS_08940 2393 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2664 2383 gene locus_tag LOCUS_08950 2664 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 3878 2679 gene locus_tag LOCUS_08960 3878 2679 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864646.1 protein_id gnl|my_center|LOCUS_08960 4513 3875 gene locus_tag LOCUS_08970 4513 3875 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226991426.1 protein_id gnl|my_center|LOCUS_08970 5291 4536 gene locus_tag LOCUS_08980 5291 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 5581 5423 gene locus_tag LOCUS_08990 5581 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence106 1913 891 gene locus_tag LOCUS_09000 gene hrcA 1913 891 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_09000 1984 2874 gene locus_tag LOCUS_09010 1984 2874 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_09010 2935 4584 gene locus_tag LOCUS_09020 gene recN 2935 4584 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194023.1 protein_id gnl|my_center|LOCUS_09020 5035 4604 gene locus_tag LOCUS_09030 gene fur 5035 4604 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_09030 >Feature sequence107 229 2130 gene locus_tag LOCUS_09040 229 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2138 2905 gene locus_tag LOCUS_09050 2138 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2902 5148 gene locus_tag LOCUS_09060 2902 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence108 47 631 gene locus_tag LOCUS_09070 47 631 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383606.1 protein_id gnl|my_center|LOCUS_09070 645 1136 gene locus_tag LOCUS_09080 645 1136 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979773.1 protein_id gnl|my_center|LOCUS_09080 1133 1540 gene locus_tag LOCUS_09090 1133 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1540 2508 gene locus_tag LOCUS_09100 gene rfaE1 1540 2508 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189069.1 protein_id gnl|my_center|LOCUS_09100 2800 3789 gene locus_tag LOCUS_09110 gene rfaD 2800 3789 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190173.1 protein_id gnl|my_center|LOCUS_09110 3792 4418 gene locus_tag LOCUS_09120 gene gmhB 3792 4418 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072769.1 protein_id gnl|my_center|LOCUS_09120 4396 4905 gene locus_tag LOCUS_09130 gene rfaE2 4396 4905 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189202.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence109 <1 1968 gene locus_tag LOCUS_09140 <1 1968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929828.1:Rne/Rng family ribonuclease 2192 3124 gene locus_tag LOCUS_09150 gene moaA 2192 3124 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 protein_id gnl|my_center|LOCUS_09150 3117 3689 gene locus_tag LOCUS_09160 gene mobA 3117 3689 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706868.1 protein_id gnl|my_center|LOCUS_09160 3692 4906 gene locus_tag LOCUS_09170 gene moeA 3692 4906 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence110 445 454 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1141 524 gene locus_tag LOCUS_09180 1141 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1399 1602 gene locus_tag LOCUS_09190 1399 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 2678 1599 gene locus_tag LOCUS_09200 2678 1599 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_09200 3439 2930 gene locus_tag LOCUS_09210 3439 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 3625 4809 gene locus_tag LOCUS_09220 3625 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence111 <1 2536 gene locus_tag LOCUS_09230 <1 2536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812546.1:UvrD-helicase domain-containing protein 3519 2770 gene locus_tag LOCUS_09240 3519 2770 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529044.1 protein_id gnl|my_center|LOCUS_09240 4457 3495 gene locus_tag LOCUS_09250 4457 3495 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530313.1 protein_id gnl|my_center|LOCUS_09250 4864 4463 gene locus_tag LOCUS_09260 4864 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 <5492 4889 gene locus_tag LOCUS_09270 <5492 4889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530319.1:TIGR00730 family Rossman fold protein >Feature sequence112 591 160 gene locus_tag LOCUS_09280 591 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 751 2844 gene locus_tag LOCUS_09290 751 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2965 3315 gene locus_tag LOCUS_09300 gene yajC 2965 3315 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064323.1 protein_id gnl|my_center|LOCUS_09300 3387 5276 gene locus_tag LOCUS_09310 gene secD 3387 5276 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064324.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence113 15 1493 gene locus_tag LOCUS_09320 gene tldD 15 1493 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_09320 1539 1817 gene locus_tag LOCUS_09330 1539 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2435 1836 gene locus_tag LOCUS_09340 2435 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 4072 2435 gene locus_tag LOCUS_09350 4072 2435 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_09350 4320 4859 gene locus_tag LOCUS_09360 4320 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence114 845 654 gene locus_tag LOCUS_09370 845 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 869 1189 gene locus_tag LOCUS_09380 gene cyaY 869 1189 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196764.1 protein_id gnl|my_center|LOCUS_09380 3448 1196 gene locus_tag LOCUS_09390 3448 1196 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535017.1 protein_id gnl|my_center|LOCUS_09390 4107 5180 gene locus_tag LOCUS_09400 4107 5180 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence115 <1 657 gene locus_tag LOCUS_09410 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807268.1:ABC transporter ATP-binding protein 664 1593 gene locus_tag LOCUS_09420 664 1593 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807265.1 protein_id gnl|my_center|LOCUS_09420 1603 2679 gene locus_tag LOCUS_09430 1603 2679 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_09430 2757 4121 gene locus_tag LOCUS_09440 2757 4121 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448384.1 protein_id gnl|my_center|LOCUS_09440 4172 4990 gene locus_tag LOCUS_09450 4172 4990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence116 792 2834 gene locus_tag LOCUS_09460 gene uvrB 792 2834 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812466.1 protein_id gnl|my_center|LOCUS_09460 3077 3493 gene locus_tag LOCUS_09470 3077 3493 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_09470 3616 4119 gene locus_tag LOCUS_09480 gene iscR 3616 4119 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_09480 4132 5184 gene locus_tag LOCUS_09490 4132 5184 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192952.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09490 5102 5111 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5144 5347 gene locus_tag LOCUS_09500 5144 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09500 >Feature sequence117 1766 387 gene locus_tag LOCUS_09510 1766 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2487 1915 gene locus_tag LOCUS_09520 2487 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 3044 2484 gene locus_tag LOCUS_09530 3044 2484 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941910.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09530 4942 3041 gene locus_tag LOCUS_09540 4942 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence118 <1 776 gene locus_tag LOCUS_09550 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926570.1:translation elongation factor Ts 791 1507 gene locus_tag LOCUS_09560 gene pyrH 791 1507 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 protein_id gnl|my_center|LOCUS_09560 1535 2095 gene locus_tag LOCUS_09570 gene frr 1535 2095 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_09570 2174 2866 gene locus_tag LOCUS_09580 gene uppS 2174 2866 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930350.1 protein_id gnl|my_center|LOCUS_09580 2873 3700 gene locus_tag LOCUS_09590 2873 3700 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521189.1 protein_id gnl|my_center|LOCUS_09590 3715 4863 gene locus_tag LOCUS_09600 3715 4863 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527290.1 protein_id gnl|my_center|LOCUS_09600 4874 5284 gene locus_tag LOCUS_09610 4874 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence119 1051 1800 gene locus_tag LOCUS_09620 1051 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence120 258 184 gene locus_tag LOCUS_t00180 258 184 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 350 274 gene locus_tag LOCUS_t00190 350 274 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 478 402 gene locus_tag LOCUS_t00200 478 402 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1869 529 gene locus_tag LOCUS_09630 gene phoR 1869 529 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 protein_id gnl|my_center|LOCUS_09630 2585 1890 gene locus_tag LOCUS_09640 gene phoB 2585 1890 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_09640 3301 2585 gene locus_tag LOCUS_09650 gene phoU 3301 2585 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193271.1 protein_id gnl|my_center|LOCUS_09650 4128 3319 gene locus_tag LOCUS_09660 gene pstB 4128 3319 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107795169.1 protein_id gnl|my_center|LOCUS_09660 5053 4133 gene locus_tag LOCUS_09670 gene pstA 5053 4133 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence121 415 101 gene locus_tag LOCUS_09680 gene psiF 415 101 CDS product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095812.1 protein_id gnl|my_center|LOCUS_09680 1521 532 gene locus_tag LOCUS_09690 gene hprK 1521 532 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929965.1 protein_id gnl|my_center|LOCUS_09690 2002 1532 gene locus_tag LOCUS_09700 gene ptsN 2002 1532 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_09700 2751 2422 gene locus_tag LOCUS_09710 gene raiA 2751 2422 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 protein_id gnl|my_center|LOCUS_09710 4281 2818 gene locus_tag LOCUS_09720 4281 2818 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_09720 5111 4317 gene locus_tag LOCUS_09730 gene lptB 5111 4317 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence122 299 51 gene locus_tag LOCUS_09740 299 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09740 2206 296 gene locus_tag LOCUS_09750 2206 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2892 2221 gene locus_tag LOCUS_09760 2892 2221 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063801.1 protein_id gnl|my_center|LOCUS_09760 3653 3021 gene locus_tag LOCUS_09770 gene pdxH 3653 3021 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_09770 4368 3715 gene locus_tag LOCUS_09780 4368 3715 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189235.1 protein_id gnl|my_center|LOCUS_09780 4571 4365 gene locus_tag LOCUS_09790 4571 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5197 4856 gene locus_tag LOCUS_09800 5197 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence123 1211 780 gene locus_tag LOCUS_09810 1211 780 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_09810 1429 1911 gene locus_tag LOCUS_09820 1429 1911 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193764.1 protein_id gnl|my_center|LOCUS_09820 1936 2166 gene locus_tag LOCUS_09830 1936 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2727 2197 gene locus_tag LOCUS_09840 2727 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3166 2837 gene locus_tag LOCUS_09850 3166 2837 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196624.1 protein_id gnl|my_center|LOCUS_09850 3631 3257 gene locus_tag LOCUS_09860 3631 3257 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 protein_id gnl|my_center|LOCUS_09860 4616 3660 gene locus_tag LOCUS_09870 4616 3660 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456983.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence124 1397 354 gene locus_tag LOCUS_09880 1397 354 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809579.1 protein_id gnl|my_center|LOCUS_09880 2580 1978 gene locus_tag LOCUS_09890 gene recR 2580 1978 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193537.1 protein_id gnl|my_center|LOCUS_09890 2980 2654 gene locus_tag LOCUS_09900 2980 2654 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_09900 4620 2998 gene locus_tag LOCUS_09910 4620 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence125 2713 368 gene locus_tag LOCUS_09920 gene fixL 2713 368 CDS product oxygen sensor histidine kinase FixL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557112.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence126 1000 2202 gene locus_tag LOCUS_09930 1000 2202 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_09930 2340 3773 gene locus_tag LOCUS_09940 gene ahcY 2340 3773 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942520.1 protein_id gnl|my_center|LOCUS_09940 3799 4719 gene locus_tag LOCUS_09950 3799 4719 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027134.1 protein_id gnl|my_center|LOCUS_09950 4727 5059 gene locus_tag LOCUS_09960 4727 5059 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence127 <1 710 gene locus_tag LOCUS_09970 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838970.1:DUF3047 domain-containing protein 795 2372 gene locus_tag LOCUS_09980 795 2372 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065033.1 protein_id gnl|my_center|LOCUS_09980 2819 2406 gene locus_tag LOCUS_09990 2819 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2946 3929 gene locus_tag LOCUS_10000 2946 3929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814271.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence128 2284 1616 gene locus_tag LOCUS_10010 gene cas5c 2284 1616 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_10010 4670 2313 gene locus_tag LOCUS_10020 gene cas3 4670 2313 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_10020 5050 4757 gene locus_tag LOCUS_10030 5050 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence129 1737 895 gene locus_tag LOCUS_10040 1737 895 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_10040 1947 2438 gene locus_tag LOCUS_10050 1947 2438 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196360.1 protein_id gnl|my_center|LOCUS_10050 3852 2458 gene locus_tag LOCUS_10060 3852 2458 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730541.1 protein_id gnl|my_center|LOCUS_10060 4235 3849 gene locus_tag LOCUS_10070 4235 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 <5025 4243 gene locus_tag LOCUS_10080 <5025 4243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205740.1:glycosyltransferase >Feature sequence130 406 1548 gene locus_tag LOCUS_10090 406 1548 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990431.1 protein_id gnl|my_center|LOCUS_10090 1552 2313 gene locus_tag LOCUS_10100 1552 2313 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083339.1 protein_id gnl|my_center|LOCUS_10100 2320 2805 gene locus_tag LOCUS_10110 2320 2805 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192400.1 protein_id gnl|my_center|LOCUS_10110 3997 2798 gene locus_tag LOCUS_10120 3997 2798 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065148.1 protein_id gnl|my_center|LOCUS_10120 4430 4011 gene locus_tag LOCUS_10130 4430 4011 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201632.1 protein_id gnl|my_center|LOCUS_10130 <4989 4434 gene locus_tag LOCUS_10140 <4989 4434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114089.1:glutamate-5-semialdehyde dehydrogenase >Feature sequence131 2423 1869 gene locus_tag LOCUS_10150 2423 1869 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189913.1 protein_id gnl|my_center|LOCUS_10150 2993 2517 gene locus_tag LOCUS_10160 gene bfr 2993 2517 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 protein_id gnl|my_center|LOCUS_10160 3252 3040 gene locus_tag LOCUS_10170 3252 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3410 4309 gene locus_tag LOCUS_10180 3410 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence132 2474 2244 gene locus_tag LOCUS_10190 2474 2244 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141125.1 protein_id gnl|my_center|LOCUS_10190 2905 2471 gene locus_tag LOCUS_10200 2905 2471 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928694.1 protein_id gnl|my_center|LOCUS_10200 3181 3017 gene locus_tag LOCUS_10210 3181 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 3428 3844 gene locus_tag LOCUS_10220 3428 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 4405 3911 gene locus_tag LOCUS_10230 4405 3911 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412970.1 protein_id gnl|my_center|LOCUS_10230 4643 4398 gene locus_tag LOCUS_10240 4643 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4672 4863 gene locus_tag LOCUS_10250 4672 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence133 <1 669 gene locus_tag LOCUS_10260 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000332950.1:sigma-54 dependent transcriptional regulator note possible pseudo, frameshifted 4681 1964 gene locus_tag LOCUS_10270 4681 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence134 1504 17 gene locus_tag LOCUS_10280 gene ppx 1504 17 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_10280 2435 1521 gene locus_tag LOCUS_10290 2435 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2517 3065 gene locus_tag LOCUS_10300 gene rsmD 2517 3065 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522861.1 protein_id gnl|my_center|LOCUS_10300 3095 3595 gene locus_tag LOCUS_10310 gene coaD 3095 3595 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 protein_id gnl|my_center|LOCUS_10310 3783 4796 gene locus_tag LOCUS_10320 3783 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence135 78 401 gene locus_tag LOCUS_10330 78 401 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_10330 406 1260 gene locus_tag LOCUS_10340 406 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1368 2174 gene locus_tag LOCUS_10350 1368 2174 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_10350 2171 2848 gene locus_tag LOCUS_10360 2171 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 2967 4733 gene locus_tag LOCUS_10370 gene asnB 2967 4733 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence136 1883 456 gene locus_tag LOCUS_10380 gene boxB 1883 456 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_10380 3555 1885 gene locus_tag LOCUS_10390 gene boxC 3555 1885 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_10390 4540 3632 gene locus_tag LOCUS_10400 4540 3632 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083896.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence137 <1 544 gene locus_tag LOCUS_10410 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085125.1:4-hydroxybenzoate 3-monooxygenase 1175 561 gene locus_tag LOCUS_10420 1175 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1803 1231 gene locus_tag LOCUS_10430 1803 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 2947 1988 gene locus_tag LOCUS_10440 2947 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2137 2146 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3496 4380 gene locus_tag LOCUS_10450 3496 4380 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530905.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence138 2264 279 gene locus_tag LOCUS_10460 2264 279 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522854.1 protein_id gnl|my_center|LOCUS_10460 2357 3343 gene locus_tag LOCUS_10470 2357 3343 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815171.1 protein_id gnl|my_center|LOCUS_10470 3340 3873 gene locus_tag LOCUS_10480 3340 3873 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200146.1 protein_id gnl|my_center|LOCUS_10480 3866 4447 gene locus_tag LOCUS_10490 3866 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence139 410 3562 gene locus_tag LOCUS_10500 410 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 3537 4358 gene locus_tag LOCUS_10510 3537 4358 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence140 <1 509 gene locus_tag LOCUS_10520 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940928.1:response regulator transcription factor 587 1003 gene locus_tag LOCUS_10530 587 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1000 3678 gene locus_tag LOCUS_10540 1000 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence141 1126 278 gene locus_tag LOCUS_10550 gene kdsA 1126 278 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193658.1 protein_id gnl|my_center|LOCUS_10550 2867 1197 gene locus_tag LOCUS_10560 2867 1197 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_10560 3458 2913 gene locus_tag LOCUS_10570 3458 2913 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_10570 4033 3836 gene locus_tag LOCUS_10580 4033 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence142 <1 513 gene locus_tag LOCUS_10590 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544237.1:tRNA 2-thiouridine(34) synthase MnmA 1876 1118 gene locus_tag LOCUS_10600 1876 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 2464 1952 gene locus_tag LOCUS_10610 2464 1952 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223804324.1 protein_id gnl|my_center|LOCUS_10610 3353 2670 gene locus_tag LOCUS_10620 3353 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 4211 3450 gene locus_tag LOCUS_10630 4211 3450 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_10630 <4823 4244 gene locus_tag LOCUS_10640 <4823 4244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190187.1:TerC family protein >Feature sequence143 182 706 gene locus_tag LOCUS_10650 gene pncC 182 706 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478554.1 protein_id gnl|my_center|LOCUS_10650 699 1604 gene locus_tag LOCUS_10660 699 1604 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523002.1 protein_id gnl|my_center|LOCUS_10660 1695 2129 gene locus_tag LOCUS_10670 1695 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 2206 3504 gene locus_tag LOCUS_10680 2206 3504 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_10680 4373 3534 gene locus_tag LOCUS_10690 gene pyrF 4373 3534 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence144 2024 2749 gene locus_tag LOCUS_10700 2024 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3451 2795 gene locus_tag LOCUS_10710 3451 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4620 3448 gene locus_tag LOCUS_10720 gene zapE 4620 3448 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447983.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence145 673 92 gene locus_tag LOCUS_10730 673 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 979 1374 gene locus_tag LOCUS_10740 979 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2842 1775 gene locus_tag LOCUS_10750 2842 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 2989 3573 gene locus_tag LOCUS_10760 2989 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence146 3 428 gene locus_tag LOCUS_10770 3 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 578 2467 gene locus_tag LOCUS_10780 gene flgK 578 2467 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037108.1 protein_id gnl|my_center|LOCUS_10780 2512 3723 gene locus_tag LOCUS_10790 2512 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence147 1046 804 gene locus_tag LOCUS_10800 1046 804 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 protein_id gnl|my_center|LOCUS_10800 1861 1049 gene locus_tag LOCUS_10810 1861 1049 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_10810 2772 1858 gene locus_tag LOCUS_10820 2772 1858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_10820 3096 2815 gene locus_tag LOCUS_10830 3096 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 3743 3099 gene locus_tag LOCUS_10840 3743 3099 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815780.1 protein_id gnl|my_center|LOCUS_10840 <4652 3855 gene locus_tag LOCUS_10850 <4652 3855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114777.1:VacJ family lipoprotein >Feature sequence148 290 299 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 739 1149 gene locus_tag LOCUS_10860 gene flgB 739 1149 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811894.1 protein_id gnl|my_center|LOCUS_10860 1235 1642 gene locus_tag LOCUS_10870 gene flgC 1235 1642 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811891.1 protein_id gnl|my_center|LOCUS_10870 1677 2345 gene locus_tag LOCUS_10880 gene flgD 1677 2345 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211112.1 protein_id gnl|my_center|LOCUS_10880 2357 3577 gene locus_tag LOCUS_10890 gene flgE 2357 3577 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197255.1 protein_id gnl|my_center|LOCUS_10890 3593 4327 gene locus_tag LOCUS_10900 gene flgF 3593 4327 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence149 34 210 gene locus_tag LOCUS_10910 34 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 867 1934 gene locus_tag LOCUS_10920 867 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence150 1353 469 gene locus_tag LOCUS_10930 gene prpB 1353 469 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040192.1 protein_id gnl|my_center|LOCUS_10930 2594 1605 gene locus_tag LOCUS_10940 2594 1605 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065155.1 protein_id gnl|my_center|LOCUS_10940 2772 3539 gene locus_tag LOCUS_10950 2772 3539 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813656.1 protein_id gnl|my_center|LOCUS_10950 3621 4040 gene locus_tag LOCUS_10960 gene sdhC 3621 4040 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813654.1 protein_id gnl|my_center|LOCUS_10960 4043 4402 gene locus_tag LOCUS_10970 gene sdhD 4043 4402 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence151 1760 1032 gene locus_tag LOCUS_10980 gene fabG 1760 1032 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765466.1 protein_id gnl|my_center|LOCUS_10980 2191 1757 gene locus_tag LOCUS_10990 2191 1757 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707154.1 protein_id gnl|my_center|LOCUS_10990 3135 2188 gene locus_tag LOCUS_11000 3135 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11000 3904 3119 gene locus_tag LOCUS_11010 3904 3119 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266398.1 protein_id gnl|my_center|LOCUS_11010 4219 3923 gene locus_tag LOCUS_11020 4219 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 4497 4216 gene locus_tag LOCUS_11030 gene xanC 4497 4216 CDS product xanthomonadin biosynthesis acyl carrier protein XanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039083.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence152 1068 52 gene locus_tag LOCUS_11040 1068 52 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_11040 1984 1088 gene locus_tag LOCUS_11050 1984 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2627 2082 gene locus_tag LOCUS_11060 2627 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3005 2640 gene locus_tag LOCUS_11070 3005 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3377 3676 gene locus_tag LOCUS_11080 3377 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11080 >Feature sequence153 445 1065 gene locus_tag LOCUS_11090 gene tmk 445 1065 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811733.1 protein_id gnl|my_center|LOCUS_11090 1050 2132 gene locus_tag LOCUS_11100 1050 2132 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_11100 2157 2585 gene locus_tag LOCUS_11110 2157 2585 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_11110 2629 3417 gene locus_tag LOCUS_11120 2629 3417 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448020.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence154 <1 1525 gene locus_tag LOCUS_11130 <1 1525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810546.1:transcription termination factor NusA 1526 4258 gene locus_tag LOCUS_11140 1526 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence155 1098 937 gene locus_tag LOCUS_11150 1098 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1850 1194 gene locus_tag LOCUS_11160 1850 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2800 1847 gene locus_tag LOCUS_11170 2800 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 3605 2808 gene locus_tag LOCUS_11180 3605 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 <4472 3660 gene locus_tag LOCUS_11190 <4472 3660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194386.1:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence156 1009 2052 gene locus_tag LOCUS_11200 1009 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2049 3743 gene locus_tag LOCUS_11210 gene recJ 2049 3743 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence157 331 2325 gene locus_tag LOCUS_11220 331 2325 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_11220 4262 3102 gene locus_tag LOCUS_11230 4262 3102 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931320.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence158 896 588 gene locus_tag LOCUS_11240 896 588 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196851.1 protein_id gnl|my_center|LOCUS_11240 980 1279 gene locus_tag LOCUS_11250 980 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2977 1283 gene locus_tag LOCUS_11260 gene ilvD 2977 1283 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191611.1 protein_id gnl|my_center|LOCUS_11260 3131 3943 gene locus_tag LOCUS_11270 gene lgt 3131 3943 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence159 <1 631 gene locus_tag LOCUS_11280 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966119.1:ABC transporter substrate-binding protein 1402 2769 gene locus_tag LOCUS_11290 1402 2769 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 protein_id gnl|my_center|LOCUS_11290 3330 2860 gene locus_tag LOCUS_11300 3330 2860 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_11300 <4281 3334 gene locus_tag LOCUS_11310 <4281 3334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535538.1:isovaleryl-CoA dehydrogenase >Feature sequence160 271 1269 gene locus_tag LOCUS_11320 271 1269 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 protein_id gnl|my_center|LOCUS_11320 1266 3185 gene locus_tag LOCUS_11330 1266 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 3525 3298 gene locus_tag LOCUS_11340 3525 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11340 >Feature sequence161 133 633 gene locus_tag LOCUS_11350 133 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 680 2284 gene locus_tag LOCUS_11360 680 2284 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209489743.1 protein_id gnl|my_center|LOCUS_11360 2593 2288 gene locus_tag LOCUS_11370 2593 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence162 <1 1230 gene locus_tag LOCUS_11380 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141651.1:amino acid permease 1223 1831 gene locus_tag LOCUS_11390 1223 1831 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 protein_id gnl|my_center|LOCUS_11390 1848 3752 gene locus_tag LOCUS_11400 1848 3752 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_11400 <4242 3723 gene locus_tag LOCUS_11410 <4242 3723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038721.1:uracil-DNA glycosylase >Feature sequence163 324 773 gene locus_tag LOCUS_11420 gene ruvX 324 773 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186163.1 protein_id gnl|my_center|LOCUS_11420 770 1279 gene locus_tag LOCUS_11430 gene pyrR 770 1279 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266430.1 protein_id gnl|my_center|LOCUS_11430 1263 2231 gene locus_tag LOCUS_11440 1263 2231 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_11440 2228 3511 gene locus_tag LOCUS_11450 2228 3511 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence164 518 213 gene locus_tag LOCUS_11460 gene nuoK 518 213 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_11460 1158 532 gene locus_tag LOCUS_11470 1158 532 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_11470 1690 1202 gene locus_tag LOCUS_11480 gene nuoI 1690 1202 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_11480 2888 1698 gene locus_tag LOCUS_11490 gene nuoH 2888 1698 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 protein_id gnl|my_center|LOCUS_11490 4174 2888 gene locus_tag LOCUS_11500 4174 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence165 851 195 gene locus_tag LOCUS_11510 851 195 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_11510 1345 848 gene locus_tag LOCUS_11520 1345 848 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065009.1 protein_id gnl|my_center|LOCUS_11520 2778 1342 gene locus_tag LOCUS_11530 gene pcnB 2778 1342 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929702.1 protein_id gnl|my_center|LOCUS_11530 2449 2458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3455 2775 gene locus_tag LOCUS_11540 3455 2775 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 protein_id gnl|my_center|LOCUS_11540 <4162 3469 gene locus_tag LOCUS_11550 <4162 3469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065012.1:DnaA regulatory inactivator Hda >Feature sequence166 <1 735 gene locus_tag LOCUS_11560 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193305.1:translation elongation factor 4 732 1616 gene locus_tag LOCUS_11570 gene lepB 732 1616 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 protein_id gnl|my_center|LOCUS_11570 1645 2028 gene locus_tag LOCUS_11580 1645 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 2053 2844 gene locus_tag LOCUS_11590 gene rnc 2053 2844 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853248.1 protein_id gnl|my_center|LOCUS_11590 2837 3757 gene locus_tag LOCUS_11600 gene era 2837 3757 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813784.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence167 1016 252 gene locus_tag LOCUS_11610 1016 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1312 1007 gene locus_tag LOCUS_11620 1312 1007 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523065.1 protein_id gnl|my_center|LOCUS_11620 2166 1309 gene locus_tag LOCUS_11630 2166 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2513 2169 gene locus_tag LOCUS_11640 2513 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2968 2531 gene locus_tag LOCUS_11650 gene fliS 2968 2531 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 protein_id gnl|my_center|LOCUS_11650 <4107 3056 gene locus_tag LOCUS_11660 <4107 3056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943664.1:flagellar filament capping protein FliD >Feature sequence168 <1 604 gene locus_tag LOCUS_11670 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033448163.1:succinyldiaminopimelate transaminase 618 1448 gene locus_tag LOCUS_11680 gene dapD 618 1448 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812536.1 protein_id gnl|my_center|LOCUS_11680 1548 2702 gene locus_tag LOCUS_11690 1548 2702 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_11690 2781 3920 gene locus_tag LOCUS_11700 gene dapE 2781 3920 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039650.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence169 <1 516 gene locus_tag LOCUS_11710 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814079.1:molecular chaperone DnaK 602 1732 gene locus_tag LOCUS_11720 gene dnaJ 602 1732 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821186.1 protein_id gnl|my_center|LOCUS_11720 2652 1792 gene locus_tag LOCUS_11730 2652 1792 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence170 1261 155 gene locus_tag LOCUS_11740 1261 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 3226 1271 gene locus_tag LOCUS_11750 3226 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3486 3223 gene locus_tag LOCUS_11760 3486 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 3755 3764 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence171 1131 241 gene locus_tag LOCUS_11770 gene aroE 1131 241 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_11770 2033 1128 gene locus_tag LOCUS_11780 2033 1128 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567783.1 protein_id gnl|my_center|LOCUS_11780 4049 2061 gene locus_tag LOCUS_11790 4049 2061 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194277.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence172 709 1182 gene locus_tag LOCUS_11800 709 1182 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266690.1 protein_id gnl|my_center|LOCUS_11800 1393 2862 gene locus_tag LOCUS_11810 1393 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 3081 3665 gene locus_tag LOCUS_11820 3081 3665 CDS product DUF3617 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378325.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence173 475 551 gene locus_tag LOCUS_t00210 475 551 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 748 2109 gene locus_tag LOCUS_11830 748 2109 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929121.1 protein_id gnl|my_center|LOCUS_11830 3561 2266 gene locus_tag LOCUS_11840 3561 2266 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence174 1624 2520 gene locus_tag LOCUS_11850 1624 2520 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929674.1 protein_id gnl|my_center|LOCUS_11850 2524 3069 gene locus_tag LOCUS_11860 2524 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3908 2958 gene locus_tag LOCUS_11870 3908 2958 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence175 326 135 gene locus_tag LOCUS_11880 326 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 508 1806 gene locus_tag LOCUS_11890 508 1806 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_11890 1934 2407 gene locus_tag LOCUS_11900 1934 2407 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence176 1166 2647 gene locus_tag LOCUS_11910 1166 2647 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence177 279 2084 gene locus_tag LOCUS_11920 279 2084 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206613.1 protein_id gnl|my_center|LOCUS_11920 2053 3888 gene locus_tag LOCUS_11930 2053 3888 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206613.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence178 1615 284 gene locus_tag LOCUS_11940 1615 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2247 1612 gene locus_tag LOCUS_11950 2247 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2775 3413 gene locus_tag LOCUS_11960 gene lexA 2775 3413 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence179 155 2209 gene locus_tag LOCUS_11970 gene recG 155 2209 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446218.1 protein_id gnl|my_center|LOCUS_11970 2237 3193 gene locus_tag LOCUS_11980 2237 3193 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_11980 3297 3794 gene locus_tag LOCUS_11990 gene dpsA 3297 3794 CDS product non-specific DNA-binding protein DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200519.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence180 3 698 gene locus_tag LOCUS_12000 gene prmB 3 698 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930547.1 protein_id gnl|my_center|LOCUS_12000 2230 1433 gene locus_tag LOCUS_12010 2230 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2573 2923 gene locus_tag LOCUS_12020 2573 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2933 3199 gene locus_tag LOCUS_12030 2933 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence181 1903 1229 gene locus_tag LOCUS_12040 1903 1229 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 protein_id gnl|my_center|LOCUS_12040 2963 2049 gene locus_tag LOCUS_12050 2963 2049 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039189.1 protein_id gnl|my_center|LOCUS_12050 3048 3632 gene locus_tag LOCUS_12060 3048 3632 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence182 <1 505 gene locus_tag LOCUS_12070 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931140.1:M20 aminoacylase family protein 806 435 gene locus_tag LOCUS_12080 806 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1333 770 gene locus_tag LOCUS_12090 1333 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12090 1683 1330 gene locus_tag LOCUS_12100 1683 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2050 1673 gene locus_tag LOCUS_12110 2050 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2356 2051 gene locus_tag LOCUS_12120 2356 2051 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533578.1 protein_id gnl|my_center|LOCUS_12120 3724 2387 gene locus_tag LOCUS_12130 3724 2387 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence183 454 960 gene locus_tag LOCUS_12140 454 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 999 1322 gene locus_tag LOCUS_12150 999 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1386 2756 gene locus_tag LOCUS_12160 1386 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence184 437 1501 gene locus_tag LOCUS_12170 gene fba 437 1501 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064288.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence185 273 201 gene locus_tag LOCUS_t00220 273 201 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 481 2460 gene locus_tag LOCUS_12180 gene parE 481 2460 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185934.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence186 91 735 gene locus_tag LOCUS_12190 91 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 768 1745 gene locus_tag LOCUS_12200 768 1745 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_12200 1711 3165 gene locus_tag LOCUS_12210 gene tilS 1711 3165 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026262905.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence187 815 63 gene locus_tag LOCUS_12220 gene fliP 815 63 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061723562.1 protein_id gnl|my_center|LOCUS_12220 1134 820 gene locus_tag LOCUS_12230 1134 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1577 1140 gene locus_tag LOCUS_12240 1577 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2581 1580 gene locus_tag LOCUS_12250 gene fliM 2581 1580 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 protein_id gnl|my_center|LOCUS_12250 3151 2609 gene locus_tag LOCUS_12260 3151 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence188 492 869 gene locus_tag LOCUS_12270 gene rpsL 492 869 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005017264.1 protein_id gnl|my_center|LOCUS_12270 972 1442 gene locus_tag LOCUS_12280 gene rpsG 972 1442 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_12280 1480 3579 gene locus_tag LOCUS_12290 gene fusA 1480 3579 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806902.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence189 607 332 gene locus_tag LOCUS_12300 607 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1577 609 gene locus_tag LOCUS_12310 gene rsmH 1577 609 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194427.1 protein_id gnl|my_center|LOCUS_12310 2036 1587 gene locus_tag LOCUS_12320 gene mraZ 2036 1587 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931263.1 protein_id gnl|my_center|LOCUS_12320 3676 2603 gene locus_tag LOCUS_12330 3676 2603 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198645.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence190 <1 835 gene locus_tag LOCUS_12340 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004538083.1:FAD-binding oxidoreductase 1336 854 gene locus_tag LOCUS_12350 gene moaC 1336 854 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_12350 1431 2963 gene locus_tag LOCUS_12360 1431 2963 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 protein_id gnl|my_center|LOCUS_12360 3091 3327 gene locus_tag LOCUS_12370 3091 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 3324 3611 gene locus_tag LOCUS_12380 3324 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence191 200 817 gene locus_tag LOCUS_12390 gene pncA 200 817 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521275.1 protein_id gnl|my_center|LOCUS_12390 814 2127 gene locus_tag LOCUS_12400 814 2127 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_12400 2188 2541 gene locus_tag LOCUS_12410 2188 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 <3685 2669 gene locus_tag LOCUS_12420 <3685 2669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194146.1:glycolate oxidase subunit GlcF >Feature sequence192 857 1309 gene locus_tag LOCUS_12430 857 1309 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194168.1 protein_id gnl|my_center|LOCUS_12430 1327 1716 gene locus_tag LOCUS_12440 1327 1716 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535286.1 protein_id gnl|my_center|LOCUS_12440 1751 2245 gene locus_tag LOCUS_12450 1751 2245 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence193 1709 1446 gene locus_tag LOCUS_12460 1709 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 3211 1739 gene locus_tag LOCUS_12470 3211 1739 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence194 1740 859 gene locus_tag LOCUS_12480 1740 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence195 1322 651 gene locus_tag LOCUS_12490 1322 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2382 1561 gene locus_tag LOCUS_12500 2382 1561 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229249.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence196 968 714 gene locus_tag LOCUS_12510 968 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 2785 968 gene locus_tag LOCUS_12520 2785 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 <3562 2787 gene locus_tag LOCUS_12530 <3562 2787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000166313.1:recombination protein RecT >Feature sequence197 266 1342 gene locus_tag LOCUS_12540 266 1342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_12540 1389 1479 gene locus_tag LOCUS_t00230 1389 1479 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1518 2789 gene locus_tag LOCUS_12550 1518 2789 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_12550 3535 2861 gene locus_tag LOCUS_12560 3535 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence198 <1 945 gene locus_tag LOCUS_12570 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039166.1:dipeptide ABC transporter ATP-binding protein 942 2099 gene locus_tag LOCUS_12580 942 2099 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_12580 2759 2112 gene locus_tag LOCUS_12590 2759 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3304 2828 gene locus_tag LOCUS_12600 3304 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12600 3252 3261 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence199 <1 1051 gene locus_tag LOCUS_12610 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205311.1:primosomal protein N' 2094 1588 gene locus_tag LOCUS_12620 2094 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2206 2281 gene locus_tag LOCUS_t00240 2206 2281 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2791 2306 gene locus_tag LOCUS_12630 2791 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence200 <3497 350 gene locus_tag LOCUS_12640 <3497 350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009241452.1:YhdP family protein >Feature sequence201 2040 1564 gene locus_tag LOCUS_12650 2040 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 2226 3404 gene locus_tag LOCUS_12660 2226 3404 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence202 914 156 gene locus_tag LOCUS_12670 gene cysE 914 156 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 protein_id gnl|my_center|LOCUS_12670 1749 961 gene locus_tag LOCUS_12680 1749 961 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926281.1 protein_id gnl|my_center|LOCUS_12680 1806 2612 gene locus_tag LOCUS_12690 1806 2612 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence203 311 1264 gene locus_tag LOCUS_12700 311 1264 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064670.1 protein_id gnl|my_center|LOCUS_12700 1369 2403 gene locus_tag LOCUS_12710 1369 2403 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532423.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence204 <1 585 gene locus_tag LOCUS_12720 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064934.1:ribonucleoside-diphosphate reductase subunit alpha 607 1707 gene locus_tag LOCUS_12730 607 1707 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194129.1 protein_id gnl|my_center|LOCUS_12730 2708 3250 gene locus_tag LOCUS_12740 2708 3250 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814933.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence205 >Feature sequence206 1480 1202 gene locus_tag LOCUS_12750 1480 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1884 1477 gene locus_tag LOCUS_12760 1884 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence207 1334 1873 gene locus_tag LOCUS_12770 1334 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1892 2473 gene locus_tag LOCUS_12780 1892 2473 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191635.1 protein_id gnl|my_center|LOCUS_12780 2486 2983 gene locus_tag LOCUS_12790 2486 2983 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence208 1186 599 gene locus_tag LOCUS_12800 1186 599 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_12800 1640 1359 gene locus_tag LOCUS_12810 1640 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1936 1658 gene locus_tag LOCUS_12820 1936 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2250 1909 gene locus_tag LOCUS_12830 2250 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2374 2625 gene locus_tag LOCUS_12840 2374 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 3162 2878 gene locus_tag LOCUS_12850 3162 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence209 1293 1030 gene locus_tag LOCUS_12860 1293 1030 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256445.1 protein_id gnl|my_center|LOCUS_12860 1979 1335 gene locus_tag LOCUS_12870 1979 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 2308 1976 gene locus_tag LOCUS_12880 2308 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 <3415 2338 gene locus_tag LOCUS_12890 <3415 2338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188376.1:acetate--CoA ligase >Feature sequence210 <1 1204 gene locus_tag LOCUS_12900 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069319778.1:ABC transporter permease 1403 2950 gene locus_tag LOCUS_12910 1403 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence211 <1 1389 gene locus_tag LOCUS_12920 <1 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103491.1:NAD-glutamate dehydrogenase GdhB 1517 1978 gene locus_tag LOCUS_12930 gene purE 1517 1978 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188932.1 protein_id gnl|my_center|LOCUS_12930 1987 3162 gene locus_tag LOCUS_12940 1987 3162 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809527.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence212 <1 619 gene locus_tag LOCUS_12950 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193202.1:peptidoglycan editing factor PgeF 885 2456 gene locus_tag LOCUS_12960 gene phaC 885 2456 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527151.1 protein_id gnl|my_center|LOCUS_12960 2550 2741 gene locus_tag LOCUS_12970 2550 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence213 >Feature sequence214 519 914 gene locus_tag LOCUS_12980 519 914 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence215 970 533 gene locus_tag LOCUS_12990 970 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1350 976 gene locus_tag LOCUS_13000 1350 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1548 2594 gene locus_tag LOCUS_13010 gene intI1 1548 2594 CDS product class 1 integron integrase IntI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845048.1 protein_id gnl|my_center|LOCUS_13010 <3364 2796 gene locus_tag LOCUS_13020 <3364 2796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522633.1:glycerol-3-phosphate 1-O-acyltransferase PlsY >Feature sequence216 121 801 gene locus_tag LOCUS_13030 121 801 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_13030 808 1131 gene locus_tag LOCUS_13040 808 1131 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_13040 1153 1542 gene locus_tag LOCUS_13050 1153 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1552 2478 gene locus_tag LOCUS_13060 1552 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13060 <3359 2510 gene locus_tag LOCUS_13070 <3359 2510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532247.1:lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase >Feature sequence217 327 435 gene locus_tag LOCUS_r00010 327 435 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 531 2996 gene locus_tag LOCUS_13080 531 2996 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence218 <1 584 gene locus_tag LOCUS_13090 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191158.1:alanine--tRNA ligase 710 1126 gene locus_tag LOCUS_13100 710 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1152 1391 gene locus_tag LOCUS_13110 1152 1391 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063946.1 protein_id gnl|my_center|LOCUS_13110 1397 1846 gene locus_tag LOCUS_13120 1397 1846 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_13120 <3338 2008 gene locus_tag LOCUS_13130 <3338 2008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040079.1:valine--tRNA ligase >Feature sequence219 427 1956 gene locus_tag LOCUS_13140 gene gabD 427 1956 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971372.1 protein_id gnl|my_center|LOCUS_13140 1981 2391 gene locus_tag LOCUS_13150 1981 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 3316 2447 gene locus_tag LOCUS_13160 3316 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence220 1458 562 gene locus_tag LOCUS_13170 1458 562 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_13170 2839 1556 gene locus_tag LOCUS_13180 2839 1556 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259470.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence221 <1 1447 gene locus_tag LOCUS_13190 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113216.1:EAL domain-containing protein >Feature sequence222 112 528 gene locus_tag LOCUS_13200 112 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 249 258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 529 538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 541 762 gene locus_tag LOCUS_13210 541 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1936 776 gene locus_tag LOCUS_13220 1936 776 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140316.1 protein_id gnl|my_center|LOCUS_13220 2897 1956 gene locus_tag LOCUS_13230 2897 1956 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence223 <1 712 gene locus_tag LOCUS_13240 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039999.1:enoyl-CoA hydratase/isomerase family protein 762 1367 gene locus_tag LOCUS_13250 762 1367 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence224 305 862 gene locus_tag LOCUS_13260 305 862 CDS product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975846.1 protein_id gnl|my_center|LOCUS_13260 1011 2033 gene locus_tag LOCUS_13270 1011 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2214 2047 gene locus_tag LOCUS_13280 2214 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2285 2692 gene locus_tag LOCUS_13290 2285 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence225 2380 326 gene locus_tag LOCUS_13300 2380 326 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550186.1 protein_id gnl|my_center|LOCUS_13300 <3207 2408 gene locus_tag LOCUS_13310 <3207 2408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033448683.1:bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD >Feature sequence226 2046 628 gene locus_tag LOCUS_13320 2046 628 CDS product PelD GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113952.1 protein_id gnl|my_center|LOCUS_13320 2594 2043 gene locus_tag LOCUS_13330 2594 2043 CDS product pellicle/biofilm biosynthesis outer membrane protein PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091288.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence227 1 1023 gene locus_tag LOCUS_13340 1 1023 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_13340 1055 1840 gene locus_tag LOCUS_13350 1055 1840 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812449.1 protein_id gnl|my_center|LOCUS_13350 2008 2721 gene locus_tag LOCUS_13360 2008 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence228 1282 1055 gene locus_tag LOCUS_13370 1282 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1294 1485 gene locus_tag LOCUS_13380 1294 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2511 1804 gene locus_tag LOCUS_13390 2511 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence229 3021 835 gene locus_tag LOCUS_13400 3021 835 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920055.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence230 2075 1194 gene locus_tag LOCUS_13410 2075 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2238 2627 gene locus_tag LOCUS_13420 2238 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2919 2638 gene locus_tag LOCUS_13430 2919 2638 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764805.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence231 124 861 gene locus_tag LOCUS_13440 124 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 992 2410 gene locus_tag LOCUS_13450 992 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence232 2144 1443 gene locus_tag LOCUS_13460 2144 1443 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_13460 2884 2141 gene locus_tag LOCUS_13470 gene rpe 2884 2141 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815384.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence233 1334 2104 gene locus_tag LOCUS_13480 1334 2104 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705617.1 protein_id gnl|my_center|LOCUS_13480 2146 2748 gene locus_tag LOCUS_13490 2146 2748 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence234 <1 583 gene locus_tag LOCUS_13500 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887175.1:DUF3987 domain-containing protein 1517 1729 gene locus_tag LOCUS_13510 1517 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2411 1980 gene locus_tag LOCUS_13520 2411 1980 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769733.1 protein_id gnl|my_center|LOCUS_13520 2662 2408 gene locus_tag LOCUS_13530 2662 2408 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101799467.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence235 2081 777 gene locus_tag LOCUS_13540 gene nuoF 2081 777 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_13540 2584 2078 gene locus_tag LOCUS_13550 gene nuoE 2584 2078 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813932.1 protein_id gnl|my_center|LOCUS_13550 <3097 2488 gene locus_tag LOCUS_13560 <3097 2488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185833.1:NADH-quinone oxidoreductase subunit D >Feature sequence236 <1 856 gene locus_tag LOCUS_13570 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339021.1:ergothioneine biosynthesis protein EgtB 1682 885 gene locus_tag LOCUS_13580 gene fabI 1682 885 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191586.1 protein_id gnl|my_center|LOCUS_13580 2937 1723 gene locus_tag LOCUS_13590 2937 1723 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192263.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence237 112 351 gene locus_tag LOCUS_13600 112 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 338 1465 gene locus_tag LOCUS_13610 338 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1477 2004 gene locus_tag LOCUS_13620 1477 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence238 1 258 gene locus_tag LOCUS_13630 1 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 2982 211 gene locus_tag LOCUS_13640 2982 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence239 646 1146 gene locus_tag LOCUS_13650 646 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1409 1233 gene locus_tag LOCUS_13660 1409 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1733 1413 gene locus_tag LOCUS_13670 1733 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13670 2319 1738 gene locus_tag LOCUS_13680 2319 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13680 <3068 2393 gene locus_tag LOCUS_13690 <3068 2393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194380.1:cell division protein FtsZ >Feature sequence240 >Feature sequence241 747 1595 gene locus_tag LOCUS_13700 747 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence242 921 1400 gene locus_tag LOCUS_13710 921 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1404 1823 gene locus_tag LOCUS_13720 1404 1823 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_13720 <3061 1834 gene locus_tag LOCUS_13730 <3061 1834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003818202.1:bifunctional isocitrate dehydrogenase kinase/phosphatase >Feature sequence243 145 3002 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attatccgccgtgtaggcggcttagaa >Feature sequence244 263 272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 291 1166 gene locus_tag LOCUS_13740 291 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1166 2599 gene locus_tag LOCUS_13750 gene thrC 1166 2599 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence245 <1 570 gene locus_tag LOCUS_13760 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192539.1:NAD-dependent DNA ligase LigA 573 1316 gene locus_tag LOCUS_13770 573 1316 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036479.1 protein_id gnl|my_center|LOCUS_13770 1313 1858 gene locus_tag LOCUS_13780 gene def 1313 1858 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_13780 <3032 1882 gene locus_tag LOCUS_13790 <3032 1882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197089.1:[protein-PII] uridylyltransferase >Feature sequence246 616 134 gene locus_tag LOCUS_13800 616 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence247 1958 714 gene locus_tag LOCUS_13810 1958 714 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 protein_id gnl|my_center|LOCUS_13810 2055 2777 gene locus_tag LOCUS_13820 2055 2777 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040671.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence248 962 2275 gene locus_tag LOCUS_13830 962 2275 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089468.1 protein_id gnl|my_center|LOCUS_13830 <3014 2383 gene locus_tag LOCUS_13840 <3014 2383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257525.1:DUF5979 domain-containing protein >Feature sequence249 107 457 gene locus_tag LOCUS_13850 107 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 678 2708 gene locus_tag LOCUS_13860 678 2708 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200389.1 protein_id gnl|my_center|LOCUS_13860 2734 2743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence250 120 2624 gene locus_tag LOCUS_13870 gene gyrB 120 2624 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816022.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence251 438 1145 gene locus_tag LOCUS_13880 438 1145 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965671.1 protein_id gnl|my_center|LOCUS_13880 1188 2162 gene locus_tag LOCUS_13890 1188 2162 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965680.1 protein_id gnl|my_center|LOCUS_13890 2236 2814 gene locus_tag LOCUS_13900 2236 2814 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089572.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence252 >Feature sequence253 <2896 357 gene locus_tag LOCUS_13910 <2896 357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258561.1:Swt1 family HEPN domain-containing protein >Feature sequence254 912 2279 gene locus_tag LOCUS_13920 912 2279 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 protein_id gnl|my_center|LOCUS_13920 2311 2235 gene locus_tag LOCUS_t00250 2311 2235 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2519 2797 gene locus_tag LOCUS_13930 2519 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence255 723 193 gene locus_tag LOCUS_13940 723 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 911 1384 gene locus_tag LOCUS_13950 911 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence256 1263 814 gene locus_tag LOCUS_13960 1263 814 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815949.1 protein_id gnl|my_center|LOCUS_13960 1282 2379 gene locus_tag LOCUS_13970 1282 2379 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence257 1673 606 gene locus_tag LOCUS_13980 1673 606 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_13980 2543 1872 gene locus_tag LOCUS_13990 2543 1872 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168989238.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence258 <1 1188 gene locus_tag LOCUS_14000 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535294.1:leucine--tRNA ligase 1199 1750 gene locus_tag LOCUS_14010 gene lptE 1199 1750 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194132.1 protein_id gnl|my_center|LOCUS_14010 1734 2744 gene locus_tag LOCUS_14020 gene holA 1734 2744 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810253.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence259 94 1074 gene locus_tag LOCUS_14030 94 1074 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_14030 1075 2127 gene locus_tag LOCUS_14040 gene ugpC 1075 2127 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061266.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence260 <2815 448 gene locus_tag LOCUS_14050 <2815 448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111069335.1:patatin-like phospholipase family protein >Feature sequence261 643 1956 gene locus_tag LOCUS_14060 643 1956 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_14060 <2812 1976 gene locus_tag LOCUS_14070 <2812 1976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201216554.1:glycosyltransferase family 4 protein >Feature sequence262 5 1141 gene locus_tag LOCUS_14080 gene lplT 5 1141 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_14080 1914 1138 gene locus_tag LOCUS_14090 1914 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2378 1911 gene locus_tag LOCUS_14100 gene rimI 2378 1911 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence263 <1 1069 gene locus_tag LOCUS_14110 <1 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527215.1:SurA N-terminal domain-containing protein 2146 1097 gene locus_tag LOCUS_14120 gene mnmH 2146 1097 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_14120 <2805 2143 gene locus_tag LOCUS_14130 <2805 2143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009942000.1:arylesterase >Feature sequence264 270 1232 gene locus_tag LOCUS_14140 270 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1225 1968 gene locus_tag LOCUS_14150 1225 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence265 2283 763 gene locus_tag LOCUS_14160 gene purF 2283 763 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence266 201 833 gene locus_tag LOCUS_14170 201 833 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_14170 1453 1304 gene locus_tag LOCUS_14180 1453 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1932 1504 gene locus_tag LOCUS_14190 1932 1504 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205242.1 protein_id gnl|my_center|LOCUS_14190 2627 1929 gene locus_tag LOCUS_14200 2627 1929 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194134.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence267 162 710 gene locus_tag LOCUS_14210 162 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 889 1659 gene locus_tag LOCUS_14220 gene modA 889 1659 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_14220 1661 2335 gene locus_tag LOCUS_14230 gene modB 1661 2335 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence268 863 177 gene locus_tag LOCUS_14240 863 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2610 1654 gene locus_tag LOCUS_14250 2610 1654 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence269 109 1209 gene locus_tag LOCUS_14260 109 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 2382 1225 gene locus_tag LOCUS_14270 2382 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 2582 2379 gene locus_tag LOCUS_14280 2582 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence270 2093 798 gene locus_tag LOCUS_14290 2093 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence271 1964 1026 gene locus_tag LOCUS_14300 1964 1026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence272 2 463 gene locus_tag LOCUS_14310 gene hisB 2 463 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815795.1 protein_id gnl|my_center|LOCUS_14310 508 1155 gene locus_tag LOCUS_14320 gene hisH 508 1155 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931644.1 protein_id gnl|my_center|LOCUS_14320 1230 1973 gene locus_tag LOCUS_14330 gene hisA 1230 1973 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence273 2228 219 gene locus_tag LOCUS_14340 2228 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence274 15 1274 gene locus_tag LOCUS_14350 15 1274 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence275 221 1030 gene locus_tag LOCUS_14360 221 1030 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807040.1 protein_id gnl|my_center|LOCUS_14360 1718 2101 gene locus_tag LOCUS_14370 1718 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence276 1383 469 gene locus_tag LOCUS_14380 gene glyQ 1383 469 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_14380 <2643 1420 gene locus_tag LOCUS_14390 <2643 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064331.1:apolipoprotein N-acyltransferase >Feature sequence277 194 3 gene locus_tag LOCUS_14400 194 3 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189988.1 protein_id gnl|my_center|LOCUS_14400 1341 220 gene locus_tag LOCUS_14410 1341 220 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038719.1 protein_id gnl|my_center|LOCUS_14410 1422 2183 gene locus_tag LOCUS_14420 1422 2183 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_14420 2180 2578 gene locus_tag LOCUS_14430 2180 2578 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199336.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence278 <1 981 gene locus_tag LOCUS_14440 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941165.1:ABC transporter permease 1022 1855 gene locus_tag LOCUS_14450 1022 1855 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_14450 1910 2452 gene locus_tag LOCUS_14460 1910 2452 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198002.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence279 <1 1889 gene locus_tag LOCUS_14470 <1 1889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_148590534.1:DUF499 domain-containing protein <2630 2027 gene locus_tag LOCUS_14480 <2630 2027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004551026.1:phenylacetate-CoA oxygenase/reductase subunit PaaK >Feature sequence280 884 1963 gene locus_tag LOCUS_14490 gene serC 884 1963 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189993.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence281 176 373 gene locus_tag LOCUS_14500 176 373 CDS product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186154.1 protein_id gnl|my_center|LOCUS_14500 378 1199 gene locus_tag LOCUS_14510 gene nudC 378 1199 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033458993.1 protein_id gnl|my_center|LOCUS_14510 1755 1830 gene locus_tag LOCUS_t00260 1755 1830 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence282 373 464 gene locus_tag LOCUS_t00270 373 464 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1245 1000 gene locus_tag LOCUS_14520 1245 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence283 553 1404 gene locus_tag LOCUS_14530 553 1404 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525413.1 protein_id gnl|my_center|LOCUS_14530 2354 2363 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence284 141 593 gene locus_tag LOCUS_14540 141 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 590 919 gene locus_tag LOCUS_14550 590 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1596 928 gene locus_tag LOCUS_14560 gene narL 1596 928 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_14560 <2587 1593 gene locus_tag LOCUS_14570 <2587 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001300881.1:nitrate/nitrite two-component system sensor histidine kinase NarQ >Feature sequence285 1583 921 gene locus_tag LOCUS_14580 1583 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence286 137 415 gene locus_tag LOCUS_14590 137 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 418 1233 gene locus_tag LOCUS_14600 418 1233 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931055.1 protein_id gnl|my_center|LOCUS_14600 1682 1251 gene locus_tag LOCUS_14610 1682 1251 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812977.1 protein_id gnl|my_center|LOCUS_14610 2127 1669 gene locus_tag LOCUS_14620 2127 1669 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence287 616 1761 gene locus_tag LOCUS_14630 616 1761 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926116.1 protein_id gnl|my_center|LOCUS_14630 <2570 1751 gene locus_tag LOCUS_14640 <2570 1751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194782.1:NAD-binding protein >Feature sequence288 <1 1848 gene locus_tag LOCUS_14650 <1 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189629.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein >Feature sequence289 163 1746 gene locus_tag LOCUS_14660 163 1746 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086194.1 protein_id gnl|my_center|LOCUS_14660 2530 1721 gene locus_tag LOCUS_14670 2530 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence290 534 235 gene locus_tag LOCUS_14680 534 235 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529164.1 protein_id gnl|my_center|LOCUS_14680 851 534 gene locus_tag LOCUS_14690 851 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 883 1656 gene locus_tag LOCUS_14700 883 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1705 2334 gene locus_tag LOCUS_14710 1705 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence291 808 1062 gene locus_tag LOCUS_14720 808 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1062 1637 gene locus_tag LOCUS_14730 1062 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1871 1796 gene locus_tag LOCUS_t00280 1871 1796 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 <2518 2018 gene locus_tag LOCUS_14740 <2518 2018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189647.1:response regulator transcription factor EsaR >Feature sequence292 <1 561 gene locus_tag LOCUS_14750 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924824.1:ATP-binding protein 534 917 gene locus_tag LOCUS_14760 534 917 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720740.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence293 163 519 gene locus_tag LOCUS_14770 163 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 696 475 gene locus_tag LOCUS_14780 696 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 780 1211 gene locus_tag LOCUS_14790 780 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1208 1636 gene locus_tag LOCUS_14800 1208 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1636 2187 gene locus_tag LOCUS_14810 1636 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence294 1 189 gene locus_tag LOCUS_14820 1 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 189 1061 gene locus_tag LOCUS_14830 189 1061 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810130.1 protein_id gnl|my_center|LOCUS_14830 1803 1021 gene locus_tag LOCUS_14840 1803 1021 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 protein_id gnl|my_center|LOCUS_14840 <2494 1803 gene locus_tag LOCUS_14850 <2494 1803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012777536.1:histidine kinase >Feature sequence295 680 393 gene locus_tag LOCUS_14860 680 393 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_14860 2052 703 gene locus_tag LOCUS_14870 gene argA 2052 703 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence296 <2480 1161 gene locus_tag LOCUS_14880 <2480 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087443.1:acetoacetate--CoA ligase >Feature sequence297 530 1624 gene locus_tag LOCUS_14890 530 1624 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035469.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence298 221 682 gene locus_tag LOCUS_14900 221 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 <2475 669 gene locus_tag LOCUS_14910 <2475 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222149.1:BTAD domain-containing putative transcriptional regulator >Feature sequence299 331 1098 gene locus_tag LOCUS_14920 331 1098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090654.1 protein_id gnl|my_center|LOCUS_14920 1095 1868 gene locus_tag LOCUS_14930 1095 1868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence300 82 717 gene locus_tag LOCUS_14940 82 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 803 1060 gene locus_tag LOCUS_14950 803 1060 CDS product DUF3567 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189087.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence301 <1 1064 gene locus_tag LOCUS_14960 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810577.1:transcription termination factor Rho 1197 1481 gene locus_tag LOCUS_14970 1197 1481 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810513.1 protein_id gnl|my_center|LOCUS_14970 1632 2195 gene locus_tag LOCUS_14980 1632 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14980 2123 2132 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence302 45 2036 gene locus_tag LOCUS_14990 45 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence303 >Feature sequence304 76 >2452 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttctaagccgcctacacggcggataat >Feature sequence305 1 903 gene locus_tag LOCUS_15000 1 903 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965217.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence306 2 1054 gene locus_tag LOCUS_15010 2 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1035 1562 gene locus_tag LOCUS_15020 1035 1562 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185796.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence307 286 831 gene locus_tag LOCUS_15030 286 831 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_15030 836 1909 gene locus_tag LOCUS_15040 gene lpxD 836 1909 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521195.1 protein_id gnl|my_center|LOCUS_15040 1906 2358 gene locus_tag LOCUS_15050 gene fabZ 1906 2358 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811776.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence308 719 1027 gene locus_tag LOCUS_15060 719 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence309 737 1381 gene locus_tag LOCUS_15070 737 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15070 >Feature sequence310 >Feature sequence311 <1 807 gene locus_tag LOCUS_15080 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039628.1:TRAP transporter large permease subunit 1937 852 gene locus_tag LOCUS_15090 1937 852 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814893.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence312 1043 465 gene locus_tag LOCUS_15100 1043 465 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551457.1 protein_id gnl|my_center|LOCUS_15100 2062 1040 gene locus_tag LOCUS_15110 2062 1040 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence313 312 671 gene locus_tag LOCUS_15120 312 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 668 1939 gene locus_tag LOCUS_15130 gene kynU 668 1939 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038738.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence314 380 1915 gene locus_tag LOCUS_15140 380 1915 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815305.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence315 <2365 599 gene locus_tag LOCUS_15150 <2365 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036061.1:ATP-binding protein >Feature sequence316 827 1009 gene locus_tag LOCUS_15160 827 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1163 1645 gene locus_tag LOCUS_15170 1163 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2276 2013 gene locus_tag LOCUS_15180 2276 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence317 1026 472 gene locus_tag LOCUS_15190 gene phaR 1026 472 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192676.1 protein_id gnl|my_center|LOCUS_15190 2060 1326 gene locus_tag LOCUS_15200 gene phbB 2060 1326 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813586.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence318 1201 458 gene locus_tag LOCUS_15210 1201 458 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_15210 <2343 1210 gene locus_tag LOCUS_15220 <2343 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087267.1:oxygen-independent coproporphyrinogen III oxidase >Feature sequence319 890 420 gene locus_tag LOCUS_15230 890 420 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 protein_id gnl|my_center|LOCUS_15230 1212 1883 gene locus_tag LOCUS_15240 1212 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2287 2003 gene locus_tag LOCUS_15250 2287 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence320 >Feature sequence321 644 90 gene locus_tag LOCUS_15260 644 90 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524888.1 protein_id gnl|my_center|LOCUS_15260 892 1767 gene locus_tag LOCUS_15270 892 1767 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_15270 2052 2061 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence322 582 658 gene locus_tag LOCUS_t00290 582 658 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence323 1709 1038 gene locus_tag LOCUS_15280 1709 1038 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447174.1 protein_id gnl|my_center|LOCUS_15280 <2323 1706 gene locus_tag LOCUS_15290 <2323 1706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008500810.1:flagellar basal-body rod protein FlgG >Feature sequence324 3 410 gene locus_tag LOCUS_15300 3 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence325 <1 612 gene locus_tag LOCUS_15310 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200150.1:50S ribosomal protein L25/general stress protein Ctc 679 1287 gene locus_tag LOCUS_15320 gene pth 679 1287 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931308.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence326 3 218 gene locus_tag LOCUS_15330 3 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 306 1664 gene locus_tag LOCUS_15340 306 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 <2311 1748 gene locus_tag LOCUS_15350 <2311 1748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259741.1:lipid II flippase MurJ >Feature sequence327 1039 2172 gene locus_tag LOCUS_15360 gene carA 1039 2172 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence328 <1 1492 gene locus_tag LOCUS_15370 <1 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140963.1:allophanate hydrolase 1731 1486 gene locus_tag LOCUS_15380 1731 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1954 1682 gene locus_tag LOCUS_15390 1954 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence329 228 1547 gene locus_tag LOCUS_15400 228 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1540 2289 gene locus_tag LOCUS_15410 1540 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence330 1129 1641 gene locus_tag LOCUS_15420 1129 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 <2296 1646 gene locus_tag LOCUS_15430 <2296 1646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267921.1:feruloyl-CoA synthase >Feature sequence331 2 652 gene locus_tag LOCUS_15440 2 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 649 2037 gene locus_tag LOCUS_15450 gene murC 649 2037 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194319.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence332 1012 425 gene locus_tag LOCUS_15460 1012 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1350 1075 gene locus_tag LOCUS_15470 1350 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1337 2014 gene locus_tag LOCUS_15480 1337 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence333 926 417 gene locus_tag LOCUS_15490 gene rsfS 926 417 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185806.1 protein_id gnl|my_center|LOCUS_15490 1572 931 gene locus_tag LOCUS_15500 gene nadD 1572 931 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080561922.1 protein_id gnl|my_center|LOCUS_15500 <2271 1575 gene locus_tag LOCUS_15510 <2271 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526433.1:oxygen-dependent coproporphyrinogen oxidase >Feature sequence334 >Feature sequence335 258 1460 gene locus_tag LOCUS_15520 258 1460 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400420.1 protein_id gnl|my_center|LOCUS_15520 1513 1977 gene locus_tag LOCUS_15530 gene ssb 1513 1977 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence336 <1 1588 gene locus_tag LOCUS_15540 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940735.1:CRISPR-associated endonuclease Cas1 1598 1891 gene locus_tag LOCUS_15550 gene cas2 1598 1891 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940736.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence337 <2236 782 gene locus_tag LOCUS_15560 <2236 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004536557.1:methyl-accepting chemotaxis protein >Feature sequence338 1132 1716 gene locus_tag LOCUS_15570 1132 1716 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197233.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence339 374 715 gene locus_tag LOCUS_15580 374 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265779.1 protein_id gnl|my_center|LOCUS_15580 865 1572 gene locus_tag LOCUS_15590 865 1572 CDS product protocatechuate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922892.1 protein_id gnl|my_center|LOCUS_15590 <2235 1706 gene locus_tag LOCUS_15600 <2235 1706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118837937.1:carotenoid oxygenase family protein >Feature sequence340 1010 627 gene locus_tag LOCUS_15610 1010 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1287 1200 gene locus_tag LOCUS_t00300 1287 1200 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1799 1488 gene locus_tag LOCUS_15620 gene soxZ 1799 1488 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932697.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence341 1858 239 gene locus_tag LOCUS_15630 1858 239 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526341.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence342 1188 1421 gene locus_tag LOCUS_15640 1188 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1418 1819 gene locus_tag LOCUS_15650 1418 1819 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092226.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence343 863 39 gene locus_tag LOCUS_15660 863 39 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957509.1 protein_id gnl|my_center|LOCUS_15660 1081 866 gene locus_tag LOCUS_15670 1081 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2121 1081 gene locus_tag LOCUS_15680 gene thiO 2121 1081 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957508.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence344 1698 892 gene locus_tag LOCUS_15690 1698 892 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527360.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence345 1145 537 gene locus_tag LOCUS_15700 1145 537 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113581.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence346 1408 137 gene locus_tag LOCUS_15710 1408 137 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967050.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence347 <1 535 gene locus_tag LOCUS_15720 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926132.1:biotin synthase BioB 1817 699 gene locus_tag LOCUS_15730 1817 699 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085825.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence348 <1 1671 gene locus_tag LOCUS_15740 <1 1671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195264.1:nitrite reductase large subunit NirB 1668 2075 gene locus_tag LOCUS_15750 1668 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence349 796 407 gene locus_tag LOCUS_15760 796 407 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194678.1 protein_id gnl|my_center|LOCUS_15760 1180 905 gene locus_tag LOCUS_15770 1180 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence350 996 364 gene locus_tag LOCUS_15780 gene plsY 996 364 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_15780 1501 998 gene locus_tag LOCUS_15790 gene ybaK 1501 998 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 protein_id gnl|my_center|LOCUS_15790 2126 1521 gene locus_tag LOCUS_15800 2126 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence351 659 1990 gene locus_tag LOCUS_15810 659 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence352 864 394 gene locus_tag LOCUS_15820 gene dtd 864 394 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200499.1 protein_id gnl|my_center|LOCUS_15820 2086 875 gene locus_tag LOCUS_15830 gene tyrS 2086 875 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194043.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence353 1064 120 gene locus_tag LOCUS_15840 1064 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence354 748 263 gene locus_tag LOCUS_15850 748 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1421 1029 gene locus_tag LOCUS_15860 1421 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence355 85 723 gene locus_tag LOCUS_15870 85 723 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195230.1 protein_id gnl|my_center|LOCUS_15870 725 1255 gene locus_tag LOCUS_15880 725 1255 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808796.1 protein_id gnl|my_center|LOCUS_15880 <2091 1204 gene locus_tag LOCUS_15890 <2091 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195232.1:A/G-specific adenine glycosylase >Feature sequence356 1841 1848 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence357 236 403 gene locus_tag LOCUS_15900 236 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1877 567 gene locus_tag LOCUS_15910 1877 567 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence358 <1 1273 gene locus_tag LOCUS_15920 <1 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003821527.1:acyl-CoA dehydrogenase 1418 1840 gene locus_tag LOCUS_15930 1418 1840 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence359 1712 366 gene locus_tag LOCUS_15940 1712 366 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence360 >Feature sequence361 668 1144 gene locus_tag LOCUS_15950 668 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence362 <2026 650 gene locus_tag LOCUS_15960 <2026 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527788.1:long-chain fatty acid--CoA ligase >Feature sequence363 280 1152 gene locus_tag LOCUS_15970 280 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1177 1677 gene locus_tag LOCUS_15980 1177 1677 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086736.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence364 435 974 gene locus_tag LOCUS_15990 435 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 983 1393 gene locus_tag LOCUS_16000 983 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1468 1647 gene locus_tag LOCUS_16010 1468 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1634 1816 gene locus_tag LOCUS_16020 1634 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1816 1974 gene locus_tag LOCUS_16030 1816 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence365 781 50 gene locus_tag LOCUS_16040 gene dsrM 781 50 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878008.1 protein_id gnl|my_center|LOCUS_16040 1162 827 gene locus_tag LOCUS_16050 1162 827 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_16050 1481 1185 gene locus_tag LOCUS_16060 gene tusB 1481 1185 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481146.1 protein_id gnl|my_center|LOCUS_16060 1854 1495 gene locus_tag LOCUS_16070 gene tusC 1854 1495 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458285.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence366 1240 326 gene locus_tag LOCUS_16080 1240 326 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 protein_id gnl|my_center|LOCUS_16080 1408 1968 gene locus_tag LOCUS_16090 1408 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence367 >Feature sequence368 <1 521 gene locus_tag LOCUS_16100 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189550.1:rod shape-determining protein 617 1519 gene locus_tag LOCUS_16110 gene mreC 617 1519 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence369 1600 1397 gene locus_tag LOCUS_16120 1600 1397 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence370 982 674 gene locus_tag LOCUS_16130 982 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1809 979 gene locus_tag LOCUS_16140 1809 979 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence371 480 1181 gene locus_tag LOCUS_16150 480 1181 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532296.1 protein_id gnl|my_center|LOCUS_16150 1178 1849 gene locus_tag LOCUS_16160 gene gph 1178 1849 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190123.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence372 1625 657 gene locus_tag LOCUS_16170 1625 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence373 1289 363 gene locus_tag LOCUS_16180 gene carH 1289 363 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence374 >Feature sequence375 <1 561 gene locus_tag LOCUS_16190 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192390.1:GNAT family N-acetyltransferase 1062 883 gene locus_tag LOCUS_16200 1062 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16200 >Feature sequence376 >Feature sequence377 >Feature sequence378 >Feature sequence379 >Feature sequence380 1890 493 gene locus_tag LOCUS_16210 1890 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence381 <1892 542 gene locus_tag LOCUS_16220 <1892 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948598.1:ATP-binding protein >Feature sequence382 >Feature sequence383 <1 815 gene locus_tag LOCUS_16230 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525689.1:branched-chain amino acid ABC transporter substrate-binding protein >Feature sequence384 <1857 502 gene locus_tag LOCUS_16240 <1857 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256318.1:SdrD B-like domain-containing protein >Feature sequence385 621 776 gene locus_tag LOCUS_16250 621 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16250 1062 886 gene locus_tag LOCUS_16260 1062 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 <1856 1327 gene locus_tag LOCUS_16270 <1856 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003526374.1:carbohydrate ABC transporter permease >Feature sequence386 <1 1342 gene locus_tag LOCUS_16280 <1 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113216.1:EAL domain-containing protein >Feature sequence387 544 236 gene locus_tag LOCUS_16290 gene rplU 544 236 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_16290 602 1735 gene locus_tag LOCUS_16300 gene ispB 602 1735 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807467.1 protein_id gnl|my_center|LOCUS_16300 1762 1837 gene locus_tag LOCUS_t00310 1762 1837 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence388 847 89 gene locus_tag LOCUS_16310 847 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 <1833 996 gene locus_tag LOCUS_16320 <1833 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198639.1:flagellar biosynthesis protein FlhA >Feature sequence389 126 201 gene locus_tag LOCUS_t00320 126 201 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 238 313 gene locus_tag LOCUS_t00330 238 313 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 353 429 gene locus_tag LOCUS_t00340 353 429 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1615 680 gene locus_tag LOCUS_16330 1615 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence390 1821 1399 gene locus_tag LOCUS_16340 1821 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence391 2 577 gene locus_tag LOCUS_16350 2 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 699 962 gene locus_tag LOCUS_16360 699 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1055 980 gene locus_tag LOCUS_t00350 1055 980 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 <1801 1076 gene locus_tag LOCUS_16370 <1801 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198124.1:aspartate/tyrosine/aromatic aminotransferase >Feature sequence392 303 602 gene locus_tag LOCUS_16380 303 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_16380 599 1372 gene locus_tag LOCUS_16390 599 1372 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence393 1405 182 gene locus_tag LOCUS_16400 1405 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence394 483 172 gene locus_tag LOCUS_16410 483 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1001 819 gene locus_tag LOCUS_16420 1001 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1242 1027 gene locus_tag LOCUS_16430 1242 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence395 643 1494 gene locus_tag LOCUS_16440 643 1494 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528449.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence396 1692 991 gene locus_tag LOCUS_16450 1692 991 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence397 <1 849 gene locus_tag LOCUS_16460 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065159.1:citrate synthase 1126 1470 gene locus_tag LOCUS_16470 1126 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence398 1 294 gene locus_tag LOCUS_16480 1 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 291 1547 gene locus_tag LOCUS_16490 gene fahA 291 1547 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818932.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence399 1481 255 gene locus_tag LOCUS_16500 1481 255 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223851191.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence400 840 184 gene locus_tag LOCUS_16510 840 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1103 903 gene locus_tag LOCUS_16520 1103 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence401 802 59 gene locus_tag LOCUS_16530 802 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 <1718 830 gene locus_tag LOCUS_16540 <1718 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527788.1:long-chain fatty acid--CoA ligase >Feature sequence402 3 332 gene locus_tag LOCUS_16550 3 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 495 1568 gene locus_tag LOCUS_16560 495 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence403 217 741 gene locus_tag LOCUS_16570 217 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16570 751 1110 gene locus_tag LOCUS_16580 751 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16580 1228 1629 gene locus_tag LOCUS_16590 1228 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16590 1434 1443 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence404 1290 352 gene locus_tag LOCUS_16600 1290 352 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence405 1586 171 gene locus_tag LOCUS_16610 gene argH 1586 171 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191886.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence406 >Feature sequence407 1173 469 gene locus_tag LOCUS_16620 1173 469 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257174.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence408 <1 771 gene locus_tag LOCUS_16630 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072348.1:cytochrome-c oxidase, cbb3-type subunit III >Feature sequence409 >Feature sequence410 443 96 gene locus_tag LOCUS_16640 gene sugE 443 96 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932066.1 protein_id gnl|my_center|LOCUS_16640 530 1450 gene locus_tag LOCUS_16650 530 1450 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence411 460 68 gene locus_tag LOCUS_16660 gene rpsI 460 68 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_16660 903 457 gene locus_tag LOCUS_16670 gene rplM 903 457 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_16670 1065 1496 gene locus_tag LOCUS_16680 1065 1496 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808444.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence412 >Feature sequence413 143 901 gene locus_tag LOCUS_16690 143 901 CDS product hydrolase 2, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390871.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence414 <1550 984 gene locus_tag LOCUS_16700 <1550 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973277.1:DinB family protein >Feature sequence415 <1 895 gene locus_tag LOCUS_16710 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969663.1:TRAP transporter substrate-binding protein >Feature sequence416 509 279 gene locus_tag LOCUS_16720 509 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 973 506 gene locus_tag LOCUS_16730 973 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence417 <1 603 gene locus_tag LOCUS_16740 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815935.1:arginine--tRNA ligase 606 1145 gene locus_tag LOCUS_16750 606 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence418 867 1388 gene locus_tag LOCUS_16760 867 1388 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189096.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence419 >Feature sequence420 104 754 gene locus_tag LOCUS_16770 104 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 831 1058 gene locus_tag LOCUS_16780 831 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence421 515 1216 gene locus_tag LOCUS_16790 515 1216 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812687.1 protein_id gnl|my_center|LOCUS_16790 1492 1226 gene locus_tag LOCUS_16800 1492 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence422 <1 873 gene locus_tag LOCUS_16810 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039854.1:bifunctional tetrahydrofolate synthase/dihydrofolate synthase 916 1458 gene locus_tag LOCUS_16820 916 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence423 >Feature sequence424 1213 515 gene locus_tag LOCUS_16830 1213 515 CDS product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920346.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence425 669 349 gene locus_tag LOCUS_16840 669 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 946 674 gene locus_tag LOCUS_16850 946 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence426 >Feature sequence427 <1407 388 gene locus_tag LOCUS_16860 <1407 388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870202.1:magnesium transporter >Feature sequence428 <1 539 gene locus_tag LOCUS_16870 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144248.1:molecular chaperone DnaK >Feature sequence429 >Feature sequence430 >Feature sequence431 <1327 197 gene locus_tag LOCUS_16880 <1327 197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189008.1:glycine--tRNA ligase subunit beta >Feature sequence432 223 408 gene locus_tag LOCUS_16890 223 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 459 535 gene locus_tag LOCUS_t00360 459 535 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 541 616 gene locus_tag LOCUS_t00370 541 616 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 622 695 gene locus_tag LOCUS_t00380 622 695 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 708 797 gene locus_tag LOCUS_t00390 708 797 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1057 1130 gene locus_tag LOCUS_t00400 1057 1130 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence433 308 964 gene locus_tag LOCUS_16900 308 964 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942828.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence434 >Feature sequence435 <1151 556 gene locus_tag LOCUS_16910 <1151 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004543739.1:methyl-accepting chemotaxis protein >Feature sequence436 >Feature sequence437 561 989 gene locus_tag LOCUS_16920 561 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence438 37 1026 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttatccgcggcaaattgccgcggcctcattgaagc >Feature sequence439 8 986 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatgaggccgcggctcttcgccgcggaaaac >Feature sequence440 <1 580 gene locus_tag LOCUS_16930 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228998.1:carbon-nitrogen hydrolase >Feature sequence441 >Feature sequence442 622 347 gene locus_tag LOCUS_16940 622 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence443 <1 748 gene locus_tag LOCUS_16950 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195844.1:acyl-CoA dehydrogenase family protein >Feature sequence444 698 276 gene locus_tag LOCUS_16960 698 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence445 >Feature sequence446 728 638 gene locus_tag LOCUS_t00410 728 638 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence447 632 48 gene locus_tag LOCUS_16970 gene cheD 632 48 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_16970 652 661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence448 121 702 gene locus_tag LOCUS_16980 121 702 CDS product polyhydroxyalkanoate synthesis regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909395.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence449 >Feature sequence450 708 409 gene locus_tag LOCUS_16990 708 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16990 >Feature sequence451 <1 525 gene locus_tag LOCUS_17000 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223804324.1:pilin >Feature sequence452 392 401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence453 >Feature sequence454 557 566 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence455 >Feature sequence456 <1 709 gene locus_tag LOCUS_17010 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063921532.1:glycerophosphodiester phosphodiesterase >Feature sequence457 >Feature sequence458 >Feature sequence459 444 190 gene locus_tag LOCUS_17020 444 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17020 425 434 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence460 <1 681 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attatccgccgtgtaggcggcttagaag >Feature sequence461 <670 157 gene locus_tag LOCUS_17030 <670 157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003703604.1:OmpA family protein >Feature sequence462 >Feature sequence463 >Feature sequence464 373 382 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence465 64 158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence466 >Feature sequence467 >Feature sequence468 541 29 gene locus_tag LOCUS_17040 gene rfaE2 541 29 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189202.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence469 >Feature sequence470 <1 508 gene locus_tag LOCUS_17050 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114106.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase >Feature sequence471 >Feature sequence472 >Feature sequence473 >Feature sequence474 >Feature sequence475 >Feature sequence476 >Feature sequence477 >Feature sequence478 >Feature sequence479 >Feature sequence480 >Feature sequence481 >Feature sequence482 417 109 gene locus_tag LOCUS_17060 417 109 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence483 >Feature sequence484 >Feature sequence485 41 510 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatgaggccgcggctcttcgccgcggaaaac >Feature sequence486 >Feature sequence487 >Feature sequence488 >Feature sequence489 >Feature sequence490