>Feature sequence01 465 1736 gene locus_tag LOCUS_00010 465 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1733 2605 gene locus_tag LOCUS_00020 1733 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3987 2602 gene locus_tag LOCUS_00030 3987 2602 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_00030 4115 5803 gene locus_tag LOCUS_00040 4115 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5848 7815 gene locus_tag LOCUS_00050 5848 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8722 7826 gene locus_tag LOCUS_00060 8722 7826 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234629.1 protein_id gnl|my_center|LOCUS_00060 8960 9412 gene locus_tag LOCUS_00070 8960 9412 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_00070 9415 9648 gene locus_tag LOCUS_00080 9415 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11736 10918 gene locus_tag LOCUS_00090 11736 10918 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848056.1 protein_id gnl|my_center|LOCUS_00090 11788 12438 gene locus_tag LOCUS_00100 11788 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12489 13103 gene locus_tag LOCUS_00110 12489 13103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13210 14226 gene locus_tag LOCUS_00120 gene pdhA 13210 14226 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980946.1 protein_id gnl|my_center|LOCUS_00120 14239 15216 gene locus_tag LOCUS_00130 14239 15216 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_00130 15237 16709 gene locus_tag LOCUS_00140 15237 16709 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062320.1 protein_id gnl|my_center|LOCUS_00140 17181 16747 gene locus_tag LOCUS_00150 17181 16747 CDS product bacitracin resistance protein BacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007616.1 protein_id gnl|my_center|LOCUS_00150 17283 17798 gene locus_tag LOCUS_00160 17283 17798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18105 19001 gene locus_tag LOCUS_00170 18105 19001 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107373.1 protein_id gnl|my_center|LOCUS_00170 19007 20146 gene locus_tag LOCUS_00180 gene thiH 19007 20146 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_00180 20189 20716 gene locus_tag LOCUS_00190 gene trmL 20189 20716 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_00190 21654 20731 gene locus_tag LOCUS_00200 21654 20731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22418 21903 gene locus_tag LOCUS_00210 gene crtO 22418 21903 CDS product glycosyl-4,4'-diaponeurosporenoate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805835.1 protein_id gnl|my_center|LOCUS_00210 23053 22415 gene locus_tag LOCUS_00220 23053 22415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23525 23016 gene locus_tag LOCUS_00230 23525 23016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00230 23886 25199 gene locus_tag LOCUS_00240 gene murA 23886 25199 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257925.1 protein_id gnl|my_center|LOCUS_00240 25486 26019 gene locus_tag LOCUS_00250 25486 26019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27384 26173 gene locus_tag LOCUS_00260 27384 26173 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485071.1 protein_id gnl|my_center|LOCUS_00260 27491 27673 gene locus_tag LOCUS_00270 27491 27673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29801 27705 gene locus_tag LOCUS_00280 gene recG 29801 27705 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798669.1 protein_id gnl|my_center|LOCUS_00280 31551 29977 gene locus_tag LOCUS_00290 31551 29977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32695 31781 gene locus_tag LOCUS_00300 gene lpxC 32695 31781 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447207.1 protein_id gnl|my_center|LOCUS_00300 33054 33716 gene locus_tag LOCUS_00310 33054 33716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34506 33718 gene locus_tag LOCUS_00320 gene yaaA 34506 33718 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947096.1 protein_id gnl|my_center|LOCUS_00320 35144 34503 gene locus_tag LOCUS_00330 35144 34503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 37277 35310 gene locus_tag LOCUS_00340 37277 35310 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416237.1 protein_id gnl|my_center|LOCUS_00340 38031 37357 gene locus_tag LOCUS_00350 38031 37357 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_00350 38116 38724 gene locus_tag LOCUS_00360 38116 38724 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174792.1 protein_id gnl|my_center|LOCUS_00360 38766 39248 gene locus_tag LOCUS_00370 38766 39248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 39245 39829 gene locus_tag LOCUS_00380 39245 39829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40419 39832 gene locus_tag LOCUS_00390 40419 39832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 40873 40388 gene locus_tag LOCUS_00400 40873 40388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 41254 40952 gene locus_tag LOCUS_00410 41254 40952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 43146 41251 gene locus_tag LOCUS_00420 43146 41251 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332595.1 protein_id gnl|my_center|LOCUS_00420 43220 44137 gene locus_tag LOCUS_00430 43220 44137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44955 44155 gene locus_tag LOCUS_00440 44955 44155 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402846.1 protein_id gnl|my_center|LOCUS_00440 45514 44981 gene locus_tag LOCUS_00450 45514 44981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 45959 45504 gene locus_tag LOCUS_00460 45959 45504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 46483 45956 gene locus_tag LOCUS_00470 46483 45956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 47993 46527 gene locus_tag LOCUS_00480 47993 46527 CDS product Mur ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708409.1 protein_id gnl|my_center|LOCUS_00480 48650 49594 gene locus_tag LOCUS_00490 48650 49594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 49787 50656 gene locus_tag LOCUS_00500 49787 50656 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_00500 50720 51157 gene locus_tag LOCUS_00510 gene fliS 50720 51157 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050477.1 protein_id gnl|my_center|LOCUS_00510 51160 51492 gene locus_tag LOCUS_00520 51160 51492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 51553 53220 gene locus_tag LOCUS_00530 51553 53220 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837584.1 protein_id gnl|my_center|LOCUS_00530 53217 53411 gene locus_tag LOCUS_00540 53217 53411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 53963 53421 gene locus_tag LOCUS_00550 53963 53421 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067248.1 protein_id gnl|my_center|LOCUS_00550 55102 53966 gene locus_tag LOCUS_00560 55102 53966 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951973.1 protein_id gnl|my_center|LOCUS_00560 55682 55119 gene locus_tag LOCUS_00570 gene efp 55682 55119 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172195.1 protein_id gnl|my_center|LOCUS_00570 56610 55912 gene locus_tag LOCUS_00580 gene rpiA 56610 55912 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057113.1 protein_id gnl|my_center|LOCUS_00580 57683 56613 gene locus_tag LOCUS_00590 gene meaB 57683 56613 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784891.1 protein_id gnl|my_center|LOCUS_00590 59854 57680 gene locus_tag LOCUS_00600 gene scpA 59854 57680 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_00600 61764 59866 gene locus_tag LOCUS_00610 61764 59866 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013245.1 protein_id gnl|my_center|LOCUS_00610 63630 61837 gene locus_tag LOCUS_00620 63630 61837 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166984.1 protein_id gnl|my_center|LOCUS_00620 65259 63649 gene locus_tag LOCUS_00630 65259 63649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 65807 65295 gene locus_tag LOCUS_00640 65807 65295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 67238 65817 gene locus_tag LOCUS_00650 67238 65817 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412099.1 protein_id gnl|my_center|LOCUS_00650 67478 68398 gene locus_tag LOCUS_00660 gene xerD 67478 68398 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204200.1 protein_id gnl|my_center|LOCUS_00660 68520 69887 gene locus_tag LOCUS_00670 68520 69887 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_00670 69947 70243 gene locus_tag LOCUS_00680 69947 70243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714458.1 protein_id gnl|my_center|LOCUS_00680 71677 70268 gene locus_tag LOCUS_00690 gene fumC 71677 70268 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_00690 73153 71747 gene locus_tag LOCUS_00700 73153 71747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 74759 73137 gene locus_tag LOCUS_00710 74759 73137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 75958 74756 gene locus_tag LOCUS_00720 75958 74756 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444859.1 protein_id gnl|my_center|LOCUS_00720 77446 75962 gene locus_tag LOCUS_00730 77446 75962 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_00730 78153 77443 gene locus_tag LOCUS_00740 78153 77443 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444858.1 protein_id gnl|my_center|LOCUS_00740 78994 78176 gene locus_tag LOCUS_00750 78994 78176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 79967 78978 gene locus_tag LOCUS_00760 79967 78978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 80460 80029 gene locus_tag LOCUS_00770 80460 80029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 81310 80477 gene locus_tag LOCUS_00780 81310 80477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 81732 82256 gene locus_tag LOCUS_00790 81732 82256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 82346 82720 gene locus_tag LOCUS_00800 82346 82720 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888483.1 protein_id gnl|my_center|LOCUS_00800 82729 83127 gene locus_tag LOCUS_00810 82729 83127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 84088 83129 gene locus_tag LOCUS_00820 84088 83129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 86054 84165 gene locus_tag LOCUS_00830 gene mnmC 86054 84165 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947261.1 protein_id gnl|my_center|LOCUS_00830 86071 86889 gene locus_tag LOCUS_00840 86071 86889 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528194.1 protein_id gnl|my_center|LOCUS_00840 86892 87509 gene locus_tag LOCUS_00850 86892 87509 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_00850 87812 89194 gene locus_tag LOCUS_00860 87812 89194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 89291 89836 gene locus_tag LOCUS_00870 89291 89836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 90039 91307 gene locus_tag LOCUS_00880 90039 91307 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995952.1 protein_id gnl|my_center|LOCUS_00880 91350 91958 gene locus_tag LOCUS_00890 91350 91958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 92327 91941 gene locus_tag LOCUS_00900 92327 91941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 92566 92243 gene locus_tag LOCUS_00910 92566 92243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 93341 92571 gene locus_tag LOCUS_00920 93341 92571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 93366 93635 gene locus_tag LOCUS_00930 93366 93635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 95404 93638 gene locus_tag LOCUS_00940 95404 93638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760152.1 protein_id gnl|my_center|LOCUS_00940 96070 95456 gene locus_tag LOCUS_00950 96070 95456 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274345.1 protein_id gnl|my_center|LOCUS_00950 96833 96072 gene locus_tag LOCUS_00960 96833 96072 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043153.1 protein_id gnl|my_center|LOCUS_00960 97118 98467 gene locus_tag LOCUS_00970 97118 98467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 99604 98498 gene locus_tag LOCUS_00980 gene prfA 99604 98498 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880532.1 protein_id gnl|my_center|LOCUS_00980 101209 99656 gene locus_tag LOCUS_00990 gene gltX 101209 99656 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076468.1 protein_id gnl|my_center|LOCUS_00990 101636 101217 gene locus_tag LOCUS_01000 101636 101217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 102271 101603 gene locus_tag LOCUS_01010 gene lipB 102271 101603 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004754331.1 protein_id gnl|my_center|LOCUS_01010 102920 102261 gene locus_tag LOCUS_01020 102920 102261 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_01020 102965 104251 gene locus_tag LOCUS_01030 102965 104251 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_01030 104736 105167 gene locus_tag LOCUS_01040 gene umuD 104736 105167 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124912.1 protein_id gnl|my_center|LOCUS_01040 105142 106440 gene locus_tag LOCUS_01050 105142 106440 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705677.1 protein_id gnl|my_center|LOCUS_01050 106590 107093 gene locus_tag LOCUS_01060 106590 107093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 107776 107231 gene locus_tag LOCUS_01070 107776 107231 CDS product lipoprotein LipL21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610519.1 protein_id gnl|my_center|LOCUS_01070 107768 108727 gene locus_tag LOCUS_01080 107768 108727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 109883 108702 gene locus_tag LOCUS_01090 109883 108702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 109996 109910 gene locus_tag LOCUS_t00010 109996 109910 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 110076 110002 gene locus_tag LOCUS_t00020 110076 110002 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 111495 110140 gene locus_tag LOCUS_01100 gene bioA 111495 110140 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655595.1 protein_id gnl|my_center|LOCUS_01100 111733 112110 gene locus_tag LOCUS_01110 111733 112110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 112190 113317 gene locus_tag LOCUS_01120 112190 113317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 113310 115229 gene locus_tag LOCUS_01130 113310 115229 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247314.1 protein_id gnl|my_center|LOCUS_01130 115265 116332 gene locus_tag LOCUS_01140 115265 116332 CDS product DUF1577 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116023.1 protein_id gnl|my_center|LOCUS_01140 116334 117668 gene locus_tag LOCUS_01150 gene hisS 116334 117668 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_01150 118704 117700 gene locus_tag LOCUS_01160 gene ilvC 118704 117700 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284348.1 protein_id gnl|my_center|LOCUS_01160 118851 119978 gene locus_tag LOCUS_01170 118851 119978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 120006 121322 gene locus_tag LOCUS_01180 120006 121322 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 protein_id gnl|my_center|LOCUS_01180 122426 121311 gene locus_tag LOCUS_01190 122426 121311 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834066.1 protein_id gnl|my_center|LOCUS_01190 122661 122410 gene locus_tag LOCUS_01200 122661 122410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 123787 122663 gene locus_tag LOCUS_01210 123787 122663 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127234.1 protein_id gnl|my_center|LOCUS_01210 125926 123791 gene locus_tag LOCUS_01220 125926 123791 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_01220 127828 125990 gene locus_tag LOCUS_01230 gene glmS 127828 125990 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334327.1 protein_id gnl|my_center|LOCUS_01230 128105 129850 gene locus_tag LOCUS_01240 128105 129850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 129923 130435 gene locus_tag LOCUS_01250 129923 130435 CDS product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053574.1 protein_id gnl|my_center|LOCUS_01250 131294 130452 gene locus_tag LOCUS_01260 131294 130452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785351.1 protein_id gnl|my_center|LOCUS_01260 131475 131284 gene locus_tag LOCUS_01270 131475 131284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 132373 131618 gene locus_tag LOCUS_01280 132373 131618 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001977544.1 protein_id gnl|my_center|LOCUS_01280 132504 133031 gene locus_tag LOCUS_01290 132504 133031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 134718 133036 gene locus_tag LOCUS_01300 134718 133036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 136195 134726 gene locus_tag LOCUS_01310 136195 134726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 136431 136323 gene locus_tag LOCUS_r00010 136431 136323 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 136557 137480 gene locus_tag LOCUS_01320 136557 137480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 139811 138180 gene locus_tag LOCUS_01330 gene groL 139811 138180 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029966.1 protein_id gnl|my_center|LOCUS_01330 140147 139863 gene locus_tag LOCUS_01340 gene groES 140147 139863 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146552.1 protein_id gnl|my_center|LOCUS_01340 140484 141893 gene locus_tag LOCUS_01350 140484 141893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 141959 142483 gene locus_tag LOCUS_01360 141959 142483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 142480 143502 gene locus_tag LOCUS_01370 142480 143502 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176666.1 protein_id gnl|my_center|LOCUS_01370 143495 144778 gene locus_tag LOCUS_01380 143495 144778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 144782 145456 gene locus_tag LOCUS_01390 144782 145456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01390 146518 145457 gene locus_tag LOCUS_01400 146518 145457 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972959.1 protein_id gnl|my_center|LOCUS_01400 148243 146723 gene locus_tag LOCUS_01410 148243 146723 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930810.1 protein_id gnl|my_center|LOCUS_01410 148351 148776 gene locus_tag LOCUS_01420 148351 148776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 148869 149210 gene locus_tag LOCUS_01430 148869 149210 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023831.1 protein_id gnl|my_center|LOCUS_01430 149219 149584 gene locus_tag LOCUS_01440 gene crcB 149219 149584 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880255.1 protein_id gnl|my_center|LOCUS_01440 149747 150172 gene locus_tag LOCUS_01450 149747 150172 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_01450 150192 151364 gene locus_tag LOCUS_01460 gene ahbC 150192 151364 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_01460 151361 152539 gene locus_tag LOCUS_01470 gene nirF 151361 152539 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_01470 152563 153603 gene locus_tag LOCUS_01480 152563 153603 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_01480 153674 155653 gene locus_tag LOCUS_01490 gene nirS 153674 155653 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_01490 156288 155692 gene locus_tag LOCUS_01500 156288 155692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 156580 157584 gene locus_tag LOCUS_01510 156580 157584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 157587 160211 gene locus_tag LOCUS_01520 157587 160211 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052877.1 protein_id gnl|my_center|LOCUS_01520 160208 160738 gene locus_tag LOCUS_01530 160208 160738 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932621.1 protein_id gnl|my_center|LOCUS_01530 160735 162093 gene locus_tag LOCUS_01540 160735 162093 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022072.1 protein_id gnl|my_center|LOCUS_01540 162090 162293 gene locus_tag LOCUS_01550 162090 162293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 162305 162787 gene locus_tag LOCUS_01560 162305 162787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 162797 163339 gene locus_tag LOCUS_01570 162797 163339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 163317 164549 gene locus_tag LOCUS_01580 163317 164549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 164536 165738 gene locus_tag LOCUS_01590 164536 165738 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025017.1 protein_id gnl|my_center|LOCUS_01590 165751 166119 gene locus_tag LOCUS_01600 165751 166119 CDS product DUF3209 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752159.1 protein_id gnl|my_center|LOCUS_01600 166142 166819 gene locus_tag LOCUS_01610 166142 166819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 166823 168667 gene locus_tag LOCUS_01620 166823 168667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 168654 169301 gene locus_tag LOCUS_01630 gene cbiC 168654 169301 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 protein_id gnl|my_center|LOCUS_01630 169305 170525 gene locus_tag LOCUS_01640 169305 170525 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649057.1 protein_id gnl|my_center|LOCUS_01640 170543 171328 gene locus_tag LOCUS_01650 gene cobI 170543 171328 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092521.1 protein_id gnl|my_center|LOCUS_01650 171325 172455 gene locus_tag LOCUS_01660 171325 172455 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828196.1 protein_id gnl|my_center|LOCUS_01660 172448 173293 gene locus_tag LOCUS_01670 172448 173293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 173286 173693 gene locus_tag LOCUS_01680 173286 173693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 173704 174465 gene locus_tag LOCUS_01690 gene cobM 173704 174465 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870280.1 protein_id gnl|my_center|LOCUS_01690 174673 174503 gene locus_tag LOCUS_01700 174673 174503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 174778 175278 gene locus_tag LOCUS_01710 174778 175278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 175259 176002 gene locus_tag LOCUS_01720 175259 176002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 177105 176008 gene locus_tag LOCUS_01730 177105 176008 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512781.1 protein_id gnl|my_center|LOCUS_01730 177220 177429 gene locus_tag LOCUS_01740 177220 177429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 180284 177417 gene locus_tag LOCUS_01750 180284 177417 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061293285.1 protein_id gnl|my_center|LOCUS_01750 181096 180329 gene locus_tag LOCUS_01760 181096 180329 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_01760 181481 181179 gene locus_tag LOCUS_01770 181481 181179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 183017 181596 gene locus_tag LOCUS_01780 183017 181596 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_01780 183345 183031 gene locus_tag LOCUS_01790 183345 183031 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_01790 184501 183359 gene locus_tag LOCUS_01800 184501 183359 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125393.1 protein_id gnl|my_center|LOCUS_01800 185999 184623 gene locus_tag LOCUS_01810 185999 184623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 186478 186107 gene locus_tag LOCUS_01820 186478 186107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 188647 186584 gene locus_tag LOCUS_01830 gene uvrB 188647 186584 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179030.1 protein_id gnl|my_center|LOCUS_01830 189284 188634 gene locus_tag LOCUS_01840 189284 188634 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144004.1 protein_id gnl|my_center|LOCUS_01840 190164 189271 gene locus_tag LOCUS_01850 190164 189271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 190193 190894 gene locus_tag LOCUS_01860 190193 190894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135390.1 protein_id gnl|my_center|LOCUS_01860 192178 190895 gene locus_tag LOCUS_01870 gene xseA 192178 190895 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390226.1 protein_id gnl|my_center|LOCUS_01870 193312 192191 gene locus_tag LOCUS_01880 193312 192191 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572375.1 protein_id gnl|my_center|LOCUS_01880 193763 193305 gene locus_tag LOCUS_01890 193763 193305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 195757 193760 gene locus_tag LOCUS_01900 195757 193760 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063951.1 protein_id gnl|my_center|LOCUS_01900 196063 196593 gene locus_tag LOCUS_01910 196063 196593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 196583 198469 gene locus_tag LOCUS_01920 196583 198469 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088499.1 protein_id gnl|my_center|LOCUS_01920 198966 198505 gene locus_tag LOCUS_01930 198966 198505 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 protein_id gnl|my_center|LOCUS_01930 199902 199093 gene locus_tag LOCUS_01940 199902 199093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 202637 199974 gene locus_tag LOCUS_01950 202637 199974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 202679 204052 gene locus_tag LOCUS_01960 202679 204052 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884774.1 protein_id gnl|my_center|LOCUS_01960 204876 204055 gene locus_tag LOCUS_01970 204876 204055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 205422 205135 gene locus_tag LOCUS_01980 205422 205135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 206222 205548 gene locus_tag LOCUS_01990 206222 205548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 207076 206234 gene locus_tag LOCUS_02000 207076 206234 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728716.1 protein_id gnl|my_center|LOCUS_02000 207207 207395 gene locus_tag LOCUS_02010 207207 207395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 207405 207770 gene locus_tag LOCUS_02020 207405 207770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 207772 209163 gene locus_tag LOCUS_02030 207772 209163 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506556.1 protein_id gnl|my_center|LOCUS_02030 210087 209167 gene locus_tag LOCUS_02040 gene hcpD 210087 209167 CDS product Sel1-like repeat protein HcpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597856.1 protein_id gnl|my_center|LOCUS_02040 210594 211544 gene locus_tag LOCUS_02050 210594 211544 CDS product DNA polymerase III subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834729.1 protein_id gnl|my_center|LOCUS_02050 211754 211530 gene locus_tag LOCUS_02060 211754 211530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 212272 211817 gene locus_tag LOCUS_02070 212272 211817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 212821 212276 gene locus_tag LOCUS_02080 212821 212276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 213187 212843 gene locus_tag LOCUS_02090 213187 212843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 213251 214420 gene locus_tag LOCUS_02100 gene bioF 213251 214420 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880373.1 protein_id gnl|my_center|LOCUS_02100 214716 214417 gene locus_tag LOCUS_02110 214716 214417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 214891 216063 gene locus_tag LOCUS_02120 214891 216063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 217215 216043 gene locus_tag LOCUS_02130 217215 216043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 218056 217220 gene locus_tag LOCUS_02140 218056 217220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 218156 219472 gene locus_tag LOCUS_02150 218156 219472 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214763.1 protein_id gnl|my_center|LOCUS_02150 219528 221129 gene locus_tag LOCUS_02160 219528 221129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 221493 221089 gene locus_tag LOCUS_02170 221493 221089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 222548 221496 gene locus_tag LOCUS_02180 gene fliN 222548 221496 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503780.1 protein_id gnl|my_center|LOCUS_02180 222735 224057 gene locus_tag LOCUS_02190 gene dnaX 222735 224057 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929205.1 protein_id gnl|my_center|LOCUS_02190 224023 224484 gene locus_tag LOCUS_02200 224023 224484 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278813.1 protein_id gnl|my_center|LOCUS_02200 224513 226666 gene locus_tag LOCUS_02210 224513 226666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 226733 227317 gene locus_tag LOCUS_02220 226733 227317 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_02220 227400 227327 gene locus_tag LOCUS_t00030 227400 227327 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 228717 227452 gene locus_tag LOCUS_02230 228717 227452 CDS product lipoprotein LipL46 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079033.1 protein_id gnl|my_center|LOCUS_02230 228925 229410 gene locus_tag LOCUS_02240 228925 229410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 229423 231369 gene locus_tag LOCUS_02250 gene flgK 229423 231369 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535890.1 protein_id gnl|my_center|LOCUS_02250 231387 232655 gene locus_tag LOCUS_02260 231387 232655 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223330.1 protein_id gnl|my_center|LOCUS_02260 232666 233112 gene locus_tag LOCUS_02270 gene fliW 232666 233112 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510650.1 protein_id gnl|my_center|LOCUS_02270 233115 233354 gene locus_tag LOCUS_02280 gene csrA 233115 233354 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960595.1 protein_id gnl|my_center|LOCUS_02280 233323 233697 gene locus_tag LOCUS_02290 233323 233697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 234400 233702 gene locus_tag LOCUS_02300 234400 233702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472806.1 protein_id gnl|my_center|LOCUS_02300 234461 234913 gene locus_tag LOCUS_02310 234461 234913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 234985 235743 gene locus_tag LOCUS_02320 234985 235743 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147518.1 protein_id gnl|my_center|LOCUS_02320 235746 236585 gene locus_tag LOCUS_02330 235746 236585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 236594 237376 gene locus_tag LOCUS_02340 236594 237376 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_02340 237881 237396 gene locus_tag LOCUS_02350 237881 237396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 239520 237937 gene locus_tag LOCUS_02360 239520 237937 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583965.1 protein_id gnl|my_center|LOCUS_02360 240647 239517 gene locus_tag LOCUS_02370 240647 239517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 241914 240697 gene locus_tag LOCUS_02380 241914 240697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230324.1 protein_id gnl|my_center|LOCUS_02380 242770 242135 gene locus_tag LOCUS_02390 242770 242135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 243496 242930 gene locus_tag LOCUS_02400 243496 242930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 243884 243477 gene locus_tag LOCUS_02410 243884 243477 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 protein_id gnl|my_center|LOCUS_02410 244456 243881 gene locus_tag LOCUS_02420 244456 243881 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894436.1 protein_id gnl|my_center|LOCUS_02420 247115 244647 gene locus_tag LOCUS_02430 247115 244647 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 protein_id gnl|my_center|LOCUS_02430 247551 247180 gene locus_tag LOCUS_02440 247551 247180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 248027 247605 gene locus_tag LOCUS_02450 248027 247605 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494334.1 protein_id gnl|my_center|LOCUS_02450 248119 250188 gene locus_tag LOCUS_02460 248119 250188 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_02460 251922 250189 gene locus_tag LOCUS_02470 251922 250189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 252712 251924 gene locus_tag LOCUS_02480 252712 251924 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_02480 254117 252768 gene locus_tag LOCUS_02490 254117 252768 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327923.1 protein_id gnl|my_center|LOCUS_02490 254818 254135 gene locus_tag LOCUS_02500 254818 254135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 255962 254988 gene locus_tag LOCUS_02510 255962 254988 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613385.1 protein_id gnl|my_center|LOCUS_02510 257081 256035 gene locus_tag LOCUS_02520 gene trpD 257081 256035 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880074.1 protein_id gnl|my_center|LOCUS_02520 257780 257085 gene locus_tag LOCUS_02530 gene pgsA 257780 257085 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045091.1 protein_id gnl|my_center|LOCUS_02530 259137 257791 gene locus_tag LOCUS_02540 gene rimO 259137 257791 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358323.1 protein_id gnl|my_center|LOCUS_02540 260212 259139 gene locus_tag LOCUS_02550 260212 259139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 260900 260214 gene locus_tag LOCUS_02560 260900 260214 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196651.1 protein_id gnl|my_center|LOCUS_02560 263874 260989 gene locus_tag LOCUS_02570 263874 260989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 263960 264790 gene locus_tag LOCUS_02580 263960 264790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 266040 264901 gene locus_tag LOCUS_02590 266040 264901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 266308 266012 gene locus_tag LOCUS_02600 266308 266012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 266427 267860 gene locus_tag LOCUS_02610 gene argH 266427 267860 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136475.1 protein_id gnl|my_center|LOCUS_02610 267861 268457 gene locus_tag LOCUS_02620 267861 268457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 269854 268460 gene locus_tag LOCUS_02630 gene pcnB 269854 268460 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670773.1 protein_id gnl|my_center|LOCUS_02630 269943 270881 gene locus_tag LOCUS_02640 269943 270881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 273034 270884 gene locus_tag LOCUS_02650 gene topA 273034 270884 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678704.1 protein_id gnl|my_center|LOCUS_02650 275099 273210 gene locus_tag LOCUS_02660 275099 273210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940971.1 protein_id gnl|my_center|LOCUS_02660 275958 275101 gene locus_tag LOCUS_02670 275958 275101 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943921.1 protein_id gnl|my_center|LOCUS_02670 276070 276996 gene locus_tag LOCUS_02680 276070 276996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 277076 278593 gene locus_tag LOCUS_02690 277076 278593 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076957.1 protein_id gnl|my_center|LOCUS_02690 279230 278559 gene locus_tag LOCUS_02700 279230 278559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 279777 279220 gene locus_tag LOCUS_02710 279777 279220 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168301328.1 protein_id gnl|my_center|LOCUS_02710 280650 279796 gene locus_tag LOCUS_02720 280650 279796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 281647 280763 gene locus_tag LOCUS_02730 281647 280763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433142.1 protein_id gnl|my_center|LOCUS_02730 282910 281657 gene locus_tag LOCUS_02740 282910 281657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 284921 282912 gene locus_tag LOCUS_02750 284921 282912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 285418 284927 gene locus_tag LOCUS_02760 285418 284927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 285897 285415 gene locus_tag LOCUS_02770 gene ribE 285897 285415 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258065.1 protein_id gnl|my_center|LOCUS_02770 287182 285908 gene locus_tag LOCUS_02780 287182 285908 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071432.1 protein_id gnl|my_center|LOCUS_02780 287336 287263 gene locus_tag LOCUS_t00040 287336 287263 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 288457 287645 gene locus_tag LOCUS_02790 288457 287645 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087254.1 protein_id gnl|my_center|LOCUS_02790 288569 289114 gene locus_tag LOCUS_02800 288569 289114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 290024 289104 gene locus_tag LOCUS_02810 290024 289104 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948290.1 protein_id gnl|my_center|LOCUS_02810 290157 292973 gene locus_tag LOCUS_02820 gene alaS 290157 292973 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802924.1 protein_id gnl|my_center|LOCUS_02820 292994 293485 gene locus_tag LOCUS_02830 292994 293485 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_02830 293489 294445 gene locus_tag LOCUS_02840 293489 294445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 294442 295497 gene locus_tag LOCUS_02850 294442 295497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 295591 296421 gene locus_tag LOCUS_02860 295591 296421 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 protein_id gnl|my_center|LOCUS_02860 297401 296436 gene locus_tag LOCUS_02870 297401 296436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 298267 297380 gene locus_tag LOCUS_02880 298267 297380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 298323 298832 gene locus_tag LOCUS_02890 298323 298832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 298915 300099 gene locus_tag LOCUS_02900 298915 300099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 300140 301870 gene locus_tag LOCUS_02910 300140 301870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 302722 301865 gene locus_tag LOCUS_02920 302722 301865 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102782.1 protein_id gnl|my_center|LOCUS_02920 303778 302801 gene locus_tag LOCUS_02930 303778 302801 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881003.1 protein_id gnl|my_center|LOCUS_02930 304315 303833 gene locus_tag LOCUS_02940 304315 303833 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880795.1 protein_id gnl|my_center|LOCUS_02940 305215 304469 gene locus_tag LOCUS_02950 305215 304469 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065490.1 protein_id gnl|my_center|LOCUS_02950 306101 305238 gene locus_tag LOCUS_02960 gene mtnP 306101 305238 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121285.1 protein_id gnl|my_center|LOCUS_02960 306435 306187 gene locus_tag LOCUS_02970 306435 306187 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143646.1 protein_id gnl|my_center|LOCUS_02970 307121 306510 gene locus_tag LOCUS_02980 gene yihA 307121 306510 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045119.1 protein_id gnl|my_center|LOCUS_02980 308104 307124 gene locus_tag LOCUS_02990 308104 307124 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407635.1 protein_id gnl|my_center|LOCUS_02990 309033 308182 gene locus_tag LOCUS_03000 gene panC 309033 308182 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_03000 309499 309014 gene locus_tag LOCUS_03010 309499 309014 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966535.1 protein_id gnl|my_center|LOCUS_03010 310029 309499 gene locus_tag LOCUS_03020 310029 309499 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228998.1 protein_id gnl|my_center|LOCUS_03020 310145 310516 gene locus_tag LOCUS_03030 gene yajC 310145 310516 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672297.1 protein_id gnl|my_center|LOCUS_03030 310518 310856 gene locus_tag LOCUS_03040 310518 310856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 310862 312772 gene locus_tag LOCUS_03050 gene secD 310862 312772 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833715.1 protein_id gnl|my_center|LOCUS_03050 312769 313683 gene locus_tag LOCUS_03060 gene secF 312769 313683 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459252.1 protein_id gnl|my_center|LOCUS_03060 313646 314935 gene locus_tag LOCUS_03070 313646 314935 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202680.1 protein_id gnl|my_center|LOCUS_03070 315296 314937 gene locus_tag LOCUS_03080 315296 314937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 315835 316635 gene locus_tag LOCUS_03090 315835 316635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 316655 317677 gene locus_tag LOCUS_03100 316655 317677 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804872.1 protein_id gnl|my_center|LOCUS_03100 317807 318193 gene locus_tag LOCUS_03110 317807 318193 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289415.1 protein_id gnl|my_center|LOCUS_03110 319073 318180 gene locus_tag LOCUS_03120 319073 318180 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545817.1 protein_id gnl|my_center|LOCUS_03120 320101 319070 gene locus_tag LOCUS_03130 320101 319070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 320630 320160 gene locus_tag LOCUS_03140 320630 320160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 321456 320587 gene locus_tag LOCUS_03150 321456 320587 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601184.1 protein_id gnl|my_center|LOCUS_03150 321622 322548 gene locus_tag LOCUS_03160 321622 322548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867010.1 protein_id gnl|my_center|LOCUS_03160 324093 322600 gene locus_tag LOCUS_03170 324093 322600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005189.1 protein_id gnl|my_center|LOCUS_03170 324173 325078 gene locus_tag LOCUS_03180 324173 325078 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410917.1 protein_id gnl|my_center|LOCUS_03180 325141 326031 gene locus_tag LOCUS_03190 325141 326031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510896.1 protein_id gnl|my_center|LOCUS_03190 327184 326036 gene locus_tag LOCUS_03200 327184 326036 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538757.1 protein_id gnl|my_center|LOCUS_03200 327939 327220 gene locus_tag LOCUS_03210 327939 327220 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658321.1 protein_id gnl|my_center|LOCUS_03210 328006 328398 gene locus_tag LOCUS_03220 328006 328398 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668053.1 protein_id gnl|my_center|LOCUS_03220 329157 328414 gene locus_tag LOCUS_03230 329157 328414 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410308.1 protein_id gnl|my_center|LOCUS_03230 329235 331022 gene locus_tag LOCUS_03240 gene pabB 329235 331022 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217385.1 protein_id gnl|my_center|LOCUS_03240 331305 331027 gene locus_tag LOCUS_03250 331305 331027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454661.1 protein_id gnl|my_center|LOCUS_03250 332816 331338 gene locus_tag LOCUS_03260 gene gcvPB 332816 331338 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881244.1 protein_id gnl|my_center|LOCUS_03260 334172 332826 gene locus_tag LOCUS_03270 gene gcvPA 334172 332826 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_03270 334586 334188 gene locus_tag LOCUS_03280 gene gcvH 334586 334188 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146698.1 protein_id gnl|my_center|LOCUS_03280 334701 335192 gene locus_tag LOCUS_03290 334701 335192 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979773.1 protein_id gnl|my_center|LOCUS_03290 335189 335593 gene locus_tag LOCUS_03300 335189 335593 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846630.1 protein_id gnl|my_center|LOCUS_03300 335666 336256 gene locus_tag LOCUS_03310 335666 336256 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379289.1 protein_id gnl|my_center|LOCUS_03310 336864 336262 gene locus_tag LOCUS_03320 336864 336262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 337828 336902 gene locus_tag LOCUS_03330 337828 336902 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023345.1 protein_id gnl|my_center|LOCUS_03330 338869 337874 gene locus_tag LOCUS_03340 338869 337874 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804894.1 protein_id gnl|my_center|LOCUS_03340 340172 339030 gene locus_tag LOCUS_03350 340172 339030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825590.1 protein_id gnl|my_center|LOCUS_03350 340291 341169 gene locus_tag LOCUS_03360 340291 341169 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127192.1 protein_id gnl|my_center|LOCUS_03360 341172 342035 gene locus_tag LOCUS_03370 gene truA 341172 342035 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010667.1 protein_id gnl|my_center|LOCUS_03370 342048 342689 gene locus_tag LOCUS_03380 342048 342689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 342797 343972 gene locus_tag LOCUS_03390 342797 343972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831279.1 protein_id gnl|my_center|LOCUS_03390 343972 344244 gene locus_tag LOCUS_03400 343972 344244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 344343 344846 gene locus_tag LOCUS_03410 gene purE 344343 344846 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093510.1 protein_id gnl|my_center|LOCUS_03410 344843 346030 gene locus_tag LOCUS_03420 gene purK 344843 346030 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733237.1 protein_id gnl|my_center|LOCUS_03420 347188 346037 gene locus_tag LOCUS_03430 347188 346037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 347792 347247 gene locus_tag LOCUS_03440 347792 347247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 347813 350314 gene locus_tag LOCUS_03450 gene gyrA 347813 350314 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076846.1 protein_id gnl|my_center|LOCUS_03450 351440 350352 gene locus_tag LOCUS_03460 351440 350352 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581182.1 protein_id gnl|my_center|LOCUS_03460 352106 351504 gene locus_tag LOCUS_03470 352106 351504 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729197.1 protein_id gnl|my_center|LOCUS_03470 352240 353451 gene locus_tag LOCUS_03480 352240 353451 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063746.1 protein_id gnl|my_center|LOCUS_03480 353537 354676 gene locus_tag LOCUS_03490 gene prfB 353537 354676 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453255.1 protein_id gnl|my_center|LOCUS_03490 354956 354684 gene locus_tag LOCUS_03500 354956 354684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 355336 354947 gene locus_tag LOCUS_03510 355336 354947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 355469 356638 gene locus_tag LOCUS_03520 gene gcvT 355469 356638 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973508.1 protein_id gnl|my_center|LOCUS_03520 357544 356639 gene locus_tag LOCUS_03530 357544 356639 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270455.1 protein_id gnl|my_center|LOCUS_03530 359321 357549 gene locus_tag LOCUS_03540 359321 357549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 359379 359747 gene locus_tag LOCUS_03550 359379 359747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 359820 360761 gene locus_tag LOCUS_03560 359820 360761 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488462.1 protein_id gnl|my_center|LOCUS_03560 360853 361167 gene locus_tag LOCUS_03570 360853 361167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 361849 361319 gene locus_tag LOCUS_03580 361849 361319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 362540 361854 gene locus_tag LOCUS_03590 gene queC 362540 361854 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545080.1 protein_id gnl|my_center|LOCUS_03590 362915 362553 gene locus_tag LOCUS_03600 gene queD 362915 362553 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391049.1 protein_id gnl|my_center|LOCUS_03600 362962 363342 gene locus_tag LOCUS_03610 362962 363342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 363381 364385 gene locus_tag LOCUS_03620 363381 364385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 364906 364424 gene locus_tag LOCUS_03630 364906 364424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 365495 364896 gene locus_tag LOCUS_03640 365495 364896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 366729 365497 gene locus_tag LOCUS_03650 366729 365497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 367686 366826 gene locus_tag LOCUS_03660 367686 366826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 369741 367711 gene locus_tag LOCUS_03670 369741 367711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 371107 369809 gene locus_tag LOCUS_03680 371107 369809 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083037.1 protein_id gnl|my_center|LOCUS_03680 372542 371127 gene locus_tag LOCUS_03690 372542 371127 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 protein_id gnl|my_center|LOCUS_03690 373496 372555 gene locus_tag LOCUS_03700 373496 372555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 375423 373510 gene locus_tag LOCUS_03710 375423 373510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 375645 376253 gene locus_tag LOCUS_03720 375645 376253 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930580.1 protein_id gnl|my_center|LOCUS_03720 376271 376618 gene locus_tag LOCUS_03730 376271 376618 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406135.1 protein_id gnl|my_center|LOCUS_03730 376622 377047 gene locus_tag LOCUS_03740 376622 377047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 378195 377044 gene locus_tag LOCUS_03750 378195 377044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 378289 379710 gene locus_tag LOCUS_03760 gene glmM 378289 379710 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092954.1 protein_id gnl|my_center|LOCUS_03760 379707 380498 gene locus_tag LOCUS_03770 379707 380498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 protein_id gnl|my_center|LOCUS_03770 380470 382182 gene locus_tag LOCUS_03780 380470 382182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 382994 382140 gene locus_tag LOCUS_03790 382994 382140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 383923 383117 gene locus_tag LOCUS_03800 383923 383117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 384372 383923 gene locus_tag LOCUS_03810 384372 383923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 385044 384385 gene locus_tag LOCUS_03820 gene ccsA 385044 384385 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702045.1 protein_id gnl|my_center|LOCUS_03820 385674 385057 gene locus_tag LOCUS_03830 385674 385057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 385780 386544 gene locus_tag LOCUS_03840 385780 386544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 387414 386545 gene locus_tag LOCUS_03850 387414 386545 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185518.1 protein_id gnl|my_center|LOCUS_03850 388187 387426 gene locus_tag LOCUS_03860 388187 387426 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516556.1 protein_id gnl|my_center|LOCUS_03860 388893 388123 gene locus_tag LOCUS_03870 388893 388123 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153932.1 protein_id gnl|my_center|LOCUS_03870 388944 389423 gene locus_tag LOCUS_03880 388944 389423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 391663 389420 gene locus_tag LOCUS_03890 391663 389420 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058907.1 protein_id gnl|my_center|LOCUS_03890 391772 393664 gene locus_tag LOCUS_03900 gene mnmG 391772 393664 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572982.1 protein_id gnl|my_center|LOCUS_03900 393664 394482 gene locus_tag LOCUS_03910 393664 394482 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_03910 395745 394474 gene locus_tag LOCUS_03920 gene argG 395745 394474 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207680.1 protein_id gnl|my_center|LOCUS_03920 396582 395878 gene locus_tag LOCUS_03930 396582 395878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545450.1 protein_id gnl|my_center|LOCUS_03930 397322 396585 gene locus_tag LOCUS_03940 397322 396585 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545387.1 protein_id gnl|my_center|LOCUS_03940 398297 397338 gene locus_tag LOCUS_03950 398297 397338 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546311.1 protein_id gnl|my_center|LOCUS_03950 399169 398294 gene locus_tag LOCUS_03960 399169 398294 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544937.1 protein_id gnl|my_center|LOCUS_03960 400426 399230 gene locus_tag LOCUS_03970 400426 399230 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_03970 401567 400566 gene locus_tag LOCUS_03980 401567 400566 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 protein_id gnl|my_center|LOCUS_03980 402136 401960 gene locus_tag LOCUS_03990 402136 401960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 402284 402114 gene locus_tag LOCUS_04000 402284 402114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04000 402894 404861 gene locus_tag LOCUS_04010 gene argS 402894 404861 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662007.1 protein_id gnl|my_center|LOCUS_04010 405118 404849 gene locus_tag LOCUS_04020 405118 404849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 405631 405128 gene locus_tag LOCUS_04030 405631 405128 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435437.1 protein_id gnl|my_center|LOCUS_04030 406081 405638 gene locus_tag LOCUS_04040 406081 405638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 406270 407130 gene locus_tag LOCUS_04050 406270 407130 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_04050 407256 407999 gene locus_tag LOCUS_04060 407256 407999 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227585.1 protein_id gnl|my_center|LOCUS_04060 408047 409093 gene locus_tag LOCUS_04070 408047 409093 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972005.1 protein_id gnl|my_center|LOCUS_04070 409679 409128 gene locus_tag LOCUS_04080 409679 409128 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127205.1 protein_id gnl|my_center|LOCUS_04080 409778 410812 gene locus_tag LOCUS_04090 409778 410812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 410992 412317 gene locus_tag LOCUS_04100 410992 412317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 412349 413539 gene locus_tag LOCUS_04110 412349 413539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 413541 414815 gene locus_tag LOCUS_04120 gene pap 413541 414815 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065389.1 protein_id gnl|my_center|LOCUS_04120 414927 415226 gene locus_tag LOCUS_04130 414927 415226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 415230 416006 gene locus_tag LOCUS_04140 415230 416006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 416854 416018 gene locus_tag LOCUS_04150 416854 416018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 416908 418590 gene locus_tag LOCUS_04160 416908 418590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 418955 418596 gene locus_tag LOCUS_04170 418955 418596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 419872 418958 gene locus_tag LOCUS_04180 419872 418958 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684382.1 protein_id gnl|my_center|LOCUS_04180 420307 419939 gene locus_tag LOCUS_04190 420307 419939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 420755 420309 gene locus_tag LOCUS_04200 420755 420309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 421848 420745 gene locus_tag LOCUS_04210 gene recF 421848 420745 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478831.1 protein_id gnl|my_center|LOCUS_04210 422989 421865 gene locus_tag LOCUS_04220 gene dnaN 422989 421865 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695822.1 protein_id gnl|my_center|LOCUS_04220 423460 423933 gene locus_tag LOCUS_04230 423460 423933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 423945 425885 gene locus_tag LOCUS_04240 gene yidC 423945 425885 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390191.1 protein_id gnl|my_center|LOCUS_04240 425952 426629 gene locus_tag LOCUS_04250 425952 426629 CDS product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432936.1 protein_id gnl|my_center|LOCUS_04250 426636 428051 gene locus_tag LOCUS_04260 gene mnmE 426636 428051 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000163.1 protein_id gnl|my_center|LOCUS_04260 428148 428747 gene locus_tag LOCUS_04270 428148 428747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 428757 430136 gene locus_tag LOCUS_04280 428757 430136 CDS product DUF5982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786864.1 protein_id gnl|my_center|LOCUS_04280 430178 430675 gene locus_tag LOCUS_04290 430178 430675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 430708 431643 gene locus_tag LOCUS_04300 430708 431643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 431627 432445 gene locus_tag LOCUS_04310 431627 432445 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143916869.1 protein_id gnl|my_center|LOCUS_04310 432482 432793 gene locus_tag LOCUS_04320 432482 432793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 432824 434602 gene locus_tag LOCUS_04330 432824 434602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 435692 434604 gene locus_tag LOCUS_04340 gene fliG 435692 434604 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_04340 435828 436433 gene locus_tag LOCUS_04350 435828 436433 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603280.1 protein_id gnl|my_center|LOCUS_04350 436498 437043 gene locus_tag LOCUS_04360 436498 437043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 437660 437076 gene locus_tag LOCUS_04370 437660 437076 CDS product lipoprotein LipL21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610519.1 protein_id gnl|my_center|LOCUS_04370 438028 439242 gene locus_tag LOCUS_04380 438028 439242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 439800 439249 gene locus_tag LOCUS_04390 439800 439249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 440728 439793 gene locus_tag LOCUS_04400 440728 439793 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_04400 443395 440795 gene locus_tag LOCUS_04410 443395 440795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 444334 443459 gene locus_tag LOCUS_04420 gene murI 444334 443459 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_04420 445569 444334 gene locus_tag LOCUS_04430 445569 444334 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181768.1 protein_id gnl|my_center|LOCUS_04430 445649 447697 gene locus_tag LOCUS_04440 445649 447697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 450475 447659 gene locus_tag LOCUS_04450 450475 447659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 451177 450575 gene locus_tag LOCUS_04460 451177 450575 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932882.1 protein_id gnl|my_center|LOCUS_04460 451928 451326 gene locus_tag LOCUS_04470 gene recR 451928 451326 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582670.1 protein_id gnl|my_center|LOCUS_04470 452249 451929 gene locus_tag LOCUS_04480 452249 451929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 452407 453789 gene locus_tag LOCUS_04490 452407 453789 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_04490 453790 455094 gene locus_tag LOCUS_04500 453790 455094 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124936.1 protein_id gnl|my_center|LOCUS_04500 455764 455087 gene locus_tag LOCUS_04510 455764 455087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 455945 455757 gene locus_tag LOCUS_04520 455945 455757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 456475 455969 gene locus_tag LOCUS_04530 456475 455969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 457497 456475 gene locus_tag LOCUS_04540 gene fba 457497 456475 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 protein_id gnl|my_center|LOCUS_04540 457648 457950 gene locus_tag LOCUS_04550 457648 457950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 458398 457934 gene locus_tag LOCUS_04560 458398 457934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 458487 459188 gene locus_tag LOCUS_04570 458487 459188 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425174.1 protein_id gnl|my_center|LOCUS_04570 459229 459987 gene locus_tag LOCUS_04580 459229 459987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 460881 460090 gene locus_tag LOCUS_04590 460881 460090 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069861.1 protein_id gnl|my_center|LOCUS_04590 461534 460926 gene locus_tag LOCUS_04600 461534 460926 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922085.1 protein_id gnl|my_center|LOCUS_04600 462864 461518 gene locus_tag LOCUS_04610 462864 461518 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_04610 463653 462871 gene locus_tag LOCUS_04620 463653 462871 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790405.1 protein_id gnl|my_center|LOCUS_04620 463756 464151 gene locus_tag LOCUS_04630 463756 464151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 464160 466346 gene locus_tag LOCUS_04640 gene pcrA 464160 466346 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992924.1 protein_id gnl|my_center|LOCUS_04640 466343 468976 gene locus_tag LOCUS_04650 466343 468976 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002071771.1 protein_id gnl|my_center|LOCUS_04650 470162 469002 gene locus_tag LOCUS_04660 470162 469002 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_04660 471981 470167 gene locus_tag LOCUS_04670 471981 470167 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207710.1 protein_id gnl|my_center|LOCUS_04670 473319 472060 gene locus_tag LOCUS_04680 473319 472060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 473406 475088 gene locus_tag LOCUS_04690 473406 475088 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973770.1 protein_id gnl|my_center|LOCUS_04690 475093 475734 gene locus_tag LOCUS_04700 gene bioD 475093 475734 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257883.1 protein_id gnl|my_center|LOCUS_04700 475886 476878 gene locus_tag LOCUS_04710 gene cysK 475886 476878 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267110.1 protein_id gnl|my_center|LOCUS_04710 478199 476913 gene locus_tag LOCUS_04720 478199 476913 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_04720 481474 478277 gene locus_tag LOCUS_04730 481474 478277 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839353.1 protein_id gnl|my_center|LOCUS_04730 481585 482367 gene locus_tag LOCUS_04740 481585 482367 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_04740 483038 482391 gene locus_tag LOCUS_04750 483038 482391 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_04750 483177 483650 gene locus_tag LOCUS_04760 483177 483650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 483746 484504 gene locus_tag LOCUS_04770 gene fabG 483746 484504 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566240.1 protein_id gnl|my_center|LOCUS_04770 484602 484841 gene locus_tag LOCUS_04780 gene acpP 484602 484841 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753030.1 protein_id gnl|my_center|LOCUS_04780 484922 485674 gene locus_tag LOCUS_04790 gene rnc 484922 485674 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_04790 485682 486788 gene locus_tag LOCUS_04800 gene aroB 485682 486788 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052388.1 protein_id gnl|my_center|LOCUS_04800 486793 487269 gene locus_tag LOCUS_04810 gene aroQ 486793 487269 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068810.1 protein_id gnl|my_center|LOCUS_04810 488474 487224 gene locus_tag LOCUS_04820 488474 487224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 488763 488921 gene locus_tag LOCUS_04830 488763 488921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 489248 489718 gene locus_tag LOCUS_04840 489248 489718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 489905 491149 gene locus_tag LOCUS_04850 489905 491149 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389343.1 protein_id gnl|my_center|LOCUS_04850 491189 492184 gene locus_tag LOCUS_04860 491189 492184 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_04860 494129 492216 gene locus_tag LOCUS_04870 494129 492216 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277633.1 protein_id gnl|my_center|LOCUS_04870 494208 495023 gene locus_tag LOCUS_04880 gene pyrF 494208 495023 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_04880 495148 495828 gene locus_tag LOCUS_04890 495148 495828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_04890 495853 497772 gene locus_tag LOCUS_04900 495853 497772 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_04900 497788 498573 gene locus_tag LOCUS_04910 497788 498573 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_04910 499017 499220 gene locus_tag LOCUS_04920 499017 499220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 499342 499524 gene locus_tag LOCUS_04930 499342 499524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 499681 499944 gene locus_tag LOCUS_04940 499681 499944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 500110 500460 gene locus_tag LOCUS_04950 500110 500460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 500610 500993 gene locus_tag LOCUS_04960 500610 500993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 501436 506037 gene locus_tag LOCUS_04970 501436 506037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence02 1104 2357 gene locus_tag LOCUS_04980 1104 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 2474 4996 gene locus_tag LOCUS_04990 gene nirB 2474 4996 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 protein_id gnl|my_center|LOCUS_04990 5009 5347 gene locus_tag LOCUS_05000 gene nirD 5009 5347 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246252.1 protein_id gnl|my_center|LOCUS_05000 5436 5780 gene locus_tag LOCUS_05010 5436 5780 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881007.1 protein_id gnl|my_center|LOCUS_05010 6579 5803 gene locus_tag LOCUS_05020 6579 5803 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928025.1 protein_id gnl|my_center|LOCUS_05020 7325 6576 gene locus_tag LOCUS_05030 7325 6576 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583575.1 protein_id gnl|my_center|LOCUS_05030 8451 7327 gene locus_tag LOCUS_05040 8451 7327 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001976240.1 protein_id gnl|my_center|LOCUS_05040 8587 9486 gene locus_tag LOCUS_05050 8587 9486 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714135.1 protein_id gnl|my_center|LOCUS_05050 9881 9483 gene locus_tag LOCUS_05060 9881 9483 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190402.1 protein_id gnl|my_center|LOCUS_05060 10534 9890 gene locus_tag LOCUS_05070 gene hisG 10534 9890 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956489.1 protein_id gnl|my_center|LOCUS_05070 11276 10524 gene locus_tag LOCUS_05080 11276 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 12997 11276 gene locus_tag LOCUS_05090 12997 11276 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182263.1 protein_id gnl|my_center|LOCUS_05090 13757 13041 gene locus_tag LOCUS_05100 gene cmk 13757 13041 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361252.1 protein_id gnl|my_center|LOCUS_05100 14667 13738 gene locus_tag LOCUS_05110 14667 13738 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763025.1 protein_id gnl|my_center|LOCUS_05110 15782 14664 gene locus_tag LOCUS_05120 gene pheA 15782 14664 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281293.1 protein_id gnl|my_center|LOCUS_05120 15874 16551 gene locus_tag LOCUS_05130 15874 16551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 18212 16569 gene locus_tag LOCUS_05140 18212 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 21045 18370 gene locus_tag LOCUS_05150 gene acnA 21045 18370 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_05150 21412 21209 gene locus_tag LOCUS_05160 21412 21209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 24153 21463 gene locus_tag LOCUS_05170 gene ppdK 24153 21463 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_05170 24429 24779 gene locus_tag LOCUS_05180 24429 24779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 24823 26154 gene locus_tag LOCUS_05190 24823 26154 CDS product DUF1577 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268191.1 protein_id gnl|my_center|LOCUS_05190 26700 26218 gene locus_tag LOCUS_05200 26700 26218 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167022.1 protein_id gnl|my_center|LOCUS_05200 27931 26744 gene locus_tag LOCUS_05210 27931 26744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 27986 28681 gene locus_tag LOCUS_05220 27986 28681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 28725 29741 gene locus_tag LOCUS_05230 28725 29741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 29841 30878 gene locus_tag LOCUS_05240 29841 30878 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575569.1 protein_id gnl|my_center|LOCUS_05240 30882 32000 gene locus_tag LOCUS_05250 gene mreC 30882 32000 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657455.1 protein_id gnl|my_center|LOCUS_05250 32017 32538 gene locus_tag LOCUS_05260 gene mreD 32017 32538 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599731.1 protein_id gnl|my_center|LOCUS_05260 32542 34428 gene locus_tag LOCUS_05270 gene mrdA 32542 34428 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900432.1 protein_id gnl|my_center|LOCUS_05270 34418 35944 gene locus_tag LOCUS_05280 gene rodA 34418 35944 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801434.1 protein_id gnl|my_center|LOCUS_05280 35969 36721 gene locus_tag LOCUS_05290 35969 36721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 37205 36765 gene locus_tag LOCUS_05300 37205 36765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 38440 37439 gene locus_tag LOCUS_05310 38440 37439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 38732 38415 gene locus_tag LOCUS_05320 38732 38415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 38925 39368 gene locus_tag LOCUS_05330 38925 39368 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792515.1 protein_id gnl|my_center|LOCUS_05330 39931 39416 gene locus_tag LOCUS_05340 39931 39416 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_05340 41100 40000 gene locus_tag LOCUS_05350 gene ychF 41100 40000 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 protein_id gnl|my_center|LOCUS_05350 41245 41637 gene locus_tag LOCUS_05360 41245 41637 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656289.1 protein_id gnl|my_center|LOCUS_05360 43601 41631 gene locus_tag LOCUS_05370 43601 41631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 43694 44653 gene locus_tag LOCUS_05380 43694 44653 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220497.1 protein_id gnl|my_center|LOCUS_05380 45667 44642 gene locus_tag LOCUS_05390 gene hemE 45667 44642 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545646.1 protein_id gnl|my_center|LOCUS_05390 46392 45664 gene locus_tag LOCUS_05400 gene yycF 46392 45664 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722907.1 protein_id gnl|my_center|LOCUS_05400 47308 46385 gene locus_tag LOCUS_05410 47308 46385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 48740 47451 gene locus_tag LOCUS_05420 gene hemL 48740 47451 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_05420 50361 48730 gene locus_tag LOCUS_05430 50361 48730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 51361 50345 gene locus_tag LOCUS_05440 gene neuB 51361 50345 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066398080.1 protein_id gnl|my_center|LOCUS_05440 51987 51379 gene locus_tag LOCUS_05450 51987 51379 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_05450 53378 51993 gene locus_tag LOCUS_05460 gene trpE 53378 51993 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_05460 53493 54293 gene locus_tag LOCUS_05470 gene proC 53493 54293 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002080974.1 protein_id gnl|my_center|LOCUS_05470 54295 54927 gene locus_tag LOCUS_05480 54295 54927 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_05480 54927 56090 gene locus_tag LOCUS_05490 54927 56090 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051000.1 protein_id gnl|my_center|LOCUS_05490 57158 56043 gene locus_tag LOCUS_05500 57158 56043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 57893 57159 gene locus_tag LOCUS_05510 57893 57159 CDS product dolichol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797975.1 protein_id gnl|my_center|LOCUS_05510 58985 57897 gene locus_tag LOCUS_05520 58985 57897 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698728.1 protein_id gnl|my_center|LOCUS_05520 60493 58988 gene locus_tag LOCUS_05530 gene lysS 60493 58988 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004512.1 protein_id gnl|my_center|LOCUS_05530 60623 61708 gene locus_tag LOCUS_05540 60623 61708 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409996.1 protein_id gnl|my_center|LOCUS_05540 64500 61705 gene locus_tag LOCUS_05550 gene uvrA 64500 61705 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156251.1 protein_id gnl|my_center|LOCUS_05550 64552 65214 gene locus_tag LOCUS_05560 64552 65214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880985.1 protein_id gnl|my_center|LOCUS_05560 65808 65284 gene locus_tag LOCUS_05570 65808 65284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 66045 65911 gene locus_tag LOCUS_05580 66045 65911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 66592 66143 gene locus_tag LOCUS_05590 66592 66143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 67158 67003 gene locus_tag LOCUS_05600 67158 67003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 67279 68088 gene locus_tag LOCUS_05610 67279 68088 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945962.1 protein_id gnl|my_center|LOCUS_05610 68105 69124 gene locus_tag LOCUS_05620 68105 69124 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207172.1 protein_id gnl|my_center|LOCUS_05620 70505 69108 gene locus_tag LOCUS_05630 70505 69108 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_05630 70600 71397 gene locus_tag LOCUS_05640 70600 71397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 71415 72716 gene locus_tag LOCUS_05650 71415 72716 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460050.1 protein_id gnl|my_center|LOCUS_05650 72679 73458 gene locus_tag LOCUS_05660 72679 73458 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096718.1 protein_id gnl|my_center|LOCUS_05660 73476 74780 gene locus_tag LOCUS_05670 73476 74780 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073246.1 protein_id gnl|my_center|LOCUS_05670 74777 75487 gene locus_tag LOCUS_05680 74777 75487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 75459 75944 gene locus_tag LOCUS_05690 75459 75944 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_05690 76003 77049 gene locus_tag LOCUS_05700 76003 77049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 78894 77050 gene locus_tag LOCUS_05710 78894 77050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 79019 80422 gene locus_tag LOCUS_05720 79019 80422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 80539 80739 gene locus_tag LOCUS_05730 gene rpmE 80539 80739 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_05730 80745 81743 gene locus_tag LOCUS_05740 80745 81743 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_05740 81745 83004 gene locus_tag LOCUS_05750 81745 83004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 83008 85341 gene locus_tag LOCUS_05760 83008 85341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 85343 86623 gene locus_tag LOCUS_05770 85343 86623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 86672 87661 gene locus_tag LOCUS_05780 gene nadA 86672 87661 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853488.1 protein_id gnl|my_center|LOCUS_05780 89209 87662 gene locus_tag LOCUS_05790 89209 87662 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_05790 89422 90372 gene locus_tag LOCUS_05800 89422 90372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 90374 91663 gene locus_tag LOCUS_05810 90374 91663 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_05810 92719 91664 gene locus_tag LOCUS_05820 92719 91664 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070306.1 protein_id gnl|my_center|LOCUS_05820 93113 92697 gene locus_tag LOCUS_05830 93113 92697 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091691.1 protein_id gnl|my_center|LOCUS_05830 93403 93834 gene locus_tag LOCUS_05840 93403 93834 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903188.1 protein_id gnl|my_center|LOCUS_05840 94289 93831 gene locus_tag LOCUS_05850 94289 93831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 97112 94299 gene locus_tag LOCUS_05860 97112 94299 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510661.1 protein_id gnl|my_center|LOCUS_05860 97292 97840 gene locus_tag LOCUS_05870 97292 97840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 97862 98158 gene locus_tag LOCUS_05880 97862 98158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 99831 98146 gene locus_tag LOCUS_05890 99831 98146 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973629.1 protein_id gnl|my_center|LOCUS_05890 101149 99839 gene locus_tag LOCUS_05900 gene aroA 101149 99839 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693605.1 protein_id gnl|my_center|LOCUS_05900 101180 101605 gene locus_tag LOCUS_05910 101180 101605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 101636 102607 gene locus_tag LOCUS_05920 gene lipA 101636 102607 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068714.1 protein_id gnl|my_center|LOCUS_05920 102629 103225 gene locus_tag LOCUS_05930 102629 103225 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760764.1 protein_id gnl|my_center|LOCUS_05930 103203 103478 gene locus_tag LOCUS_05940 103203 103478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 103488 104096 gene locus_tag LOCUS_05950 103488 104096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 104093 104761 gene locus_tag LOCUS_05960 104093 104761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 105272 104778 gene locus_tag LOCUS_05970 105272 104778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 105492 106097 gene locus_tag LOCUS_05980 105492 106097 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_05980 106142 106336 gene locus_tag LOCUS_05990 106142 106336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 106371 106835 gene locus_tag LOCUS_06000 gene bfr 106371 106835 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390044.1 protein_id gnl|my_center|LOCUS_06000 108155 106836 gene locus_tag LOCUS_06010 108155 106836 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253865.1 protein_id gnl|my_center|LOCUS_06010 108960 108184 gene locus_tag LOCUS_06020 108960 108184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 109846 109043 gene locus_tag LOCUS_06030 109846 109043 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853863.1 protein_id gnl|my_center|LOCUS_06030 109931 111028 gene locus_tag LOCUS_06040 gene serC 109931 111028 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858670.1 protein_id gnl|my_center|LOCUS_06040 111034 111240 gene locus_tag LOCUS_06050 111034 111240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266284.1 protein_id gnl|my_center|LOCUS_06050 111541 111254 gene locus_tag LOCUS_06060 111541 111254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 111577 112353 gene locus_tag LOCUS_06070 111577 112353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 112388 113071 gene locus_tag LOCUS_06080 gene radC 112388 113071 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_06080 113117 113518 gene locus_tag LOCUS_06090 113117 113518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689175.1 protein_id gnl|my_center|LOCUS_06090 113515 113979 gene locus_tag LOCUS_06100 113515 113979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 113981 114259 gene locus_tag LOCUS_06110 113981 114259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 114256 116748 gene locus_tag LOCUS_06120 114256 116748 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790264.1 protein_id gnl|my_center|LOCUS_06120 116748 117257 gene locus_tag LOCUS_06130 116748 117257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 118317 117259 gene locus_tag LOCUS_06140 118317 117259 CDS product DUF1574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837638.1 protein_id gnl|my_center|LOCUS_06140 119743 118304 gene locus_tag LOCUS_06150 119743 118304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 119792 120859 gene locus_tag LOCUS_06160 gene queA 119792 120859 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897624.1 protein_id gnl|my_center|LOCUS_06160 120902 121804 gene locus_tag LOCUS_06170 120902 121804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 122241 121801 gene locus_tag LOCUS_06180 122241 121801 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671223.1 protein_id gnl|my_center|LOCUS_06180 123605 122238 gene locus_tag LOCUS_06190 123605 122238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 124888 123650 gene locus_tag LOCUS_06200 gene ftsA 124888 123650 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294722.1 protein_id gnl|my_center|LOCUS_06200 125358 124885 gene locus_tag LOCUS_06210 125358 124885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 126953 125496 gene locus_tag LOCUS_06220 gene murC 126953 125496 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377539.1 protein_id gnl|my_center|LOCUS_06220 127038 127748 gene locus_tag LOCUS_06230 127038 127748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 127908 129410 gene locus_tag LOCUS_06240 127908 129410 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333576.1 protein_id gnl|my_center|LOCUS_06240 129420 130895 gene locus_tag LOCUS_06250 129420 130895 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649937.1 protein_id gnl|my_center|LOCUS_06250 130903 131772 gene locus_tag LOCUS_06260 130903 131772 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271588.1 protein_id gnl|my_center|LOCUS_06260 132498 131758 gene locus_tag LOCUS_06270 gene hisA 132498 131758 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436675.1 protein_id gnl|my_center|LOCUS_06270 133134 132508 gene locus_tag LOCUS_06280 gene hisH 133134 132508 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560473.1 protein_id gnl|my_center|LOCUS_06280 133734 133144 gene locus_tag LOCUS_06290 gene hisB 133734 133144 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130165.1 protein_id gnl|my_center|LOCUS_06290 135062 133731 gene locus_tag LOCUS_06300 135062 133731 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932061.1 protein_id gnl|my_center|LOCUS_06300 136536 135055 gene locus_tag LOCUS_06310 136536 135055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 137611 136520 gene locus_tag LOCUS_06320 137611 136520 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016360.1 protein_id gnl|my_center|LOCUS_06320 138372 137611 gene locus_tag LOCUS_06330 138372 137611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 138431 139411 gene locus_tag LOCUS_06340 138431 139411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 139577 140008 gene locus_tag LOCUS_06350 139577 140008 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179084.1 protein_id gnl|my_center|LOCUS_06350 140050 140625 gene locus_tag LOCUS_06360 140050 140625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 140629 142470 gene locus_tag LOCUS_06370 140629 142470 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_06370 145502 142473 gene locus_tag LOCUS_06380 145502 142473 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004845.1 protein_id gnl|my_center|LOCUS_06380 148545 145525 gene locus_tag LOCUS_06390 148545 145525 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521953.1 protein_id gnl|my_center|LOCUS_06390 148816 150165 gene locus_tag LOCUS_06400 148816 150165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 150226 150960 gene locus_tag LOCUS_06410 150226 150960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 151070 152479 gene locus_tag LOCUS_06420 151070 152479 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055092.1 protein_id gnl|my_center|LOCUS_06420 152559 153416 gene locus_tag LOCUS_06430 152559 153416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 154993 153437 gene locus_tag LOCUS_06440 154993 153437 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263383.1 protein_id gnl|my_center|LOCUS_06440 157375 155168 gene locus_tag LOCUS_06450 157375 155168 CDS product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094324403.1 protein_id gnl|my_center|LOCUS_06450 157633 157439 gene locus_tag LOCUS_06460 157633 157439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 157706 158647 gene locus_tag LOCUS_06470 gene pyrB 157706 158647 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002063873.1 protein_id gnl|my_center|LOCUS_06470 158651 159514 gene locus_tag LOCUS_06480 158651 159514 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011733.1 protein_id gnl|my_center|LOCUS_06480 159680 160096 gene locus_tag LOCUS_06490 159680 160096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099422.1 protein_id gnl|my_center|LOCUS_06490 161186 160125 gene locus_tag LOCUS_06500 161186 160125 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838056.1 protein_id gnl|my_center|LOCUS_06500 161844 161176 gene locus_tag LOCUS_06510 161844 161176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 162645 161848 gene locus_tag LOCUS_06520 gene flgG 162645 161848 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257272.1 protein_id gnl|my_center|LOCUS_06520 163928 162687 gene locus_tag LOCUS_06530 163928 162687 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_06530 163992 164222 gene locus_tag LOCUS_06540 163992 164222 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201605.1 protein_id gnl|my_center|LOCUS_06540 164302 165150 gene locus_tag LOCUS_06550 164302 165150 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586158.1 protein_id gnl|my_center|LOCUS_06550 166211 165177 gene locus_tag LOCUS_06560 gene mtnA 166211 165177 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104604.1 protein_id gnl|my_center|LOCUS_06560 166858 166226 gene locus_tag LOCUS_06570 166858 166226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 168248 166839 gene locus_tag LOCUS_06580 gene der 168248 166839 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029807.1 protein_id gnl|my_center|LOCUS_06580 168720 168241 gene locus_tag LOCUS_06590 gene smpB 168720 168241 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932251.1 protein_id gnl|my_center|LOCUS_06590 169641 168775 gene locus_tag LOCUS_06600 169641 168775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 170140 169643 gene locus_tag LOCUS_06610 170140 169643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 171768 170140 gene locus_tag LOCUS_06620 171768 170140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 173599 171824 gene locus_tag LOCUS_06630 173599 171824 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971176.1 protein_id gnl|my_center|LOCUS_06630 174674 173655 gene locus_tag LOCUS_06640 174674 173655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 175599 174682 gene locus_tag LOCUS_06650 175599 174682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 177312 175651 gene locus_tag LOCUS_06660 gene sulP 177312 175651 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_06660 177472 177400 gene locus_tag LOCUS_t00050 177472 177400 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 177630 178478 gene locus_tag LOCUS_06670 177630 178478 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_06670 178482 181832 gene locus_tag LOCUS_06680 178482 181832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 182532 181807 gene locus_tag LOCUS_06690 182532 181807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 183253 182558 gene locus_tag LOCUS_06700 183253 182558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 184004 183234 gene locus_tag LOCUS_06710 184004 183234 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809564.1 protein_id gnl|my_center|LOCUS_06710 184089 185531 gene locus_tag LOCUS_06720 gene gatB 184089 185531 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807228.1 protein_id gnl|my_center|LOCUS_06720 185549 186292 gene locus_tag LOCUS_06730 185549 186292 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_06730 186307 187467 gene locus_tag LOCUS_06740 186307 187467 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190668.1 protein_id gnl|my_center|LOCUS_06740 187755 187471 gene locus_tag LOCUS_06750 187755 187471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 188714 187743 gene locus_tag LOCUS_06760 gene rsmH 188714 187743 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881225.1 protein_id gnl|my_center|LOCUS_06760 189666 188695 gene locus_tag LOCUS_06770 gene queG 189666 188695 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572974.1 protein_id gnl|my_center|LOCUS_06770 190057 189641 gene locus_tag LOCUS_06780 190057 189641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 190511 190098 gene locus_tag LOCUS_06790 190511 190098 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_06790 190966 190523 gene locus_tag LOCUS_06800 190966 190523 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274661.1 protein_id gnl|my_center|LOCUS_06800 191904 191026 gene locus_tag LOCUS_06810 191904 191026 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_06810 193728 191914 gene locus_tag LOCUS_06820 gene sppA 193728 191914 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489490.1 protein_id gnl|my_center|LOCUS_06820 193851 194330 gene locus_tag LOCUS_06830 gene ilvN 193851 194330 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680556.1 protein_id gnl|my_center|LOCUS_06830 194382 195401 gene locus_tag LOCUS_06840 194382 195401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 196273 196010 gene locus_tag LOCUS_06850 196273 196010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06850 197087 199429 gene locus_tag LOCUS_06860 gene cas10 197087 199429 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545463.1 protein_id gnl|my_center|LOCUS_06860 199419 199961 gene locus_tag LOCUS_06870 gene csm2 199419 199961 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296332.1 protein_id gnl|my_center|LOCUS_06870 199963 200712 gene locus_tag LOCUS_06880 gene csm3 199963 200712 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582983.1 protein_id gnl|my_center|LOCUS_06880 200714 201661 gene locus_tag LOCUS_06890 gene csm4 200714 201661 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871192.1 protein_id gnl|my_center|LOCUS_06890 201643 202668 gene locus_tag LOCUS_06900 gene csm5 201643 202668 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021931.1 protein_id gnl|my_center|LOCUS_06900 203905 202673 gene locus_tag LOCUS_06910 gene csx2 203905 202673 CDS product TIGR02221 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582979.1 protein_id gnl|my_center|LOCUS_06910 204080 204925 gene locus_tag LOCUS_06920 204080 204925 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410044.1 protein_id gnl|my_center|LOCUS_06920 204918 205802 gene locus_tag LOCUS_06930 204918 205802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 205839 207470 gene locus_tag LOCUS_06940 205839 207470 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116258.1 protein_id gnl|my_center|LOCUS_06940 207471 208844 gene locus_tag LOCUS_06950 gene hemN 207471 208844 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881391.1 protein_id gnl|my_center|LOCUS_06950 210144 208846 gene locus_tag LOCUS_06960 210144 208846 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288561.1 protein_id gnl|my_center|LOCUS_06960 212069 210171 gene locus_tag LOCUS_06970 212069 210171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 213904 212066 gene locus_tag LOCUS_06980 213904 212066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 214985 213924 gene locus_tag LOCUS_06990 214985 213924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 215050 216762 gene locus_tag LOCUS_07000 215050 216762 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155537.1 protein_id gnl|my_center|LOCUS_07000 217344 216730 gene locus_tag LOCUS_07010 gene rhtC 217344 216730 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205974.1 protein_id gnl|my_center|LOCUS_07010 218078 217341 gene locus_tag LOCUS_07020 218078 217341 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880787.1 protein_id gnl|my_center|LOCUS_07020 218199 219062 gene locus_tag LOCUS_07030 218199 219062 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983600.1 protein_id gnl|my_center|LOCUS_07030 219067 221100 gene locus_tag LOCUS_07040 gene metG 219067 221100 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088999.1 protein_id gnl|my_center|LOCUS_07040 221100 223982 gene locus_tag LOCUS_07050 221100 223982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 226549 225080 gene locus_tag LOCUS_07060 gene mgtE 226549 225080 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_07060 226692 226913 gene locus_tag LOCUS_07070 226692 226913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 227278 226910 gene locus_tag LOCUS_07080 227278 226910 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587664.1 protein_id gnl|my_center|LOCUS_07080 227462 228520 gene locus_tag LOCUS_07090 227462 228520 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681866.1 protein_id gnl|my_center|LOCUS_07090 228558 228884 gene locus_tag LOCUS_07100 228558 228884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 228874 229422 gene locus_tag LOCUS_07110 228874 229422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 229518 230219 gene locus_tag LOCUS_07120 gene rsmI 229518 230219 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083567.1 protein_id gnl|my_center|LOCUS_07120 230370 230699 gene locus_tag LOCUS_07130 230370 230699 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150993.1 protein_id gnl|my_center|LOCUS_07130 231783 230725 gene locus_tag LOCUS_07140 231783 230725 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190880.1 protein_id gnl|my_center|LOCUS_07140 232262 231891 gene locus_tag LOCUS_07150 232262 231891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 232321 232599 gene locus_tag LOCUS_07160 232321 232599 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081975.1 protein_id gnl|my_center|LOCUS_07160 232596 232883 gene locus_tag LOCUS_07170 232596 232883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 236121 232903 gene locus_tag LOCUS_07180 gene ileS 236121 232903 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258550.1 protein_id gnl|my_center|LOCUS_07180 236334 239363 gene locus_tag LOCUS_07190 236334 239363 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880933.1 protein_id gnl|my_center|LOCUS_07190 239512 240021 gene locus_tag LOCUS_07200 239512 240021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 240725 241624 gene locus_tag LOCUS_07210 240725 241624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057419.1 protein_id gnl|my_center|LOCUS_07210 241848 242771 gene locus_tag LOCUS_07220 241848 242771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 242777 244681 gene locus_tag LOCUS_07230 242777 244681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045337.1 protein_id gnl|my_center|LOCUS_07230 245380 244688 gene locus_tag LOCUS_07240 245380 244688 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_07240 245542 246051 gene locus_tag LOCUS_07250 245542 246051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 246313 246241 gene locus_tag LOCUS_t00060 246313 246241 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 246389 246317 gene locus_tag LOCUS_t00070 246389 246317 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 247108 246650 gene locus_tag LOCUS_07260 247108 246650 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093551.1 protein_id gnl|my_center|LOCUS_07260 248019 247159 gene locus_tag LOCUS_07270 248019 247159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 248079 248393 gene locus_tag LOCUS_07280 248079 248393 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278842.1 protein_id gnl|my_center|LOCUS_07280 248412 249398 gene locus_tag LOCUS_07290 gene thrB 248412 249398 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095032.1 protein_id gnl|my_center|LOCUS_07290 249418 250416 gene locus_tag LOCUS_07300 249418 250416 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_07300 251835 250444 gene locus_tag LOCUS_07310 gene flgE 251835 250444 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986372.1 protein_id gnl|my_center|LOCUS_07310 252425 251850 gene locus_tag LOCUS_07320 252425 251850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 253994 252429 gene locus_tag LOCUS_07330 253994 252429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 254110 254673 gene locus_tag LOCUS_07340 254110 254673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 254670 255560 gene locus_tag LOCUS_07350 254670 255560 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070066.1 protein_id gnl|my_center|LOCUS_07350 255611 256255 gene locus_tag LOCUS_07360 255611 256255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 256709 256260 gene locus_tag LOCUS_07370 256709 256260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 258301 256718 gene locus_tag LOCUS_07380 258301 256718 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_07380 258786 258313 gene locus_tag LOCUS_07390 258786 258313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 259348 258851 gene locus_tag LOCUS_07400 gene coaD 259348 258851 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681221.1 protein_id gnl|my_center|LOCUS_07400 259864 259400 gene locus_tag LOCUS_07410 gene flgC 259864 259400 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522494.1 protein_id gnl|my_center|LOCUS_07410 260295 259876 gene locus_tag LOCUS_07420 gene flgB 260295 259876 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462091.1 protein_id gnl|my_center|LOCUS_07420 260365 260877 gene locus_tag LOCUS_07430 260365 260877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 260864 261301 gene locus_tag LOCUS_07440 260864 261301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 261301 262260 gene locus_tag LOCUS_07450 261301 262260 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084059.1 protein_id gnl|my_center|LOCUS_07450 266599 262214 gene locus_tag LOCUS_07460 266599 262214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 266774 268066 gene locus_tag LOCUS_07470 266774 268066 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_07470 268070 269245 gene locus_tag LOCUS_07480 268070 269245 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_07480 269287 270267 gene locus_tag LOCUS_07490 269287 270267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 271494 270262 gene locus_tag LOCUS_07500 271494 270262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 271538 273304 gene locus_tag LOCUS_07510 271538 273304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 273837 273295 gene locus_tag LOCUS_07520 273837 273295 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256707.1 protein_id gnl|my_center|LOCUS_07520 274495 273986 gene locus_tag LOCUS_07530 274495 273986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 274951 275304 gene locus_tag LOCUS_07540 274951 275304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 275482 275793 gene locus_tag LOCUS_07550 275482 275793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07550 276325 276540 gene locus_tag LOCUS_07560 276325 276540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 276873 277034 gene locus_tag LOCUS_07570 276873 277034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 279278 277062 gene locus_tag LOCUS_07580 279278 277062 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832365.1 protein_id gnl|my_center|LOCUS_07580 281794 279284 gene locus_tag LOCUS_07590 gene mutS 281794 279284 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047648.1 protein_id gnl|my_center|LOCUS_07590 283802 281799 gene locus_tag LOCUS_07600 gene gyrB 283802 281799 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076460.1 protein_id gnl|my_center|LOCUS_07600 284242 283868 gene locus_tag LOCUS_07610 284242 283868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 284336 284830 gene locus_tag LOCUS_07620 284336 284830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 287363 284835 gene locus_tag LOCUS_07630 gene pheT 287363 284835 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777486.1 protein_id gnl|my_center|LOCUS_07630 288410 287376 gene locus_tag LOCUS_07640 gene pheS 288410 287376 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_07640 288550 288744 gene locus_tag LOCUS_07650 gene rpmF 288550 288744 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290471.1 protein_id gnl|my_center|LOCUS_07650 288832 289632 gene locus_tag LOCUS_07660 288832 289632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 289815 290990 gene locus_tag LOCUS_07670 289815 290990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 292336 291017 gene locus_tag LOCUS_07680 292336 291017 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778965.1 protein_id gnl|my_center|LOCUS_07680 292420 293205 gene locus_tag LOCUS_07690 292420 293205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 293271 294404 gene locus_tag LOCUS_07700 293271 294404 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921970.1 protein_id gnl|my_center|LOCUS_07700 295943 294450 gene locus_tag LOCUS_07710 295943 294450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 297100 295943 gene locus_tag LOCUS_07720 297100 295943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 297165 300011 gene locus_tag LOCUS_07730 297165 300011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 300008 301384 gene locus_tag LOCUS_07740 300008 301384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 301393 303084 gene locus_tag LOCUS_07750 301393 303084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 303084 303797 gene locus_tag LOCUS_07760 303084 303797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 303790 304467 gene locus_tag LOCUS_07770 gene coaE 303790 304467 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181518.1 protein_id gnl|my_center|LOCUS_07770 304476 305105 gene locus_tag LOCUS_07780 304476 305105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 305174 305839 gene locus_tag LOCUS_07790 305174 305839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372768.1 protein_id gnl|my_center|LOCUS_07790 305877 308183 gene locus_tag LOCUS_07800 gene ppk1 305877 308183 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045686.1 protein_id gnl|my_center|LOCUS_07800 308413 308180 gene locus_tag LOCUS_07810 308413 308180 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426908.1 protein_id gnl|my_center|LOCUS_07810 309713 308463 gene locus_tag LOCUS_07820 309713 308463 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982317.1 protein_id gnl|my_center|LOCUS_07820 309837 310658 gene locus_tag LOCUS_07830 309837 310658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 311139 310687 gene locus_tag LOCUS_07840 311139 310687 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141820.1 protein_id gnl|my_center|LOCUS_07840 311584 311195 gene locus_tag LOCUS_07850 311584 311195 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963612.1 protein_id gnl|my_center|LOCUS_07850 313252 311663 gene locus_tag LOCUS_07860 313252 311663 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169689.1 protein_id gnl|my_center|LOCUS_07860 314571 313321 gene locus_tag LOCUS_07870 314571 313321 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963345.1 protein_id gnl|my_center|LOCUS_07870 315043 314582 gene locus_tag LOCUS_07880 315043 314582 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_07880 315122 315988 gene locus_tag LOCUS_07890 gene speE 315122 315988 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424716.1 protein_id gnl|my_center|LOCUS_07890 316872 316018 gene locus_tag LOCUS_07900 gene prmC 316872 316018 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_07900 317741 316869 gene locus_tag LOCUS_07910 317741 316869 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_07910 319597 317732 gene locus_tag LOCUS_07920 gene guaA 319597 317732 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234667.1 protein_id gnl|my_center|LOCUS_07920 320815 319604 gene locus_tag LOCUS_07930 320815 319604 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615785.1 protein_id gnl|my_center|LOCUS_07930 321082 321672 gene locus_tag LOCUS_07940 321082 321672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07940 321826 321632 gene locus_tag LOCUS_07950 321826 321632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 322212 322721 gene locus_tag LOCUS_07960 322212 322721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 323865 322870 gene locus_tag LOCUS_07970 323865 322870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 325565 323862 gene locus_tag LOCUS_07980 325565 323862 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623945.1 protein_id gnl|my_center|LOCUS_07980 326303 325575 gene locus_tag LOCUS_07990 326303 325575 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_07990 327242 326316 gene locus_tag LOCUS_08000 327242 326316 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536752.1 protein_id gnl|my_center|LOCUS_08000 327468 328235 gene locus_tag LOCUS_08010 327468 328235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 328272 329582 gene locus_tag LOCUS_08020 328272 329582 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658464.1 protein_id gnl|my_center|LOCUS_08020 329579 330205 gene locus_tag LOCUS_08030 gene nadD 329579 330205 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964574.1 protein_id gnl|my_center|LOCUS_08030 331382 330219 gene locus_tag LOCUS_08040 331382 330219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_08040 331486 332913 gene locus_tag LOCUS_08050 331486 332913 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_08050 332956 333465 gene locus_tag LOCUS_08060 332956 333465 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_08060 334096 333578 gene locus_tag LOCUS_08070 334096 333578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 334275 334940 gene locus_tag LOCUS_08080 gene mpaA 334275 334940 CDS product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816358.1 protein_id gnl|my_center|LOCUS_08080 334960 335790 gene locus_tag LOCUS_08090 334960 335790 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_08090 335790 337109 gene locus_tag LOCUS_08100 335790 337109 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 protein_id gnl|my_center|LOCUS_08100 337763 337104 gene locus_tag LOCUS_08110 337763 337104 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_08110 338139 337753 gene locus_tag LOCUS_08120 338139 337753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 338567 339667 gene locus_tag LOCUS_08130 338567 339667 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096813.1 protein_id gnl|my_center|LOCUS_08130 339669 340616 gene locus_tag LOCUS_08140 339669 340616 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282348.1 protein_id gnl|my_center|LOCUS_08140 341647 340589 gene locus_tag LOCUS_08150 341647 340589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 342686 341655 gene locus_tag LOCUS_08160 342686 341655 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_08160 343630 342878 gene locus_tag LOCUS_08170 343630 342878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 344481 343645 gene locus_tag LOCUS_08180 344481 343645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 344548 347757 gene locus_tag LOCUS_08190 344548 347757 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796630.1 protein_id gnl|my_center|LOCUS_08190 348563 347694 gene locus_tag LOCUS_08200 348563 347694 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742874.1 protein_id gnl|my_center|LOCUS_08200 349279 348578 gene locus_tag LOCUS_08210 349279 348578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 349483 349283 gene locus_tag LOCUS_08220 gene thiS 349483 349283 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966207.1 protein_id gnl|my_center|LOCUS_08220 350199 349519 gene locus_tag LOCUS_08230 350199 349519 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_08230 350409 351389 gene locus_tag LOCUS_08240 350409 351389 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379429.1 protein_id gnl|my_center|LOCUS_08240 351392 351691 gene locus_tag LOCUS_08250 351392 351691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 352263 351688 gene locus_tag LOCUS_08260 352263 351688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 353526 352285 gene locus_tag LOCUS_08270 353526 352285 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492627.1 protein_id gnl|my_center|LOCUS_08270 353797 353528 gene locus_tag LOCUS_08280 353797 353528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 354884 353802 gene locus_tag LOCUS_08290 354884 353802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 355055 355852 gene locus_tag LOCUS_08300 355055 355852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08300 355857 356408 gene locus_tag LOCUS_08310 355857 356408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 357735 356410 gene locus_tag LOCUS_08320 357735 356410 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040212.1 protein_id gnl|my_center|LOCUS_08320 357882 360401 gene locus_tag LOCUS_08330 357882 360401 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999373.1 protein_id gnl|my_center|LOCUS_08330 360856 360509 gene locus_tag LOCUS_08340 360856 360509 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131883.1 protein_id gnl|my_center|LOCUS_08340 360943 361464 gene locus_tag LOCUS_08350 360943 361464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 361512 364331 gene locus_tag LOCUS_08360 361512 364331 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937562.1 protein_id gnl|my_center|LOCUS_08360 365137 364322 gene locus_tag LOCUS_08370 365137 364322 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921899.1 protein_id gnl|my_center|LOCUS_08370 366855 365140 gene locus_tag LOCUS_08380 366855 365140 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042798.1 protein_id gnl|my_center|LOCUS_08380 367000 367500 gene locus_tag LOCUS_08390 367000 367500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 368298 367501 gene locus_tag LOCUS_08400 368298 367501 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_08400 368448 368843 gene locus_tag LOCUS_08410 368448 368843 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879111.1 protein_id gnl|my_center|LOCUS_08410 368818 369174 gene locus_tag LOCUS_08420 368818 369174 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_08420 369915 369178 gene locus_tag LOCUS_08430 369915 369178 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_08430 370584 370063 gene locus_tag LOCUS_08440 370584 370063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 370740 371456 gene locus_tag LOCUS_08450 370740 371456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 371453 371947 gene locus_tag LOCUS_08460 371453 371947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08460 372140 372757 gene locus_tag LOCUS_08470 372140 372757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08470 372786 373748 gene locus_tag LOCUS_08480 gene wbpB 372786 373748 CDS product UDP-N-acetyl-2-amino-2-deoxy-D-glucuronate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113428.1 protein_id gnl|my_center|LOCUS_08480 373752 374357 gene locus_tag LOCUS_08490 373752 374357 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_08490 374373 375944 gene locus_tag LOCUS_08500 374373 375944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 375955 376326 gene locus_tag LOCUS_08510 375955 376326 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_08510 376438 377514 gene locus_tag LOCUS_08520 gene wecB 376438 377514 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_08520 377530 378822 gene locus_tag LOCUS_08530 377530 378822 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966346.1 protein_id gnl|my_center|LOCUS_08530 378803 380248 gene locus_tag LOCUS_08540 378803 380248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 380245 381384 gene locus_tag LOCUS_08550 gene waaB 380245 381384 CDS product lipopolysaccharide 1,6-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704702.1 protein_id gnl|my_center|LOCUS_08550 381402 382403 gene locus_tag LOCUS_08560 381402 382403 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_08560 383192 382398 gene locus_tag LOCUS_08570 383192 382398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08570 383440 383189 gene locus_tag LOCUS_08580 383440 383189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 383629 384705 gene locus_tag LOCUS_08590 383629 384705 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104563.1 protein_id gnl|my_center|LOCUS_08590 384698 385537 gene locus_tag LOCUS_08600 384698 385537 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_08600 385723 386025 gene locus_tag LOCUS_08610 385723 386025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 386079 386912 gene locus_tag LOCUS_08620 386079 386912 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941223.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence03 513 163 gene locus_tag LOCUS_08630 513 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 712 1380 gene locus_tag LOCUS_08640 712 1380 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_08640 2279 1398 gene locus_tag LOCUS_08650 gene rssA 2279 1398 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367078.1 protein_id gnl|my_center|LOCUS_08650 4060 2282 gene locus_tag LOCUS_08660 4060 2282 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587238.1 protein_id gnl|my_center|LOCUS_08660 4320 5687 gene locus_tag LOCUS_08670 4320 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 5704 6339 gene locus_tag LOCUS_08680 5704 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 6526 7995 gene locus_tag LOCUS_08690 6526 7995 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201884.1 protein_id gnl|my_center|LOCUS_08690 8775 7984 gene locus_tag LOCUS_08700 8775 7984 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963577.1 protein_id gnl|my_center|LOCUS_08700 9009 8904 gene locus_tag LOCUS_r00020 9009 8904 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 9194 10744 gene locus_tag LOCUS_08710 9194 10744 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 protein_id gnl|my_center|LOCUS_08710 10832 11707 gene locus_tag LOCUS_08720 10832 11707 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886798.1 protein_id gnl|my_center|LOCUS_08720 12551 11697 gene locus_tag LOCUS_08730 12551 11697 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050899.1 protein_id gnl|my_center|LOCUS_08730 12780 12562 gene locus_tag LOCUS_08740 12780 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 14633 12804 gene locus_tag LOCUS_08750 14633 12804 CDS product proteasome accessory factor PafA2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615993.1 protein_id gnl|my_center|LOCUS_08750 14825 14655 gene locus_tag LOCUS_08760 14825 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 14959 15807 gene locus_tag LOCUS_08770 14959 15807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 15878 18334 gene locus_tag LOCUS_08780 15878 18334 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391162.1 protein_id gnl|my_center|LOCUS_08780 18321 19103 gene locus_tag LOCUS_08790 18321 19103 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882838.1 protein_id gnl|my_center|LOCUS_08790 20377 19100 gene locus_tag LOCUS_08800 gene purD 20377 19100 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197375.1 protein_id gnl|my_center|LOCUS_08800 20562 22214 gene locus_tag LOCUS_08810 20562 22214 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_08810 23352 22240 gene locus_tag LOCUS_08820 23352 22240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 24510 23356 gene locus_tag LOCUS_08830 24510 23356 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767913.1 protein_id gnl|my_center|LOCUS_08830 25583 24507 gene locus_tag LOCUS_08840 25583 24507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468362.1 protein_id gnl|my_center|LOCUS_08840 25627 26814 gene locus_tag LOCUS_08850 25627 26814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 27482 26811 gene locus_tag LOCUS_08860 27482 26811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016106.1 protein_id gnl|my_center|LOCUS_08860 29947 27506 gene locus_tag LOCUS_08870 29947 27506 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251358.1 protein_id gnl|my_center|LOCUS_08870 30071 31891 gene locus_tag LOCUS_08880 gene lepA 30071 31891 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280999.1 protein_id gnl|my_center|LOCUS_08880 32008 33132 gene locus_tag LOCUS_08890 32008 33132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 33146 34006 gene locus_tag LOCUS_08900 33146 34006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 35772 34009 gene locus_tag LOCUS_08910 35772 34009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 36013 36192 gene locus_tag LOCUS_08920 36013 36192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 37106 36597 gene locus_tag LOCUS_08930 37106 36597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 37329 38438 gene locus_tag LOCUS_08940 37329 38438 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095359.1 protein_id gnl|my_center|LOCUS_08940 38454 39326 gene locus_tag LOCUS_08950 38454 39326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 40558 39473 gene locus_tag LOCUS_08960 40558 39473 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070779.1 protein_id gnl|my_center|LOCUS_08960 41530 40571 gene locus_tag LOCUS_08970 41530 40571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 41752 41534 gene locus_tag LOCUS_08980 gene hfq 41752 41534 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274793.1 protein_id gnl|my_center|LOCUS_08980 42782 41805 gene locus_tag LOCUS_08990 gene miaA 42782 41805 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081395.1 protein_id gnl|my_center|LOCUS_08990 43354 42779 gene locus_tag LOCUS_09000 gene gmk 43354 42779 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599646.1 protein_id gnl|my_center|LOCUS_09000 44221 43364 gene locus_tag LOCUS_09010 44221 43364 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939354.1 protein_id gnl|my_center|LOCUS_09010 45102 44221 gene locus_tag LOCUS_09020 45102 44221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 45433 45104 gene locus_tag LOCUS_09030 45433 45104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 47402 45438 gene locus_tag LOCUS_09040 47402 45438 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535110.1 protein_id gnl|my_center|LOCUS_09040 48353 47475 gene locus_tag LOCUS_09050 48353 47475 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145885.1 protein_id gnl|my_center|LOCUS_09050 48380 50791 gene locus_tag LOCUS_09060 48380 50791 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835640.1 protein_id gnl|my_center|LOCUS_09060 50803 51942 gene locus_tag LOCUS_09070 gene rpsA 50803 51942 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547091.1 protein_id gnl|my_center|LOCUS_09070 52078 52587 gene locus_tag LOCUS_09080 52078 52587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 53337 52639 gene locus_tag LOCUS_09090 53337 52639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623631.1 protein_id gnl|my_center|LOCUS_09090 53475 55961 gene locus_tag LOCUS_09100 53475 55961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 55971 56816 gene locus_tag LOCUS_09110 55971 56816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 56806 59970 gene locus_tag LOCUS_09120 56806 59970 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103182.1 protein_id gnl|my_center|LOCUS_09120 59955 61763 gene locus_tag LOCUS_09130 gene recD 59955 61763 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503851.1 protein_id gnl|my_center|LOCUS_09130 61770 62969 gene locus_tag LOCUS_09140 61770 62969 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476309.1 protein_id gnl|my_center|LOCUS_09140 62981 65629 gene locus_tag LOCUS_09150 62981 65629 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476308.1 protein_id gnl|my_center|LOCUS_09150 66536 65664 gene locus_tag LOCUS_09160 66536 65664 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172234.1 protein_id gnl|my_center|LOCUS_09160 67307 67585 gene locus_tag LOCUS_09170 67307 67585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 71304 68185 gene locus_tag LOCUS_09180 71304 68185 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 protein_id gnl|my_center|LOCUS_09180 73392 71530 gene locus_tag LOCUS_09190 73392 71530 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040060.1 protein_id gnl|my_center|LOCUS_09190 74504 73389 gene locus_tag LOCUS_09200 74504 73389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 76056 74509 gene locus_tag LOCUS_09210 76056 74509 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_09210 77395 76193 gene locus_tag LOCUS_09220 gene lhgO 77395 76193 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958479.1 protein_id gnl|my_center|LOCUS_09220 77549 79783 gene locus_tag LOCUS_09230 77549 79783 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 protein_id gnl|my_center|LOCUS_09230 79828 80307 gene locus_tag LOCUS_09240 79828 80307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 81316 80312 gene locus_tag LOCUS_09250 gene plsX 81316 80312 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990052.1 protein_id gnl|my_center|LOCUS_09250 83110 81515 gene locus_tag LOCUS_09260 gene purH 83110 81515 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614727.1 protein_id gnl|my_center|LOCUS_09260 83785 83156 gene locus_tag LOCUS_09270 gene purN 83785 83156 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_09270 86430 84667 gene locus_tag LOCUS_09280 86430 84667 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621166.1 protein_id gnl|my_center|LOCUS_09280 87754 86435 gene locus_tag LOCUS_09290 87754 86435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 88978 87755 gene locus_tag LOCUS_09300 gene truD 88978 87755 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545670.1 protein_id gnl|my_center|LOCUS_09300 89080 90012 gene locus_tag LOCUS_09310 89080 90012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 90009 90500 gene locus_tag LOCUS_09320 90009 90500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 91067 90504 gene locus_tag LOCUS_09330 91067 90504 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942963.1 protein_id gnl|my_center|LOCUS_09330 91230 92030 gene locus_tag LOCUS_09340 91230 92030 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_09340 92625 92050 gene locus_tag LOCUS_09350 92625 92050 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393578.1 protein_id gnl|my_center|LOCUS_09350 92937 94223 gene locus_tag LOCUS_09360 92937 94223 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_09360 94208 94588 gene locus_tag LOCUS_09370 94208 94588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 95358 94585 gene locus_tag LOCUS_09380 95358 94585 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880576.1 protein_id gnl|my_center|LOCUS_09380 95498 96004 gene locus_tag LOCUS_09390 95498 96004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 96808 96095 gene locus_tag LOCUS_09400 96808 96095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 96965 97037 gene locus_tag LOCUS_t00080 96965 97037 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 97044 97130 gene locus_tag LOCUS_t00090 97044 97130 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 98291 97182 gene locus_tag LOCUS_09410 gene proB 98291 97182 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583199.1 protein_id gnl|my_center|LOCUS_09410 99373 98291 gene locus_tag LOCUS_09420 gene obgE 99373 98291 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881354.1 protein_id gnl|my_center|LOCUS_09420 99630 99376 gene locus_tag LOCUS_09430 gene rpmA 99630 99376 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940600.1 protein_id gnl|my_center|LOCUS_09430 99964 99641 gene locus_tag LOCUS_09440 99964 99641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 100322 99966 gene locus_tag LOCUS_09450 gene rplU 100322 99966 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270913.1 protein_id gnl|my_center|LOCUS_09450 101267 100638 gene locus_tag LOCUS_09460 101267 100638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 102168 101311 gene locus_tag LOCUS_09470 102168 101311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 102888 102622 gene locus_tag LOCUS_09480 102888 102622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09480 105369 102931 gene locus_tag LOCUS_09490 105369 102931 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221442.1 protein_id gnl|my_center|LOCUS_09490 105848 105399 gene locus_tag LOCUS_09500 105848 105399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 106138 105845 gene locus_tag LOCUS_09510 106138 105845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 106269 109673 gene locus_tag LOCUS_09520 106269 109673 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449873.1 protein_id gnl|my_center|LOCUS_09520 110056 110529 gene locus_tag LOCUS_09530 110056 110529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 110767 110576 gene locus_tag LOCUS_09540 110767 110576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 110747 112408 gene locus_tag LOCUS_09550 110747 112408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 112900 112430 gene locus_tag LOCUS_09560 112900 112430 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658301.1 protein_id gnl|my_center|LOCUS_09560 113146 114450 gene locus_tag LOCUS_09570 113146 114450 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206943.1 protein_id gnl|my_center|LOCUS_09570 114490 115383 gene locus_tag LOCUS_09580 114490 115383 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_09580 115459 116724 gene locus_tag LOCUS_09590 115459 116724 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 protein_id gnl|my_center|LOCUS_09590 117164 116940 gene locus_tag LOCUS_09600 117164 116940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 118334 117660 gene locus_tag LOCUS_09610 118334 117660 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_09610 121548 118324 gene locus_tag LOCUS_09620 121548 118324 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070740.1 protein_id gnl|my_center|LOCUS_09620 123320 121551 gene locus_tag LOCUS_09630 123320 121551 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870191.1 protein_id gnl|my_center|LOCUS_09630 124562 123324 gene locus_tag LOCUS_09640 124562 123324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 125383 124775 gene locus_tag LOCUS_09650 125383 124775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 126611 125475 gene locus_tag LOCUS_09660 126611 125475 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_09660 129036 126595 gene locus_tag LOCUS_09670 129036 126595 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087775.1 protein_id gnl|my_center|LOCUS_09670 132235 129803 gene locus_tag LOCUS_09680 gene lon 132235 129803 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_09680 132738 132409 gene locus_tag LOCUS_09690 132738 132409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 133635 132868 gene locus_tag LOCUS_09700 133635 132868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 134465 133632 gene locus_tag LOCUS_09710 134465 133632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 135282 134452 gene locus_tag LOCUS_09720 135282 134452 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965458.1 protein_id gnl|my_center|LOCUS_09720 135885 135286 gene locus_tag LOCUS_09730 135885 135286 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850110.1 protein_id gnl|my_center|LOCUS_09730 135984 137705 gene locus_tag LOCUS_09740 135984 137705 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546696.1 protein_id gnl|my_center|LOCUS_09740 138419 137706 gene locus_tag LOCUS_09750 138419 137706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 138570 139112 gene locus_tag LOCUS_09760 gene rimP 138570 139112 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172333.1 protein_id gnl|my_center|LOCUS_09760 139137 140567 gene locus_tag LOCUS_09770 gene nusA 139137 140567 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279228.1 protein_id gnl|my_center|LOCUS_09770 140574 142880 gene locus_tag LOCUS_09780 140574 142880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 142883 143272 gene locus_tag LOCUS_09790 gene rbfA 142883 143272 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057468.1 protein_id gnl|my_center|LOCUS_09790 143304 144233 gene locus_tag LOCUS_09800 gene truB 143304 144233 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082025.1 protein_id gnl|my_center|LOCUS_09800 144301 144570 gene locus_tag LOCUS_09810 gene rpsO 144301 144570 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546801.1 protein_id gnl|my_center|LOCUS_09810 144596 146887 gene locus_tag LOCUS_09820 gene pnp 144596 146887 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149893.1 protein_id gnl|my_center|LOCUS_09820 146889 147341 gene locus_tag LOCUS_09830 gene dut 146889 147341 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067748.1 protein_id gnl|my_center|LOCUS_09830 148192 147338 gene locus_tag LOCUS_09840 148192 147338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 148368 149723 gene locus_tag LOCUS_09850 148368 149723 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_09850 150965 149718 gene locus_tag LOCUS_09860 150965 149718 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_09860 152712 150976 gene locus_tag LOCUS_09870 152712 150976 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816805.1 protein_id gnl|my_center|LOCUS_09870 155863 152735 gene locus_tag LOCUS_09880 155863 152735 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444671.1 protein_id gnl|my_center|LOCUS_09880 157180 155873 gene locus_tag LOCUS_09890 157180 155873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 157244 157777 gene locus_tag LOCUS_09900 157244 157777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 158071 159627 gene locus_tag LOCUS_09910 158071 159627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 160310 159624 gene locus_tag LOCUS_09920 160310 159624 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220028.1 protein_id gnl|my_center|LOCUS_09920 160997 160362 gene locus_tag LOCUS_09930 160997 160362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 162149 161019 gene locus_tag LOCUS_09940 162149 161019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 164746 162146 gene locus_tag LOCUS_09950 gene leuS 164746 162146 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199945.1 protein_id gnl|my_center|LOCUS_09950 166150 164966 gene locus_tag LOCUS_09960 166150 164966 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_09960 167590 166238 gene locus_tag LOCUS_09970 167590 166238 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544945.1 protein_id gnl|my_center|LOCUS_09970 167789 168541 gene locus_tag LOCUS_09980 gene map 167789 168541 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200692.1 protein_id gnl|my_center|LOCUS_09980 168652 169221 gene locus_tag LOCUS_09990 168652 169221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 169321 169716 gene locus_tag LOCUS_10000 169321 169716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083857.1 protein_id gnl|my_center|LOCUS_10000 169761 170144 gene locus_tag LOCUS_10010 169761 170144 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093268.1 protein_id gnl|my_center|LOCUS_10010 172102 170141 gene locus_tag LOCUS_10020 172102 170141 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_10020 174961 172163 gene locus_tag LOCUS_10030 gene polA 174961 172163 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825981.1 protein_id gnl|my_center|LOCUS_10030 176066 175035 gene locus_tag LOCUS_10040 176066 175035 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002067912.1 protein_id gnl|my_center|LOCUS_10040 176166 176615 gene locus_tag LOCUS_10050 176166 176615 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969255.1 protein_id gnl|my_center|LOCUS_10050 176762 177154 gene locus_tag LOCUS_10060 176762 177154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 177124 179115 gene locus_tag LOCUS_10070 177124 179115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 179748 179110 gene locus_tag LOCUS_10080 179748 179110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 181202 179760 gene locus_tag LOCUS_10090 gene lpdA 181202 179760 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115270.1 protein_id gnl|my_center|LOCUS_10090 181325 182230 gene locus_tag LOCUS_10100 181325 182230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 185937 182275 gene locus_tag LOCUS_10110 185937 182275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 186115 186648 gene locus_tag LOCUS_10120 186115 186648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 187534 186659 gene locus_tag LOCUS_10130 187534 186659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 188518 187538 gene locus_tag LOCUS_10140 188518 187538 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_10140 188644 190317 gene locus_tag LOCUS_10150 188644 190317 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206169.1 protein_id gnl|my_center|LOCUS_10150 191255 190389 gene locus_tag LOCUS_10160 191255 190389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 192102 191425 gene locus_tag LOCUS_10170 gene cysE 192102 191425 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_10170 192523 192122 gene locus_tag LOCUS_10180 192523 192122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 193082 192531 gene locus_tag LOCUS_10190 gene dcd 193082 192531 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_10190 193140 194072 gene locus_tag LOCUS_10200 gene fliH 193140 194072 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096786.1 protein_id gnl|my_center|LOCUS_10200 194123 194701 gene locus_tag LOCUS_10210 194123 194701 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_10210 194783 195286 gene locus_tag LOCUS_10220 194783 195286 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880261.1 protein_id gnl|my_center|LOCUS_10220 195436 196401 gene locus_tag LOCUS_10230 195436 196401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 196842 196384 gene locus_tag LOCUS_10240 196842 196384 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058819.1 protein_id gnl|my_center|LOCUS_10240 198108 196852 gene locus_tag LOCUS_10250 198108 196852 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010075.1 protein_id gnl|my_center|LOCUS_10250 198433 198119 gene locus_tag LOCUS_10260 198433 198119 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_10260 199611 198442 gene locus_tag LOCUS_10270 gene sufD 199611 198442 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147970.1 protein_id gnl|my_center|LOCUS_10270 200369 199626 gene locus_tag LOCUS_10280 gene sufC 200369 199626 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136057.1 protein_id gnl|my_center|LOCUS_10280 201820 200366 gene locus_tag LOCUS_10290 gene sufB 201820 200366 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438391.1 protein_id gnl|my_center|LOCUS_10290 202131 202583 gene locus_tag LOCUS_10300 202131 202583 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528503.1 protein_id gnl|my_center|LOCUS_10300 203097 202621 gene locus_tag LOCUS_10310 203097 202621 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172509.1 protein_id gnl|my_center|LOCUS_10310 204628 203144 gene locus_tag LOCUS_10320 204628 203144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489983.1 protein_id gnl|my_center|LOCUS_10320 205252 204686 gene locus_tag LOCUS_10330 205252 204686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 205493 205930 gene locus_tag LOCUS_10340 205493 205930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 205943 208441 gene locus_tag LOCUS_10350 gene ccsA 205943 208441 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997623.1 protein_id gnl|my_center|LOCUS_10350 208582 208869 gene locus_tag LOCUS_10360 208582 208869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 208866 209852 gene locus_tag LOCUS_10370 208866 209852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 209845 210570 gene locus_tag LOCUS_10380 209845 210570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 210733 211242 gene locus_tag LOCUS_10390 210733 211242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 212724 211483 gene locus_tag LOCUS_10400 212724 211483 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_10400 213685 212726 gene locus_tag LOCUS_10410 gene cysD 213685 212726 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_10410 215440 213689 gene locus_tag LOCUS_10420 215440 213689 CDS product NADPH-dependent assimilatory sulfite reductase hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287342.1 protein_id gnl|my_center|LOCUS_10420 215805 215524 gene locus_tag LOCUS_10430 215805 215524 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630832.1 protein_id gnl|my_center|LOCUS_10430 215999 216295 gene locus_tag LOCUS_10440 215999 216295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 216313 217086 gene locus_tag LOCUS_10450 216313 217086 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942361.1 protein_id gnl|my_center|LOCUS_10450 217083 217757 gene locus_tag LOCUS_10460 217083 217757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 217894 218304 gene locus_tag LOCUS_10470 217894 218304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 218319 218834 gene locus_tag LOCUS_10480 218319 218834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 219491 218868 gene locus_tag LOCUS_10490 gene rdgB 219491 218868 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256394.1 protein_id gnl|my_center|LOCUS_10490 219757 220275 gene locus_tag LOCUS_10500 219757 220275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 223545 220597 gene locus_tag LOCUS_10510 223545 220597 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074841.1 protein_id gnl|my_center|LOCUS_10510 224065 223559 gene locus_tag LOCUS_10520 224065 223559 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544978.1 protein_id gnl|my_center|LOCUS_10520 225180 224062 gene locus_tag LOCUS_10530 225180 224062 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_10530 226397 225240 gene locus_tag LOCUS_10540 226397 225240 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_10540 226859 226518 gene locus_tag LOCUS_10550 226859 226518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 227179 226856 gene locus_tag LOCUS_10560 227179 226856 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249913.1 protein_id gnl|my_center|LOCUS_10560 230212 227183 gene locus_tag LOCUS_10570 230212 227183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 231311 230385 gene locus_tag LOCUS_10580 231311 230385 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_10580 231771 231421 gene locus_tag LOCUS_10590 231771 231421 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406975.1 protein_id gnl|my_center|LOCUS_10590 232271 231759 gene locus_tag LOCUS_10600 232271 231759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 232646 233080 gene locus_tag LOCUS_10610 232646 233080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 233204 234757 gene locus_tag LOCUS_10620 233204 234757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 234770 235663 gene locus_tag LOCUS_10630 234770 235663 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_10630 235676 236320 gene locus_tag LOCUS_10640 235676 236320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 236322 237137 gene locus_tag LOCUS_10650 236322 237137 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927154.1 protein_id gnl|my_center|LOCUS_10650 237689 237111 gene locus_tag LOCUS_10660 237689 237111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 239489 237693 gene locus_tag LOCUS_10670 239489 237693 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_10670 241555 239489 gene locus_tag LOCUS_10680 241555 239489 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001974395.1 protein_id gnl|my_center|LOCUS_10680 242192 241671 gene locus_tag LOCUS_10690 gene msrA 242192 241671 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_10690 242358 242999 gene locus_tag LOCUS_10700 242358 242999 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_10700 244402 243089 gene locus_tag LOCUS_10710 244402 243089 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250780.1 protein_id gnl|my_center|LOCUS_10710 244632 245225 gene locus_tag LOCUS_10720 244632 245225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 245312 245737 gene locus_tag LOCUS_10730 gene nikR 245312 245737 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380787.1 protein_id gnl|my_center|LOCUS_10730 245747 245998 gene locus_tag LOCUS_10740 245747 245998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 246285 245995 gene locus_tag LOCUS_10750 246285 245995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 246348 247400 gene locus_tag LOCUS_10760 246348 247400 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812925.1 protein_id gnl|my_center|LOCUS_10760 247441 247896 gene locus_tag LOCUS_10770 247441 247896 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_10770 248096 249700 gene locus_tag LOCUS_10780 248096 249700 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545223.1 protein_id gnl|my_center|LOCUS_10780 249704 249970 gene locus_tag LOCUS_10790 249704 249970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10790 250002 250481 gene locus_tag LOCUS_10800 250002 250481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10800 250685 251713 gene locus_tag LOCUS_10810 250685 251713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 252556 251786 gene locus_tag LOCUS_10820 252556 251786 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268585.1 protein_id gnl|my_center|LOCUS_10820 252698 253465 gene locus_tag LOCUS_10830 252698 253465 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_10830 253475 254374 gene locus_tag LOCUS_10840 253475 254374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 254456 257107 gene locus_tag LOCUS_10850 254456 257107 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131037.1 protein_id gnl|my_center|LOCUS_10850 257473 257688 gene locus_tag LOCUS_10860 257473 257688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10860 258376 258654 gene locus_tag LOCUS_10870 258376 258654 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496759.1 protein_id gnl|my_center|LOCUS_10870 258700 259440 gene locus_tag LOCUS_10880 258700 259440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10880 259400 259585 gene locus_tag LOCUS_10890 259400 259585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 259709 259909 gene locus_tag LOCUS_10900 259709 259909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 260909 260400 gene locus_tag LOCUS_10910 260909 260400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 261333 261833 gene locus_tag LOCUS_10920 261333 261833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 261953 262270 gene locus_tag LOCUS_10930 261953 262270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 262504 263013 gene locus_tag LOCUS_10940 262504 263013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 263241 264701 gene locus_tag LOCUS_10950 263241 264701 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_10950 265224 264682 gene locus_tag LOCUS_10960 265224 264682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 265643 265221 gene locus_tag LOCUS_10970 265643 265221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 266073 265627 gene locus_tag LOCUS_10980 266073 265627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 266074 266343 gene locus_tag LOCUS_10990 266074 266343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 266561 266340 gene locus_tag LOCUS_11000 266561 266340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 267262 266603 gene locus_tag LOCUS_11010 gene trmB 267262 266603 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249518.1 protein_id gnl|my_center|LOCUS_11010 267363 268307 gene locus_tag LOCUS_11020 267363 268307 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636970.1 protein_id gnl|my_center|LOCUS_11020 276544 268652 gene locus_tag LOCUS_11030 276544 268652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 277106 276513 gene locus_tag LOCUS_11040 277106 276513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 280110 277111 gene locus_tag LOCUS_11050 280110 277111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 281290 280133 gene locus_tag LOCUS_11060 281290 280133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 281411 282343 gene locus_tag LOCUS_11070 281411 282343 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983101.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence04 644 5107 gene locus_tag LOCUS_11080 644 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 5275 6501 gene locus_tag LOCUS_11090 5275 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 6491 6679 gene locus_tag LOCUS_11100 6491 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 6840 8270 gene locus_tag LOCUS_11110 6840 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 8261 8692 gene locus_tag LOCUS_11120 8261 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 8607 8984 gene locus_tag LOCUS_11130 8607 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 9904 10941 gene locus_tag LOCUS_11140 9904 10941 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066138.1 protein_id gnl|my_center|LOCUS_11140 12174 10942 gene locus_tag LOCUS_11150 12174 10942 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024301.1 protein_id gnl|my_center|LOCUS_11150 12234 13709 gene locus_tag LOCUS_11160 12234 13709 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247553.1 protein_id gnl|my_center|LOCUS_11160 13709 14638 gene locus_tag LOCUS_11170 13709 14638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 14631 15791 gene locus_tag LOCUS_11180 14631 15791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 15846 16448 gene locus_tag LOCUS_11190 15846 16448 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392363.1 protein_id gnl|my_center|LOCUS_11190 16696 16445 gene locus_tag LOCUS_11200 16696 16445 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 protein_id gnl|my_center|LOCUS_11200 18057 16738 gene locus_tag LOCUS_11210 18057 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869088.1 protein_id gnl|my_center|LOCUS_11210 18139 18486 gene locus_tag LOCUS_11220 18139 18486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 18483 19415 gene locus_tag LOCUS_11230 18483 19415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 19439 21130 gene locus_tag LOCUS_11240 gene gpmI 19439 21130 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_11240 22181 21132 gene locus_tag LOCUS_11250 22181 21132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 23224 22214 gene locus_tag LOCUS_11260 gene hemH 23224 22214 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957341.1 protein_id gnl|my_center|LOCUS_11260 23827 23231 gene locus_tag LOCUS_11270 23827 23231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 23972 25096 gene locus_tag LOCUS_11280 23972 25096 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422650.1 protein_id gnl|my_center|LOCUS_11280 25174 26508 gene locus_tag LOCUS_11290 25174 26508 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_11290 26527 27267 gene locus_tag LOCUS_11300 26527 27267 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_11300 27815 27270 gene locus_tag LOCUS_11310 27815 27270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 27905 28516 gene locus_tag LOCUS_11320 27905 28516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 29331 28513 gene locus_tag LOCUS_11330 gene rsmA 29331 28513 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098504.1 protein_id gnl|my_center|LOCUS_11330 31024 29309 gene locus_tag LOCUS_11340 31024 29309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 31146 31925 gene locus_tag LOCUS_11350 31146 31925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 32537 31917 gene locus_tag LOCUS_11360 32537 31917 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053413.1 protein_id gnl|my_center|LOCUS_11360 33070 32534 gene locus_tag LOCUS_11370 33070 32534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 33572 33030 gene locus_tag LOCUS_11380 33572 33030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 34028 33588 gene locus_tag LOCUS_11390 34028 33588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 35297 34071 gene locus_tag LOCUS_11400 35297 34071 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029466.1 protein_id gnl|my_center|LOCUS_11400 36964 35297 gene locus_tag LOCUS_11410 gene gspE 36964 35297 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_11410 38780 36966 gene locus_tag LOCUS_11420 gene gspD 38780 36966 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017090.1 protein_id gnl|my_center|LOCUS_11420 39683 38808 gene locus_tag LOCUS_11430 39683 38808 CDS product general secretion pathway protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991320.1 protein_id gnl|my_center|LOCUS_11430 40853 39687 gene locus_tag LOCUS_11440 40853 39687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 41251 40850 gene locus_tag LOCUS_11450 41251 40850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 41270 42760 gene locus_tag LOCUS_11460 41270 42760 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880140.1 protein_id gnl|my_center|LOCUS_11460 42986 42741 gene locus_tag LOCUS_11470 42986 42741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 43497 43069 gene locus_tag LOCUS_11480 43497 43069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 44707 43508 gene locus_tag LOCUS_11490 44707 43508 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712870.1 protein_id gnl|my_center|LOCUS_11490 44951 44679 gene locus_tag LOCUS_11500 44951 44679 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082188.1 protein_id gnl|my_center|LOCUS_11500 45210 44974 gene locus_tag LOCUS_11510 45210 44974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 46080 45322 gene locus_tag LOCUS_11520 46080 45322 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963332.1 protein_id gnl|my_center|LOCUS_11520 46517 46083 gene locus_tag LOCUS_11530 46517 46083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 47252 46542 gene locus_tag LOCUS_11540 gene trmD 47252 46542 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671159.1 protein_id gnl|my_center|LOCUS_11540 47896 47252 gene locus_tag LOCUS_11550 47896 47252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 48144 47899 gene locus_tag LOCUS_11560 48144 47899 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_11560 48484 48146 gene locus_tag LOCUS_11570 48484 48146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 49130 48795 gene locus_tag LOCUS_11580 gene zapA 49130 48795 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808223.1 protein_id gnl|my_center|LOCUS_11580 49965 49111 gene locus_tag LOCUS_11590 49965 49111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 50446 50102 gene locus_tag LOCUS_11600 gene rplT 50446 50102 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136837.1 protein_id gnl|my_center|LOCUS_11600 50687 50475 gene locus_tag LOCUS_11610 gene rpmI 50687 50475 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_11610 51294 50749 gene locus_tag LOCUS_11620 gene infC 51294 50749 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106936.1 protein_id gnl|my_center|LOCUS_11620 52643 51387 gene locus_tag LOCUS_11630 52643 51387 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160150.1 protein_id gnl|my_center|LOCUS_11630 53483 52656 gene locus_tag LOCUS_11640 53483 52656 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258776.1 protein_id gnl|my_center|LOCUS_11640 53982 53485 gene locus_tag LOCUS_11650 53982 53485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 55850 53979 gene locus_tag LOCUS_11660 gene typA 55850 53979 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405892.1 protein_id gnl|my_center|LOCUS_11660 56050 58599 gene locus_tag LOCUS_11670 56050 58599 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889672.1 protein_id gnl|my_center|LOCUS_11670 58605 60734 gene locus_tag LOCUS_11680 58605 60734 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876410.1 protein_id gnl|my_center|LOCUS_11680 60739 61779 gene locus_tag LOCUS_11690 60739 61779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 62941 61763 gene locus_tag LOCUS_11700 62941 61763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 63077 64090 gene locus_tag LOCUS_11710 63077 64090 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625202.1 protein_id gnl|my_center|LOCUS_11710 64148 65428 gene locus_tag LOCUS_11720 64148 65428 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965707.1 protein_id gnl|my_center|LOCUS_11720 65428 66435 gene locus_tag LOCUS_11730 65428 66435 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583172.1 protein_id gnl|my_center|LOCUS_11730 66650 67933 gene locus_tag LOCUS_11740 gene manA 66650 67933 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170615.1 protein_id gnl|my_center|LOCUS_11740 67976 69091 gene locus_tag LOCUS_11750 67976 69091 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982414.1 protein_id gnl|my_center|LOCUS_11750 70050 69088 gene locus_tag LOCUS_11760 70050 69088 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140212.1 protein_id gnl|my_center|LOCUS_11760 71204 70092 gene locus_tag LOCUS_11770 gene dnaJ 71204 70092 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004170.1 protein_id gnl|my_center|LOCUS_11770 73166 71256 gene locus_tag LOCUS_11780 gene dnaK 73166 71256 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031822.1 protein_id gnl|my_center|LOCUS_11780 73892 73203 gene locus_tag LOCUS_11790 gene grpE 73892 73203 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829531.1 protein_id gnl|my_center|LOCUS_11790 75039 73903 gene locus_tag LOCUS_11800 gene hrcA 75039 73903 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366219.1 protein_id gnl|my_center|LOCUS_11800 75734 75252 gene locus_tag LOCUS_11810 75734 75252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 76849 75713 gene locus_tag LOCUS_11820 76849 75713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 76936 77919 gene locus_tag LOCUS_11830 76936 77919 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578515.1 protein_id gnl|my_center|LOCUS_11830 79217 77916 gene locus_tag LOCUS_11840 79217 77916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 81244 79217 gene locus_tag LOCUS_11850 81244 79217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 81324 81956 gene locus_tag LOCUS_11860 81324 81956 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973506.1 protein_id gnl|my_center|LOCUS_11860 83328 81958 gene locus_tag LOCUS_11870 gene mtaB 83328 81958 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555988.1 protein_id gnl|my_center|LOCUS_11870 84087 83329 gene locus_tag LOCUS_11880 84087 83329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 84604 84134 gene locus_tag LOCUS_11890 84604 84134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 87200 84606 gene locus_tag LOCUS_11900 87200 84606 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889239.1 protein_id gnl|my_center|LOCUS_11900 88435 87302 gene locus_tag LOCUS_11910 88435 87302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 89121 88432 gene locus_tag LOCUS_11920 89121 88432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052667.1 protein_id gnl|my_center|LOCUS_11920 90461 89124 gene locus_tag LOCUS_11930 90461 89124 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867620.1 protein_id gnl|my_center|LOCUS_11930 92129 90552 gene locus_tag LOCUS_11940 92129 90552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 92484 92945 gene locus_tag LOCUS_11950 92484 92945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 94271 92976 gene locus_tag LOCUS_11960 94271 92976 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280808.1 protein_id gnl|my_center|LOCUS_11960 96053 94374 gene locus_tag LOCUS_11970 gene hflX 96053 94374 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960087.1 protein_id gnl|my_center|LOCUS_11970 96173 97015 gene locus_tag LOCUS_11980 96173 97015 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140342.1 protein_id gnl|my_center|LOCUS_11980 97114 98556 gene locus_tag LOCUS_11990 gene leuC 97114 98556 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140662.1 protein_id gnl|my_center|LOCUS_11990 98559 99623 gene locus_tag LOCUS_12000 gene mutY 98559 99623 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773586.1 protein_id gnl|my_center|LOCUS_12000 99677 100246 gene locus_tag LOCUS_12010 99677 100246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 100236 100697 gene locus_tag LOCUS_12020 100236 100697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 101181 100702 gene locus_tag LOCUS_12030 101181 100702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 101344 102243 gene locus_tag LOCUS_12040 101344 102243 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817415.1 protein_id gnl|my_center|LOCUS_12040 102257 103222 gene locus_tag LOCUS_12050 102257 103222 CDS product lauroyl/myristoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027687.1 protein_id gnl|my_center|LOCUS_12050 104102 103212 gene locus_tag LOCUS_12060 gene dapF 104102 103212 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157609.1 protein_id gnl|my_center|LOCUS_12060 104306 105109 gene locus_tag LOCUS_12070 104306 105109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 105081 105446 gene locus_tag LOCUS_12080 105081 105446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 105456 105797 gene locus_tag LOCUS_12090 105456 105797 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695903.1 protein_id gnl|my_center|LOCUS_12090 106713 105799 gene locus_tag LOCUS_12100 106713 105799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 106688 107644 gene locus_tag LOCUS_12110 106688 107644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 108019 107645 gene locus_tag LOCUS_12120 108019 107645 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986781.1 protein_id gnl|my_center|LOCUS_12120 108649 108062 gene locus_tag LOCUS_12130 108649 108062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 109337 108642 gene locus_tag LOCUS_12140 109337 108642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 109882 109340 gene locus_tag LOCUS_12150 109882 109340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 109964 110773 gene locus_tag LOCUS_12160 109964 110773 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690058.1 protein_id gnl|my_center|LOCUS_12160 111371 110751 gene locus_tag LOCUS_12170 111371 110751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 111430 112344 gene locus_tag LOCUS_12180 gene ubiA 111430 112344 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156605.1 protein_id gnl|my_center|LOCUS_12180 112349 113017 gene locus_tag LOCUS_12190 112349 113017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 113021 113623 gene locus_tag LOCUS_12200 113021 113623 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868085.1 protein_id gnl|my_center|LOCUS_12200 113639 114880 gene locus_tag LOCUS_12210 gene tyrS 113639 114880 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354445.1 protein_id gnl|my_center|LOCUS_12210 114892 116589 gene locus_tag LOCUS_12220 114892 116589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 118398 116590 gene locus_tag LOCUS_12230 118398 116590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 118645 119976 gene locus_tag LOCUS_12240 118645 119976 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_12240 119973 123485 gene locus_tag LOCUS_12250 119973 123485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 123482 124828 gene locus_tag LOCUS_12260 123482 124828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 125252 124791 gene locus_tag LOCUS_12270 125252 124791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 125371 125634 gene locus_tag LOCUS_12280 125371 125634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 125645 126103 gene locus_tag LOCUS_12290 125645 126103 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057200.1 protein_id gnl|my_center|LOCUS_12290 126123 126410 gene locus_tag LOCUS_12300 126123 126410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 126353 126718 gene locus_tag LOCUS_12310 126353 126718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 126705 127628 gene locus_tag LOCUS_12320 gene thiL 126705 127628 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662272.1 protein_id gnl|my_center|LOCUS_12320 127733 128353 gene locus_tag LOCUS_12330 gene rpsD 127733 128353 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_12330 128708 128376 gene locus_tag LOCUS_12340 128708 128376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 129623 128817 gene locus_tag LOCUS_12350 gene whiG 129623 128817 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_12350 130157 129678 gene locus_tag LOCUS_12360 130157 129678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053201.1 protein_id gnl|my_center|LOCUS_12360 131144 130227 gene locus_tag LOCUS_12370 131144 130227 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371638.1 protein_id gnl|my_center|LOCUS_12370 132507 131179 gene locus_tag LOCUS_12380 gene flhF 132507 131179 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986949.1 protein_id gnl|my_center|LOCUS_12380 132638 133303 gene locus_tag LOCUS_12390 132638 133303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 133359 134420 gene locus_tag LOCUS_12400 133359 134420 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_12400 135100 134453 gene locus_tag LOCUS_12410 135100 134453 CDS product dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967625.1 protein_id gnl|my_center|LOCUS_12410 135153 136421 gene locus_tag LOCUS_12420 135153 136421 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576871.1 protein_id gnl|my_center|LOCUS_12420 136451 137089 gene locus_tag LOCUS_12430 136451 137089 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402807.1 protein_id gnl|my_center|LOCUS_12430 137522 137091 gene locus_tag LOCUS_12440 137522 137091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 137678 138178 gene locus_tag LOCUS_12450 137678 138178 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078417.1 protein_id gnl|my_center|LOCUS_12450 138171 140240 gene locus_tag LOCUS_12460 gene ligA 138171 140240 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124831.1 protein_id gnl|my_center|LOCUS_12460 141504 140242 gene locus_tag LOCUS_12470 141504 140242 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_12470 141618 144977 gene locus_tag LOCUS_12480 gene carB 141618 144977 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137995.1 protein_id gnl|my_center|LOCUS_12480 144974 145696 gene locus_tag LOCUS_12490 144974 145696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 145824 146234 gene locus_tag LOCUS_12500 145824 146234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142725.1 protein_id gnl|my_center|LOCUS_12500 147133 146258 gene locus_tag LOCUS_12510 gene sucD 147133 146258 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279904.1 protein_id gnl|my_center|LOCUS_12510 148363 147149 gene locus_tag LOCUS_12520 gene sucC 148363 147149 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690686.1 protein_id gnl|my_center|LOCUS_12520 149716 148553 gene locus_tag LOCUS_12530 149716 148553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 151174 149729 gene locus_tag LOCUS_12540 151174 149729 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_12540 153191 151200 gene locus_tag LOCUS_12550 153191 151200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 153319 153393 gene locus_tag LOCUS_t00100 153319 153393 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 156396 153400 gene locus_tag LOCUS_12560 156396 153400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 156369 158450 gene locus_tag LOCUS_12570 156369 158450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 158426 158788 gene locus_tag LOCUS_12580 158426 158788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 159662 158763 gene locus_tag LOCUS_12590 159662 158763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361891.1 protein_id gnl|my_center|LOCUS_12590 160617 159646 gene locus_tag LOCUS_12600 gene ruvB 160617 159646 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903189.1 protein_id gnl|my_center|LOCUS_12600 161347 160667 gene locus_tag LOCUS_12610 gene rsmI 161347 160667 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_12610 162230 161340 gene locus_tag LOCUS_12620 162230 161340 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176746.1 protein_id gnl|my_center|LOCUS_12620 163033 162227 gene locus_tag LOCUS_12630 163033 162227 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824202.1 protein_id gnl|my_center|LOCUS_12630 164372 163122 gene locus_tag LOCUS_12640 164372 163122 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128545.1 protein_id gnl|my_center|LOCUS_12640 165591 164362 gene locus_tag LOCUS_12650 165591 164362 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951973.1 protein_id gnl|my_center|LOCUS_12650 165739 171588 gene locus_tag LOCUS_12660 165739 171588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 172629 171583 gene locus_tag LOCUS_12670 172629 171583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 172796 173860 gene locus_tag LOCUS_12680 gene dusA 172796 173860 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261114.1 protein_id gnl|my_center|LOCUS_12680 173829 174554 gene locus_tag LOCUS_12690 gene nfi 173829 174554 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583138.1 protein_id gnl|my_center|LOCUS_12690 174922 174527 gene locus_tag LOCUS_12700 174922 174527 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_12700 175567 174926 gene locus_tag LOCUS_12710 175567 174926 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603802.1 protein_id gnl|my_center|LOCUS_12710 176340 175561 gene locus_tag LOCUS_12720 176340 175561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050596.1 protein_id gnl|my_center|LOCUS_12720 178145 176337 gene locus_tag LOCUS_12730 178145 176337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 178875 178147 gene locus_tag LOCUS_12740 gene pdxJ 178875 178147 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880920.1 protein_id gnl|my_center|LOCUS_12740 179738 178881 gene locus_tag LOCUS_12750 179738 178881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 181486 179897 gene locus_tag LOCUS_12760 gene pckA 181486 179897 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148872.1 protein_id gnl|my_center|LOCUS_12760 183023 181656 gene locus_tag LOCUS_12770 183023 181656 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064354.1 protein_id gnl|my_center|LOCUS_12770 183633 183097 gene locus_tag LOCUS_12780 183633 183097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 184229 183630 gene locus_tag LOCUS_12790 184229 183630 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378484.1 protein_id gnl|my_center|LOCUS_12790 184847 184275 gene locus_tag LOCUS_12800 184847 184275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 185145 185831 gene locus_tag LOCUS_12810 185145 185831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 185866 187371 gene locus_tag LOCUS_12820 185866 187371 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844448.1 protein_id gnl|my_center|LOCUS_12820 187399 188019 gene locus_tag LOCUS_12830 187399 188019 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128627.1 protein_id gnl|my_center|LOCUS_12830 189467 188016 gene locus_tag LOCUS_12840 189467 188016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 189559 190041 gene locus_tag LOCUS_12850 189559 190041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 191857 190013 gene locus_tag LOCUS_12860 191857 190013 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199929.1 protein_id gnl|my_center|LOCUS_12860 191914 193899 gene locus_tag LOCUS_12870 gene ispG 191914 193899 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011576.1 protein_id gnl|my_center|LOCUS_12870 194699 193926 gene locus_tag LOCUS_12880 194699 193926 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_12880 194957 195454 gene locus_tag LOCUS_12890 gene tpx 194957 195454 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880278.1 protein_id gnl|my_center|LOCUS_12890 195556 196398 gene locus_tag LOCUS_12900 195556 196398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 197016 196381 gene locus_tag LOCUS_12910 197016 196381 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880861.1 protein_id gnl|my_center|LOCUS_12910 197425 197018 gene locus_tag LOCUS_12920 197425 197018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 197682 197437 gene locus_tag LOCUS_12930 197682 197437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 197806 198783 gene locus_tag LOCUS_12940 gene galE 197806 198783 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984071.1 protein_id gnl|my_center|LOCUS_12940 198776 199681 gene locus_tag LOCUS_12950 198776 199681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 200071 200961 gene locus_tag LOCUS_12960 200071 200961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 201018 201449 gene locus_tag LOCUS_12970 201018 201449 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188723.1 protein_id gnl|my_center|LOCUS_12970 201505 202524 gene locus_tag LOCUS_12980 gene gap 201505 202524 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479552.1 protein_id gnl|my_center|LOCUS_12980 202588 203799 gene locus_tag LOCUS_12990 202588 203799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 203851 204150 gene locus_tag LOCUS_13000 203851 204150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 204745 204164 gene locus_tag LOCUS_13010 204745 204164 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708720.1 protein_id gnl|my_center|LOCUS_13010 205368 204745 gene locus_tag LOCUS_13020 gene tmk 205368 204745 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791380.1 protein_id gnl|my_center|LOCUS_13020 205476 206903 gene locus_tag LOCUS_13030 205476 206903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144183.1 protein_id gnl|my_center|LOCUS_13030 206905 208146 gene locus_tag LOCUS_13040 206905 208146 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281336.1 protein_id gnl|my_center|LOCUS_13040 208754 208239 gene locus_tag LOCUS_13050 208754 208239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 208877 210370 gene locus_tag LOCUS_13060 208877 210370 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136108.1 protein_id gnl|my_center|LOCUS_13060 210489 211883 gene locus_tag LOCUS_13070 210489 211883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 211885 214704 gene locus_tag LOCUS_13080 gene secA 211885 214704 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615621.1 protein_id gnl|my_center|LOCUS_13080 214701 215543 gene locus_tag LOCUS_13090 gene trpA 214701 215543 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084828.1 protein_id gnl|my_center|LOCUS_13090 215559 218264 gene locus_tag LOCUS_13100 215559 218264 CDS product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291001.1 protein_id gnl|my_center|LOCUS_13100 218268 220190 gene locus_tag LOCUS_13110 gene dxs 218268 220190 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183723.1 protein_id gnl|my_center|LOCUS_13110 220233 220718 gene locus_tag LOCUS_13120 220233 220718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 220702 222690 gene locus_tag LOCUS_13130 220702 222690 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480299.1 protein_id gnl|my_center|LOCUS_13130 222696 223463 gene locus_tag LOCUS_13140 222696 223463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 223447 224427 gene locus_tag LOCUS_13150 gene rfaE1 223447 224427 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291586.1 protein_id gnl|my_center|LOCUS_13150 224429 224932 gene locus_tag LOCUS_13160 gene rfaE2 224429 224932 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_13160 225054 226310 gene locus_tag LOCUS_13170 225054 226310 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_13170 226944 226345 gene locus_tag LOCUS_13180 226944 226345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 227989 226919 gene locus_tag LOCUS_13190 gene hisC 227989 226919 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949115.1 protein_id gnl|my_center|LOCUS_13190 229654 228155 gene locus_tag LOCUS_13200 229654 228155 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_13200 231383 229755 gene locus_tag LOCUS_13210 gene murJ 231383 229755 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063338.1 protein_id gnl|my_center|LOCUS_13210 232324 231380 gene locus_tag LOCUS_13220 232324 231380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 233416 232334 gene locus_tag LOCUS_13230 233416 232334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 233498 234481 gene locus_tag LOCUS_13240 233498 234481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 234478 235740 gene locus_tag LOCUS_13250 234478 235740 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111751.1 protein_id gnl|my_center|LOCUS_13250 235775 236314 gene locus_tag LOCUS_13260 235775 236314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 236315 237367 gene locus_tag LOCUS_13270 236315 237367 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566815.1 protein_id gnl|my_center|LOCUS_13270 239139 237334 gene locus_tag LOCUS_13280 239139 237334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 239229 240158 gene locus_tag LOCUS_13290 239229 240158 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_13290 240158 242053 gene locus_tag LOCUS_13300 gene uvrC 240158 242053 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114128.1 protein_id gnl|my_center|LOCUS_13300 242043 242486 gene locus_tag LOCUS_13310 242043 242486 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451642.1 protein_id gnl|my_center|LOCUS_13310 <243143 242490 gene locus_tag LOCUS_13320 <243143 242490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943350.1:fibronectin type III >Feature sequence05 604 1884 gene locus_tag LOCUS_13330 gene tilS 604 1884 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205039.1 protein_id gnl|my_center|LOCUS_13330 1925 2713 gene locus_tag LOCUS_13340 1925 2713 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030521.1 protein_id gnl|my_center|LOCUS_13340 2706 3212 gene locus_tag LOCUS_13350 2706 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 3193 3516 gene locus_tag LOCUS_13360 3193 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3636 4145 gene locus_tag LOCUS_13370 3636 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 4319 4705 gene locus_tag LOCUS_13380 gene fliE 4319 4705 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405186.1 protein_id gnl|my_center|LOCUS_13380 4826 6514 gene locus_tag LOCUS_13390 gene fliF 4826 6514 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115055.1 protein_id gnl|my_center|LOCUS_13390 7832 6516 gene locus_tag LOCUS_13400 7832 6516 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454161.1 protein_id gnl|my_center|LOCUS_13400 7970 8062 gene locus_tag LOCUS_t00110 7970 8062 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8137 9060 gene locus_tag LOCUS_13410 8137 9060 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054050.1 protein_id gnl|my_center|LOCUS_13410 9097 9747 gene locus_tag LOCUS_13420 9097 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 13252 9752 gene locus_tag LOCUS_13430 gene dnaE 13252 9752 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150496.1 protein_id gnl|my_center|LOCUS_13430 13462 14274 gene locus_tag LOCUS_13440 13462 14274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 14271 15257 gene locus_tag LOCUS_13450 14271 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 15474 15259 gene locus_tag LOCUS_13460 15474 15259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 15701 15922 gene locus_tag LOCUS_13470 15701 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 15944 17842 gene locus_tag LOCUS_13480 gene dnaG 15944 17842 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066267.1 protein_id gnl|my_center|LOCUS_13480 17868 19622 gene locus_tag LOCUS_13490 gene rpoD 17868 19622 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429410.1 protein_id gnl|my_center|LOCUS_13490 21056 19647 gene locus_tag LOCUS_13500 21056 19647 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839201.1 protein_id gnl|my_center|LOCUS_13500 21221 21586 gene locus_tag LOCUS_13510 21221 21586 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206200.1 protein_id gnl|my_center|LOCUS_13510 22207 21614 gene locus_tag LOCUS_13520 22207 21614 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115288.1 protein_id gnl|my_center|LOCUS_13520 22666 22250 gene locus_tag LOCUS_13530 22666 22250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 23996 22683 gene locus_tag LOCUS_13540 gene eno 23996 22683 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880276.1 protein_id gnl|my_center|LOCUS_13540 24081 24587 gene locus_tag LOCUS_13550 24081 24587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 24659 25771 gene locus_tag LOCUS_13560 gene leuB 24659 25771 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799846.1 protein_id gnl|my_center|LOCUS_13560 25781 26164 gene locus_tag LOCUS_13570 25781 26164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 26226 28850 gene locus_tag LOCUS_13580 26226 28850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 29223 28885 gene locus_tag LOCUS_13590 29223 28885 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788957.1 protein_id gnl|my_center|LOCUS_13590 29315 30634 gene locus_tag LOCUS_13600 29315 30634 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792443.1 protein_id gnl|my_center|LOCUS_13600 31368 30637 gene locus_tag LOCUS_13610 31368 30637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 31487 31966 gene locus_tag LOCUS_13620 31487 31966 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 protein_id gnl|my_center|LOCUS_13620 32076 32798 gene locus_tag LOCUS_13630 32076 32798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 32801 33574 gene locus_tag LOCUS_13640 gene fliP 32801 33574 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783972.1 protein_id gnl|my_center|LOCUS_13640 33584 33847 gene locus_tag LOCUS_13650 gene fliQ 33584 33847 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137385.1 protein_id gnl|my_center|LOCUS_13650 33853 34665 gene locus_tag LOCUS_13660 gene fliR 33853 34665 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455610.1 protein_id gnl|my_center|LOCUS_13660 34667 35857 gene locus_tag LOCUS_13670 34667 35857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 35863 37995 gene locus_tag LOCUS_13680 gene flhA 35863 37995 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412863.1 protein_id gnl|my_center|LOCUS_13680 38146 39138 gene locus_tag LOCUS_13690 38146 39138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 39141 39554 gene locus_tag LOCUS_13700 39141 39554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 39876 39517 gene locus_tag LOCUS_13710 39876 39517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 40617 39877 gene locus_tag LOCUS_13720 gene lmtA 40617 39877 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_13720 41372 40629 gene locus_tag LOCUS_13730 gene cmoA 41372 40629 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655545.1 protein_id gnl|my_center|LOCUS_13730 41467 41916 gene locus_tag LOCUS_13740 41467 41916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 41913 42785 gene locus_tag LOCUS_13750 41913 42785 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084702.1 protein_id gnl|my_center|LOCUS_13750 43546 42818 gene locus_tag LOCUS_13760 43546 42818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 43884 43549 gene locus_tag LOCUS_13770 43884 43549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 44029 43895 gene locus_tag LOCUS_13780 44029 43895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 44851 44180 gene locus_tag LOCUS_13790 44851 44180 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616977.1 protein_id gnl|my_center|LOCUS_13790 45918 44956 gene locus_tag LOCUS_13800 45918 44956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 46771 45902 gene locus_tag LOCUS_13810 46771 45902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 46819 47619 gene locus_tag LOCUS_13820 46819 47619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 48019 47600 gene locus_tag LOCUS_13830 gene queF 48019 47600 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_13830 48116 48307 gene locus_tag LOCUS_13840 48116 48307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 48612 49181 gene locus_tag LOCUS_13850 48612 49181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 49210 49725 gene locus_tag LOCUS_13860 49210 49725 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200285.1 protein_id gnl|my_center|LOCUS_13860 49715 52861 gene locus_tag LOCUS_13870 49715 52861 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907369.1 protein_id gnl|my_center|LOCUS_13870 52867 53916 gene locus_tag LOCUS_13880 52867 53916 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083251.1 protein_id gnl|my_center|LOCUS_13880 53986 54345 gene locus_tag LOCUS_13890 53986 54345 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101124.1 protein_id gnl|my_center|LOCUS_13890 54373 55152 gene locus_tag LOCUS_13900 54373 55152 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426654.1 protein_id gnl|my_center|LOCUS_13900 55168 55860 gene locus_tag LOCUS_13910 gene scpB 55168 55860 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439024.1 protein_id gnl|my_center|LOCUS_13910 55958 56773 gene locus_tag LOCUS_13920 55958 56773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 56846 57067 gene locus_tag LOCUS_13930 56846 57067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 57372 57611 gene locus_tag LOCUS_13940 57372 57611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 57623 59056 gene locus_tag LOCUS_13950 57623 59056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 59075 59797 gene locus_tag LOCUS_13960 59075 59797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 60874 59798 gene locus_tag LOCUS_13970 60874 59798 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836517.1 protein_id gnl|my_center|LOCUS_13970 61970 60861 gene locus_tag LOCUS_13980 61970 60861 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606798.1 protein_id gnl|my_center|LOCUS_13980 63367 61967 gene locus_tag LOCUS_13990 gene murD 63367 61967 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545218.1 protein_id gnl|my_center|LOCUS_13990 64478 63369 gene locus_tag LOCUS_14000 gene mraY 64478 63369 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500387.1 protein_id gnl|my_center|LOCUS_14000 65958 64471 gene locus_tag LOCUS_14010 65958 64471 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457113.1 protein_id gnl|my_center|LOCUS_14010 66329 67492 gene locus_tag LOCUS_14020 gene recA 66329 67492 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504720.1 protein_id gnl|my_center|LOCUS_14020 67565 68590 gene locus_tag LOCUS_14030 gene argC 67565 68590 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808031.1 protein_id gnl|my_center|LOCUS_14030 69262 68591 gene locus_tag LOCUS_14040 69262 68591 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985723.1 protein_id gnl|my_center|LOCUS_14040 70556 69273 gene locus_tag LOCUS_14050 70556 69273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 71111 73165 gene locus_tag LOCUS_14060 71111 73165 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508136.1 protein_id gnl|my_center|LOCUS_14060 74415 73183 gene locus_tag LOCUS_14070 74415 73183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 74926 74420 gene locus_tag LOCUS_14080 74926 74420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 75038 77110 gene locus_tag LOCUS_14090 75038 77110 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100745190.1 protein_id gnl|my_center|LOCUS_14090 77163 79091 gene locus_tag LOCUS_14100 77163 79091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 79212 79859 gene locus_tag LOCUS_14110 79212 79859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 79957 82989 gene locus_tag LOCUS_14120 79957 82989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 83082 83155 gene locus_tag LOCUS_t00120 83082 83155 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 83958 83161 gene locus_tag LOCUS_14130 83958 83161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 84665 83955 gene locus_tag LOCUS_14140 84665 83955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 85929 84604 gene locus_tag LOCUS_14150 85929 84604 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_14150 86365 85907 gene locus_tag LOCUS_14160 86365 85907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 86968 86366 gene locus_tag LOCUS_14170 86968 86366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 88984 87053 gene locus_tag LOCUS_14180 gene nosZ 88984 87053 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_14180 89496 89026 gene locus_tag LOCUS_14190 89496 89026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 89679 89837 gene locus_tag LOCUS_14200 89679 89837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 89834 90781 gene locus_tag LOCUS_14210 gene epmA 89834 90781 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010896173.1 protein_id gnl|my_center|LOCUS_14210 90876 91568 gene locus_tag LOCUS_14220 90876 91568 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_14220 91569 93071 gene locus_tag LOCUS_14230 91569 93071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 93153 95642 gene locus_tag LOCUS_14240 93153 95642 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930590.1 protein_id gnl|my_center|LOCUS_14240 96047 95643 gene locus_tag LOCUS_14250 96047 95643 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080643.1 protein_id gnl|my_center|LOCUS_14250 97381 96044 gene locus_tag LOCUS_14260 97381 96044 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949344.1 protein_id gnl|my_center|LOCUS_14260 97836 97384 gene locus_tag LOCUS_14270 97836 97384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 98004 99197 gene locus_tag LOCUS_14280 98004 99197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 99207 99713 gene locus_tag LOCUS_14290 99207 99713 CDS product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266965.1 protein_id gnl|my_center|LOCUS_14290 99757 100848 gene locus_tag LOCUS_14300 99757 100848 CDS product DUF1574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489551.1 protein_id gnl|my_center|LOCUS_14300 100845 101078 gene locus_tag LOCUS_14310 100845 101078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 101932 101081 gene locus_tag LOCUS_14320 101932 101081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 102215 101889 gene locus_tag LOCUS_14330 102215 101889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 102840 102208 gene locus_tag LOCUS_14340 gene leuD 102840 102208 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802156.1 protein_id gnl|my_center|LOCUS_14340 102988 103497 gene locus_tag LOCUS_14350 102988 103497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 104108 103614 gene locus_tag LOCUS_14360 104108 103614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 105078 104068 gene locus_tag LOCUS_14370 105078 104068 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351423.1 protein_id gnl|my_center|LOCUS_14370 106307 105075 gene locus_tag LOCUS_14380 106307 105075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 106509 106312 gene locus_tag LOCUS_14390 106509 106312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14390 106671 106543 gene locus_tag LOCUS_14400 106671 106543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 107537 106695 gene locus_tag LOCUS_14410 107537 106695 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084985.1 protein_id gnl|my_center|LOCUS_14410 108588 107539 gene locus_tag LOCUS_14420 108588 107539 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965520.1 protein_id gnl|my_center|LOCUS_14420 109005 108592 gene locus_tag LOCUS_14430 109005 108592 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868676.1 protein_id gnl|my_center|LOCUS_14430 111491 109005 gene locus_tag LOCUS_14440 111491 109005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 111756 111496 gene locus_tag LOCUS_14450 111756 111496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 111871 113484 gene locus_tag LOCUS_14460 111871 113484 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098826.1 protein_id gnl|my_center|LOCUS_14460 113583 114314 gene locus_tag LOCUS_14470 113583 114314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 114327 114581 gene locus_tag LOCUS_14480 114327 114581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 114583 115029 gene locus_tag LOCUS_14490 114583 115029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 115129 116127 gene locus_tag LOCUS_14500 115129 116127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 116120 116683 gene locus_tag LOCUS_14510 116120 116683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 118305 116710 gene locus_tag LOCUS_14520 gene serA 118305 116710 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_14520 119263 118355 gene locus_tag LOCUS_14530 119263 118355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 119265 119528 gene locus_tag LOCUS_14540 119265 119528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 119525 119947 gene locus_tag LOCUS_14550 119525 119947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 120419 119925 gene locus_tag LOCUS_14560 120419 119925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 120516 120779 gene locus_tag LOCUS_14570 120516 120779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 120783 121469 gene locus_tag LOCUS_14580 120783 121469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390247.1 protein_id gnl|my_center|LOCUS_14580 123977 121470 gene locus_tag LOCUS_14590 123977 121470 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863352.1 protein_id gnl|my_center|LOCUS_14590 124752 124045 gene locus_tag LOCUS_14600 124752 124045 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538451.1 protein_id gnl|my_center|LOCUS_14600 125255 124761 gene locus_tag LOCUS_14610 125255 124761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 125360 126322 gene locus_tag LOCUS_14620 125360 126322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 126324 126923 gene locus_tag LOCUS_14630 126324 126923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 126934 127704 gene locus_tag LOCUS_14640 gene surE 126934 127704 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023250.1 protein_id gnl|my_center|LOCUS_14640 127679 128371 gene locus_tag LOCUS_14650 127679 128371 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280575.1 protein_id gnl|my_center|LOCUS_14650 131484 128383 gene locus_tag LOCUS_14660 131484 128383 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927582.1 protein_id gnl|my_center|LOCUS_14660 131626 132339 gene locus_tag LOCUS_14670 gene fadR 131626 132339 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072796.1 protein_id gnl|my_center|LOCUS_14670 132336 134000 gene locus_tag LOCUS_14680 132336 134000 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_14680 134012 135541 gene locus_tag LOCUS_14690 134012 135541 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_14690 135516 137051 gene locus_tag LOCUS_14700 135516 137051 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_14700 137203 138468 gene locus_tag LOCUS_14710 137203 138468 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864838.1 protein_id gnl|my_center|LOCUS_14710 138474 139475 gene locus_tag LOCUS_14720 138474 139475 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_14720 139557 141062 gene locus_tag LOCUS_14730 139557 141062 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583612.1 protein_id gnl|my_center|LOCUS_14730 141043 141813 gene locus_tag LOCUS_14740 141043 141813 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_14740 146165 141810 gene locus_tag LOCUS_14750 146165 141810 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596985.1 protein_id gnl|my_center|LOCUS_14750 146126 146374 gene locus_tag LOCUS_14760 146126 146374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 146280 147125 gene locus_tag LOCUS_14770 146280 147125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258977.1 protein_id gnl|my_center|LOCUS_14770 147705 147034 gene locus_tag LOCUS_14780 147705 147034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219378.1 protein_id gnl|my_center|LOCUS_14780 148689 147715 gene locus_tag LOCUS_14790 148689 147715 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567061.1 protein_id gnl|my_center|LOCUS_14790 150189 148762 gene locus_tag LOCUS_14800 150189 148762 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205134.1 protein_id gnl|my_center|LOCUS_14800 151400 150186 gene locus_tag LOCUS_14810 151400 150186 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083524.1 protein_id gnl|my_center|LOCUS_14810 152299 151397 gene locus_tag LOCUS_14820 gene aroE 152299 151397 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033107988.1 protein_id gnl|my_center|LOCUS_14820 152359 152688 gene locus_tag LOCUS_14830 152359 152688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 153078 152689 gene locus_tag LOCUS_14840 153078 152689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 153176 153526 gene locus_tag LOCUS_14850 153176 153526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983891.1 protein_id gnl|my_center|LOCUS_14850 156018 153523 gene locus_tag LOCUS_14860 156018 153523 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798121.1 protein_id gnl|my_center|LOCUS_14860 158206 156086 gene locus_tag LOCUS_14870 gene nadE 158206 156086 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_14870 158871 158203 gene locus_tag LOCUS_14880 gene purQ 158871 158203 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686200.1 protein_id gnl|my_center|LOCUS_14880 159116 158868 gene locus_tag LOCUS_14890 gene purS 159116 158868 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219409.1 protein_id gnl|my_center|LOCUS_14890 159249 160199 gene locus_tag LOCUS_14900 159249 160199 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954148.1 protein_id gnl|my_center|LOCUS_14900 160261 161052 gene locus_tag LOCUS_14910 gene modA 160261 161052 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857589.1 protein_id gnl|my_center|LOCUS_14910 161045 161434 gene locus_tag LOCUS_14920 161045 161434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 161436 162104 gene locus_tag LOCUS_14930 gene modB 161436 162104 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_14930 162101 162961 gene locus_tag LOCUS_14940 162101 162961 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_14940 163306 163097 gene locus_tag LOCUS_14950 163306 163097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 164634 163321 gene locus_tag LOCUS_14960 164634 163321 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_14960 165212 164631 gene locus_tag LOCUS_14970 165212 164631 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_14970 166381 165269 gene locus_tag LOCUS_14980 166381 165269 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_14980 167566 166460 gene locus_tag LOCUS_14990 167566 166460 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_14990 167652 169010 gene locus_tag LOCUS_15000 167652 169010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 170144 168999 gene locus_tag LOCUS_15010 170144 168999 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_15010 170299 170589 gene locus_tag LOCUS_15020 170299 170589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 170594 171034 gene locus_tag LOCUS_15030 gene ssb 170594 171034 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262509.1 protein_id gnl|my_center|LOCUS_15030 171052 171555 gene locus_tag LOCUS_15040 gene rplI 171052 171555 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263864.1 protein_id gnl|my_center|LOCUS_15040 171587 172969 gene locus_tag LOCUS_15050 gene dnaB 171587 172969 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190299.1 protein_id gnl|my_center|LOCUS_15050 173016 174365 gene locus_tag LOCUS_15060 gene radA 173016 174365 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728128.1 protein_id gnl|my_center|LOCUS_15060 174358 174618 gene locus_tag LOCUS_15070 174358 174618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 174620 175639 gene locus_tag LOCUS_15080 gene tsaD 174620 175639 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579852.1 protein_id gnl|my_center|LOCUS_15080 175683 176450 gene locus_tag LOCUS_15090 gene pssA 175683 176450 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769017.1 protein_id gnl|my_center|LOCUS_15090 177651 176455 gene locus_tag LOCUS_15100 177651 176455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 177810 178352 gene locus_tag LOCUS_15110 177810 178352 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971886.1 protein_id gnl|my_center|LOCUS_15110 178407 179462 gene locus_tag LOCUS_15120 178407 179462 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792401.1 protein_id gnl|my_center|LOCUS_15120 179486 180619 gene locus_tag LOCUS_15130 179486 180619 CDS product lipoprotein LipL45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714030.1 protein_id gnl|my_center|LOCUS_15130 180623 180886 gene locus_tag LOCUS_15140 180623 180886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 180917 181528 gene locus_tag LOCUS_15150 180917 181528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 181512 181913 gene locus_tag LOCUS_15160 gene tolR 181512 181913 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067772.1 protein_id gnl|my_center|LOCUS_15160 182418 183710 gene locus_tag LOCUS_15170 182418 183710 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137848.1 protein_id gnl|my_center|LOCUS_15170 183724 184884 gene locus_tag LOCUS_15180 183724 184884 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005981.1 protein_id gnl|my_center|LOCUS_15180 184874 185464 gene locus_tag LOCUS_15190 gene metW 184874 185464 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188046.1 protein_id gnl|my_center|LOCUS_15190 186621 185461 gene locus_tag LOCUS_15200 186621 185461 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273947.1 protein_id gnl|my_center|LOCUS_15200 187747 186665 gene locus_tag LOCUS_15210 187747 186665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 187895 188320 gene locus_tag LOCUS_15220 187895 188320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 189395 188322 gene locus_tag LOCUS_15230 189395 188322 CDS product lipoprotein LipL41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228945.1 protein_id gnl|my_center|LOCUS_15230 190627 189392 gene locus_tag LOCUS_15240 gene csx2 190627 189392 CDS product TIGR02221 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582979.1 protein_id gnl|my_center|LOCUS_15240 191087 190668 gene locus_tag LOCUS_15250 191087 190668 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750243.1 protein_id gnl|my_center|LOCUS_15250 193139 191100 gene locus_tag LOCUS_15260 193139 191100 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667646.1 protein_id gnl|my_center|LOCUS_15260 194395 193145 gene locus_tag LOCUS_15270 gene ccrA 194395 193145 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078168.1 protein_id gnl|my_center|LOCUS_15270 194515 196005 gene locus_tag LOCUS_15280 194515 196005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339988.1 protein_id gnl|my_center|LOCUS_15280 196009 198321 gene locus_tag LOCUS_15290 196009 198321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 198358 198431 gene locus_tag LOCUS_t00130 198358 198431 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 199720 198422 gene locus_tag LOCUS_15300 199720 198422 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098167.1 protein_id gnl|my_center|LOCUS_15300 199817 200356 gene locus_tag LOCUS_15310 199817 200356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 200415 200840 gene locus_tag LOCUS_15320 200415 200840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 200873 201463 gene locus_tag LOCUS_15330 200873 201463 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366622.1 protein_id gnl|my_center|LOCUS_15330 201469 202545 gene locus_tag LOCUS_15340 201469 202545 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200269.1 protein_id gnl|my_center|LOCUS_15340 202569 204686 gene locus_tag LOCUS_15350 202569 204686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 204731 205903 gene locus_tag LOCUS_15360 204731 205903 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161599.1 protein_id gnl|my_center|LOCUS_15360 205917 207602 gene locus_tag LOCUS_15370 205917 207602 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855916.1 protein_id gnl|my_center|LOCUS_15370 208026 207730 gene locus_tag LOCUS_15380 208026 207730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 209124 208072 gene locus_tag LOCUS_15390 gene moeB 209124 208072 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404770.1 protein_id gnl|my_center|LOCUS_15390 210326 209115 gene locus_tag LOCUS_15400 210326 209115 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_15400 211251 210328 gene locus_tag LOCUS_15410 gene moaCB 211251 210328 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_15410 212240 211254 gene locus_tag LOCUS_15420 gene moaA 212240 211254 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438521.1 protein_id gnl|my_center|LOCUS_15420 213041 212394 gene locus_tag LOCUS_15430 213041 212394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 213851 213051 gene locus_tag LOCUS_15440 213851 213051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 214988 213861 gene locus_tag LOCUS_15450 gene narH 214988 213861 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702535.1 protein_id gnl|my_center|LOCUS_15450 218506 215012 gene locus_tag LOCUS_15460 218506 215012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 218729 219868 gene locus_tag LOCUS_15470 218729 219868 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666150.1 protein_id gnl|my_center|LOCUS_15470 219995 221236 gene locus_tag LOCUS_15480 219995 221236 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141218.1 protein_id gnl|my_center|LOCUS_15480 222081 221233 gene locus_tag LOCUS_15490 222081 221233 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_15490 222163 223041 gene locus_tag LOCUS_15500 222163 223041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 224321 223044 gene locus_tag LOCUS_15510 224321 223044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 224447 225874 gene locus_tag LOCUS_15520 224447 225874 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377734.1 protein_id gnl|my_center|LOCUS_15520 227152 225863 gene locus_tag LOCUS_15530 227152 225863 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151296.1 protein_id gnl|my_center|LOCUS_15530 227245 227742 gene locus_tag LOCUS_15540 227245 227742 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956231.1 protein_id gnl|my_center|LOCUS_15540 227752 228621 gene locus_tag LOCUS_15550 227752 228621 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659901.1 protein_id gnl|my_center|LOCUS_15550 228618 229157 gene locus_tag LOCUS_15560 228618 229157 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739193.1 protein_id gnl|my_center|LOCUS_15560 229205 230311 gene locus_tag LOCUS_15570 229205 230311 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457387.1 protein_id gnl|my_center|LOCUS_15570 230362 230760 gene locus_tag LOCUS_15580 230362 230760 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594462.1 protein_id gnl|my_center|LOCUS_15580 <231297 230671 gene locus_tag LOCUS_15590 <231297 230671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938977.1:lysophospholipid acyltransferase family protein >Feature sequence06 1236 613 gene locus_tag LOCUS_15600 1236 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616810.1 protein_id gnl|my_center|LOCUS_15600 1697 3094 gene locus_tag LOCUS_15610 1697 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 3173 3967 gene locus_tag LOCUS_15620 3173 3967 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778163.1 protein_id gnl|my_center|LOCUS_15620 3964 4443 gene locus_tag LOCUS_15630 3964 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 6045 4435 gene locus_tag LOCUS_15640 6045 4435 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091728.1 protein_id gnl|my_center|LOCUS_15640 6276 6728 gene locus_tag LOCUS_15650 6276 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 6795 8138 gene locus_tag LOCUS_15660 6795 8138 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012661737.1 protein_id gnl|my_center|LOCUS_15660 8148 8837 gene locus_tag LOCUS_15670 8148 8837 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_15670 8837 9517 gene locus_tag LOCUS_15680 8837 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694669.1 protein_id gnl|my_center|LOCUS_15680 9536 9904 gene locus_tag LOCUS_15690 9536 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 9919 11268 gene locus_tag LOCUS_15700 9919 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 11374 11448 gene locus_tag LOCUS_t00140 11374 11448 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11451 11525 gene locus_tag LOCUS_t00150 11451 11525 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 11547 11732 gene locus_tag LOCUS_15710 gene secE 11547 11732 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881261.1 protein_id gnl|my_center|LOCUS_15710 11735 12271 gene locus_tag LOCUS_15720 gene nusG 11735 12271 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536871.1 protein_id gnl|my_center|LOCUS_15720 12311 12742 gene locus_tag LOCUS_15730 gene rplK 12311 12742 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729204.1 protein_id gnl|my_center|LOCUS_15730 12761 13438 gene locus_tag LOCUS_15740 gene rplA 12761 13438 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188789.1 protein_id gnl|my_center|LOCUS_15740 13524 14063 gene locus_tag LOCUS_15750 gene rplJ 13524 14063 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924917.1 protein_id gnl|my_center|LOCUS_15750 14100 14486 gene locus_tag LOCUS_15760 gene rplL 14100 14486 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102400.1 protein_id gnl|my_center|LOCUS_15760 14693 18487 gene locus_tag LOCUS_15770 gene rpoB 14693 18487 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274330.1 protein_id gnl|my_center|LOCUS_15770 18503 22837 gene locus_tag LOCUS_15780 gene rpoC 18503 22837 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256473.1 protein_id gnl|my_center|LOCUS_15780 22943 23317 gene locus_tag LOCUS_15790 gene rpsL 22943 23317 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142358.1 protein_id gnl|my_center|LOCUS_15790 23335 23808 gene locus_tag LOCUS_15800 gene rpsG 23335 23808 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091209.1 protein_id gnl|my_center|LOCUS_15800 23839 25938 gene locus_tag LOCUS_15810 gene fusA 23839 25938 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_15810 26070 27272 gene locus_tag LOCUS_15820 gene tuf 26070 27272 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040571.1 protein_id gnl|my_center|LOCUS_15820 27291 27617 gene locus_tag LOCUS_15830 gene rpsJ 27291 27617 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918607.1 protein_id gnl|my_center|LOCUS_15830 27632 28252 gene locus_tag LOCUS_15840 gene rplC 27632 28252 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051846.1 protein_id gnl|my_center|LOCUS_15840 28249 28911 gene locus_tag LOCUS_15850 gene rplD 28249 28911 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647275.1 protein_id gnl|my_center|LOCUS_15850 28921 29208 gene locus_tag LOCUS_15860 gene rplW 28921 29208 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166911.1 protein_id gnl|my_center|LOCUS_15860 29221 30057 gene locus_tag LOCUS_15870 gene rplB 29221 30057 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511542.1 protein_id gnl|my_center|LOCUS_15870 30071 30349 gene locus_tag LOCUS_15880 gene rpsS 30071 30349 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851509.1 protein_id gnl|my_center|LOCUS_15880 30356 30694 gene locus_tag LOCUS_15890 gene rplV 30356 30694 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387530.1 protein_id gnl|my_center|LOCUS_15890 30707 31378 gene locus_tag LOCUS_15900 gene rpsC 30707 31378 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529953.1 protein_id gnl|my_center|LOCUS_15900 31403 31816 gene locus_tag LOCUS_15910 gene rplP 31403 31816 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950835.1 protein_id gnl|my_center|LOCUS_15910 31838 32047 gene locus_tag LOCUS_15920 31838 32047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 32057 32329 gene locus_tag LOCUS_15930 gene rpsQ 32057 32329 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123883.1 protein_id gnl|my_center|LOCUS_15930 32326 32718 gene locus_tag LOCUS_15940 gene rplN 32326 32718 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615917.1 protein_id gnl|my_center|LOCUS_15940 32729 33118 gene locus_tag LOCUS_15950 gene rplX 32729 33118 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096782.1 protein_id gnl|my_center|LOCUS_15950 33129 33671 gene locus_tag LOCUS_15960 gene rplE 33129 33671 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842801.1 protein_id gnl|my_center|LOCUS_15960 33684 33869 gene locus_tag LOCUS_15970 33684 33869 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943473.1 protein_id gnl|my_center|LOCUS_15970 33892 34287 gene locus_tag LOCUS_15980 gene rpsH 33892 34287 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245511.1 protein_id gnl|my_center|LOCUS_15980 34309 34851 gene locus_tag LOCUS_15990 gene rplF 34309 34851 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086547.1 protein_id gnl|my_center|LOCUS_15990 34870 35244 gene locus_tag LOCUS_16000 gene rplR 34870 35244 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_16000 35255 35764 gene locus_tag LOCUS_16010 gene rpsE 35255 35764 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331210.1 protein_id gnl|my_center|LOCUS_16010 35780 35995 gene locus_tag LOCUS_16020 gene rpmD 35780 35995 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288686.1 protein_id gnl|my_center|LOCUS_16020 35992 36513 gene locus_tag LOCUS_16030 gene rplO 35992 36513 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081797.1 protein_id gnl|my_center|LOCUS_16030 36515 37876 gene locus_tag LOCUS_16040 gene secY 36515 37876 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958241.1 protein_id gnl|my_center|LOCUS_16040 37873 38439 gene locus_tag LOCUS_16050 37873 38439 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789400.1 protein_id gnl|my_center|LOCUS_16050 38482 38700 gene locus_tag LOCUS_16060 gene infA 38482 38700 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_16060 38859 39227 gene locus_tag LOCUS_16070 gene rpsM 38859 39227 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_16070 39239 39610 gene locus_tag LOCUS_16080 gene rpsK 39239 39610 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_16080 39630 40625 gene locus_tag LOCUS_16090 39630 40625 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054108.1 protein_id gnl|my_center|LOCUS_16090 40647 41219 gene locus_tag LOCUS_16100 gene rplQ 40647 41219 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042618.1 protein_id gnl|my_center|LOCUS_16100 41670 41251 gene locus_tag LOCUS_16110 41670 41251 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_16110 41816 44953 gene locus_tag LOCUS_16120 41816 44953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 44959 46845 gene locus_tag LOCUS_16130 44959 46845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172203.1 protein_id gnl|my_center|LOCUS_16130 46805 47815 gene locus_tag LOCUS_16140 gene lpxK 46805 47815 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927066.1 protein_id gnl|my_center|LOCUS_16140 47821 48483 gene locus_tag LOCUS_16150 47821 48483 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705866.1 protein_id gnl|my_center|LOCUS_16150 48480 48833 gene locus_tag LOCUS_16160 48480 48833 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166988.1 protein_id gnl|my_center|LOCUS_16160 49389 48835 gene locus_tag LOCUS_16170 49389 48835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 49471 51576 gene locus_tag LOCUS_16180 49471 51576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 51620 52810 gene locus_tag LOCUS_16190 51620 52810 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230594.1 protein_id gnl|my_center|LOCUS_16190 53464 52811 gene locus_tag LOCUS_16200 gene pdxH 53464 52811 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056186.1 protein_id gnl|my_center|LOCUS_16200 55410 53497 gene locus_tag LOCUS_16210 55410 53497 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101415.1 protein_id gnl|my_center|LOCUS_16210 55461 56957 gene locus_tag LOCUS_16220 gene purF 55461 56957 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086941.1 protein_id gnl|my_center|LOCUS_16220 57481 56954 gene locus_tag LOCUS_16230 57481 56954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 57687 60086 gene locus_tag LOCUS_16240 57687 60086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 60187 61410 gene locus_tag LOCUS_16250 gene icd 60187 61410 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_16250 61470 61961 gene locus_tag LOCUS_16260 61470 61961 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_16260 61963 62439 gene locus_tag LOCUS_16270 61963 62439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 62981 62436 gene locus_tag LOCUS_16280 gene hslV 62981 62436 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114726.1 protein_id gnl|my_center|LOCUS_16280 63730 62993 gene locus_tag LOCUS_16290 63730 62993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 64233 63856 gene locus_tag LOCUS_16300 64233 63856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 65866 64223 gene locus_tag LOCUS_16310 65866 64223 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490750.1 protein_id gnl|my_center|LOCUS_16310 66006 66917 gene locus_tag LOCUS_16320 66006 66917 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583214.1 protein_id gnl|my_center|LOCUS_16320 68453 67332 gene locus_tag LOCUS_16330 68453 67332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 68763 69164 gene locus_tag LOCUS_16340 68763 69164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 69780 69307 gene locus_tag LOCUS_16350 69780 69307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 69941 69789 gene locus_tag LOCUS_16360 69941 69789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 70166 70375 gene locus_tag LOCUS_16370 70166 70375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 70704 71258 gene locus_tag LOCUS_16380 70704 71258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 71273 72136 gene locus_tag LOCUS_16390 71273 72136 CDS product LIC_13355 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932722.1 protein_id gnl|my_center|LOCUS_16390 72150 72617 gene locus_tag LOCUS_16400 72150 72617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 72592 73161 gene locus_tag LOCUS_16410 72592 73161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_16410 73173 75185 gene locus_tag LOCUS_16420 73173 75185 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517762.1 protein_id gnl|my_center|LOCUS_16420 75194 76117 gene locus_tag LOCUS_16430 75194 76117 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242776.1 protein_id gnl|my_center|LOCUS_16430 76080 77225 gene locus_tag LOCUS_16440 76080 77225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259338.1 protein_id gnl|my_center|LOCUS_16440 77386 78231 gene locus_tag LOCUS_16450 77386 78231 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586163.1 protein_id gnl|my_center|LOCUS_16450 78359 79204 gene locus_tag LOCUS_16460 78359 79204 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586163.1 protein_id gnl|my_center|LOCUS_16460 80568 79234 gene locus_tag LOCUS_16470 80568 79234 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006194892.1 protein_id gnl|my_center|LOCUS_16470 82004 80580 gene locus_tag LOCUS_16480 82004 80580 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_16480 82798 82271 gene locus_tag LOCUS_16490 82798 82271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 83888 82941 gene locus_tag LOCUS_16500 83888 82941 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_16500 85035 83878 gene locus_tag LOCUS_16510 85035 83878 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_16510 85114 85977 gene locus_tag LOCUS_16520 85114 85977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 86012 87712 gene locus_tag LOCUS_16530 86012 87712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 87712 88335 gene locus_tag LOCUS_16540 87712 88335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918209.1 protein_id gnl|my_center|LOCUS_16540 89646 88405 gene locus_tag LOCUS_16550 89646 88405 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404617.1 protein_id gnl|my_center|LOCUS_16550 90943 89726 gene locus_tag LOCUS_16560 90943 89726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470532.1 protein_id gnl|my_center|LOCUS_16560 92361 91282 gene locus_tag LOCUS_16570 92361 91282 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410870.1 protein_id gnl|my_center|LOCUS_16570 92295 92879 gene locus_tag LOCUS_16580 92295 92879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 94381 92876 gene locus_tag LOCUS_16590 94381 92876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 94536 94847 gene locus_tag LOCUS_16600 94536 94847 CDS product TRL-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720240.1 protein_id gnl|my_center|LOCUS_16600 95498 94878 gene locus_tag LOCUS_16610 95498 94878 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456632.1 protein_id gnl|my_center|LOCUS_16610 96860 95523 gene locus_tag LOCUS_16620 96860 95523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 96992 98290 gene locus_tag LOCUS_16630 gene purB 96992 98290 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567237.1 protein_id gnl|my_center|LOCUS_16630 99472 98300 gene locus_tag LOCUS_16640 99472 98300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 100119 99598 gene locus_tag LOCUS_16650 100119 99598 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140553.1 protein_id gnl|my_center|LOCUS_16650 100643 100131 gene locus_tag LOCUS_16660 100643 100131 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140553.1 protein_id gnl|my_center|LOCUS_16660 100857 104210 gene locus_tag LOCUS_16670 100857 104210 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521953.1 protein_id gnl|my_center|LOCUS_16670 104217 105524 gene locus_tag LOCUS_16680 gene add 104217 105524 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229174.1 protein_id gnl|my_center|LOCUS_16680 105616 106746 gene locus_tag LOCUS_16690 105616 106746 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103009.1 protein_id gnl|my_center|LOCUS_16690 106746 107498 gene locus_tag LOCUS_16700 106746 107498 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838282.1 protein_id gnl|my_center|LOCUS_16700 107504 108085 gene locus_tag LOCUS_16710 gene thpR 107504 108085 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083289.1 protein_id gnl|my_center|LOCUS_16710 108082 110451 gene locus_tag LOCUS_16720 108082 110451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 110488 110952 gene locus_tag LOCUS_16730 110488 110952 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933657.1 protein_id gnl|my_center|LOCUS_16730 110956 111894 gene locus_tag LOCUS_16740 110956 111894 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627564.1 protein_id gnl|my_center|LOCUS_16740 112741 111896 gene locus_tag LOCUS_16750 112741 111896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 112818 113063 gene locus_tag LOCUS_16760 gene rpmB 112818 113063 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113840.1 protein_id gnl|my_center|LOCUS_16760 113075 113740 gene locus_tag LOCUS_16770 gene nth 113075 113740 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228256.1 protein_id gnl|my_center|LOCUS_16770 113762 115222 gene locus_tag LOCUS_16780 113762 115222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 115222 115764 gene locus_tag LOCUS_16790 115222 115764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 117132 115771 gene locus_tag LOCUS_16800 117132 115771 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_16800 117203 117607 gene locus_tag LOCUS_16810 117203 117607 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648186.1 protein_id gnl|my_center|LOCUS_16810 118394 117612 gene locus_tag LOCUS_16820 118394 117612 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987042.1 protein_id gnl|my_center|LOCUS_16820 118492 120549 gene locus_tag LOCUS_16830 118492 120549 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777808.1 protein_id gnl|my_center|LOCUS_16830 121538 120546 gene locus_tag LOCUS_16840 121538 120546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146644.1 protein_id gnl|my_center|LOCUS_16840 122053 121535 gene locus_tag LOCUS_16850 122053 121535 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360600.1 protein_id gnl|my_center|LOCUS_16850 122222 124162 gene locus_tag LOCUS_16860 gene aspS 122222 124162 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683521.1 protein_id gnl|my_center|LOCUS_16860 125358 124159 gene locus_tag LOCUS_16870 125358 124159 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459075.1 protein_id gnl|my_center|LOCUS_16870 125636 126499 gene locus_tag LOCUS_16880 125636 126499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 126765 128237 gene locus_tag LOCUS_16890 126765 128237 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_16890 128368 129180 gene locus_tag LOCUS_16900 128368 129180 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_16900 129231 130331 gene locus_tag LOCUS_16910 129231 130331 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615660.1 protein_id gnl|my_center|LOCUS_16910 130345 131988 gene locus_tag LOCUS_16920 130345 131988 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146648805.1 protein_id gnl|my_center|LOCUS_16920 132004 132708 gene locus_tag LOCUS_16930 132004 132708 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_16930 132726 133043 gene locus_tag LOCUS_16940 132726 133043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 133612 133073 gene locus_tag LOCUS_16950 133612 133073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 134589 133687 gene locus_tag LOCUS_16960 134589 133687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 134751 135947 gene locus_tag LOCUS_16970 gene aroC 134751 135947 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141234.1 protein_id gnl|my_center|LOCUS_16970 135922 137175 gene locus_tag LOCUS_16980 135922 137175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 137175 137942 gene locus_tag LOCUS_16990 137175 137942 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_16990 137944 138297 gene locus_tag LOCUS_17000 137944 138297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 140420 138303 gene locus_tag LOCUS_17010 140420 138303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 140462 141526 gene locus_tag LOCUS_17020 140462 141526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 142234 141539 gene locus_tag LOCUS_17030 142234 141539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 142387 142605 gene locus_tag LOCUS_17040 142387 142605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 142589 142858 gene locus_tag LOCUS_17050 142589 142858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 142910 144175 gene locus_tag LOCUS_17060 142910 144175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 144179 145315 gene locus_tag LOCUS_17070 gene tgt 144179 145315 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577236.1 protein_id gnl|my_center|LOCUS_17070 145524 145862 gene locus_tag LOCUS_17080 145524 145862 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_17080 145885 147270 gene locus_tag LOCUS_17090 145885 147270 CDS product lipoprotein LipL71 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843317.1 protein_id gnl|my_center|LOCUS_17090 148626 147460 gene locus_tag LOCUS_17100 gene metK 148626 147460 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053346.1 protein_id gnl|my_center|LOCUS_17100 148762 149436 gene locus_tag LOCUS_17110 148762 149436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619825.1 protein_id gnl|my_center|LOCUS_17110 149457 149972 gene locus_tag LOCUS_17120 149457 149972 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680200.1 protein_id gnl|my_center|LOCUS_17120 150850 150008 gene locus_tag LOCUS_17130 150850 150008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 151083 151682 gene locus_tag LOCUS_17140 151083 151682 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104390.1 protein_id gnl|my_center|LOCUS_17140 153844 151709 gene locus_tag LOCUS_17150 153844 151709 CDS product VacB/RNase II family 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022144.1 protein_id gnl|my_center|LOCUS_17150 154593 153841 gene locus_tag LOCUS_17160 154593 153841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 155068 154562 gene locus_tag LOCUS_17170 155068 154562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 155188 156297 gene locus_tag LOCUS_17180 155188 156297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982215.1 protein_id gnl|my_center|LOCUS_17180 157157 156318 gene locus_tag LOCUS_17190 157157 156318 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051394.1 protein_id gnl|my_center|LOCUS_17190 158397 157144 gene locus_tag LOCUS_17200 158397 157144 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095359.1 protein_id gnl|my_center|LOCUS_17200 158440 158847 gene locus_tag LOCUS_17210 158440 158847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 159330 158839 gene locus_tag LOCUS_17220 159330 158839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 159408 160124 gene locus_tag LOCUS_17230 159408 160124 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_17230 160173 160535 gene locus_tag LOCUS_17240 160173 160535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 160937 160560 gene locus_tag LOCUS_17250 160937 160560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 161282 162481 gene locus_tag LOCUS_17260 161282 162481 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 protein_id gnl|my_center|LOCUS_17260 163402 162482 gene locus_tag LOCUS_17270 163402 162482 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944890.1 protein_id gnl|my_center|LOCUS_17270 163806 163408 gene locus_tag LOCUS_17280 163806 163408 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081702.1 protein_id gnl|my_center|LOCUS_17280 163943 164278 gene locus_tag LOCUS_17290 163943 164278 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884017.1 protein_id gnl|my_center|LOCUS_17290 164278 165078 gene locus_tag LOCUS_17300 164278 165078 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099241.1 protein_id gnl|my_center|LOCUS_17300 166607 165075 gene locus_tag LOCUS_17310 166607 165075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 168398 166758 gene locus_tag LOCUS_17320 168398 166758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 168678 169715 gene locus_tag LOCUS_17330 gene lepB 168678 169715 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764509.1 protein_id gnl|my_center|LOCUS_17330 169725 170117 gene locus_tag LOCUS_17340 169725 170117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 170107 170445 gene locus_tag LOCUS_17350 170107 170445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 170459 171520 gene locus_tag LOCUS_17360 gene atpB 170459 171520 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281179.1 protein_id gnl|my_center|LOCUS_17360 171570 171854 gene locus_tag LOCUS_17370 171570 171854 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394249.1 protein_id gnl|my_center|LOCUS_17370 171894 172415 gene locus_tag LOCUS_17380 171894 172415 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243426.1 protein_id gnl|my_center|LOCUS_17380 172425 172985 gene locus_tag LOCUS_17390 gene atpH 172425 172985 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475836.1 protein_id gnl|my_center|LOCUS_17390 172975 174516 gene locus_tag LOCUS_17400 gene atpA 172975 174516 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695329.1 protein_id gnl|my_center|LOCUS_17400 174530 175402 gene locus_tag LOCUS_17410 gene atpG 174530 175402 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235141.1 protein_id gnl|my_center|LOCUS_17410 175429 176856 gene locus_tag LOCUS_17420 gene atpD 175429 176856 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032431.1 protein_id gnl|my_center|LOCUS_17420 176906 177307 gene locus_tag LOCUS_17430 176906 177307 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641444.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence07 2400 940 gene locus_tag LOCUS_17440 2400 940 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898580.1 protein_id gnl|my_center|LOCUS_17440 3674 2403 gene locus_tag LOCUS_17450 3674 2403 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675686.1 protein_id gnl|my_center|LOCUS_17450 4679 3675 gene locus_tag LOCUS_17460 4679 3675 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868877.1 protein_id gnl|my_center|LOCUS_17460 5580 4654 gene locus_tag LOCUS_17470 5580 4654 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069743.1 protein_id gnl|my_center|LOCUS_17470 6711 5656 gene locus_tag LOCUS_17480 gene fliM 6711 5656 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_17480 7871 6786 gene locus_tag LOCUS_17490 gene rlmN 7871 6786 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622604.1 protein_id gnl|my_center|LOCUS_17490 9050 7893 gene locus_tag LOCUS_17500 gene purM 9050 7893 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_17500 10142 9063 gene locus_tag LOCUS_17510 10142 9063 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_17510 10192 11754 gene locus_tag LOCUS_17520 10192 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 11771 12643 gene locus_tag LOCUS_17530 11771 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 12695 14725 gene locus_tag LOCUS_17540 12695 14725 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545443.1 protein_id gnl|my_center|LOCUS_17540 14706 16661 gene locus_tag LOCUS_17550 14706 16661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 16707 17696 gene locus_tag LOCUS_17560 16707 17696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621805.1 protein_id gnl|my_center|LOCUS_17560 18673 17723 gene locus_tag LOCUS_17570 gene mdh 18673 17723 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721256.1 protein_id gnl|my_center|LOCUS_17570 19125 18826 gene locus_tag LOCUS_17580 19125 18826 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294653.1 protein_id gnl|my_center|LOCUS_17580 20053 19133 gene locus_tag LOCUS_17590 20053 19133 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404954.1 protein_id gnl|my_center|LOCUS_17590 20963 20064 gene locus_tag LOCUS_17600 20963 20064 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272390.1 protein_id gnl|my_center|LOCUS_17600 21191 21265 gene locus_tag LOCUS_t00160 21191 21265 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21285 21361 gene locus_tag LOCUS_t00170 21285 21361 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21445 22863 gene locus_tag LOCUS_17610 21445 22863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 23010 23528 gene locus_tag LOCUS_17620 23010 23528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 24269 23619 gene locus_tag LOCUS_17630 24269 23619 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_17630 25539 24316 gene locus_tag LOCUS_17640 25539 24316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_17640 26219 25536 gene locus_tag LOCUS_17650 26219 25536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_17650 27366 26221 gene locus_tag LOCUS_17660 27366 26221 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_17660 28697 27363 gene locus_tag LOCUS_17670 28697 27363 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930700.1 protein_id gnl|my_center|LOCUS_17670 30396 28738 gene locus_tag LOCUS_17680 30396 28738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 31457 30432 gene locus_tag LOCUS_17690 31457 30432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 32444 31464 gene locus_tag LOCUS_17700 32444 31464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 34484 32463 gene locus_tag LOCUS_17710 34484 32463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 34596 34952 gene locus_tag LOCUS_17720 34596 34952 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947249.1 protein_id gnl|my_center|LOCUS_17720 36246 34969 gene locus_tag LOCUS_17730 gene clpX 36246 34969 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_17730 36867 36256 gene locus_tag LOCUS_17740 gene clpP 36867 36256 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111455.1 protein_id gnl|my_center|LOCUS_17740 38334 36973 gene locus_tag LOCUS_17750 gene tig 38334 36973 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384982.1 protein_id gnl|my_center|LOCUS_17750 38509 38435 gene locus_tag LOCUS_t00180 38509 38435 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 38598 38512 gene locus_tag LOCUS_t00190 38598 38512 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38742 38669 gene locus_tag LOCUS_t00200 38742 38669 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 38823 38748 gene locus_tag LOCUS_t00210 38823 38748 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 38897 38826 gene locus_tag LOCUS_t00220 38897 38826 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 38995 39528 gene locus_tag LOCUS_17760 38995 39528 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645314.1 protein_id gnl|my_center|LOCUS_17760 39525 40565 gene locus_tag LOCUS_17770 39525 40565 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206646.1 protein_id gnl|my_center|LOCUS_17770 41266 40562 gene locus_tag LOCUS_17780 41266 40562 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022303.1 protein_id gnl|my_center|LOCUS_17780 41655 41269 gene locus_tag LOCUS_17790 41655 41269 CDS product DUF6285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153016.1 protein_id gnl|my_center|LOCUS_17790 42670 41645 gene locus_tag LOCUS_17800 42670 41645 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995968.1 protein_id gnl|my_center|LOCUS_17800 43891 42710 gene locus_tag LOCUS_17810 43891 42710 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_17810 44605 43949 gene locus_tag LOCUS_17820 44605 43949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 45424 44618 gene locus_tag LOCUS_17830 45424 44618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 46794 45427 gene locus_tag LOCUS_17840 46794 45427 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918539.1 protein_id gnl|my_center|LOCUS_17840 47252 46803 gene locus_tag LOCUS_17850 47252 46803 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125898.1 protein_id gnl|my_center|LOCUS_17850 47366 48718 gene locus_tag LOCUS_17860 47366 48718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 48972 50282 gene locus_tag LOCUS_17870 48972 50282 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898533.1 protein_id gnl|my_center|LOCUS_17870 50286 51380 gene locus_tag LOCUS_17880 50286 51380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 51390 52040 gene locus_tag LOCUS_17890 51390 52040 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_17890 52606 52043 gene locus_tag LOCUS_17900 gene def 52606 52043 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_17900 52736 52664 gene locus_tag LOCUS_t00230 52736 52664 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 52828 54177 gene locus_tag LOCUS_17910 52828 54177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 54187 56853 gene locus_tag LOCUS_17920 54187 56853 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612757.1 protein_id gnl|my_center|LOCUS_17920 56963 57301 gene locus_tag LOCUS_17930 56963 57301 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884017.1 protein_id gnl|my_center|LOCUS_17930 57298 59742 gene locus_tag LOCUS_17940 57298 59742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 60928 59726 gene locus_tag LOCUS_17950 60928 59726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 61728 60925 gene locus_tag LOCUS_17960 61728 60925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 62223 61765 gene locus_tag LOCUS_17970 62223 61765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 62932 62228 gene locus_tag LOCUS_17980 62932 62228 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428485.1 protein_id gnl|my_center|LOCUS_17980 63143 64306 gene locus_tag LOCUS_17990 63143 64306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 65641 64349 gene locus_tag LOCUS_18000 65641 64349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 67563 65644 gene locus_tag LOCUS_18010 67563 65644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 68957 67563 gene locus_tag LOCUS_18020 68957 67563 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_18020 69081 70430 gene locus_tag LOCUS_18030 69081 70430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 74151 70456 gene locus_tag LOCUS_18040 gene metH 74151 70456 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 protein_id gnl|my_center|LOCUS_18040 75493 74195 gene locus_tag LOCUS_18050 gene ahcY 75493 74195 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117570.1 protein_id gnl|my_center|LOCUS_18050 76616 75666 gene locus_tag LOCUS_18060 76616 75666 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230181.1 protein_id gnl|my_center|LOCUS_18060 76741 76980 gene locus_tag LOCUS_18070 76741 76980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 76989 77318 gene locus_tag LOCUS_18080 76989 77318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 77818 77891 gene locus_tag LOCUS_t00240 77818 77891 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 77960 78691 gene locus_tag LOCUS_18090 77960 78691 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795919.1 protein_id gnl|my_center|LOCUS_18090 78698 80134 gene locus_tag LOCUS_18100 78698 80134 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254665.1 protein_id gnl|my_center|LOCUS_18100 80558 80136 gene locus_tag LOCUS_18110 80558 80136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 80924 81544 gene locus_tag LOCUS_18120 80924 81544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 82495 81515 gene locus_tag LOCUS_18130 82495 81515 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694947.1 protein_id gnl|my_center|LOCUS_18130 82577 82903 gene locus_tag LOCUS_18140 82577 82903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 83765 82905 gene locus_tag LOCUS_18150 83765 82905 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943783.1 protein_id gnl|my_center|LOCUS_18150 83807 84988 gene locus_tag LOCUS_18160 83807 84988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 87135 84982 gene locus_tag LOCUS_18170 87135 84982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 87113 87883 gene locus_tag LOCUS_18180 87113 87883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 87967 88497 gene locus_tag LOCUS_18190 87967 88497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 88498 90297 gene locus_tag LOCUS_18200 88498 90297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 90372 90677 gene locus_tag LOCUS_18210 90372 90677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 90815 91726 gene locus_tag LOCUS_18220 90815 91726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 91842 93530 gene locus_tag LOCUS_18230 gene ilvB 91842 93530 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272051.1 protein_id gnl|my_center|LOCUS_18230 93568 94440 gene locus_tag LOCUS_18240 93568 94440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 94464 95066 gene locus_tag LOCUS_18250 94464 95066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 96296 95070 gene locus_tag LOCUS_18260 96296 95070 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119682992.1 protein_id gnl|my_center|LOCUS_18260 97223 96351 gene locus_tag LOCUS_18270 97223 96351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 98181 97270 gene locus_tag LOCUS_18280 98181 97270 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551848.1 protein_id gnl|my_center|LOCUS_18280 99211 98174 gene locus_tag LOCUS_18290 99211 98174 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291460.1 protein_id gnl|my_center|LOCUS_18290 100480 99269 gene locus_tag LOCUS_18300 gene mnmA 100480 99269 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033460.1 protein_id gnl|my_center|LOCUS_18300 100506 102380 gene locus_tag LOCUS_18310 100506 102380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 102346 102810 gene locus_tag LOCUS_18320 102346 102810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 102878 104059 gene locus_tag LOCUS_18330 102878 104059 CDS product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616634.1 protein_id gnl|my_center|LOCUS_18330 104668 104159 gene locus_tag LOCUS_18340 104668 104159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 108572 104970 gene locus_tag LOCUS_18350 108572 104970 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783498.1 protein_id gnl|my_center|LOCUS_18350 108829 109614 gene locus_tag LOCUS_18360 108829 109614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 109693 112467 gene locus_tag LOCUS_18370 109693 112467 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564921.1 protein_id gnl|my_center|LOCUS_18370 112672 113604 gene locus_tag LOCUS_18380 112672 113604 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_18380 114243 113734 gene locus_tag LOCUS_18390 114243 113734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 114410 115354 gene locus_tag LOCUS_18400 114410 115354 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277165.1 protein_id gnl|my_center|LOCUS_18400 115497 116021 gene locus_tag LOCUS_18410 115497 116021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 116503 116324 gene locus_tag LOCUS_18420 116503 116324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 116831 116637 gene locus_tag LOCUS_18430 116831 116637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 117074 118996 gene locus_tag LOCUS_18440 117074 118996 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698487.1 protein_id gnl|my_center|LOCUS_18440 119010 119312 gene locus_tag LOCUS_18450 119010 119312 CDS product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438557.1 protein_id gnl|my_center|LOCUS_18450 119314 120402 gene locus_tag LOCUS_18460 119314 120402 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931520.1 protein_id gnl|my_center|LOCUS_18460 120995 120405 gene locus_tag LOCUS_18470 120995 120405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 121176 122132 gene locus_tag LOCUS_18480 121176 122132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 123530 122133 gene locus_tag LOCUS_18490 123530 122133 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070251.1 protein_id gnl|my_center|LOCUS_18490 123982 123533 gene locus_tag LOCUS_18500 123982 123533 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928467.1 protein_id gnl|my_center|LOCUS_18500 125512 123995 gene locus_tag LOCUS_18510 125512 123995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 125602 126582 gene locus_tag LOCUS_18520 gene rfaD 125602 126582 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_18520 126575 127462 gene locus_tag LOCUS_18530 126575 127462 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800998.1 protein_id gnl|my_center|LOCUS_18530 127472 129070 gene locus_tag LOCUS_18540 127472 129070 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604736.1 protein_id gnl|my_center|LOCUS_18540 129603 129067 gene locus_tag LOCUS_18550 129603 129067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 130729 129593 gene locus_tag LOCUS_18560 130729 129593 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235370.1 protein_id gnl|my_center|LOCUS_18560 132371 130731 gene locus_tag LOCUS_18570 132371 130731 CDS product glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069642.1 protein_id gnl|my_center|LOCUS_18570 133061 132387 gene locus_tag LOCUS_18580 133061 132387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 133074 134741 gene locus_tag LOCUS_18590 133074 134741 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291493.1 protein_id gnl|my_center|LOCUS_18590 134744 135328 gene locus_tag LOCUS_18600 134744 135328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 135715 135365 gene locus_tag LOCUS_18610 135715 135365 CDS product high-potential iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405532.1 protein_id gnl|my_center|LOCUS_18610 135963 136415 gene locus_tag LOCUS_18620 135963 136415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 136455 136925 gene locus_tag LOCUS_18630 gene rplM 136455 136925 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_18630 136947 137372 gene locus_tag LOCUS_18640 gene rpsI 136947 137372 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001966744.1 protein_id gnl|my_center|LOCUS_18640 137775 137428 gene locus_tag LOCUS_18650 137775 137428 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246073.1 protein_id gnl|my_center|LOCUS_18650 138884 137751 gene locus_tag LOCUS_18660 138884 137751 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351651.1 protein_id gnl|my_center|LOCUS_18660 138994 141063 gene locus_tag LOCUS_18670 138994 141063 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229482.1 protein_id gnl|my_center|LOCUS_18670 141647 141060 gene locus_tag LOCUS_18680 141647 141060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 142154 141771 gene locus_tag LOCUS_18690 142154 141771 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167581.1 protein_id gnl|my_center|LOCUS_18690 142281 144422 gene locus_tag LOCUS_18700 142281 144422 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_18700 145368 144364 gene locus_tag LOCUS_18710 145368 144364 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222403.1 protein_id gnl|my_center|LOCUS_18710 146284 145373 gene locus_tag LOCUS_18720 146284 145373 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_18720 148028 146295 gene locus_tag LOCUS_18730 148028 146295 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_18730 148763 148050 gene locus_tag LOCUS_18740 148763 148050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 148887 150512 gene locus_tag LOCUS_18750 148887 150512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 150543 151154 gene locus_tag LOCUS_18760 150543 151154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 151927 151142 gene locus_tag LOCUS_18770 151927 151142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence08 545 255 gene locus_tag LOCUS_18780 545 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 744 1139 gene locus_tag LOCUS_18790 744 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1767 1258 gene locus_tag LOCUS_18800 1767 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1919 2707 gene locus_tag LOCUS_18810 gene hisF 1919 2707 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067921.1 protein_id gnl|my_center|LOCUS_18810 2730 3008 gene locus_tag LOCUS_18820 gene hisE 2730 3008 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394955.1 protein_id gnl|my_center|LOCUS_18820 3008 3856 gene locus_tag LOCUS_18830 gene kdsA 3008 3856 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056080.1 protein_id gnl|my_center|LOCUS_18830 3828 4415 gene locus_tag LOCUS_18840 3828 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 4390 5739 gene locus_tag LOCUS_18850 4390 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 5748 6485 gene locus_tag LOCUS_18860 gene lptB 5748 6485 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_18860 6488 7840 gene locus_tag LOCUS_18870 gene rpoN 6488 7840 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421965.1 protein_id gnl|my_center|LOCUS_18870 8827 7841 gene locus_tag LOCUS_18880 8827 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 8962 9348 gene locus_tag LOCUS_18890 8962 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 9353 9802 gene locus_tag LOCUS_18900 9353 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 9805 10833 gene locus_tag LOCUS_18910 9805 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 11051 11824 gene locus_tag LOCUS_18920 11051 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 12986 11817 gene locus_tag LOCUS_18930 12986 11817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439951.1 protein_id gnl|my_center|LOCUS_18930 14343 13039 gene locus_tag LOCUS_18940 gene nhaA 14343 13039 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107366.1 protein_id gnl|my_center|LOCUS_18940 14474 15118 gene locus_tag LOCUS_18950 14474 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 15124 15594 gene locus_tag LOCUS_18960 15124 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 16407 15589 gene locus_tag LOCUS_18970 16407 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 18622 16400 gene locus_tag LOCUS_18980 18622 16400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 19120 18632 gene locus_tag LOCUS_18990 gene ispF 19120 18632 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285625.1 protein_id gnl|my_center|LOCUS_18990 19607 19161 gene locus_tag LOCUS_19000 19607 19161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 21183 19657 gene locus_tag LOCUS_19010 21183 19657 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984000.1 protein_id gnl|my_center|LOCUS_19010 21911 21246 gene locus_tag LOCUS_19020 21911 21246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669416.1 protein_id gnl|my_center|LOCUS_19020 23228 21960 gene locus_tag LOCUS_19030 23228 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488656.1 protein_id gnl|my_center|LOCUS_19030 23612 25216 gene locus_tag LOCUS_19040 gene cysS 23612 25216 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570132.1 protein_id gnl|my_center|LOCUS_19040 25213 26010 gene locus_tag LOCUS_19050 gene rlmB 25213 26010 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060589244.1 protein_id gnl|my_center|LOCUS_19050 26514 26017 gene locus_tag LOCUS_19060 26514 26017 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879705.1 protein_id gnl|my_center|LOCUS_19060 27992 26511 gene locus_tag LOCUS_19070 27992 26511 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877731.1 protein_id gnl|my_center|LOCUS_19070 28773 27979 gene locus_tag LOCUS_19080 28773 27979 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768560.1 protein_id gnl|my_center|LOCUS_19080 30381 28777 gene locus_tag LOCUS_19090 30381 28777 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040777.1 protein_id gnl|my_center|LOCUS_19090 31322 30441 gene locus_tag LOCUS_19100 gene tatC 31322 30441 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165498.1 protein_id gnl|my_center|LOCUS_19100 31579 31328 gene locus_tag LOCUS_19110 31579 31328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 31633 32445 gene locus_tag LOCUS_19120 31633 32445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197038.1 protein_id gnl|my_center|LOCUS_19120 32514 32825 gene locus_tag LOCUS_19130 gene trxA 32514 32825 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970524.1 protein_id gnl|my_center|LOCUS_19130 33202 32888 gene locus_tag LOCUS_19140 33202 32888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 33313 35502 gene locus_tag LOCUS_19150 33313 35502 CDS product cAMP/cGMP-dependent 3',5'-cyclic-AMP/GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910893.1 protein_id gnl|my_center|LOCUS_19150 35971 35507 gene locus_tag LOCUS_19160 35971 35507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 36836 36102 gene locus_tag LOCUS_19170 36836 36102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 38960 36891 gene locus_tag LOCUS_19180 38960 36891 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966811.1 protein_id gnl|my_center|LOCUS_19180 39406 39002 gene locus_tag LOCUS_19190 39406 39002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 41124 39403 gene locus_tag LOCUS_19200 41124 39403 CDS product P83/100 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488504.1 protein_id gnl|my_center|LOCUS_19200 41221 44790 gene locus_tag LOCUS_19210 gene mfd 41221 44790 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654016.1 protein_id gnl|my_center|LOCUS_19210 44839 45564 gene locus_tag LOCUS_19220 44839 45564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 46739 45588 gene locus_tag LOCUS_19230 46739 45588 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037901.1 protein_id gnl|my_center|LOCUS_19230 46957 47466 gene locus_tag LOCUS_19240 46957 47466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 48759 47578 gene locus_tag LOCUS_19250 48759 47578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 49075 49779 gene locus_tag LOCUS_19260 49075 49779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 51237 49795 gene locus_tag LOCUS_19270 51237 49795 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_19270 55804 51230 gene locus_tag LOCUS_19280 gene gltB 55804 51230 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_19280 57008 55980 gene locus_tag LOCUS_19290 57008 55980 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_19290 57213 59390 gene locus_tag LOCUS_19300 57213 59390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 59756 60016 gene locus_tag LOCUS_19310 59756 60016 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546253.1 protein_id gnl|my_center|LOCUS_19310 60018 62018 gene locus_tag LOCUS_19320 60018 62018 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545400.1 protein_id gnl|my_center|LOCUS_19320 62018 62248 gene locus_tag LOCUS_19330 62018 62248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 62258 64090 gene locus_tag LOCUS_19340 62258 64090 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546223.1 protein_id gnl|my_center|LOCUS_19340 64163 65230 gene locus_tag LOCUS_19350 64163 65230 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395264.1 protein_id gnl|my_center|LOCUS_19350 65499 65572 gene locus_tag LOCUS_t00250 65499 65572 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 65611 67041 gene locus_tag LOCUS_19360 65611 67041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19360 67060 67725 gene locus_tag LOCUS_19370 gene ccoO 67060 67725 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 protein_id gnl|my_center|LOCUS_19370 67735 67890 gene locus_tag LOCUS_19380 67735 67890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 67974 68516 gene locus_tag LOCUS_19390 67974 68516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 68608 69939 gene locus_tag LOCUS_19400 gene ccoG 68608 69939 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930776.1 protein_id gnl|my_center|LOCUS_19400 69947 70489 gene locus_tag LOCUS_19410 69947 70489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 70493 70657 gene locus_tag LOCUS_19420 70493 70657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 70663 70875 gene locus_tag LOCUS_19430 70663 70875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 70887 73424 gene locus_tag LOCUS_19440 70887 73424 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457369.1 protein_id gnl|my_center|LOCUS_19440 75194 73428 gene locus_tag LOCUS_19450 75194 73428 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015897.1 protein_id gnl|my_center|LOCUS_19450 76556 75324 gene locus_tag LOCUS_19460 76556 75324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 79347 76762 gene locus_tag LOCUS_19470 gene clpB 79347 76762 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762672.1 protein_id gnl|my_center|LOCUS_19470 79691 80254 gene locus_tag LOCUS_19480 79691 80254 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_19480 80285 83398 gene locus_tag LOCUS_19490 80285 83398 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_19490 83412 84815 gene locus_tag LOCUS_19500 gene nrfD 83412 84815 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_19500 84829 85515 gene locus_tag LOCUS_19510 84829 85515 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277765.1 protein_id gnl|my_center|LOCUS_19510 85517 86134 gene locus_tag LOCUS_19520 85517 86134 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872574.1 protein_id gnl|my_center|LOCUS_19520 86145 87386 gene locus_tag LOCUS_19530 86145 87386 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_19530 87400 88302 gene locus_tag LOCUS_19540 87400 88302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 88309 89652 gene locus_tag LOCUS_19550 88309 89652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 89663 90301 gene locus_tag LOCUS_19560 89663 90301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 90311 90793 gene locus_tag LOCUS_19570 90311 90793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 92613 90817 gene locus_tag LOCUS_19580 gene thiC 92613 90817 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962597.1 protein_id gnl|my_center|LOCUS_19580 93201 92815 gene locus_tag LOCUS_19590 93201 92815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 93821 93279 gene locus_tag LOCUS_19600 gene cobC 93821 93279 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424906.1 protein_id gnl|my_center|LOCUS_19600 94864 93818 gene locus_tag LOCUS_19610 94864 93818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 95877 94867 gene locus_tag LOCUS_19620 95877 94867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 96080 98830 gene locus_tag LOCUS_19630 96080 98830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 99668 98772 gene locus_tag LOCUS_19640 99668 98772 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003304.1 protein_id gnl|my_center|LOCUS_19640 99747 100442 gene locus_tag LOCUS_19650 99747 100442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 100442 101107 gene locus_tag LOCUS_19660 100442 101107 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_19660 101224 101550 gene locus_tag LOCUS_19670 101224 101550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 102185 101622 gene locus_tag LOCUS_19680 102185 101622 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147798296.1 protein_id gnl|my_center|LOCUS_19680 104293 102188 gene locus_tag LOCUS_19690 104293 102188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19690 105684 104281 gene locus_tag LOCUS_19700 105684 104281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19700 108314 105720 gene locus_tag LOCUS_19710 108314 105720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 109060 108692 gene locus_tag LOCUS_19720 109060 108692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 109277 109495 gene locus_tag LOCUS_19730 109277 109495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 109673 112099 gene locus_tag LOCUS_19740 109673 112099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 113350 112493 gene locus_tag LOCUS_19750 gene cmoB 113350 112493 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903912.1 protein_id gnl|my_center|LOCUS_19750 113480 114031 gene locus_tag LOCUS_19760 113480 114031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 114018 114362 gene locus_tag LOCUS_19770 114018 114362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 114451 116427 gene locus_tag LOCUS_19780 gene recJ 114451 116427 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615880.1 protein_id gnl|my_center|LOCUS_19780 116521 117030 gene locus_tag LOCUS_19790 116521 117030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 117193 118578 gene locus_tag LOCUS_19800 117193 118578 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247973.1 protein_id gnl|my_center|LOCUS_19800 118627 119841 gene locus_tag LOCUS_19810 118627 119841 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933267.1 protein_id gnl|my_center|LOCUS_19810 120013 121575 gene locus_tag LOCUS_19820 gene guaB 120013 121575 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070955.1 protein_id gnl|my_center|LOCUS_19820 121586 122368 gene locus_tag LOCUS_19830 121586 122368 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115248.1 protein_id gnl|my_center|LOCUS_19830 122443 122643 gene locus_tag LOCUS_19840 122443 122643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 122649 123014 gene locus_tag LOCUS_19850 122649 123014 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908508.1 protein_id gnl|my_center|LOCUS_19850 123022 123798 gene locus_tag LOCUS_19860 123022 123798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence09 940 1191 gene locus_tag LOCUS_19870 940 1191 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_19870 1175 3457 gene locus_tag LOCUS_19880 gene feoB 1175 3457 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_19880 3459 4220 gene locus_tag LOCUS_19890 3459 4220 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277165.1 protein_id gnl|my_center|LOCUS_19890 4284 6392 gene locus_tag LOCUS_19900 4284 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 6518 7027 gene locus_tag LOCUS_19910 6518 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 7856 7152 gene locus_tag LOCUS_19920 7856 7152 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656570.1 protein_id gnl|my_center|LOCUS_19920 7914 7997 gene locus_tag LOCUS_t00260 7914 7997 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8157 7999 gene locus_tag LOCUS_19930 8157 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 8949 8224 gene locus_tag LOCUS_19940 8949 8224 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770360.1 protein_id gnl|my_center|LOCUS_19940 9670 8924 gene locus_tag LOCUS_19950 9670 8924 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770694.1 protein_id gnl|my_center|LOCUS_19950 9954 9706 gene locus_tag LOCUS_19960 9954 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 11274 9994 gene locus_tag LOCUS_19970 11274 9994 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_19970 11740 11288 gene locus_tag LOCUS_19980 11740 11288 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_19980 12458 11730 gene locus_tag LOCUS_19990 gene fabG 12458 11730 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_19990 13059 12475 gene locus_tag LOCUS_20000 gene fabA 13059 12475 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770369.1 protein_id gnl|my_center|LOCUS_20000 14013 13069 gene locus_tag LOCUS_20010 14013 13069 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_20010 14944 14024 gene locus_tag LOCUS_20020 gene fabD 14944 14024 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048428.1 protein_id gnl|my_center|LOCUS_20020 16278 15190 gene locus_tag LOCUS_20030 16278 15190 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623742.1 protein_id gnl|my_center|LOCUS_20030 16417 17091 gene locus_tag LOCUS_20040 16417 17091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102691.1 protein_id gnl|my_center|LOCUS_20040 17536 17093 gene locus_tag LOCUS_20050 17536 17093 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 protein_id gnl|my_center|LOCUS_20050 18734 17541 gene locus_tag LOCUS_20060 18734 17541 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_20060 18879 19322 gene locus_tag LOCUS_20070 18879 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 19312 20655 gene locus_tag LOCUS_20080 19312 20655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 22451 20670 gene locus_tag LOCUS_20090 22451 20670 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793275.1 protein_id gnl|my_center|LOCUS_20090 22675 25599 gene locus_tag LOCUS_20100 gene greA 22675 25599 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064092.1 protein_id gnl|my_center|LOCUS_20100 26404 25625 gene locus_tag LOCUS_20110 26404 25625 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262530.1 protein_id gnl|my_center|LOCUS_20110 26533 27294 gene locus_tag LOCUS_20120 26533 27294 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668013.1 protein_id gnl|my_center|LOCUS_20120 27284 27691 gene locus_tag LOCUS_20130 27284 27691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 27695 28114 gene locus_tag LOCUS_20140 27695 28114 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053705.1 protein_id gnl|my_center|LOCUS_20140 28111 28737 gene locus_tag LOCUS_20150 28111 28737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 28864 29859 gene locus_tag LOCUS_20160 28864 29859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 29856 30488 gene locus_tag LOCUS_20170 29856 30488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 30606 31004 gene locus_tag LOCUS_20180 30606 31004 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615575.1 protein_id gnl|my_center|LOCUS_20180 31007 32233 gene locus_tag LOCUS_20190 31007 32233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 32270 33103 gene locus_tag LOCUS_20200 32270 33103 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400940.1 protein_id gnl|my_center|LOCUS_20200 33087 33557 gene locus_tag LOCUS_20210 33087 33557 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393936.1 protein_id gnl|my_center|LOCUS_20210 34802 33549 gene locus_tag LOCUS_20220 gene serS 34802 33549 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886261.1 protein_id gnl|my_center|LOCUS_20220 35684 34878 gene locus_tag LOCUS_20230 gene sfsA 35684 34878 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141732.1 protein_id gnl|my_center|LOCUS_20230 35758 37197 gene locus_tag LOCUS_20240 35758 37197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 37743 37177 gene locus_tag LOCUS_20250 gene lpxE 37743 37177 CDS product lipid A 1-phosphatase LpxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881106.1 protein_id gnl|my_center|LOCUS_20250 37886 39748 gene locus_tag LOCUS_20260 37886 39748 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_20260 39771 40769 gene locus_tag LOCUS_20270 39771 40769 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838141.1 protein_id gnl|my_center|LOCUS_20270 40880 41305 gene locus_tag LOCUS_20280 gene speD 40880 41305 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496461.1 protein_id gnl|my_center|LOCUS_20280 41302 42204 gene locus_tag LOCUS_20290 41302 42204 CDS product S-adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054152.1 protein_id gnl|my_center|LOCUS_20290 42330 43403 gene locus_tag LOCUS_20300 gene aroF 42330 43403 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583420.1 protein_id gnl|my_center|LOCUS_20300 46169 43572 gene locus_tag LOCUS_20310 46169 43572 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682103.1 protein_id gnl|my_center|LOCUS_20310 47394 46354 gene locus_tag LOCUS_20320 47394 46354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 47438 47728 gene locus_tag LOCUS_20330 47438 47728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 49748 47733 gene locus_tag LOCUS_20340 49748 47733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 50967 49726 gene locus_tag LOCUS_20350 50967 49726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 51696 50983 gene locus_tag LOCUS_20360 51696 50983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 52630 51704 gene locus_tag LOCUS_20370 52630 51704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682102.1 protein_id gnl|my_center|LOCUS_20370 54776 52737 gene locus_tag LOCUS_20380 gene cfpA 54776 52737 CDS product cytoplasmic filament protein CfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672116.1 protein_id gnl|my_center|LOCUS_20380 55126 54920 gene locus_tag LOCUS_20390 55126 54920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 56316 55141 gene locus_tag LOCUS_20400 56316 55141 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_20400 57152 56313 gene locus_tag LOCUS_20410 57152 56313 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249950.1 protein_id gnl|my_center|LOCUS_20410 57302 58396 gene locus_tag LOCUS_20420 57302 58396 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861276.1 protein_id gnl|my_center|LOCUS_20420 58407 59456 gene locus_tag LOCUS_20430 58407 59456 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692533.1 protein_id gnl|my_center|LOCUS_20430 60403 59558 gene locus_tag LOCUS_20440 gene ygiD 60403 59558 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184346.1 protein_id gnl|my_center|LOCUS_20440 61189 60644 gene locus_tag LOCUS_20450 61189 60644 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 protein_id gnl|my_center|LOCUS_20450 62174 61665 gene locus_tag LOCUS_20460 62174 61665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 63356 62274 gene locus_tag LOCUS_20470 gene amrS 63356 62274 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_20470 64368 63469 gene locus_tag LOCUS_20480 64368 63469 CDS product porin OmpL1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620707.1 protein_id gnl|my_center|LOCUS_20480 64713 65465 gene locus_tag LOCUS_20490 64713 65465 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014140.1 protein_id gnl|my_center|LOCUS_20490 65462 65950 gene locus_tag LOCUS_20500 gene ruvC 65462 65950 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597152.1 protein_id gnl|my_center|LOCUS_20500 65940 66548 gene locus_tag LOCUS_20510 gene ruvA 65940 66548 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229717.1 protein_id gnl|my_center|LOCUS_20510 68344 66503 gene locus_tag LOCUS_20520 68344 66503 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019143.1 protein_id gnl|my_center|LOCUS_20520 69381 68353 gene locus_tag LOCUS_20530 69381 68353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 70477 69398 gene locus_tag LOCUS_20540 gene mqnC 70477 69398 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146501.1 protein_id gnl|my_center|LOCUS_20540 71287 70487 gene locus_tag LOCUS_20550 71287 70487 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064553.1 protein_id gnl|my_center|LOCUS_20550 71852 71316 gene locus_tag LOCUS_20560 71852 71316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 73518 72202 gene locus_tag LOCUS_20570 73518 72202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20570 73625 77938 gene locus_tag LOCUS_20580 73625 77938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 79124 77982 gene locus_tag LOCUS_20590 79124 77982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 80558 79134 gene locus_tag LOCUS_20600 80558 79134 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578213.1 protein_id gnl|my_center|LOCUS_20600 81399 80560 gene locus_tag LOCUS_20610 81399 80560 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053851.1 protein_id gnl|my_center|LOCUS_20610 82036 81389 gene locus_tag LOCUS_20620 82036 81389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 83180 82059 gene locus_tag LOCUS_20630 83180 82059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 83756 83265 gene locus_tag LOCUS_20640 83756 83265 CDS product polyhydroxyalkanoate synthesis regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771339.1 protein_id gnl|my_center|LOCUS_20640 84266 83802 gene locus_tag LOCUS_20650 84266 83802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360826.1 protein_id gnl|my_center|LOCUS_20650 85058 84273 gene locus_tag LOCUS_20660 85058 84273 CDS product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052874.1 protein_id gnl|my_center|LOCUS_20660 85691 85068 gene locus_tag LOCUS_20670 85691 85068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 85780 86526 gene locus_tag LOCUS_20680 85780 86526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 87119 86505 gene locus_tag LOCUS_20690 gene phoU 87119 86505 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_20690 87280 88260 gene locus_tag LOCUS_20700 87280 88260 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_20700 88271 89245 gene locus_tag LOCUS_20710 gene pstC 88271 89245 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_20710 89242 90126 gene locus_tag LOCUS_20720 gene pstA 89242 90126 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_20720 90139 90939 gene locus_tag LOCUS_20730 gene pstB 90139 90939 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880655.1 protein_id gnl|my_center|LOCUS_20730 90941 91558 gene locus_tag LOCUS_20740 90941 91558 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069832.1 protein_id gnl|my_center|LOCUS_20740 91624 92022 gene locus_tag LOCUS_20750 91624 92022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20750 92045 93718 gene locus_tag LOCUS_20760 92045 93718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 93718 94575 gene locus_tag LOCUS_20770 93718 94575 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347675.1 protein_id gnl|my_center|LOCUS_20770 94618 94980 gene locus_tag LOCUS_20780 94618 94980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 95041 96366 gene locus_tag LOCUS_20790 95041 96366 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220692.1 protein_id gnl|my_center|LOCUS_20790 96363 97655 gene locus_tag LOCUS_20800 96363 97655 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946829.1 protein_id gnl|my_center|LOCUS_20800 97667 100864 gene locus_tag LOCUS_20810 97667 100864 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence10 1162 329 gene locus_tag LOCUS_20820 1162 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2535 1159 gene locus_tag LOCUS_20830 2535 1159 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_20830 3328 2519 gene locus_tag LOCUS_20840 3328 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4841 3321 gene locus_tag LOCUS_20850 4841 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 4965 5243 gene locus_tag LOCUS_20860 4965 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 7947 5308 gene locus_tag LOCUS_20870 7947 5308 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_20870 8165 8545 gene locus_tag LOCUS_20880 8165 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 8564 9631 gene locus_tag LOCUS_20890 8564 9631 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_20890 10177 9659 gene locus_tag LOCUS_20900 10177 9659 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186895.1 protein_id gnl|my_center|LOCUS_20900 11707 10211 gene locus_tag LOCUS_20910 gene glpK 11707 10211 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286755.1 protein_id gnl|my_center|LOCUS_20910 12313 11723 gene locus_tag LOCUS_20920 12313 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 12696 12983 gene locus_tag LOCUS_20930 12696 12983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 12998 14461 gene locus_tag LOCUS_20940 gene gatA 12998 14461 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002775.1 protein_id gnl|my_center|LOCUS_20940 14478 15491 gene locus_tag LOCUS_20950 14478 15491 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_20950 16300 15494 gene locus_tag LOCUS_20960 16300 15494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 16354 16569 gene locus_tag LOCUS_20970 16354 16569 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601827.1 protein_id gnl|my_center|LOCUS_20970 16569 17360 gene locus_tag LOCUS_20980 16569 17360 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345490.1 protein_id gnl|my_center|LOCUS_20980 17435 18244 gene locus_tag LOCUS_20990 gene motB 17435 18244 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129914.1 protein_id gnl|my_center|LOCUS_20990 18280 18810 gene locus_tag LOCUS_21000 18280 18810 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501992.1 protein_id gnl|my_center|LOCUS_21000 19000 20268 gene locus_tag LOCUS_21010 19000 20268 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898568.1 protein_id gnl|my_center|LOCUS_21010 21449 20265 gene locus_tag LOCUS_21020 gene hemW 21449 20265 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582256.1 protein_id gnl|my_center|LOCUS_21020 21558 22064 gene locus_tag LOCUS_21030 21558 22064 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_21030 22190 23212 gene locus_tag LOCUS_21040 gene fliG 22190 23212 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_21040 23218 23445 gene locus_tag LOCUS_21050 23218 23445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 23576 26512 gene locus_tag LOCUS_21060 23576 26512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 27835 26504 gene locus_tag LOCUS_21070 27835 26504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 30614 27852 gene locus_tag LOCUS_21080 30614 27852 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281021.1 protein_id gnl|my_center|LOCUS_21080 30868 31296 gene locus_tag LOCUS_21090 30868 31296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377461.1 protein_id gnl|my_center|LOCUS_21090 31283 32254 gene locus_tag LOCUS_21100 31283 32254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 32251 33471 gene locus_tag LOCUS_21110 32251 33471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 33507 34292 gene locus_tag LOCUS_21120 33507 34292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 34991 34293 gene locus_tag LOCUS_21130 34991 34293 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215708.1 protein_id gnl|my_center|LOCUS_21130 36091 34994 gene locus_tag LOCUS_21140 36091 34994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042628.1 protein_id gnl|my_center|LOCUS_21140 36186 36410 gene locus_tag LOCUS_21150 36186 36410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 36407 37603 gene locus_tag LOCUS_21160 36407 37603 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922549.1 protein_id gnl|my_center|LOCUS_21160 37724 40168 gene locus_tag LOCUS_21170 37724 40168 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783265.1 protein_id gnl|my_center|LOCUS_21170 40426 40178 gene locus_tag LOCUS_21180 40426 40178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 40738 41877 gene locus_tag LOCUS_21190 40738 41877 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_21190 41888 43612 gene locus_tag LOCUS_21200 41888 43612 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_21200 43622 44296 gene locus_tag LOCUS_21210 gene cybH 43622 44296 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924456.1 protein_id gnl|my_center|LOCUS_21210 44300 44779 gene locus_tag LOCUS_21220 44300 44779 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459789.1 protein_id gnl|my_center|LOCUS_21220 44791 47247 gene locus_tag LOCUS_21230 gene hypF 44791 47247 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986402.1 protein_id gnl|my_center|LOCUS_21230 47198 47503 gene locus_tag LOCUS_21240 47198 47503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 47500 48501 gene locus_tag LOCUS_21250 gene hypE 47500 48501 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_21250 48503 48838 gene locus_tag LOCUS_21260 48503 48838 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939601.1 protein_id gnl|my_center|LOCUS_21260 48849 49544 gene locus_tag LOCUS_21270 gene hypB 48849 49544 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_21270 49531 50679 gene locus_tag LOCUS_21280 gene hypD 49531 50679 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880727.1 protein_id gnl|my_center|LOCUS_21280 50684 52432 gene locus_tag LOCUS_21290 50684 52432 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880726.1 protein_id gnl|my_center|LOCUS_21290 52825 53241 gene locus_tag LOCUS_21300 52825 53241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 53291 54187 gene locus_tag LOCUS_21310 53291 54187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21310 55970 54204 gene locus_tag LOCUS_21320 55970 54204 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958086.1 protein_id gnl|my_center|LOCUS_21320 55971 56549 gene locus_tag LOCUS_21330 gene pyrE 55971 56549 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913344.1 protein_id gnl|my_center|LOCUS_21330 57342 56530 gene locus_tag LOCUS_21340 57342 56530 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060390007.1 protein_id gnl|my_center|LOCUS_21340 58500 57346 gene locus_tag LOCUS_21350 58500 57346 CDS product DUF1577 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014283.1 protein_id gnl|my_center|LOCUS_21350 58857 58504 gene locus_tag LOCUS_21360 58857 58504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 59664 58918 gene locus_tag LOCUS_21370 59664 58918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 59677 62040 gene locus_tag LOCUS_21380 59677 62040 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989370.1 protein_id gnl|my_center|LOCUS_21380 62046 62546 gene locus_tag LOCUS_21390 gene msrB 62046 62546 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070109.1 protein_id gnl|my_center|LOCUS_21390 64713 62539 gene locus_tag LOCUS_21400 64713 62539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 65213 64767 gene locus_tag LOCUS_21410 65213 64767 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628813.1 protein_id gnl|my_center|LOCUS_21410 66196 65210 gene locus_tag LOCUS_21420 gene mltG 66196 65210 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022116.1 protein_id gnl|my_center|LOCUS_21420 67027 66200 gene locus_tag LOCUS_21430 67027 66200 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_21430 67812 67030 gene locus_tag LOCUS_21440 67812 67030 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505733.1 protein_id gnl|my_center|LOCUS_21440 67965 67816 gene locus_tag LOCUS_21450 67965 67816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 69530 67968 gene locus_tag LOCUS_21460 69530 67968 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001969726.1 protein_id gnl|my_center|LOCUS_21460 69805 70059 gene locus_tag LOCUS_21470 69805 70059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 70161 70568 gene locus_tag LOCUS_21480 70161 70568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 70571 71467 gene locus_tag LOCUS_21490 gene nadC 70571 71467 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266735.1 protein_id gnl|my_center|LOCUS_21490 71468 72319 gene locus_tag LOCUS_21500 71468 72319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 72320 72991 gene locus_tag LOCUS_21510 72320 72991 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582682.1 protein_id gnl|my_center|LOCUS_21510 74295 72988 gene locus_tag LOCUS_21520 74295 72988 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 protein_id gnl|my_center|LOCUS_21520 74388 75239 gene locus_tag LOCUS_21530 74388 75239 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546470.1 protein_id gnl|my_center|LOCUS_21530 76261 75197 gene locus_tag LOCUS_21540 76261 75197 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 protein_id gnl|my_center|LOCUS_21540 76681 76493 gene locus_tag LOCUS_21550 76681 76493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 76983 78626 gene locus_tag LOCUS_21560 76983 78626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 78661 78816 gene locus_tag LOCUS_21570 gene rpmG 78661 78816 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096555.1 protein_id gnl|my_center|LOCUS_21570 78823 79851 gene locus_tag LOCUS_21580 78823 79851 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625236.1 protein_id gnl|my_center|LOCUS_21580 79773 79847 gene locus_tag LOCUS_t00270 79773 79847 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 79873 80664 gene locus_tag LOCUS_21590 79873 80664 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805357.1 protein_id gnl|my_center|LOCUS_21590 80670 81620 gene locus_tag LOCUS_21600 80670 81620 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012708.1 protein_id gnl|my_center|LOCUS_21600 81669 82259 gene locus_tag LOCUS_21610 81669 82259 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_21610 82343 82909 gene locus_tag LOCUS_21620 gene pth 82343 82909 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767698.1 protein_id gnl|my_center|LOCUS_21620 82975 84984 gene locus_tag LOCUS_21630 gene ftsH 82975 84984 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038998.1 protein_id gnl|my_center|LOCUS_21630 84999 86606 gene locus_tag LOCUS_21640 84999 86606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 86655 87818 gene locus_tag LOCUS_21650 86655 87818 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374065.1 protein_id gnl|my_center|LOCUS_21650 87997 87921 gene locus_tag LOCUS_t00280 87997 87921 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 88210 89058 gene locus_tag LOCUS_21660 gene folD 88210 89058 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070308.1 protein_id gnl|my_center|LOCUS_21660 89161 92238 gene locus_tag LOCUS_21670 89161 92238 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450798.1 protein_id gnl|my_center|LOCUS_21670 92247 92822 gene locus_tag LOCUS_21680 92247 92822 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020833.1 protein_id gnl|my_center|LOCUS_21680 92979 95072 gene locus_tag LOCUS_21690 92979 95072 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010416483.1 protein_id gnl|my_center|LOCUS_21690 95056 96936 gene locus_tag LOCUS_21700 95056 96936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 <97788 96939 gene locus_tag LOCUS_21710 <97788 96939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000849131.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence11 1936 350 gene locus_tag LOCUS_21720 1936 350 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111376.1 protein_id gnl|my_center|LOCUS_21720 3606 1951 gene locus_tag LOCUS_21730 3606 1951 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706501.1 protein_id gnl|my_center|LOCUS_21730 3967 5139 gene locus_tag LOCUS_21740 3967 5139 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578213.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21740 5149 6321 gene locus_tag LOCUS_21750 5149 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 7498 6275 gene locus_tag LOCUS_21760 7498 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 8075 8689 gene locus_tag LOCUS_21770 8075 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 8931 8701 gene locus_tag LOCUS_21780 8931 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 8910 10247 gene locus_tag LOCUS_21790 8910 10247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 11357 10215 gene locus_tag LOCUS_21800 11357 10215 CDS product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421042.1 protein_id gnl|my_center|LOCUS_21800 12144 11338 gene locus_tag LOCUS_21810 12144 11338 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965773.1 protein_id gnl|my_center|LOCUS_21810 12937 12146 gene locus_tag LOCUS_21820 12937 12146 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240172.1 protein_id gnl|my_center|LOCUS_21820 13952 12939 gene locus_tag LOCUS_21830 13952 12939 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922607.1 protein_id gnl|my_center|LOCUS_21830 15207 13954 gene locus_tag LOCUS_21840 gene trpB 15207 13954 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514163.1 protein_id gnl|my_center|LOCUS_21840 16966 15215 gene locus_tag LOCUS_21850 16966 15215 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647843.1 protein_id gnl|my_center|LOCUS_21850 18618 16996 gene locus_tag LOCUS_21860 18618 16996 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906630.1 protein_id gnl|my_center|LOCUS_21860 19833 18631 gene locus_tag LOCUS_21870 gene dxr 19833 18631 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069750.1 protein_id gnl|my_center|LOCUS_21870 20762 19830 gene locus_tag LOCUS_21880 20762 19830 CDS product CDP-archaeol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504834.1 protein_id gnl|my_center|LOCUS_21880 21172 20822 gene locus_tag LOCUS_21890 21172 20822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21890 21557 21177 gene locus_tag LOCUS_21900 21557 21177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21900 22124 21558 gene locus_tag LOCUS_21910 gene frr 22124 21558 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_21910 22848 22117 gene locus_tag LOCUS_21920 gene pyrH 22848 22117 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179852.1 protein_id gnl|my_center|LOCUS_21920 23452 22856 gene locus_tag LOCUS_21930 gene tsf 23452 22856 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_21930 24341 23466 gene locus_tag LOCUS_21940 gene rpsB 24341 23466 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111480.1 protein_id gnl|my_center|LOCUS_21940 24579 24367 gene locus_tag LOCUS_21950 24579 24367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 25287 24652 gene locus_tag LOCUS_21960 25287 24652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 26036 25287 gene locus_tag LOCUS_21970 26036 25287 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058012.1 protein_id gnl|my_center|LOCUS_21970 27418 26033 gene locus_tag LOCUS_21980 27418 26033 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_21980 29378 27468 gene locus_tag LOCUS_21990 29378 27468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892878.1 protein_id gnl|my_center|LOCUS_21990 29490 30227 gene locus_tag LOCUS_22000 29490 30227 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012765.1 protein_id gnl|my_center|LOCUS_22000 30230 31162 gene locus_tag LOCUS_22010 30230 31162 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001968824.1 protein_id gnl|my_center|LOCUS_22010 31206 32216 gene locus_tag LOCUS_22020 31206 32216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 32880 32203 gene locus_tag LOCUS_22030 32880 32203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 33408 32893 gene locus_tag LOCUS_22040 33408 32893 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240474.1 protein_id gnl|my_center|LOCUS_22040 36995 33453 gene locus_tag LOCUS_22050 36995 33453 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677425.1 protein_id gnl|my_center|LOCUS_22050 38575 36998 gene locus_tag LOCUS_22060 38575 36998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 39112 38624 gene locus_tag LOCUS_22070 39112 38624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 39245 39318 gene locus_tag LOCUS_t00290 39245 39318 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 39365 40318 gene locus_tag LOCUS_22080 39365 40318 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636970.1 protein_id gnl|my_center|LOCUS_22080 40318 40818 gene locus_tag LOCUS_22090 40318 40818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 40799 41608 gene locus_tag LOCUS_22100 40799 41608 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228771.1 protein_id gnl|my_center|LOCUS_22100 42898 41603 gene locus_tag LOCUS_22110 42898 41603 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_22110 43916 42927 gene locus_tag LOCUS_22120 43916 42927 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_22120 44044 44706 gene locus_tag LOCUS_22130 44044 44706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 46190 44703 gene locus_tag LOCUS_22140 46190 44703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 47694 46180 gene locus_tag LOCUS_22150 47694 46180 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_22150 48229 47732 gene locus_tag LOCUS_22160 48229 47732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 49193 48222 gene locus_tag LOCUS_22170 gene trpS 49193 48222 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221812.1 protein_id gnl|my_center|LOCUS_22170 49289 49492 gene locus_tag LOCUS_22180 49289 49492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 51138 49489 gene locus_tag LOCUS_22190 51138 49489 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071946.1 protein_id gnl|my_center|LOCUS_22190 51441 51157 gene locus_tag LOCUS_22200 51441 51157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 51546 52955 gene locus_tag LOCUS_22210 51546 52955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 52957 53436 gene locus_tag LOCUS_22220 52957 53436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 53481 54599 gene locus_tag LOCUS_22230 53481 54599 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895444.1 protein_id gnl|my_center|LOCUS_22230 54641 56245 gene locus_tag LOCUS_22240 54641 56245 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207220.1 protein_id gnl|my_center|LOCUS_22240 56740 56237 gene locus_tag LOCUS_22250 56740 56237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 57756 56779 gene locus_tag LOCUS_22260 57756 56779 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_22260 58761 57859 gene locus_tag LOCUS_22270 58761 57859 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_22270 59406 58804 gene locus_tag LOCUS_22280 59406 58804 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_22280 60786 59422 gene locus_tag LOCUS_22290 60786 59422 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_22290 61252 60833 gene locus_tag LOCUS_22300 61252 60833 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_22300 63279 61453 gene locus_tag LOCUS_22310 gene thrS 63279 61453 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786086.1 protein_id gnl|my_center|LOCUS_22310 63926 63711 gene locus_tag LOCUS_22320 63926 63711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 64706 64347 gene locus_tag LOCUS_22330 64706 64347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 66133 64781 gene locus_tag LOCUS_22340 gene mgtE 66133 64781 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080209.1 protein_id gnl|my_center|LOCUS_22340 66872 66153 gene locus_tag LOCUS_22350 66872 66153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 68064 67081 gene locus_tag LOCUS_22360 68064 67081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 69304 68051 gene locus_tag LOCUS_22370 69304 68051 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_22370 70273 71043 gene locus_tag LOCUS_22380 70273 71043 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637633.1 protein_id gnl|my_center|LOCUS_22380 71027 71866 gene locus_tag LOCUS_22390 71027 71866 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095800.1 protein_id gnl|my_center|LOCUS_22390 72167 73015 gene locus_tag LOCUS_22400 72167 73015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 73017 75545 gene locus_tag LOCUS_22410 73017 75545 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083704.1 protein_id gnl|my_center|LOCUS_22410 76573 75542 gene locus_tag LOCUS_22420 76573 75542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 76659 77552 gene locus_tag LOCUS_22430 gene metF 76659 77552 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757857.1 protein_id gnl|my_center|LOCUS_22430 77567 79330 gene locus_tag LOCUS_22440 77567 79330 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004124.1 protein_id gnl|my_center|LOCUS_22440 79392 79700 gene locus_tag LOCUS_22450 79392 79700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 79712 81028 gene locus_tag LOCUS_22460 79712 81028 CDS product LIC20035 family adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819152.1 protein_id gnl|my_center|LOCUS_22460 84169 82676 gene locus_tag LOCUS_22470 84169 82676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 84228 84752 gene locus_tag LOCUS_22480 84228 84752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 84876 85271 gene locus_tag LOCUS_22490 84876 85271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 85585 85980 gene locus_tag LOCUS_22500 85585 85980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 86641 86126 gene locus_tag LOCUS_22510 86641 86126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 86806 87726 gene locus_tag LOCUS_22520 86806 87726 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816747.1 protein_id gnl|my_center|LOCUS_22520 87963 88766 gene locus_tag LOCUS_22530 87963 88766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 89402 88761 gene locus_tag LOCUS_22540 89402 88761 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence12 101 193 gene locus_tag LOCUS_t00300 101 193 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 208 642 gene locus_tag LOCUS_22550 208 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2458 671 gene locus_tag LOCUS_22560 gene recN 2458 671 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947750.1 protein_id gnl|my_center|LOCUS_22560 4587 2503 gene locus_tag LOCUS_22570 4587 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 5540 4599 gene locus_tag LOCUS_22580 5540 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 7366 5612 gene locus_tag LOCUS_22590 7366 5612 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_22590 7912 7388 gene locus_tag LOCUS_22600 gene cbaB 7912 7388 CDS product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 protein_id gnl|my_center|LOCUS_22600 9544 8045 gene locus_tag LOCUS_22610 9544 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 9735 10592 gene locus_tag LOCUS_22620 9735 10592 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833301.1 protein_id gnl|my_center|LOCUS_22620 10633 11700 gene locus_tag LOCUS_22630 10633 11700 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983041.1 protein_id gnl|my_center|LOCUS_22630 12727 11684 gene locus_tag LOCUS_22640 12727 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 13491 12724 gene locus_tag LOCUS_22650 13491 12724 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667727.1 protein_id gnl|my_center|LOCUS_22650 14476 13481 gene locus_tag LOCUS_22660 14476 13481 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027025.1 protein_id gnl|my_center|LOCUS_22660 15649 14477 gene locus_tag LOCUS_22670 15649 14477 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365892.1 protein_id gnl|my_center|LOCUS_22670 16642 15767 gene locus_tag LOCUS_22680 16642 15767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 17271 16621 gene locus_tag LOCUS_22690 17271 16621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 17518 18621 gene locus_tag LOCUS_22700 17518 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 18667 19716 gene locus_tag LOCUS_22710 18667 19716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 22451 19752 gene locus_tag LOCUS_22720 22451 19752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 22590 22868 gene locus_tag LOCUS_22730 22590 22868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 23781 22828 gene locus_tag LOCUS_22740 gene cbiB 23781 22828 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145777.1 protein_id gnl|my_center|LOCUS_22740 24323 23781 gene locus_tag LOCUS_22750 gene cobU 24323 23781 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166823.1 protein_id gnl|my_center|LOCUS_22750 25463 24360 gene locus_tag LOCUS_22760 25463 24360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 25688 26557 gene locus_tag LOCUS_22770 gene lpxI 25688 26557 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517125.1 protein_id gnl|my_center|LOCUS_22770 26554 27720 gene locus_tag LOCUS_22780 gene lpxB 26554 27720 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212586.1 protein_id gnl|my_center|LOCUS_22780 27727 28638 gene locus_tag LOCUS_22790 gene argF 27727 28638 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_22790 30307 28694 gene locus_tag LOCUS_22800 30307 28694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 30956 30480 gene locus_tag LOCUS_22810 30956 30480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 32002 30962 gene locus_tag LOCUS_22820 gene pyrC 32002 30962 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958384.1 protein_id gnl|my_center|LOCUS_22820 32540 31995 gene locus_tag LOCUS_22830 32540 31995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 33511 32567 gene locus_tag LOCUS_22840 33511 32567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 35343 33508 gene locus_tag LOCUS_22850 35343 33508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 36086 35355 gene locus_tag LOCUS_22860 36086 35355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 36816 36079 gene locus_tag LOCUS_22870 36816 36079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 36875 38506 gene locus_tag LOCUS_22880 36875 38506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 38514 39317 gene locus_tag LOCUS_22890 gene sul2 38514 39317 CDS product sulfonamide-resistant dihydropteroate synthase Sul2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043265.1 protein_id gnl|my_center|LOCUS_22890 39327 40073 gene locus_tag LOCUS_22900 gene kdsB 39327 40073 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721859.1 protein_id gnl|my_center|LOCUS_22900 40077 40994 gene locus_tag LOCUS_22910 40077 40994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275305.1 protein_id gnl|my_center|LOCUS_22910 41637 41017 gene locus_tag LOCUS_22920 41637 41017 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080163.1 protein_id gnl|my_center|LOCUS_22920 42593 41688 gene locus_tag LOCUS_22930 42593 41688 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_22930 43563 42679 gene locus_tag LOCUS_22940 gene htpX 43563 42679 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264281.1 protein_id gnl|my_center|LOCUS_22940 44521 43700 gene locus_tag LOCUS_22950 44521 43700 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097486.1 protein_id gnl|my_center|LOCUS_22950 44520 46229 gene locus_tag LOCUS_22960 44520 46229 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_22960 47511 46231 gene locus_tag LOCUS_22970 47511 46231 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207121.1 protein_id gnl|my_center|LOCUS_22970 48368 47577 gene locus_tag LOCUS_22980 48368 47577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 48481 49038 gene locus_tag LOCUS_22990 gene fliN 48481 49038 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503771.1 protein_id gnl|my_center|LOCUS_22990 49169 50014 gene locus_tag LOCUS_23000 49169 50014 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586163.1 protein_id gnl|my_center|LOCUS_23000 50062 50982 gene locus_tag LOCUS_23010 gene xth 50062 50982 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_23010 51458 50946 gene locus_tag LOCUS_23020 51458 50946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 51476 52081 gene locus_tag LOCUS_23030 51476 52081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 52529 52065 gene locus_tag LOCUS_23040 52529 52065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 53293 52526 gene locus_tag LOCUS_23050 53293 52526 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_23050 53735 53304 gene locus_tag LOCUS_23060 53735 53304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 53893 55860 gene locus_tag LOCUS_23070 53893 55860 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845063.1 protein_id gnl|my_center|LOCUS_23070 57410 55890 gene locus_tag LOCUS_23080 57410 55890 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545924.1 protein_id gnl|my_center|LOCUS_23080 58721 57435 gene locus_tag LOCUS_23090 58721 57435 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805980.1 protein_id gnl|my_center|LOCUS_23090 58930 58718 gene locus_tag LOCUS_23100 58930 58718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 59580 59059 gene locus_tag LOCUS_23110 59580 59059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 62092 59660 gene locus_tag LOCUS_23120 62092 59660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 62902 62096 gene locus_tag LOCUS_23130 62902 62096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 64371 63007 gene locus_tag LOCUS_23140 64371 63007 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876537.1 protein_id gnl|my_center|LOCUS_23140 65872 64418 gene locus_tag LOCUS_23150 gene crtD 65872 64418 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125869.1 protein_id gnl|my_center|LOCUS_23150 66026 67288 gene locus_tag LOCUS_23160 gene lysA 66026 67288 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_23160 67536 68879 gene locus_tag LOCUS_23170 67536 68879 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932666.1 protein_id gnl|my_center|LOCUS_23170 68907 69248 gene locus_tag LOCUS_23180 68907 69248 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_23180 70189 69281 gene locus_tag LOCUS_23190 70189 69281 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_23190 70903 70250 gene locus_tag LOCUS_23200 70903 70250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849665.1 protein_id gnl|my_center|LOCUS_23200 71007 72338 gene locus_tag LOCUS_23210 gene miaB 71007 72338 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114512.1 protein_id gnl|my_center|LOCUS_23210 72910 72335 gene locus_tag LOCUS_23220 72910 72335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 73335 74774 gene locus_tag LOCUS_23230 gene glnA 73335 74774 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141054.1 protein_id gnl|my_center|LOCUS_23230 75652 75017 gene locus_tag LOCUS_23240 75652 75017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 77031 75808 gene locus_tag LOCUS_23250 77031 75808 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071499.1 protein_id gnl|my_center|LOCUS_23250 79875 77077 gene locus_tag LOCUS_23260 79875 77077 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393269.1 protein_id gnl|my_center|LOCUS_23260 80411 79872 gene locus_tag LOCUS_23270 80411 79872 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872605.1 protein_id gnl|my_center|LOCUS_23270 82891 80423 gene locus_tag LOCUS_23280 82891 80423 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808183.1 protein_id gnl|my_center|LOCUS_23280 84254 82902 gene locus_tag LOCUS_23290 84254 82902 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282546.1 protein_id gnl|my_center|LOCUS_23290 85363 84251 gene locus_tag LOCUS_23300 gene glpX 85363 84251 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964403.1 protein_id gnl|my_center|LOCUS_23300 85644 86093 gene locus_tag LOCUS_23310 85644 86093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence13 1395 475 gene locus_tag LOCUS_23320 1395 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2539 1679 gene locus_tag LOCUS_23330 2539 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2736 2536 gene locus_tag LOCUS_23340 2736 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2866 4428 gene locus_tag LOCUS_23350 2866 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 5332 4418 gene locus_tag LOCUS_23360 5332 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 5442 5777 gene locus_tag LOCUS_23370 5442 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 5863 6576 gene locus_tag LOCUS_23380 5863 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 6677 8632 gene locus_tag LOCUS_23390 gene acs 6677 8632 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983589.1 protein_id gnl|my_center|LOCUS_23390 8647 9438 gene locus_tag LOCUS_23400 8647 9438 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580059.1 protein_id gnl|my_center|LOCUS_23400 10901 9423 gene locus_tag LOCUS_23410 10901 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 11589 10909 gene locus_tag LOCUS_23420 gene bshB1 11589 10909 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_23420 12364 11600 gene locus_tag LOCUS_23430 12364 11600 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546049.1 protein_id gnl|my_center|LOCUS_23430 14034 12361 gene locus_tag LOCUS_23440 14034 12361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 16040 14823 gene locus_tag LOCUS_23450 16040 14823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 17329 16040 gene locus_tag LOCUS_23460 gene argJ 17329 16040 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966302.1 protein_id gnl|my_center|LOCUS_23460 18741 17419 gene locus_tag LOCUS_23470 18741 17419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 18882 19496 gene locus_tag LOCUS_23480 gene lexA 18882 19496 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654116.1 protein_id gnl|my_center|LOCUS_23480 19539 19844 gene locus_tag LOCUS_23490 19539 19844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192756.1 protein_id gnl|my_center|LOCUS_23490 20612 19845 gene locus_tag LOCUS_23500 20612 19845 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_23500 20722 21579 gene locus_tag LOCUS_23510 20722 21579 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261699.1 protein_id gnl|my_center|LOCUS_23510 22240 21584 gene locus_tag LOCUS_23520 22240 21584 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367409.1 protein_id gnl|my_center|LOCUS_23520 23330 22242 gene locus_tag LOCUS_23530 23330 22242 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918546.1 protein_id gnl|my_center|LOCUS_23530 24529 23333 gene locus_tag LOCUS_23540 24529 23333 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455556.1 protein_id gnl|my_center|LOCUS_23540 24719 25003 gene locus_tag LOCUS_23550 gene rpsT 24719 25003 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274025.1 protein_id gnl|my_center|LOCUS_23550 25015 25090 gene locus_tag LOCUS_t00310 25015 25090 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25099 25518 gene locus_tag LOCUS_23560 25099 25518 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270393.1 protein_id gnl|my_center|LOCUS_23560 25527 26888 gene locus_tag LOCUS_23570 gene hisD 25527 26888 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007465.1 protein_id gnl|my_center|LOCUS_23570 27277 26909 gene locus_tag LOCUS_23580 27277 26909 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124812.1 protein_id gnl|my_center|LOCUS_23580 27719 27282 gene locus_tag LOCUS_23590 27719 27282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 29093 27816 gene locus_tag LOCUS_23600 29093 27816 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_23600 29144 29839 gene locus_tag LOCUS_23610 29144 29839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 29817 30617 gene locus_tag LOCUS_23620 29817 30617 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283287.1 protein_id gnl|my_center|LOCUS_23620 31137 31210 gene locus_tag LOCUS_t00320 31137 31210 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 31296 31787 gene locus_tag LOCUS_23630 31296 31787 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032646.1 protein_id gnl|my_center|LOCUS_23630 31774 32811 gene locus_tag LOCUS_23640 31774 32811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 32814 33218 gene locus_tag LOCUS_23650 32814 33218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 33202 33720 gene locus_tag LOCUS_23660 33202 33720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 35281 33740 gene locus_tag LOCUS_23670 35281 33740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 37681 35558 gene locus_tag LOCUS_23680 37681 35558 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251358.1 protein_id gnl|my_center|LOCUS_23680 38637 37687 gene locus_tag LOCUS_23690 38637 37687 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_23690 39044 38634 gene locus_tag LOCUS_23700 39044 38634 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413285.1 protein_id gnl|my_center|LOCUS_23700 39423 39046 gene locus_tag LOCUS_23710 39423 39046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 39572 40621 gene locus_tag LOCUS_23720 39572 40621 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189850.1 protein_id gnl|my_center|LOCUS_23720 40920 42443 gene locus_tag LOCUS_23730 40920 42443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_23730 42487 44466 gene locus_tag LOCUS_23740 42487 44466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 44470 46377 gene locus_tag LOCUS_23750 44470 46377 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932716.1 protein_id gnl|my_center|LOCUS_23750 46374 47087 gene locus_tag LOCUS_23760 46374 47087 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081452.1 protein_id gnl|my_center|LOCUS_23760 47239 49164 gene locus_tag LOCUS_23770 gene acs 47239 49164 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228547.1 protein_id gnl|my_center|LOCUS_23770 49872 49198 gene locus_tag LOCUS_23780 49872 49198 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070665.1 protein_id gnl|my_center|LOCUS_23780 51009 49879 gene locus_tag LOCUS_23790 51009 49879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 52642 51071 gene locus_tag LOCUS_23800 52642 51071 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128566.1 protein_id gnl|my_center|LOCUS_23800 52879 55059 gene locus_tag LOCUS_23810 52879 55059 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_23810 55150 56937 gene locus_tag LOCUS_23820 55150 56937 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002749.1 protein_id gnl|my_center|LOCUS_23820 56934 57719 gene locus_tag LOCUS_23830 gene thiD 56934 57719 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368307.1 protein_id gnl|my_center|LOCUS_23830 57769 58491 gene locus_tag LOCUS_23840 57769 58491 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_23840 58512 59333 gene locus_tag LOCUS_23850 58512 59333 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583689.1 protein_id gnl|my_center|LOCUS_23850 59382 59457 gene locus_tag LOCUS_t00330 59382 59457 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 59781 59461 gene locus_tag LOCUS_23860 59781 59461 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057944.1 protein_id gnl|my_center|LOCUS_23860 59850 61211 gene locus_tag LOCUS_23870 59850 61211 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_23870 61213 61926 gene locus_tag LOCUS_23880 61213 61926 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973894.1 protein_id gnl|my_center|LOCUS_23880 61950 62870 gene locus_tag LOCUS_23890 61950 62870 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841027.1 protein_id gnl|my_center|LOCUS_23890 62873 63172 gene locus_tag LOCUS_23900 62873 63172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 63269 64234 gene locus_tag LOCUS_23910 63269 64234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 64245 65051 gene locus_tag LOCUS_23920 64245 65051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 65460 65837 gene locus_tag LOCUS_23930 65460 65837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 65940 67382 gene locus_tag LOCUS_23940 gene merA 65940 67382 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193219.1 protein_id gnl|my_center|LOCUS_23940 67822 67379 gene locus_tag LOCUS_23950 67822 67379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 68827 68015 gene locus_tag LOCUS_23960 68827 68015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 70393 68885 gene locus_tag LOCUS_23970 70393 68885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 70445 71650 gene locus_tag LOCUS_23980 70445 71650 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122024.1 protein_id gnl|my_center|LOCUS_23980 71654 72706 gene locus_tag LOCUS_23990 71654 72706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 73762 74859 gene locus_tag LOCUS_24000 gene lpxD 73762 74859 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_24000 74890 74978 gene locus_tag LOCUS_t00340 74890 74978 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 75211 75618 gene locus_tag LOCUS_24010 75211 75618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 75602 76459 gene locus_tag LOCUS_24020 75602 76459 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545553.1 protein_id gnl|my_center|LOCUS_24020 76443 77489 gene locus_tag LOCUS_24030 76443 77489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546662.1 protein_id gnl|my_center|LOCUS_24030 77492 77686 gene locus_tag LOCUS_24040 77492 77686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 77664 77879 gene locus_tag LOCUS_24050 77664 77879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 78110 79015 gene locus_tag LOCUS_24060 78110 79015 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence14 632 982 gene locus_tag LOCUS_24070 632 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1728 994 gene locus_tag LOCUS_24080 1728 994 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466324.1 protein_id gnl|my_center|LOCUS_24080 2156 1743 gene locus_tag LOCUS_24090 2156 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 4076 2238 gene locus_tag LOCUS_24100 4076 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 4373 5485 gene locus_tag LOCUS_24110 gene carA 4373 5485 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643186.1 protein_id gnl|my_center|LOCUS_24110 5472 6458 gene locus_tag LOCUS_24120 5472 6458 CDS product putative peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083687.1 protein_id gnl|my_center|LOCUS_24120 6460 8043 gene locus_tag LOCUS_24130 6460 8043 CDS product spiro-SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671644.1 protein_id gnl|my_center|LOCUS_24130 8027 8794 gene locus_tag LOCUS_24140 8027 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 8772 9701 gene locus_tag LOCUS_24150 8772 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 9705 11171 gene locus_tag LOCUS_24160 9705 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 11242 12228 gene locus_tag LOCUS_24170 11242 12228 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041092.1 protein_id gnl|my_center|LOCUS_24170 12390 12767 gene locus_tag LOCUS_24180 12390 12767 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_24180 12758 13279 gene locus_tag LOCUS_24190 12758 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 13298 13840 gene locus_tag LOCUS_24200 13298 13840 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_24200 13850 15085 gene locus_tag LOCUS_24210 gene nuoD 13850 15085 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_24210 15097 15579 gene locus_tag LOCUS_24220 gene nuoE 15097 15579 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_24220 15584 16888 gene locus_tag LOCUS_24230 gene nuoF 15584 16888 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_24230 16903 18543 gene locus_tag LOCUS_24240 16903 18543 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 protein_id gnl|my_center|LOCUS_24240 18547 19848 gene locus_tag LOCUS_24250 18547 19848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 19864 20448 gene locus_tag LOCUS_24260 19864 20448 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_24260 20522 21025 gene locus_tag LOCUS_24270 20522 21025 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_24270 21035 21340 gene locus_tag LOCUS_24280 gene nuoK 21035 21340 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_24280 21342 23318 gene locus_tag LOCUS_24290 gene nuoL 21342 23318 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_24290 23343 24797 gene locus_tag LOCUS_24300 23343 24797 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_24300 24807 26231 gene locus_tag LOCUS_24310 24807 26231 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_24310 26234 26989 gene locus_tag LOCUS_24320 26234 26989 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770694.1 protein_id gnl|my_center|LOCUS_24320 26986 28536 gene locus_tag LOCUS_24330 26986 28536 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128566.1 protein_id gnl|my_center|LOCUS_24330 28547 29713 gene locus_tag LOCUS_24340 28547 29713 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583336.1 protein_id gnl|my_center|LOCUS_24340 30960 29716 gene locus_tag LOCUS_24350 30960 29716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011185.1 protein_id gnl|my_center|LOCUS_24350 32284 30938 gene locus_tag LOCUS_24360 32284 30938 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577066.1 protein_id gnl|my_center|LOCUS_24360 32642 34522 gene locus_tag LOCUS_24370 32642 34522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 35541 34543 gene locus_tag LOCUS_24380 gene trxB 35541 34543 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940581.1 protein_id gnl|my_center|LOCUS_24380 35699 36061 gene locus_tag LOCUS_24390 35699 36061 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440098.1 protein_id gnl|my_center|LOCUS_24390 36079 36552 gene locus_tag LOCUS_24400 gene bcp 36079 36552 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_24400 36565 38169 gene locus_tag LOCUS_24410 36565 38169 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762684.1 protein_id gnl|my_center|LOCUS_24410 38809 38171 gene locus_tag LOCUS_24420 38809 38171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 38811 39062 gene locus_tag LOCUS_24430 38811 39062 CDS product lipoyl domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837773.1 protein_id gnl|my_center|LOCUS_24430 39101 39667 gene locus_tag LOCUS_24440 39101 39667 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458621.1 protein_id gnl|my_center|LOCUS_24440 39667 40281 gene locus_tag LOCUS_24450 39667 40281 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765986.1 protein_id gnl|my_center|LOCUS_24450 40416 40925 gene locus_tag LOCUS_24460 40416 40925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 41788 41027 gene locus_tag LOCUS_24470 41788 41027 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_24470 44166 41785 gene locus_tag LOCUS_24480 44166 41785 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_24480 44250 45860 gene locus_tag LOCUS_24490 44250 45860 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128566.1 protein_id gnl|my_center|LOCUS_24490 45871 48234 gene locus_tag LOCUS_24500 gene purL 45871 48234 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142111.1 protein_id gnl|my_center|LOCUS_24500 48394 48224 gene locus_tag LOCUS_24510 48394 48224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 48470 50323 gene locus_tag LOCUS_24520 48470 50323 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053693.1 protein_id gnl|my_center|LOCUS_24520 50326 51954 gene locus_tag LOCUS_24530 gene nadB 50326 51954 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137375.1 protein_id gnl|my_center|LOCUS_24530 52901 51936 gene locus_tag LOCUS_24540 52901 51936 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973039.1 protein_id gnl|my_center|LOCUS_24540 54076 52901 gene locus_tag LOCUS_24550 54076 52901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 54139 54927 gene locus_tag LOCUS_24560 54139 54927 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080909.1 protein_id gnl|my_center|LOCUS_24560 56613 54889 gene locus_tag LOCUS_24570 gene ptsP 56613 54889 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_24570 57472 56594 gene locus_tag LOCUS_24580 57472 56594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 57558 58865 gene locus_tag LOCUS_24590 gene fliI 57558 58865 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570583.1 protein_id gnl|my_center|LOCUS_24590 58876 59457 gene locus_tag LOCUS_24600 gene fliJ 58876 59457 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819760.1 protein_id gnl|my_center|LOCUS_24600 59459 59614 gene locus_tag LOCUS_24610 59459 59614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 59598 60215 gene locus_tag LOCUS_24620 59598 60215 CDS product flagellar protein FlbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157730.1 protein_id gnl|my_center|LOCUS_24620 60426 60217 gene locus_tag LOCUS_24630 60426 60217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 60571 60410 gene locus_tag LOCUS_24640 60571 60410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 60854 63121 gene locus_tag LOCUS_24650 60854 63121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 63426 64052 gene locus_tag LOCUS_24660 63426 64052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 64085 64885 gene locus_tag LOCUS_24670 gene panB 64085 64885 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789319.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence15 928 161 gene locus_tag LOCUS_24680 928 161 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_24680 1488 1096 gene locus_tag LOCUS_24690 1488 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 2086 1514 gene locus_tag LOCUS_24700 gene pth 2086 1514 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284985.1 protein_id gnl|my_center|LOCUS_24700 2172 2861 gene locus_tag LOCUS_24710 2172 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 3552 2929 gene locus_tag LOCUS_24720 3552 2929 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_24720 4930 3602 gene locus_tag LOCUS_24730 4930 3602 CDS product acyl-CoA--6-aminopenicillanic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332932.1 protein_id gnl|my_center|LOCUS_24730 5609 5094 gene locus_tag LOCUS_24740 5609 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 5744 7525 gene locus_tag LOCUS_24750 5744 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 8476 7538 gene locus_tag LOCUS_24760 8476 7538 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926866.1 protein_id gnl|my_center|LOCUS_24760 8651 9622 gene locus_tag LOCUS_24770 gene fmt 8651 9622 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690652.1 protein_id gnl|my_center|LOCUS_24770 9619 10629 gene locus_tag LOCUS_24780 9619 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 10639 11277 gene locus_tag LOCUS_24790 gene rpe 10639 11277 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702819.1 protein_id gnl|my_center|LOCUS_24790 11921 11349 gene locus_tag LOCUS_24800 11921 11349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 12025 12645 gene locus_tag LOCUS_24810 12025 12645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 12653 13483 gene locus_tag LOCUS_24820 12653 13483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 13798 14115 gene locus_tag LOCUS_24830 13798 14115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 14331 15008 gene locus_tag LOCUS_24840 14331 15008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 15116 16585 gene locus_tag LOCUS_24850 15116 16585 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_24850 16604 16969 gene locus_tag LOCUS_24860 16604 16969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 17168 17470 gene locus_tag LOCUS_24870 17168 17470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291938.1 protein_id gnl|my_center|LOCUS_24870 17477 18556 gene locus_tag LOCUS_24880 17477 18556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 18540 19289 gene locus_tag LOCUS_24890 18540 19289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 19308 19769 gene locus_tag LOCUS_24900 19308 19769 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069646.1 protein_id gnl|my_center|LOCUS_24900 19884 21512 gene locus_tag LOCUS_24910 19884 21512 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113202.1 protein_id gnl|my_center|LOCUS_24910 21526 23259 gene locus_tag LOCUS_24920 21526 23259 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_24920 23673 23236 gene locus_tag LOCUS_24930 23673 23236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 25016 24036 gene locus_tag LOCUS_24940 25016 24036 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047544.1 protein_id gnl|my_center|LOCUS_24940 25174 26706 gene locus_tag LOCUS_24950 gene hslU 25174 26706 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273640.1 protein_id gnl|my_center|LOCUS_24950 26720 27826 gene locus_tag LOCUS_24960 26720 27826 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405216.1 protein_id gnl|my_center|LOCUS_24960 27823 28761 gene locus_tag LOCUS_24970 27823 28761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 28782 29129 gene locus_tag LOCUS_24980 28782 29129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 29817 29122 gene locus_tag LOCUS_24990 29817 29122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155756.1 protein_id gnl|my_center|LOCUS_24990 31354 29915 gene locus_tag LOCUS_25000 31354 29915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 32220 31447 gene locus_tag LOCUS_25010 32220 31447 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_25010 32303 33301 gene locus_tag LOCUS_25020 32303 33301 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690430.1 protein_id gnl|my_center|LOCUS_25020 33344 33874 gene locus_tag LOCUS_25030 33344 33874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381195.1 protein_id gnl|my_center|LOCUS_25030 33855 34286 gene locus_tag LOCUS_25040 33855 34286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 34539 35630 gene locus_tag LOCUS_25050 34539 35630 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103068.1 protein_id gnl|my_center|LOCUS_25050 35627 36421 gene locus_tag LOCUS_25060 35627 36421 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_25060 36405 37019 gene locus_tag LOCUS_25070 36405 37019 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454888.1 protein_id gnl|my_center|LOCUS_25070 37395 37054 gene locus_tag LOCUS_tm00010 37395 37054 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 38849 37524 gene locus_tag LOCUS_25080 38849 37524 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_25080 39305 42815 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattcctcataggtacgcgataaac 43551 43285 gene locus_tag LOCUS_25090 gene cas2 43551 43285 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013193.1 protein_id gnl|my_center|LOCUS_25090 44553 43558 gene locus_tag LOCUS_25100 gene cas1b 44553 43558 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582992.1 protein_id gnl|my_center|LOCUS_25100 45056 44556 gene locus_tag LOCUS_25110 gene cas4 45056 44556 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460582.1 protein_id gnl|my_center|LOCUS_25110 46090 45044 gene locus_tag LOCUS_25120 46090 45044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25120 47419 46184 gene locus_tag LOCUS_25130 47419 46184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25130 48128 47406 gene locus_tag LOCUS_25140 gene cas5b 48128 47406 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582995.1 protein_id gnl|my_center|LOCUS_25140 49049 48138 gene locus_tag LOCUS_25150 gene cas7b 49049 48138 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_25150 51094 49382 gene locus_tag LOCUS_25160 51094 49382 CDS product TIGR02556 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582997.1 protein_id gnl|my_center|LOCUS_25160 52030 51521 gene locus_tag LOCUS_25170 52030 51521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 52576 52073 gene locus_tag LOCUS_25180 52576 52073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 53159 52545 gene locus_tag LOCUS_25190 53159 52545 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114396.1 protein_id gnl|my_center|LOCUS_25190 54963 53149 gene locus_tag LOCUS_25200 54963 53149 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895630.1 protein_id gnl|my_center|LOCUS_25200 55733 54975 gene locus_tag LOCUS_25210 55733 54975 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880576.1 protein_id gnl|my_center|LOCUS_25210 57400 55730 gene locus_tag LOCUS_25220 57400 55730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 58918 57410 gene locus_tag LOCUS_25230 58918 57410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 <59956 58930 gene locus_tag LOCUS_25240 <59956 58930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946200.1:type IVB secretion system protein DotG/IcmE >Feature sequence16 110 1051 gene locus_tag LOCUS_25250 110 1051 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_25250 1088 1636 gene locus_tag LOCUS_25260 1088 1636 CDS product outer-membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874918.1 protein_id gnl|my_center|LOCUS_25260 1643 3427 gene locus_tag LOCUS_25270 1643 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 3452 3769 gene locus_tag LOCUS_25280 3452 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 3766 4872 gene locus_tag LOCUS_25290 3766 4872 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225795.1 protein_id gnl|my_center|LOCUS_25290 5216 4836 gene locus_tag LOCUS_25300 5216 4836 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039429.1 protein_id gnl|my_center|LOCUS_25300 5470 5252 gene locus_tag LOCUS_25310 5470 5252 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622506.1 protein_id gnl|my_center|LOCUS_25310 6959 5475 gene locus_tag LOCUS_25320 6959 5475 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067929.1 protein_id gnl|my_center|LOCUS_25320 7784 6966 gene locus_tag LOCUS_25330 7784 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 7890 8252 gene locus_tag LOCUS_25340 7890 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 10102 8249 gene locus_tag LOCUS_25350 10102 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 10275 10658 gene locus_tag LOCUS_25360 10275 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172394.1 protein_id gnl|my_center|LOCUS_25360 10733 11851 gene locus_tag LOCUS_25370 10733 11851 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771807.1 protein_id gnl|my_center|LOCUS_25370 12885 11839 gene locus_tag LOCUS_25380 12885 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 15904 12866 gene locus_tag LOCUS_25390 15904 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 16008 16937 gene locus_tag LOCUS_25400 16008 16937 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142292.1 protein_id gnl|my_center|LOCUS_25400 18051 16918 gene locus_tag LOCUS_25410 18051 16918 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681105.1 protein_id gnl|my_center|LOCUS_25410 19852 18479 gene locus_tag LOCUS_25420 19852 18479 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932503.1 protein_id gnl|my_center|LOCUS_25420 22001 19863 gene locus_tag LOCUS_25430 22001 19863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 23185 21998 gene locus_tag LOCUS_25440 23185 21998 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016043.1 protein_id gnl|my_center|LOCUS_25440 24282 23185 gene locus_tag LOCUS_25450 gene ddlA 24282 23185 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704541.1 protein_id gnl|my_center|LOCUS_25450 25260 24286 gene locus_tag LOCUS_25460 25260 24286 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877313.1 protein_id gnl|my_center|LOCUS_25460 27293 25257 gene locus_tag LOCUS_25470 27293 25257 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428541.1 protein_id gnl|my_center|LOCUS_25470 29008 27305 gene locus_tag LOCUS_25480 gene ilvD 29008 27305 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_25480 30011 29361 gene locus_tag LOCUS_25490 30011 29361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 30808 30059 gene locus_tag LOCUS_25500 30808 30059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 30960 30887 gene locus_tag LOCUS_t00350 30960 30887 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 32012 31032 gene locus_tag LOCUS_25510 gene hemB 32012 31032 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_25510 32630 32064 gene locus_tag LOCUS_25520 32630 32064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 34425 32692 gene locus_tag LOCUS_25530 34425 32692 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895584.1 protein_id gnl|my_center|LOCUS_25530 34500 35090 gene locus_tag LOCUS_25540 34500 35090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 35115 35375 gene locus_tag LOCUS_25550 gene rpsR 35115 35375 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669347.1 protein_id gnl|my_center|LOCUS_25550 35517 38228 gene locus_tag LOCUS_25560 35517 38228 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687652.1 protein_id gnl|my_center|LOCUS_25560 38243 39433 gene locus_tag LOCUS_25570 gene odhB 38243 39433 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110041.1 protein_id gnl|my_center|LOCUS_25570 39447 40862 gene locus_tag LOCUS_25580 gene lpdA 39447 40862 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271667.1 protein_id gnl|my_center|LOCUS_25580 41641 40865 gene locus_tag LOCUS_25590 41641 40865 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023915.1 protein_id gnl|my_center|LOCUS_25590 42203 41628 gene locus_tag LOCUS_25600 42203 41628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 42840 42193 gene locus_tag LOCUS_25610 gene cbiM 42840 42193 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584114.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence17 2146 137 gene locus_tag LOCUS_25620 gene tkt 2146 137 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110216.1 protein_id gnl|my_center|LOCUS_25620 2705 2250 gene locus_tag LOCUS_25630 2705 2250 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_25630 2778 3764 gene locus_tag LOCUS_25640 2778 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 3799 4116 gene locus_tag LOCUS_25650 3799 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 5254 4118 gene locus_tag LOCUS_25660 5254 4118 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122447.1 protein_id gnl|my_center|LOCUS_25660 5348 6130 gene locus_tag LOCUS_25670 5348 6130 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139985.1 protein_id gnl|my_center|LOCUS_25670 6130 8112 gene locus_tag LOCUS_25680 6130 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 8186 9130 gene locus_tag LOCUS_25690 8186 9130 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076445.1 protein_id gnl|my_center|LOCUS_25690 9141 10112 gene locus_tag LOCUS_25700 9141 10112 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865411.1 protein_id gnl|my_center|LOCUS_25700 10219 10728 gene locus_tag LOCUS_25710 10219 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 12760 10895 gene locus_tag LOCUS_25720 gene htpG 12760 10895 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287997.1 protein_id gnl|my_center|LOCUS_25720 13982 12846 gene locus_tag LOCUS_25730 13982 12846 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_25730 15010 13979 gene locus_tag LOCUS_25740 15010 13979 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683574.1 protein_id gnl|my_center|LOCUS_25740 15715 15062 gene locus_tag LOCUS_25750 15715 15062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 15821 17893 gene locus_tag LOCUS_25760 15821 17893 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487747.1 protein_id gnl|my_center|LOCUS_25760 17964 19181 gene locus_tag LOCUS_25770 17964 19181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 19184 19597 gene locus_tag LOCUS_25780 19184 19597 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033731.1 protein_id gnl|my_center|LOCUS_25780 19601 20491 gene locus_tag LOCUS_25790 19601 20491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 20835 20488 gene locus_tag LOCUS_25800 20835 20488 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218967.1 protein_id gnl|my_center|LOCUS_25800 20933 22438 gene locus_tag LOCUS_25810 20933 22438 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_25810 22826 22449 gene locus_tag LOCUS_25820 gene acpS 22826 22449 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704154.1 protein_id gnl|my_center|LOCUS_25820 23845 22823 gene locus_tag LOCUS_25830 23845 22823 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766592.1 protein_id gnl|my_center|LOCUS_25830 24603 23848 gene locus_tag LOCUS_25840 gene cdaA 24603 23848 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464749.1 protein_id gnl|my_center|LOCUS_25840 25400 24600 gene locus_tag LOCUS_25850 gene dapB 25400 24600 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_25850 26281 25397 gene locus_tag LOCUS_25860 gene dapA 26281 25397 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970781.1 protein_id gnl|my_center|LOCUS_25860 26793 26347 gene locus_tag LOCUS_25870 26793 26347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 27818 26784 gene locus_tag LOCUS_25880 27818 26784 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079893.1 protein_id gnl|my_center|LOCUS_25880 28230 27799 gene locus_tag LOCUS_25890 28230 27799 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229815.1 protein_id gnl|my_center|LOCUS_25890 29067 28258 gene locus_tag LOCUS_25900 29067 28258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008019.1 protein_id gnl|my_center|LOCUS_25900 30458 29076 gene locus_tag LOCUS_25910 30458 29076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 30609 32849 gene locus_tag LOCUS_25920 30609 32849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 32908 34377 gene locus_tag LOCUS_25930 32908 34377 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898540.1 protein_id gnl|my_center|LOCUS_25930 34422 34931 gene locus_tag LOCUS_25940 34422 34931 CDS product DUF2505 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875950.1 protein_id gnl|my_center|LOCUS_25940 34928 35833 gene locus_tag LOCUS_25950 gene argB 34928 35833 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982628.1 protein_id gnl|my_center|LOCUS_25950 35875 36423 gene locus_tag LOCUS_25960 35875 36423 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534111.1 protein_id gnl|my_center|LOCUS_25960 36404 36808 gene locus_tag LOCUS_25970 36404 36808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 38857 36776 gene locus_tag LOCUS_25980 38857 36776 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_25980 39055 39561 gene locus_tag LOCUS_25990 39055 39561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 40035 39592 gene locus_tag LOCUS_26000 40035 39592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 41549 40089 gene locus_tag LOCUS_26010 gene pyk 41549 40089 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834388.1 protein_id gnl|my_center|LOCUS_26010 42594 41566 gene locus_tag LOCUS_26020 gene gmd 42594 41566 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880676.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence18 495 866 gene locus_tag LOCUS_26030 495 866 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_26030 868 1908 gene locus_tag LOCUS_26040 868 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3385 1910 gene locus_tag LOCUS_26050 3385 1910 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_26050 3530 3961 gene locus_tag LOCUS_26060 3530 3961 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_26060 5026 3956 gene locus_tag LOCUS_26070 5026 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132138.1 protein_id gnl|my_center|LOCUS_26070 5025 6164 gene locus_tag LOCUS_26080 5025 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 6180 7145 gene locus_tag LOCUS_26090 6180 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 7187 8197 gene locus_tag LOCUS_26100 gene xerC 7187 8197 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079116.1 protein_id gnl|my_center|LOCUS_26100 8245 8406 gene locus_tag LOCUS_26110 8245 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 8561 9961 gene locus_tag LOCUS_26120 8561 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 9958 11232 gene locus_tag LOCUS_26130 9958 11232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 11355 11639 gene locus_tag LOCUS_26140 11355 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 11639 12061 gene locus_tag LOCUS_26150 11639 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 12094 13413 gene locus_tag LOCUS_26160 12094 13413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594739.1 protein_id gnl|my_center|LOCUS_26160 13410 14033 gene locus_tag LOCUS_26170 13410 14033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 14041 14505 gene locus_tag LOCUS_26180 gene tadA 14041 14505 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_26180 15114 14500 gene locus_tag LOCUS_26190 15114 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 15319 16047 gene locus_tag LOCUS_26200 15319 16047 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836548.1 protein_id gnl|my_center|LOCUS_26200 16100 17272 gene locus_tag LOCUS_26210 16100 17272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 17250 19571 gene locus_tag LOCUS_26220 gene mrfA 17250 19571 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_26220 20039 19548 gene locus_tag LOCUS_26230 20039 19548 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898860.1 protein_id gnl|my_center|LOCUS_26230 20499 20023 gene locus_tag LOCUS_26240 20499 20023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 20533 20958 gene locus_tag LOCUS_26250 gene hemJ 20533 20958 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506456.1 protein_id gnl|my_center|LOCUS_26250 22354 21104 gene locus_tag LOCUS_26260 22354 21104 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020830.1 protein_id gnl|my_center|LOCUS_26260 23942 22443 gene locus_tag LOCUS_26270 23942 22443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282641.1 protein_id gnl|my_center|LOCUS_26270 24796 23939 gene locus_tag LOCUS_26280 24796 23939 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462055.1 protein_id gnl|my_center|LOCUS_26280 24884 25540 gene locus_tag LOCUS_26290 24884 25540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 26443 25511 gene locus_tag LOCUS_26300 26443 25511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 27380 26427 gene locus_tag LOCUS_26310 27380 26427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 27544 27891 gene locus_tag LOCUS_26320 27544 27891 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406135.1 protein_id gnl|my_center|LOCUS_26320 28383 27892 gene locus_tag LOCUS_26330 28383 27892 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116541.1 protein_id gnl|my_center|LOCUS_26330 28490 28405 gene locus_tag LOCUS_t00360 28490 28405 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28593 29348 gene locus_tag LOCUS_26340 28593 29348 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_26340 30420 29350 gene locus_tag LOCUS_26350 30420 29350 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930577.1 protein_id gnl|my_center|LOCUS_26350 31598 30444 gene locus_tag LOCUS_26360 gene alkB1 31598 30444 CDS product alkane 1-monooxygenase AlkB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102475.1 protein_id gnl|my_center|LOCUS_26360 32279 31614 gene locus_tag LOCUS_26370 32279 31614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 32982 32566 gene locus_tag LOCUS_26380 32982 32566 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_26380 33405 32998 gene locus_tag LOCUS_26390 33405 32998 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976191.1 protein_id gnl|my_center|LOCUS_26390 33533 33775 gene locus_tag LOCUS_26400 33533 33775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence19 646 2631 gene locus_tag LOCUS_26410 646 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2749 3183 gene locus_tag LOCUS_26420 2749 3183 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974282.1 protein_id gnl|my_center|LOCUS_26420 3195 4307 gene locus_tag LOCUS_26430 3195 4307 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576385.1 protein_id gnl|my_center|LOCUS_26430 4378 5868 gene locus_tag LOCUS_26440 gene rho 4378 5868 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179608.1 protein_id gnl|my_center|LOCUS_26440 6404 5871 gene locus_tag LOCUS_26450 6404 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 6566 7159 gene locus_tag LOCUS_26460 gene gmhA 6566 7159 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351733.1 protein_id gnl|my_center|LOCUS_26460 7204 8193 gene locus_tag LOCUS_26470 gene glcK 7204 8193 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_26470 8302 8907 gene locus_tag LOCUS_26480 8302 8907 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136732.1 protein_id gnl|my_center|LOCUS_26480 10177 8930 gene locus_tag LOCUS_26490 10177 8930 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222086.1 protein_id gnl|my_center|LOCUS_26490 10529 10188 gene locus_tag LOCUS_26500 10529 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 11305 10526 gene locus_tag LOCUS_26510 11305 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 12120 11380 gene locus_tag LOCUS_26520 12120 11380 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998676.1 protein_id gnl|my_center|LOCUS_26520 12226 13302 gene locus_tag LOCUS_26530 12226 13302 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_26530 13345 14694 gene locus_tag LOCUS_26540 13345 14694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 14980 16026 gene locus_tag LOCUS_26550 14980 16026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 16059 18770 gene locus_tag LOCUS_26560 gene cas10 16059 18770 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274454.1 protein_id gnl|my_center|LOCUS_26560 18772 19860 gene locus_tag LOCUS_26570 gene cmr3 18772 19860 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879359.1 protein_id gnl|my_center|LOCUS_26570 19857 20993 gene locus_tag LOCUS_26580 19857 20993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 20993 21979 gene locus_tag LOCUS_26590 gene cmr4 20993 21979 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064477.1 protein_id gnl|my_center|LOCUS_26590 21988 22119 gene locus_tag LOCUS_26600 21988 22119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 22116 22400 gene locus_tag LOCUS_26610 22116 22400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26610 22393 23349 gene locus_tag LOCUS_26620 22393 23349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 23346 24164 gene locus_tag LOCUS_26630 23346 24164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 24238 24807 gene locus_tag LOCUS_26640 24238 24807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence20 498 959 gene locus_tag LOCUS_26650 498 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1094 1381 gene locus_tag LOCUS_26660 1094 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 1391 2332 gene locus_tag LOCUS_26670 gene hprK 1391 2332 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_26670 2405 2662 gene locus_tag LOCUS_26680 2405 2662 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_26680 2671 4509 gene locus_tag LOCUS_26690 2671 4509 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997519.1 protein_id gnl|my_center|LOCUS_26690 4513 5856 gene locus_tag LOCUS_26700 4513 5856 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688483.1 protein_id gnl|my_center|LOCUS_26700 5853 6878 gene locus_tag LOCUS_26710 5853 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 6880 8901 gene locus_tag LOCUS_26720 gene priA 6880 8901 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000641110.1 protein_id gnl|my_center|LOCUS_26720 9220 12093 gene locus_tag LOCUS_26730 9220 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 12123 15611 gene locus_tag LOCUS_26740 12123 15611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 15624 17129 gene locus_tag LOCUS_26750 15624 17129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence21 330 1604 gene locus_tag LOCUS_26760 330 1604 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_26760 1719 2165 gene locus_tag LOCUS_26770 1719 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 2181 3701 gene locus_tag LOCUS_26780 2181 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 3705 4472 gene locus_tag LOCUS_26790 3705 4472 CDS product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261653.1 protein_id gnl|my_center|LOCUS_26790 4530 5537 gene locus_tag LOCUS_26800 4530 5537 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087694.1 protein_id gnl|my_center|LOCUS_26800 5524 6390 gene locus_tag LOCUS_26810 gene cyoE 5524 6390 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168719.1 protein_id gnl|my_center|LOCUS_26810 7316 6387 gene locus_tag LOCUS_26820 7316 6387 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_26820 8277 7456 gene locus_tag LOCUS_26830 8277 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 9112 8282 gene locus_tag LOCUS_26840 9112 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 10359 9115 gene locus_tag LOCUS_26850 10359 9115 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_26850 13092 10363 gene locus_tag LOCUS_26860 13092 10363 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082363.1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence22 507 1412 gene locus_tag LOCUS_26870 507 1412 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861057.1 protein_id gnl|my_center|LOCUS_26870 2320 1409 gene locus_tag LOCUS_26880 2320 1409 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727141.1 protein_id gnl|my_center|LOCUS_26880 3037 2405 gene locus_tag LOCUS_26890 gene pncA 3037 2405 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444893.1 protein_id gnl|my_center|LOCUS_26890 4457 3048 gene locus_tag LOCUS_26900 4457 3048 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957965.1 protein_id gnl|my_center|LOCUS_26900 6257 4500 gene locus_tag LOCUS_26910 gene mutL 6257 4500 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957996.1 protein_id gnl|my_center|LOCUS_26910 7406 6576 gene locus_tag LOCUS_26920 7406 6576 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927632.1 protein_id gnl|my_center|LOCUS_26920 7415 8272 gene locus_tag LOCUS_26930 7415 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 8719 8264 gene locus_tag LOCUS_26940 8719 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 10319 8754 gene locus_tag LOCUS_26950 10319 8754 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576229.1 protein_id gnl|my_center|LOCUS_26950 11077 10316 gene locus_tag LOCUS_26960 11077 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 11766 11074 gene locus_tag LOCUS_26970 11766 11074 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506979.1 protein_id gnl|my_center|LOCUS_26970 12292 11753 gene locus_tag LOCUS_26980 12292 11753 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067294.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence23 45 1019 gene locus_tag LOCUS_26990 45 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 1023 2891 gene locus_tag LOCUS_27000 1023 2891 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523709.1 protein_id gnl|my_center|LOCUS_27000 2912 3544 gene locus_tag LOCUS_27010 2912 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 3544 4194 gene locus_tag LOCUS_27020 3544 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 4206 5540 gene locus_tag LOCUS_27030 gene thrC 4206 5540 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626010.1 protein_id gnl|my_center|LOCUS_27030 5542 6309 gene locus_tag LOCUS_27040 5542 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 6349 6594 gene locus_tag LOCUS_27050 6349 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 7357 6596 gene locus_tag LOCUS_27060 7357 6596 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657519.1 protein_id gnl|my_center|LOCUS_27060 7999 7364 gene locus_tag LOCUS_27070 7999 7364 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142687.1 protein_id gnl|my_center|LOCUS_27070 8638 8042 gene locus_tag LOCUS_27080 8638 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 9341 8805 gene locus_tag LOCUS_27090 9341 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 10218 9385 gene locus_tag LOCUS_27100 10218 9385 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253693.1 protein_id gnl|my_center|LOCUS_27100 10305 11105 gene locus_tag LOCUS_27110 gene lpxA 10305 11105 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690880.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence24 420 656 gene locus_tag LOCUS_27120 420 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714458.1 protein_id gnl|my_center|LOCUS_27120 1099 692 gene locus_tag LOCUS_27130 1099 692 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_27130 1812 1180 gene locus_tag LOCUS_27140 1812 1180 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024490.1 protein_id gnl|my_center|LOCUS_27140 2650 1844 gene locus_tag LOCUS_27150 2650 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 2744 4363 gene locus_tag LOCUS_27160 2744 4363 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546491.1 protein_id gnl|my_center|LOCUS_27160 4697 6247 gene locus_tag LOCUS_27170 4697 6247 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256091.1 protein_id gnl|my_center|LOCUS_27170 6262 7089 gene locus_tag LOCUS_27180 6262 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256092.1 protein_id gnl|my_center|LOCUS_27180 7237 9519 gene locus_tag LOCUS_27190 7237 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 9610 10302 gene locus_tag LOCUS_27200 9610 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 10299 10721 gene locus_tag LOCUS_27210 10299 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 >Feature sequence25 535 1656 gene locus_tag LOCUS_27220 535 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 2457 1663 gene locus_tag LOCUS_27230 gene trxA 2457 1663 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932886.1 protein_id gnl|my_center|LOCUS_27230 2707 4545 gene locus_tag LOCUS_27240 2707 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 5297 4548 gene locus_tag LOCUS_27250 gene tpiA 5297 4548 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583495.1 protein_id gnl|my_center|LOCUS_27250 5400 6038 gene locus_tag LOCUS_27260 5400 6038 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence26 <1 1197 gene locus_tag LOCUS_27270 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001982425.1:alanine racemase 1201 2166 gene locus_tag LOCUS_27280 1201 2166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_27280 2174 3187 gene locus_tag LOCUS_27290 2174 3187 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809384.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence27 226 669 gene locus_tag LOCUS_27300 226 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 943 1236 gene locus_tag LOCUS_27310 943 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence28 296 1039 gene locus_tag LOCUS_27320 gene cas6 296 1039 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_27320 1222 1395 gene locus_tag LOCUS_27330 1222 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1581 1709 gene locus_tag LOCUS_27340 1581 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340