>Feature sequence01 2231 1284 gene locus_tag LOCUS_00010 gene mdh 2231 1284 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_00010 4621 2354 gene locus_tag LOCUS_00020 4621 2354 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203425.1 protein_id gnl|my_center|LOCUS_00020 6262 4676 gene locus_tag LOCUS_00030 6262 4676 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_00030 7043 6381 gene locus_tag LOCUS_00040 7043 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8545 7040 gene locus_tag LOCUS_00050 8545 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8964 8563 gene locus_tag LOCUS_00060 8964 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10603 8996 gene locus_tag LOCUS_00070 10603 8996 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_00070 12633 10615 gene locus_tag LOCUS_00080 12633 10615 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421608.1 protein_id gnl|my_center|LOCUS_00080 12752 13417 gene locus_tag LOCUS_00090 12752 13417 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_00090 14459 13422 gene locus_tag LOCUS_00100 gene rlmN 14459 13422 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_00100 15402 14452 gene locus_tag LOCUS_00110 gene fmt 15402 14452 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255944.1 protein_id gnl|my_center|LOCUS_00110 15658 15431 gene locus_tag LOCUS_00120 15658 15431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17173 15692 gene locus_tag LOCUS_00130 17173 15692 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144150.1 protein_id gnl|my_center|LOCUS_00130 17213 18244 gene locus_tag LOCUS_00140 17213 18244 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975361.1 protein_id gnl|my_center|LOCUS_00140 18350 19339 gene locus_tag LOCUS_00150 gene akrN 18350 19339 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_00150 19433 20239 gene locus_tag LOCUS_00160 19433 20239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21848 20370 gene locus_tag LOCUS_00170 gene gatB 21848 20370 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_00170 22002 22772 gene locus_tag LOCUS_00180 22002 22772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22927 23538 gene locus_tag LOCUS_00190 22927 23538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23839 24828 gene locus_tag LOCUS_00200 23839 24828 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085331.1 protein_id gnl|my_center|LOCUS_00200 24932 25852 gene locus_tag LOCUS_00210 24932 25852 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205660833.1 protein_id gnl|my_center|LOCUS_00210 26317 25853 gene locus_tag LOCUS_00220 26317 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 28471 26336 gene locus_tag LOCUS_00230 28471 26336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30400 28532 gene locus_tag LOCUS_00240 gene dnaG 30400 28532 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258766.1 protein_id gnl|my_center|LOCUS_00240 32546 30513 gene locus_tag LOCUS_00250 32546 30513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 34936 32645 gene locus_tag LOCUS_00260 gene ppsA 34936 32645 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250243.1 protein_id gnl|my_center|LOCUS_00260 36922 35066 gene locus_tag LOCUS_00270 gene glmS 36922 35066 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256373.1 protein_id gnl|my_center|LOCUS_00270 38358 36937 gene locus_tag LOCUS_00280 38358 36937 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_00280 39265 38390 gene locus_tag LOCUS_00290 gene ispH 39265 38390 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_00290 40089 39262 gene locus_tag LOCUS_00300 40089 39262 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255947.1 protein_id gnl|my_center|LOCUS_00300 40833 40093 gene locus_tag LOCUS_00310 gene cmk 40833 40093 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_00310 41637 40858 gene locus_tag LOCUS_00320 gene rluB 41637 40858 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_00320 43892 41634 gene locus_tag LOCUS_00330 43892 41634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 44265 43981 gene locus_tag LOCUS_00340 44265 43981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 45120 44341 gene locus_tag LOCUS_00350 45120 44341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 45745 45548 gene locus_tag LOCUS_00360 45745 45548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 47075 45738 gene locus_tag LOCUS_00370 gene xseA 47075 45738 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838345.1 protein_id gnl|my_center|LOCUS_00370 47706 47149 gene locus_tag LOCUS_00380 gene efp 47706 47149 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_00380 48907 47795 gene locus_tag LOCUS_00390 48907 47795 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256149.1 protein_id gnl|my_center|LOCUS_00390 48524 48622 gene locus_tag LOCUS_t00010 48524 48622 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 49383 48904 gene locus_tag LOCUS_00400 gene aroQ 49383 48904 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256299.1 protein_id gnl|my_center|LOCUS_00400 50339 49380 gene locus_tag LOCUS_00410 gene xerD 50339 49380 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644441.1 protein_id gnl|my_center|LOCUS_00410 52861 50369 gene locus_tag LOCUS_00420 gene topA 52861 50369 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_00420 53957 52848 gene locus_tag LOCUS_00430 gene dprA 53957 52848 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_00430 55249 53969 gene locus_tag LOCUS_00440 55249 53969 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869813.1 protein_id gnl|my_center|LOCUS_00440 56664 55246 gene locus_tag LOCUS_00450 gene glmU 56664 55246 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_00450 56871 59519 gene locus_tag LOCUS_00460 gene alaS 56871 59519 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_00460 59529 60035 gene locus_tag LOCUS_00470 59529 60035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 60035 61108 gene locus_tag LOCUS_00480 gene mltG 60035 61108 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_00480 61105 61965 gene locus_tag LOCUS_00490 61105 61965 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_00490 61962 62636 gene locus_tag LOCUS_00500 61962 62636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 62629 63828 gene locus_tag LOCUS_00510 gene aroC 62629 63828 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768335.1 protein_id gnl|my_center|LOCUS_00510 63825 65570 gene locus_tag LOCUS_00520 63825 65570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 67204 65879 gene locus_tag LOCUS_00530 67204 65879 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244857.1 protein_id gnl|my_center|LOCUS_00530 68511 67237 gene locus_tag LOCUS_00540 68511 67237 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812683.1 protein_id gnl|my_center|LOCUS_00540 68831 68583 gene locus_tag LOCUS_00550 68831 68583 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728315.1 protein_id gnl|my_center|LOCUS_00550 68979 69986 gene locus_tag LOCUS_00560 gene pheS 68979 69986 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211832.1 protein_id gnl|my_center|LOCUS_00560 69986 72397 gene locus_tag LOCUS_00570 gene pheT 69986 72397 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_00570 72524 73039 gene locus_tag LOCUS_00580 72524 73039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 73486 73130 gene locus_tag LOCUS_00590 gene rplT 73486 73130 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256290.1 protein_id gnl|my_center|LOCUS_00590 73719 73513 gene locus_tag LOCUS_00600 gene rpmI 73719 73513 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_00600 74486 73851 gene locus_tag LOCUS_00610 gene infC 74486 73851 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_00610 75080 74565 gene locus_tag LOCUS_00620 75080 74565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 76621 75059 gene locus_tag LOCUS_00630 76621 75059 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877513.1 protein_id gnl|my_center|LOCUS_00630 78567 76729 gene locus_tag LOCUS_00640 gene thrS 78567 76729 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257081.1 protein_id gnl|my_center|LOCUS_00640 78714 78638 gene locus_tag LOCUS_t00020 78714 78638 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 79057 79132 gene locus_tag LOCUS_t00030 79057 79132 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 79216 79300 gene locus_tag LOCUS_t00040 79216 79300 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 79376 80422 gene locus_tag LOCUS_00650 79376 80422 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_00650 80415 81629 gene locus_tag LOCUS_00660 80415 81629 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_00660 81841 81626 gene locus_tag LOCUS_00670 81841 81626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 81729 83588 gene locus_tag LOCUS_00680 gene lepA 81729 83588 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_00680 84998 83595 gene locus_tag LOCUS_00690 84998 83595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 85408 86250 gene locus_tag LOCUS_00700 gene rsmA 85408 86250 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256787.1 protein_id gnl|my_center|LOCUS_00700 86247 87179 gene locus_tag LOCUS_00710 gene ispE 86247 87179 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_00710 87182 87601 gene locus_tag LOCUS_00720 87182 87601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 87685 88416 gene locus_tag LOCUS_00730 87685 88416 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048417.1 protein_id gnl|my_center|LOCUS_00730 88864 91617 gene locus_tag LOCUS_00740 88864 91617 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_00740 91614 92165 gene locus_tag LOCUS_00750 91614 92165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 92169 92588 gene locus_tag LOCUS_00760 92169 92588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 92803 92585 gene locus_tag LOCUS_00770 92803 92585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 93197 92883 gene locus_tag LOCUS_00780 93197 92883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 94483 93194 gene locus_tag LOCUS_00790 94483 93194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 94563 95276 gene locus_tag LOCUS_00800 gene rnc 94563 95276 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704749.1 protein_id gnl|my_center|LOCUS_00800 95276 98602 gene locus_tag LOCUS_00810 gene smc 95276 98602 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728333.1 protein_id gnl|my_center|LOCUS_00810 98788 99324 gene locus_tag LOCUS_00820 98788 99324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 99324 100304 gene locus_tag LOCUS_00830 gene ftsY 99324 100304 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081293.1 protein_id gnl|my_center|LOCUS_00830 100331 101401 gene locus_tag LOCUS_00840 100331 101401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 101792 101466 gene locus_tag LOCUS_00850 101792 101466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 102378 101779 gene locus_tag LOCUS_00860 102378 101779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 102413 103645 gene locus_tag LOCUS_00870 gene dinB 102413 103645 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_00870 103642 104328 gene locus_tag LOCUS_00880 103642 104328 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226459.1 protein_id gnl|my_center|LOCUS_00880 104351 104737 gene locus_tag LOCUS_00890 104351 104737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 104760 105134 gene locus_tag LOCUS_00900 104760 105134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 105709 105131 gene locus_tag LOCUS_00910 105709 105131 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_00910 106533 105706 gene locus_tag LOCUS_00920 106533 105706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 106621 107052 gene locus_tag LOCUS_00930 106621 107052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 107201 107422 gene locus_tag LOCUS_00940 107201 107422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 108349 107441 gene locus_tag LOCUS_00950 108349 107441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 108420 108794 gene locus_tag LOCUS_00960 108420 108794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 108978 110135 gene locus_tag LOCUS_00970 108978 110135 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391942.1 protein_id gnl|my_center|LOCUS_00970 111076 110132 gene locus_tag LOCUS_00980 111076 110132 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383456.1 protein_id gnl|my_center|LOCUS_00980 111155 111937 gene locus_tag LOCUS_00990 111155 111937 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091316930.1 protein_id gnl|my_center|LOCUS_00990 113362 111956 gene locus_tag LOCUS_01000 113362 111956 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009982187.1 protein_id gnl|my_center|LOCUS_01000 113859 113503 gene locus_tag LOCUS_01010 113859 113503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 114430 113852 gene locus_tag LOCUS_01020 114430 113852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 115763 114786 gene locus_tag LOCUS_01030 115763 114786 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927122.1 protein_id gnl|my_center|LOCUS_01030 117056 115770 gene locus_tag LOCUS_01040 117056 115770 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_01040 117221 118093 gene locus_tag LOCUS_01050 117221 118093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 119000 118110 gene locus_tag LOCUS_01060 gene lipA 119000 118110 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_01060 119518 118997 gene locus_tag LOCUS_01070 119518 118997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 119420 119704 gene locus_tag LOCUS_01080 119420 119704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 119802 122498 gene locus_tag LOCUS_01090 gene aceE 119802 122498 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_01090 122508 123908 gene locus_tag LOCUS_01100 122508 123908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 123912 125345 gene locus_tag LOCUS_01110 gene lpdA 123912 125345 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_01110 125370 126245 gene locus_tag LOCUS_01120 gene folP 125370 126245 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_01120 126286 126486 gene locus_tag LOCUS_01130 126286 126486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 126511 127614 gene locus_tag LOCUS_01140 126511 127614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 127992 127663 gene locus_tag LOCUS_01150 127992 127663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 128094 129773 gene locus_tag LOCUS_01160 128094 129773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 129834 130115 gene locus_tag LOCUS_01170 129834 130115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 130137 130364 gene locus_tag LOCUS_01180 130137 130364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 130493 131602 gene locus_tag LOCUS_01190 130493 131602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_01190 131609 132700 gene locus_tag LOCUS_01200 131609 132700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_01200 132697 133329 gene locus_tag LOCUS_01210 132697 133329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 133326 134711 gene locus_tag LOCUS_01220 133326 134711 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230206.1 protein_id gnl|my_center|LOCUS_01220 135043 135654 gene locus_tag LOCUS_01230 135043 135654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 135904 137070 gene locus_tag LOCUS_01240 135904 137070 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064823.1 protein_id gnl|my_center|LOCUS_01240 137859 137167 gene locus_tag LOCUS_01250 gene cofC 137859 137167 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496647.1 protein_id gnl|my_center|LOCUS_01250 138790 137849 gene locus_tag LOCUS_01260 gene cofD 138790 137849 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_01260 139116 138787 gene locus_tag LOCUS_01270 139116 138787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 139190 139783 gene locus_tag LOCUS_01280 139190 139783 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_01280 139807 140466 gene locus_tag LOCUS_01290 139807 140466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 140463 141020 gene locus_tag LOCUS_01300 140463 141020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 141078 141815 gene locus_tag LOCUS_01310 141078 141815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 144704 141828 gene locus_tag LOCUS_01320 144704 141828 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_01320 145062 146123 gene locus_tag LOCUS_01330 145062 146123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_01330 147165 146155 gene locus_tag LOCUS_01340 147165 146155 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_01340 148061 147162 gene locus_tag LOCUS_01350 148061 147162 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_01350 148895 148110 gene locus_tag LOCUS_01360 148895 148110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 149023 149193 gene locus_tag LOCUS_01370 149023 149193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 149710 150516 gene locus_tag LOCUS_01380 gene cobB1 149710 150516 CDS product NAD-dependent protein deacylase Cob1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879172.1 protein_id gnl|my_center|LOCUS_01380 150547 151872 gene locus_tag LOCUS_01390 150547 151872 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104117.1 protein_id gnl|my_center|LOCUS_01390 151922 152734 gene locus_tag LOCUS_01400 gene fabL 151922 152734 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723876.1 protein_id gnl|my_center|LOCUS_01400 152820 154010 gene locus_tag LOCUS_01410 152820 154010 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_01410 154023 154427 gene locus_tag LOCUS_01420 154023 154427 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467030.1 protein_id gnl|my_center|LOCUS_01420 154443 155699 gene locus_tag LOCUS_01430 154443 155699 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 protein_id gnl|my_center|LOCUS_01430 155702 156943 gene locus_tag LOCUS_01440 155702 156943 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812500.1 protein_id gnl|my_center|LOCUS_01440 156940 157737 gene locus_tag LOCUS_01450 156940 157737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 157734 158306 gene locus_tag LOCUS_01460 157734 158306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 158331 159767 gene locus_tag LOCUS_01470 158331 159767 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064211.1 protein_id gnl|my_center|LOCUS_01470 159764 160390 gene locus_tag LOCUS_01480 159764 160390 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731411.1 protein_id gnl|my_center|LOCUS_01480 160856 161503 gene locus_tag LOCUS_01490 160856 161503 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_01490 161515 162447 gene locus_tag LOCUS_01500 161515 162447 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173616194.1 protein_id gnl|my_center|LOCUS_01500 162501 163412 gene locus_tag LOCUS_01510 162501 163412 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173543.1 protein_id gnl|my_center|LOCUS_01510 165028 163505 gene locus_tag LOCUS_01520 165028 163505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 >Feature sequence02 1148 261 gene locus_tag LOCUS_01530 1148 261 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_01530 1193 1474 gene locus_tag LOCUS_01540 1193 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 1486 1683 gene locus_tag LOCUS_01550 1486 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 3038 2223 gene locus_tag LOCUS_01560 3038 2223 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_01560 3152 3814 gene locus_tag LOCUS_01570 3152 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 3829 4356 gene locus_tag LOCUS_01580 3829 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 4353 5327 gene locus_tag LOCUS_01590 4353 5327 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_01590 5614 5324 gene locus_tag LOCUS_01600 5614 5324 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528817.1 protein_id gnl|my_center|LOCUS_01600 5664 6092 gene locus_tag LOCUS_01610 5664 6092 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_01610 6885 6094 gene locus_tag LOCUS_01620 6885 6094 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 protein_id gnl|my_center|LOCUS_01620 7696 6899 gene locus_tag LOCUS_01630 7696 6899 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 protein_id gnl|my_center|LOCUS_01630 8590 7784 gene locus_tag LOCUS_01640 8590 7784 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_01640 9048 9299 gene locus_tag LOCUS_01650 9048 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 10448 9204 gene locus_tag LOCUS_01660 10448 9204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01660 11690 10449 gene locus_tag LOCUS_01670 11690 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01670 12821 11751 gene locus_tag LOCUS_01680 12821 11751 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_01680 12825 13493 gene locus_tag LOCUS_01690 12825 13493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 13463 13612 gene locus_tag LOCUS_01700 13463 13612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 14050 13670 gene locus_tag LOCUS_01710 14050 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01710 14335 14105 gene locus_tag LOCUS_01720 14335 14105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 14739 14338 gene locus_tag LOCUS_01730 14739 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 15273 14779 gene locus_tag LOCUS_01740 15273 14779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 15696 15277 gene locus_tag LOCUS_01750 15696 15277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 16287 15748 gene locus_tag LOCUS_01760 16287 15748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 16700 16287 gene locus_tag LOCUS_01770 16700 16287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01770 17042 16743 gene locus_tag LOCUS_01780 17042 16743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 17494 17090 gene locus_tag LOCUS_01790 17494 17090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01790 17881 17531 gene locus_tag LOCUS_01800 17881 17531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 18014 18646 gene locus_tag LOCUS_01810 18014 18646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 20346 18658 gene locus_tag LOCUS_01820 20346 18658 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742099.1 protein_id gnl|my_center|LOCUS_01820 20426 21805 gene locus_tag LOCUS_01830 20426 21805 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_01830 22702 22007 gene locus_tag LOCUS_01840 22702 22007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 22947 22699 gene locus_tag LOCUS_01850 22947 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 23256 23014 gene locus_tag LOCUS_01860 23256 23014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 23609 23259 gene locus_tag LOCUS_01870 23609 23259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 23970 23653 gene locus_tag LOCUS_01880 23970 23653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 24855 23974 gene locus_tag LOCUS_01890 24855 23974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 25347 24922 gene locus_tag LOCUS_01900 25347 24922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 26001 25633 gene locus_tag LOCUS_01910 26001 25633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 25882 28248 gene locus_tag LOCUS_01920 25882 28248 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_01920 28763 28245 gene locus_tag LOCUS_01930 28763 28245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 30228 28885 gene locus_tag LOCUS_01940 30228 28885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01940 31441 30221 gene locus_tag LOCUS_01950 31441 30221 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051056494.1 protein_id gnl|my_center|LOCUS_01950 31385 31789 gene locus_tag LOCUS_01960 31385 31789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 31850 32062 gene locus_tag LOCUS_01970 31850 32062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 33448 32072 gene locus_tag LOCUS_01980 33448 32072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 33692 33435 gene locus_tag LOCUS_01990 33692 33435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 35338 33920 gene locus_tag LOCUS_02000 35338 33920 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113311.1 protein_id gnl|my_center|LOCUS_02000 35457 36044 gene locus_tag LOCUS_02010 35457 36044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 36866 36045 gene locus_tag LOCUS_02020 36866 36045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 37692 36877 gene locus_tag LOCUS_02030 37692 36877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 38355 37711 gene locus_tag LOCUS_02040 38355 37711 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_02040 39541 38399 gene locus_tag LOCUS_02050 39541 38399 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 protein_id gnl|my_center|LOCUS_02050 39431 39658 gene locus_tag LOCUS_02060 39431 39658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 39822 41492 gene locus_tag LOCUS_02070 39822 41492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484458.1 protein_id gnl|my_center|LOCUS_02070 41947 41741 gene locus_tag LOCUS_02080 41947 41741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 42070 44592 gene locus_tag LOCUS_02090 42070 44592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 44922 45236 gene locus_tag LOCUS_02100 44922 45236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 46561 45323 gene locus_tag LOCUS_02110 gene lhgO 46561 45323 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122600.1 protein_id gnl|my_center|LOCUS_02110 47564 46554 gene locus_tag LOCUS_02120 gene selD 47564 46554 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301201.1 protein_id gnl|my_center|LOCUS_02120 47782 48309 gene locus_tag LOCUS_02130 47782 48309 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929781.1 protein_id gnl|my_center|LOCUS_02130 48309 48695 gene locus_tag LOCUS_02140 48309 48695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 49015 49254 gene locus_tag LOCUS_02150 49015 49254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 50060 49251 gene locus_tag LOCUS_02160 50060 49251 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_02160 50670 50053 gene locus_tag LOCUS_02170 50670 50053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 51478 50714 gene locus_tag LOCUS_02180 51478 50714 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727392.1 protein_id gnl|my_center|LOCUS_02180 52829 51786 gene locus_tag LOCUS_02190 52829 51786 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531254.1 protein_id gnl|my_center|LOCUS_02190 53315 52926 gene locus_tag LOCUS_02200 53315 52926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 54186 53401 gene locus_tag LOCUS_02210 54186 53401 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_02210 54272 55009 gene locus_tag LOCUS_02220 54272 55009 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_02220 55069 55953 gene locus_tag LOCUS_02230 55069 55953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 57994 56036 gene locus_tag LOCUS_02240 gene fusA 57994 56036 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_02240 59810 58101 gene locus_tag LOCUS_02250 gene recJ 59810 58101 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_02250 61070 59829 gene locus_tag LOCUS_02260 gene fabF 61070 59829 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_02260 61617 61222 gene locus_tag LOCUS_02270 61617 61222 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877672.1 protein_id gnl|my_center|LOCUS_02270 61995 61669 gene locus_tag LOCUS_02280 61995 61669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 62655 62017 gene locus_tag LOCUS_02290 62655 62017 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_02290 64386 62701 gene locus_tag LOCUS_02300 64386 62701 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_02300 64784 64398 gene locus_tag LOCUS_02310 64784 64398 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817437.1 protein_id gnl|my_center|LOCUS_02310 64859 65755 gene locus_tag LOCUS_02320 gene folD 64859 65755 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_02320 67400 65880 gene locus_tag LOCUS_02330 67400 65880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 68407 67397 gene locus_tag LOCUS_02340 gene prfB 68407 67397 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_02340 69493 68627 gene locus_tag LOCUS_02350 69493 68627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 70485 69547 gene locus_tag LOCUS_02360 70485 69547 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256486.1 protein_id gnl|my_center|LOCUS_02360 70649 70870 gene locus_tag LOCUS_02370 70649 70870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 71786 70977 gene locus_tag LOCUS_02380 gene hisN 71786 70977 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_02380 72029 73132 gene locus_tag LOCUS_02390 72029 73132 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_02390 73199 74059 gene locus_tag LOCUS_02400 73199 74059 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227145.1 protein_id gnl|my_center|LOCUS_02400 74072 75004 gene locus_tag LOCUS_02410 74072 75004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 75001 75762 gene locus_tag LOCUS_02420 75001 75762 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258853.1 protein_id gnl|my_center|LOCUS_02420 75759 76802 gene locus_tag LOCUS_02430 gene pimA 75759 76802 CDS product phosphatidyl-myo-inositol alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728703.1 protein_id gnl|my_center|LOCUS_02430 76818 77711 gene locus_tag LOCUS_02440 76818 77711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 77778 78443 gene locus_tag LOCUS_02450 gene pgsA1 77778 78443 CDS product phosphatidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413482.1 protein_id gnl|my_center|LOCUS_02450 79147 78512 gene locus_tag LOCUS_02460 79147 78512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 79542 79303 gene locus_tag LOCUS_02470 79542 79303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 79634 80536 gene locus_tag LOCUS_02480 79634 80536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 80775 80533 gene locus_tag LOCUS_02490 80775 80533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 81186 80893 gene locus_tag LOCUS_02500 81186 80893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 82895 81252 gene locus_tag LOCUS_02510 82895 81252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 83849 82896 gene locus_tag LOCUS_02520 83849 82896 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900835.1 protein_id gnl|my_center|LOCUS_02520 83960 85183 gene locus_tag LOCUS_02530 83960 85183 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 protein_id gnl|my_center|LOCUS_02530 85610 85197 gene locus_tag LOCUS_02540 85610 85197 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067458002.1 protein_id gnl|my_center|LOCUS_02540 85964 85617 gene locus_tag LOCUS_02550 85964 85617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 86236 87372 gene locus_tag LOCUS_02560 86236 87372 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224431.1 protein_id gnl|my_center|LOCUS_02560 87460 87987 gene locus_tag LOCUS_02570 87460 87987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 87989 88273 gene locus_tag LOCUS_02580 87989 88273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 89019 88270 gene locus_tag LOCUS_02590 89019 88270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 89707 89027 gene locus_tag LOCUS_02600 89707 89027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 90684 89707 gene locus_tag LOCUS_02610 90684 89707 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_02610 90769 91200 gene locus_tag LOCUS_02620 90769 91200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 91632 91207 gene locus_tag LOCUS_02630 91632 91207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 92229 91651 gene locus_tag LOCUS_02640 92229 91651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 92732 92256 gene locus_tag LOCUS_02650 92732 92256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 93216 92743 gene locus_tag LOCUS_02660 93216 92743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 93881 93213 gene locus_tag LOCUS_02670 93881 93213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 94551 93886 gene locus_tag LOCUS_02680 94551 93886 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_02680 95137 94559 gene locus_tag LOCUS_02690 95137 94559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 95521 95177 gene locus_tag LOCUS_02700 95521 95177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 96451 95723 gene locus_tag LOCUS_02710 96451 95723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 96583 96846 gene locus_tag LOCUS_02720 96583 96846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 96908 97201 gene locus_tag LOCUS_02730 96908 97201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 97449 99431 gene locus_tag LOCUS_02740 gene acs 97449 99431 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_02740 100317 99496 gene locus_tag LOCUS_02750 100317 99496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 101183 100308 gene locus_tag LOCUS_02760 101183 100308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 101587 101408 gene locus_tag LOCUS_02770 101587 101408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 101864 101646 gene locus_tag LOCUS_02780 101864 101646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 102144 102839 gene locus_tag LOCUS_02790 102144 102839 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867475.1 protein_id gnl|my_center|LOCUS_02790 102995 104407 gene locus_tag LOCUS_02800 102995 104407 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249895.1 protein_id gnl|my_center|LOCUS_02800 104670 106259 gene locus_tag LOCUS_02810 104670 106259 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113365.1 protein_id gnl|my_center|LOCUS_02810 106325 106978 gene locus_tag LOCUS_02820 gene pth 106325 106978 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_02820 107051 110560 gene locus_tag LOCUS_02830 gene mfd 107051 110560 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_02830 110573 111286 gene locus_tag LOCUS_02840 110573 111286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02840 111345 111947 gene locus_tag LOCUS_02850 111345 111947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02850 111944 112654 gene locus_tag LOCUS_02860 111944 112654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 112679 113134 gene locus_tag LOCUS_02870 112679 113134 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_02870 113415 113152 gene locus_tag LOCUS_02880 113415 113152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 113534 113610 gene locus_tag LOCUS_t00050 113534 113610 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 113640 114191 gene locus_tag LOCUS_02890 113640 114191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 114211 114939 gene locus_tag LOCUS_02900 114211 114939 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972574.1 protein_id gnl|my_center|LOCUS_02900 117285 114997 gene locus_tag LOCUS_02910 117285 114997 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_02910 118665 117790 gene locus_tag LOCUS_02920 118665 117790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 118862 119206 gene locus_tag LOCUS_02930 118862 119206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 119481 119203 gene locus_tag LOCUS_02940 119481 119203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 120341 119505 gene locus_tag LOCUS_02950 120341 119505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 123826 120434 gene locus_tag LOCUS_02960 123826 120434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 123995 125167 gene locus_tag LOCUS_02970 123995 125167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 125217 126371 gene locus_tag LOCUS_02980 125217 126371 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230094.1 protein_id gnl|my_center|LOCUS_02980 126406 126783 gene locus_tag LOCUS_02990 126406 126783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 127458 126793 gene locus_tag LOCUS_03000 127458 126793 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125812.1 protein_id gnl|my_center|LOCUS_03000 128959 127490 gene locus_tag LOCUS_03010 128959 127490 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846143.1 protein_id gnl|my_center|LOCUS_03010 129123 130199 gene locus_tag LOCUS_03020 129123 130199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 130411 133011 gene locus_tag LOCUS_03030 130411 133011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 133761 132892 gene locus_tag LOCUS_03040 gene hisG 133761 132892 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_03040 133860 135035 gene locus_tag LOCUS_03050 133860 135035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 136311 135049 gene locus_tag LOCUS_03060 136311 135049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 139147 136523 gene locus_tag LOCUS_03070 gene fdhF 139147 136523 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726709.1 protein_id gnl|my_center|LOCUS_03070 >Feature sequence03 1220 273 gene locus_tag LOCUS_03080 1220 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2918 1284 gene locus_tag LOCUS_03090 2918 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 3051 3839 gene locus_tag LOCUS_03100 3051 3839 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_03100 3875 4672 gene locus_tag LOCUS_03110 3875 4672 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_03110 5898 4669 gene locus_tag LOCUS_03120 5898 4669 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530831.1 protein_id gnl|my_center|LOCUS_03120 5986 7131 gene locus_tag LOCUS_03130 5986 7131 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966126.1 protein_id gnl|my_center|LOCUS_03130 8106 7135 gene locus_tag LOCUS_03140 8106 7135 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_03140 9293 8208 gene locus_tag LOCUS_03150 9293 8208 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_03150 12117 9859 gene locus_tag LOCUS_03160 12117 9859 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_03160 12285 14135 gene locus_tag LOCUS_03170 12285 14135 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_03170 14180 15106 gene locus_tag LOCUS_03180 14180 15106 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385604.1 protein_id gnl|my_center|LOCUS_03180 15103 16026 gene locus_tag LOCUS_03190 15103 16026 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328129.1 protein_id gnl|my_center|LOCUS_03190 16506 16243 gene locus_tag LOCUS_03200 16506 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 16423 18135 gene locus_tag LOCUS_03210 16423 18135 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969959.1 protein_id gnl|my_center|LOCUS_03210 18216 19151 gene locus_tag LOCUS_03220 18216 19151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385604.1 protein_id gnl|my_center|LOCUS_03220 19155 20060 gene locus_tag LOCUS_03230 19155 20060 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538206.1 protein_id gnl|my_center|LOCUS_03230 20088 21650 gene locus_tag LOCUS_03240 20088 21650 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_03240 22891 21656 gene locus_tag LOCUS_03250 22891 21656 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205107.1 protein_id gnl|my_center|LOCUS_03250 23119 22961 gene locus_tag LOCUS_03260 23119 22961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 23084 25381 gene locus_tag LOCUS_03270 23084 25381 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_03270 25410 26372 gene locus_tag LOCUS_03280 25410 26372 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_03280 26411 27463 gene locus_tag LOCUS_03290 26411 27463 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729463.1 protein_id gnl|my_center|LOCUS_03290 29976 27460 gene locus_tag LOCUS_03300 29976 27460 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_03300 30749 29976 gene locus_tag LOCUS_03310 30749 29976 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807972.1 protein_id gnl|my_center|LOCUS_03310 30848 31702 gene locus_tag LOCUS_03320 30848 31702 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088449.1 protein_id gnl|my_center|LOCUS_03320 31914 33323 gene locus_tag LOCUS_03330 31914 33323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 33370 34527 gene locus_tag LOCUS_03340 33370 34527 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_03340 34667 35683 gene locus_tag LOCUS_03350 34667 35683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 35695 36684 gene locus_tag LOCUS_03360 35695 36684 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223398.1 protein_id gnl|my_center|LOCUS_03360 36697 37164 gene locus_tag LOCUS_03370 36697 37164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 37219 37512 gene locus_tag LOCUS_03380 37219 37512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 38225 37554 gene locus_tag LOCUS_03390 38225 37554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 38293 39984 gene locus_tag LOCUS_03400 38293 39984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 40407 40174 gene locus_tag LOCUS_03410 40407 40174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 40333 42054 gene locus_tag LOCUS_03420 40333 42054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 42142 43107 gene locus_tag LOCUS_03430 42142 43107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383546.1 protein_id gnl|my_center|LOCUS_03430 43110 44012 gene locus_tag LOCUS_03440 43110 44012 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_03440 44070 44873 gene locus_tag LOCUS_03450 44070 44873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 44987 46006 gene locus_tag LOCUS_03460 44987 46006 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_03460 46159 47169 gene locus_tag LOCUS_03470 46159 47169 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521382.1 protein_id gnl|my_center|LOCUS_03470 47390 48643 gene locus_tag LOCUS_03480 47390 48643 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113133.1 protein_id gnl|my_center|LOCUS_03480 48918 48694 gene locus_tag LOCUS_03490 48918 48694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 48802 49473 gene locus_tag LOCUS_03500 48802 49473 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_03500 50770 49463 gene locus_tag LOCUS_03510 50770 49463 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123282.1 protein_id gnl|my_center|LOCUS_03510 50896 51195 gene locus_tag LOCUS_03520 50896 51195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 51283 51597 gene locus_tag LOCUS_03530 51283 51597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 51769 53379 gene locus_tag LOCUS_03540 gene groL 51769 53379 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_03540 53588 53376 gene locus_tag LOCUS_03550 53588 53376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 53978 53691 gene locus_tag LOCUS_03560 53978 53691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 53880 54782 gene locus_tag LOCUS_03570 53880 54782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 54821 56311 gene locus_tag LOCUS_03580 gene pyk 54821 56311 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_03580 56362 56748 gene locus_tag LOCUS_03590 56362 56748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 57821 56745 gene locus_tag LOCUS_03600 57821 56745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391617.1 protein_id gnl|my_center|LOCUS_03600 58516 57818 gene locus_tag LOCUS_03610 58516 57818 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_03610 59432 58545 gene locus_tag LOCUS_03620 59432 58545 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_03620 60764 59460 gene locus_tag LOCUS_03630 60764 59460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 61687 60764 gene locus_tag LOCUS_03640 gene cysD 61687 60764 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466878.1 protein_id gnl|my_center|LOCUS_03640 61869 62687 gene locus_tag LOCUS_03650 61869 62687 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529020.1 protein_id gnl|my_center|LOCUS_03650 64207 62684 gene locus_tag LOCUS_03660 64207 62684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 64197 64754 gene locus_tag LOCUS_03670 64197 64754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 64802 65275 gene locus_tag LOCUS_03680 gene bcp 64802 65275 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_03680 65310 67730 gene locus_tag LOCUS_03690 65310 67730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 67822 68376 gene locus_tag LOCUS_03700 gene orn 67822 68376 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402903.1 protein_id gnl|my_center|LOCUS_03700 69401 68373 gene locus_tag LOCUS_03710 69401 68373 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888911.1 protein_id gnl|my_center|LOCUS_03710 69483 70379 gene locus_tag LOCUS_03720 69483 70379 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727421.1 protein_id gnl|my_center|LOCUS_03720 70966 70376 gene locus_tag LOCUS_03730 70966 70376 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459507.1 protein_id gnl|my_center|LOCUS_03730 71829 70963 gene locus_tag LOCUS_03740 71829 70963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 71828 72712 gene locus_tag LOCUS_03750 gene parJ 71828 72712 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_03750 72791 73078 gene locus_tag LOCUS_03760 72791 73078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 73318 73620 gene locus_tag LOCUS_03770 gene rpsN 73318 73620 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057663.1 protein_id gnl|my_center|LOCUS_03770 73833 75197 gene locus_tag LOCUS_03780 73833 75197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 75371 76978 gene locus_tag LOCUS_03790 75371 76978 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141015.1 protein_id gnl|my_center|LOCUS_03790 76962 78071 gene locus_tag LOCUS_03800 76962 78071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799101.1 protein_id gnl|my_center|LOCUS_03800 78144 79121 gene locus_tag LOCUS_03810 78144 79121 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259143.1 protein_id gnl|my_center|LOCUS_03810 79133 79660 gene locus_tag LOCUS_03820 79133 79660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 79688 80686 gene locus_tag LOCUS_03830 79688 80686 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_03830 80776 81864 gene locus_tag LOCUS_03840 80776 81864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 81875 82963 gene locus_tag LOCUS_03850 81875 82963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 83012 83650 gene locus_tag LOCUS_03860 83012 83650 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 protein_id gnl|my_center|LOCUS_03860 84167 83634 gene locus_tag LOCUS_03870 84167 83634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 84268 85569 gene locus_tag LOCUS_03880 84268 85569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 87559 85622 gene locus_tag LOCUS_03890 87559 85622 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 protein_id gnl|my_center|LOCUS_03890 88410 89177 gene locus_tag LOCUS_03900 88410 89177 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_03900 89310 90500 gene locus_tag LOCUS_03910 89310 90500 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_03910 90500 92824 gene locus_tag LOCUS_03920 90500 92824 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173320.1 protein_id gnl|my_center|LOCUS_03920 93862 92831 gene locus_tag LOCUS_03930 93862 92831 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879191.1 protein_id gnl|my_center|LOCUS_03930 94354 93890 gene locus_tag LOCUS_03940 94354 93890 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086609.1 protein_id gnl|my_center|LOCUS_03940 94899 94351 gene locus_tag LOCUS_03950 94899 94351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 94990 95214 gene locus_tag LOCUS_03960 94990 95214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 96071 95211 gene locus_tag LOCUS_03970 96071 95211 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_03970 96154 97446 gene locus_tag LOCUS_03980 96154 97446 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_03980 97842 99143 gene locus_tag LOCUS_03990 97842 99143 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705167.1 protein_id gnl|my_center|LOCUS_03990 99152 100453 gene locus_tag LOCUS_04000 99152 100453 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127088920.1 protein_id gnl|my_center|LOCUS_04000 100956 100459 gene locus_tag LOCUS_04010 100956 100459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 101047 102219 gene locus_tag LOCUS_04020 101047 102219 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529745.1 protein_id gnl|my_center|LOCUS_04020 102280 102477 gene locus_tag LOCUS_04030 102280 102477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 102478 102753 gene locus_tag LOCUS_04040 102478 102753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 102992 102750 gene locus_tag LOCUS_04050 102992 102750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 103015 103767 gene locus_tag LOCUS_04060 103015 103767 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_04060 104708 103764 gene locus_tag LOCUS_04070 104708 103764 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212337777.1 protein_id gnl|my_center|LOCUS_04070 104831 106495 gene locus_tag LOCUS_04080 104831 106495 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_04080 106502 109039 gene locus_tag LOCUS_04090 106502 109039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 109452 109036 gene locus_tag LOCUS_04100 109452 109036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 109938 109540 gene locus_tag LOCUS_04110 109938 109540 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171561.1 protein_id gnl|my_center|LOCUS_04110 110038 110670 gene locus_tag LOCUS_04120 110038 110670 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393334.1 protein_id gnl|my_center|LOCUS_04120 111926 110817 gene locus_tag LOCUS_04130 111926 110817 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728652.1 protein_id gnl|my_center|LOCUS_04130 112906 112001 gene locus_tag LOCUS_04140 112906 112001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_04140 113819 112869 gene locus_tag LOCUS_04150 113819 112869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095722.1 protein_id gnl|my_center|LOCUS_04150 115770 113884 gene locus_tag LOCUS_04160 115770 113884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 116989 116072 gene locus_tag LOCUS_04170 gene thpD 116989 116072 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 protein_id gnl|my_center|LOCUS_04170 117208 117549 gene locus_tag LOCUS_04180 117208 117549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 117697 119277 gene locus_tag LOCUS_04190 gene ggt 117697 119277 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 protein_id gnl|my_center|LOCUS_04190 119585 119274 gene locus_tag LOCUS_04200 119585 119274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 123192 119599 gene locus_tag LOCUS_04210 123192 119599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 123357 124754 gene locus_tag LOCUS_04220 123357 124754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 125711 124791 gene locus_tag LOCUS_04230 125711 124791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 125838 126743 gene locus_tag LOCUS_04240 125838 126743 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence04 231 920 gene locus_tag LOCUS_04250 gene phoU 231 920 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382997.1 protein_id gnl|my_center|LOCUS_04250 1007 1579 gene locus_tag LOCUS_04260 1007 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2180 2575 gene locus_tag LOCUS_04270 2180 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 2832 3779 gene locus_tag LOCUS_04280 2832 3779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_04280 3776 4885 gene locus_tag LOCUS_04290 3776 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 5666 4896 gene locus_tag LOCUS_04300 5666 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 6775 5693 gene locus_tag LOCUS_04310 gene ltaE 6775 5693 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_04310 7215 6772 gene locus_tag LOCUS_04320 7215 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 7513 7223 gene locus_tag LOCUS_04330 7513 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 7841 7530 gene locus_tag LOCUS_04340 7841 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 8535 7912 gene locus_tag LOCUS_04350 8535 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 8570 9328 gene locus_tag LOCUS_04360 gene yqeC 8570 9328 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_04360 10703 9390 gene locus_tag LOCUS_04370 10703 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 11136 12176 gene locus_tag LOCUS_04380 11136 12176 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115886.1 protein_id gnl|my_center|LOCUS_04380 13444 12173 gene locus_tag LOCUS_04390 13444 12173 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_04390 13592 15370 gene locus_tag LOCUS_04400 13592 15370 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909408.1 protein_id gnl|my_center|LOCUS_04400 15784 15377 gene locus_tag LOCUS_04410 15784 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 15892 16773 gene locus_tag LOCUS_04420 15892 16773 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946909.1 protein_id gnl|my_center|LOCUS_04420 16862 17758 gene locus_tag LOCUS_04430 16862 17758 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_04430 18136 17774 gene locus_tag LOCUS_04440 18136 17774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 18326 19942 gene locus_tag LOCUS_04450 18326 19942 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529813.1 protein_id gnl|my_center|LOCUS_04450 21081 19951 gene locus_tag LOCUS_04460 21081 19951 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897322.1 protein_id gnl|my_center|LOCUS_04460 22109 21078 gene locus_tag LOCUS_04470 22109 21078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 22449 22156 gene locus_tag LOCUS_04480 22449 22156 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_04480 24261 22522 gene locus_tag LOCUS_04490 24261 22522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 24457 26064 gene locus_tag LOCUS_04500 24457 26064 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114225.1 protein_id gnl|my_center|LOCUS_04500 26528 26061 gene locus_tag LOCUS_04510 26528 26061 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525695.1 protein_id gnl|my_center|LOCUS_04510 26580 27281 gene locus_tag LOCUS_04520 26580 27281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 27306 27734 gene locus_tag LOCUS_04530 27306 27734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 28401 27739 gene locus_tag LOCUS_04540 28401 27739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 28770 29987 gene locus_tag LOCUS_04550 28770 29987 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_04550 30004 30891 gene locus_tag LOCUS_04560 30004 30891 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411868.1 protein_id gnl|my_center|LOCUS_04560 30954 31433 gene locus_tag LOCUS_04570 30954 31433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 32639 31440 gene locus_tag LOCUS_04580 32639 31440 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727455.1 protein_id gnl|my_center|LOCUS_04580 32720 33826 gene locus_tag LOCUS_04590 32720 33826 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975831.1 protein_id gnl|my_center|LOCUS_04590 34248 33823 gene locus_tag LOCUS_04600 34248 33823 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085221.1 protein_id gnl|my_center|LOCUS_04600 34574 34245 gene locus_tag LOCUS_04610 34574 34245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 36336 34693 gene locus_tag LOCUS_04620 36336 34693 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089722.1 protein_id gnl|my_center|LOCUS_04620 37736 36459 gene locus_tag LOCUS_04630 37736 36459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 37800 38330 gene locus_tag LOCUS_04640 37800 38330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 38716 38390 gene locus_tag LOCUS_04650 38716 38390 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_04650 38982 38716 gene locus_tag LOCUS_04660 38982 38716 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_04660 40740 39028 gene locus_tag LOCUS_04670 40740 39028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 40845 41879 gene locus_tag LOCUS_04680 40845 41879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929908.1 protein_id gnl|my_center|LOCUS_04680 41898 42164 gene locus_tag LOCUS_04690 41898 42164 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941406.1 protein_id gnl|my_center|LOCUS_04690 42226 42603 gene locus_tag LOCUS_04700 42226 42603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 43459 42593 gene locus_tag LOCUS_04710 43459 42593 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_04710 43573 44415 gene locus_tag LOCUS_04720 43573 44415 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027042.1 protein_id gnl|my_center|LOCUS_04720 45603 44749 gene locus_tag LOCUS_04730 45603 44749 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083715.1 protein_id gnl|my_center|LOCUS_04730 45681 46478 gene locus_tag LOCUS_04740 45681 46478 CDS product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206670.1 protein_id gnl|my_center|LOCUS_04740 46600 47709 gene locus_tag LOCUS_04750 gene gcvT 46600 47709 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259334.1 protein_id gnl|my_center|LOCUS_04750 47706 48110 gene locus_tag LOCUS_04760 gene gcvH 47706 48110 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026899.1 protein_id gnl|my_center|LOCUS_04760 48113 49459 gene locus_tag LOCUS_04770 gene gcvPA 48113 49459 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909428.1 protein_id gnl|my_center|LOCUS_04770 49456 50964 gene locus_tag LOCUS_04780 gene gcvPB 49456 50964 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259338.1 protein_id gnl|my_center|LOCUS_04780 51008 52111 gene locus_tag LOCUS_04790 51008 52111 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789856.1 protein_id gnl|my_center|LOCUS_04790 52228 53334 gene locus_tag LOCUS_04800 52228 53334 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_04800 54095 53331 gene locus_tag LOCUS_04810 54095 53331 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088364.1 protein_id gnl|my_center|LOCUS_04810 54877 54092 gene locus_tag LOCUS_04820 54877 54092 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390256.1 protein_id gnl|my_center|LOCUS_04820 54930 55445 gene locus_tag LOCUS_04830 54930 55445 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570773.1 protein_id gnl|my_center|LOCUS_04830 55542 56015 gene locus_tag LOCUS_04840 55542 56015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 56035 57216 gene locus_tag LOCUS_04850 gene ada 56035 57216 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147548.1 protein_id gnl|my_center|LOCUS_04850 58729 57170 gene locus_tag LOCUS_04860 58729 57170 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_04860 58981 59919 gene locus_tag LOCUS_04870 58981 59919 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965631.1 protein_id gnl|my_center|LOCUS_04870 60170 60466 gene locus_tag LOCUS_04880 60170 60466 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_04880 60577 61476 gene locus_tag LOCUS_04890 60577 61476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 61463 62077 gene locus_tag LOCUS_04900 61463 62077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 62227 63849 gene locus_tag LOCUS_04910 62227 63849 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_04910 64380 65837 gene locus_tag LOCUS_04920 64380 65837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 66926 65841 gene locus_tag LOCUS_04930 66926 65841 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085700.1 protein_id gnl|my_center|LOCUS_04930 67039 67785 gene locus_tag LOCUS_04940 67039 67785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 67847 68536 gene locus_tag LOCUS_04950 67847 68536 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_04950 69102 68635 gene locus_tag LOCUS_04960 69102 68635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 69397 71283 gene locus_tag LOCUS_04970 69397 71283 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459198.1 protein_id gnl|my_center|LOCUS_04970 71392 72348 gene locus_tag LOCUS_04980 71392 72348 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 protein_id gnl|my_center|LOCUS_04980 72345 73274 gene locus_tag LOCUS_04990 72345 73274 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085650.1 protein_id gnl|my_center|LOCUS_04990 74053 73271 gene locus_tag LOCUS_05000 gene fabG 74053 73271 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_05000 74560 74309 gene locus_tag LOCUS_05010 74560 74309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 74477 76234 gene locus_tag LOCUS_05020 74477 76234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 76463 77401 gene locus_tag LOCUS_05030 76463 77401 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368429.1 protein_id gnl|my_center|LOCUS_05030 77401 78294 gene locus_tag LOCUS_05040 77401 78294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368430.1 protein_id gnl|my_center|LOCUS_05040 78412 79950 gene locus_tag LOCUS_05050 78412 79950 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_05050 79958 82108 gene locus_tag LOCUS_05060 79958 82108 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195268.1 protein_id gnl|my_center|LOCUS_05060 82283 83629 gene locus_tag LOCUS_05070 82283 83629 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_05070 83733 84590 gene locus_tag LOCUS_05080 gene paaG 83733 84590 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117561.1 protein_id gnl|my_center|LOCUS_05080 84632 85417 gene locus_tag LOCUS_05090 84632 85417 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206049.1 protein_id gnl|my_center|LOCUS_05090 86451 85414 gene locus_tag LOCUS_05100 86451 85414 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_05100 87476 86502 gene locus_tag LOCUS_05110 87476 86502 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_05110 87575 87973 gene locus_tag LOCUS_05120 87575 87973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 88862 87978 gene locus_tag LOCUS_05130 88862 87978 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028906.1 protein_id gnl|my_center|LOCUS_05130 88978 90720 gene locus_tag LOCUS_05140 88978 90720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 90776 92236 gene locus_tag LOCUS_05150 90776 92236 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175426.1 protein_id gnl|my_center|LOCUS_05150 92236 93225 gene locus_tag LOCUS_05160 92236 93225 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_05160 93227 93964 gene locus_tag LOCUS_05170 93227 93964 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 protein_id gnl|my_center|LOCUS_05170 94919 93999 gene locus_tag LOCUS_05180 94919 93999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_05180 95863 94919 gene locus_tag LOCUS_05190 95863 94919 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311351.1 protein_id gnl|my_center|LOCUS_05190 96978 96013 gene locus_tag LOCUS_05200 96978 96013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 97593 97003 gene locus_tag LOCUS_05210 97593 97003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 97510 97731 gene locus_tag LOCUS_05220 97510 97731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 98708 97890 gene locus_tag LOCUS_05230 98708 97890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391202.1 protein_id gnl|my_center|LOCUS_05230 99535 98705 gene locus_tag LOCUS_05240 99535 98705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530913.1 protein_id gnl|my_center|LOCUS_05240 100422 99547 gene locus_tag LOCUS_05250 100422 99547 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807400.1 protein_id gnl|my_center|LOCUS_05250 101480 100473 gene locus_tag LOCUS_05260 gene mer 101480 100473 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_05260 101932 101528 gene locus_tag LOCUS_05270 gene pcaC 101932 101528 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705266.1 protein_id gnl|my_center|LOCUS_05270 103329 101986 gene locus_tag LOCUS_05280 103329 101986 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_05280 104767 103331 gene locus_tag LOCUS_05290 gene hydA 104767 103331 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_05290 105630 104797 gene locus_tag LOCUS_05300 105630 104797 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_05300 106800 105694 gene locus_tag LOCUS_05310 106800 105694 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383812.1 protein_id gnl|my_center|LOCUS_05310 107370 108875 gene locus_tag LOCUS_05320 107370 108875 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039202.1 protein_id gnl|my_center|LOCUS_05320 109449 110816 gene locus_tag LOCUS_05330 109449 110816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 112369 110846 gene locus_tag LOCUS_05340 112369 110846 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392612.1 protein_id gnl|my_center|LOCUS_05340 112953 112366 gene locus_tag LOCUS_05350 112953 112366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 113924 112950 gene locus_tag LOCUS_05360 gene cbiB 113924 112950 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258432.1 protein_id gnl|my_center|LOCUS_05360 114336 116726 gene locus_tag LOCUS_05370 114336 116726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 117110 116826 gene locus_tag LOCUS_05380 117110 116826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 117353 117189 gene locus_tag LOCUS_05390 117353 117189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 118029 117721 gene locus_tag LOCUS_05400 118029 117721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 118239 119486 gene locus_tag LOCUS_05410 118239 119486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 119610 120287 gene locus_tag LOCUS_05420 119610 120287 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_05420 120284 121705 gene locus_tag LOCUS_05430 120284 121705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 121788 122471 gene locus_tag LOCUS_05440 121788 122471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence05 693 97 gene locus_tag LOCUS_05450 gene coaE 693 97 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_05450 1100 1579 gene locus_tag LOCUS_05460 1100 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2648 1674 gene locus_tag LOCUS_05470 gene etfA 2648 1674 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398999.1 protein_id gnl|my_center|LOCUS_05470 3538 2735 gene locus_tag LOCUS_05480 3538 2735 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437555.1 protein_id gnl|my_center|LOCUS_05480 3771 3932 gene locus_tag LOCUS_05490 3771 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 6277 4049 gene locus_tag LOCUS_05500 6277 4049 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459849.1 protein_id gnl|my_center|LOCUS_05500 7346 6354 gene locus_tag LOCUS_05510 7346 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 9047 7476 gene locus_tag LOCUS_05520 9047 7476 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_05520 9842 9108 gene locus_tag LOCUS_05530 9842 9108 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225713.1 protein_id gnl|my_center|LOCUS_05530 10084 9842 gene locus_tag LOCUS_05540 10084 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 10370 10122 gene locus_tag LOCUS_05550 10370 10122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 11106 10399 gene locus_tag LOCUS_05560 11106 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 13570 11138 gene locus_tag LOCUS_05570 13570 11138 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_05570 13627 14406 gene locus_tag LOCUS_05580 13627 14406 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_05580 14427 14900 gene locus_tag LOCUS_05590 14427 14900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 15324 14938 gene locus_tag LOCUS_05600 15324 14938 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028144578.1 protein_id gnl|my_center|LOCUS_05600 16122 15364 gene locus_tag LOCUS_05610 16122 15364 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259577.1 protein_id gnl|my_center|LOCUS_05610 17512 16202 gene locus_tag LOCUS_05620 17512 16202 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_05620 18043 18774 gene locus_tag LOCUS_05630 18043 18774 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173642.1 protein_id gnl|my_center|LOCUS_05630 18783 19142 gene locus_tag LOCUS_05640 18783 19142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 19201 19458 gene locus_tag LOCUS_05650 19201 19458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 19519 19944 gene locus_tag LOCUS_05660 19519 19944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 20873 20040 gene locus_tag LOCUS_05670 gene thyX 20873 20040 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_05670 21276 20962 gene locus_tag LOCUS_05680 21276 20962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 21735 21310 gene locus_tag LOCUS_05690 21735 21310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 22736 21810 gene locus_tag LOCUS_05700 22736 21810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 23721 23047 gene locus_tag LOCUS_05710 23721 23047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 24201 23740 gene locus_tag LOCUS_05720 24201 23740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 25004 24252 gene locus_tag LOCUS_05730 25004 24252 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256262.1 protein_id gnl|my_center|LOCUS_05730 25208 25933 gene locus_tag LOCUS_05740 gene lexA 25208 25933 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256381.1 protein_id gnl|my_center|LOCUS_05740 25996 26988 gene locus_tag LOCUS_05750 25996 26988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727086.1 protein_id gnl|my_center|LOCUS_05750 27993 26998 gene locus_tag LOCUS_05760 gene holA 27993 26998 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258281.1 protein_id gnl|my_center|LOCUS_05760 31324 28022 gene locus_tag LOCUS_05770 31324 28022 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839229.1 protein_id gnl|my_center|LOCUS_05770 34467 31321 gene locus_tag LOCUS_05780 34467 31321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 34745 34485 gene locus_tag LOCUS_05790 34745 34485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 35921 34773 gene locus_tag LOCUS_05800 gene dnaN 35921 34773 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_05800 36912 36088 gene locus_tag LOCUS_05810 36912 36088 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968042.1 protein_id gnl|my_center|LOCUS_05810 38016 36988 gene locus_tag LOCUS_05820 gene hemB 38016 36988 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_05820 39551 38013 gene locus_tag LOCUS_05830 gene cobA 39551 38013 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_05830 40447 39548 gene locus_tag LOCUS_05840 gene hemC 40447 39548 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776655.1 protein_id gnl|my_center|LOCUS_05840 41106 40450 gene locus_tag LOCUS_05850 41106 40450 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811192.1 protein_id gnl|my_center|LOCUS_05850 42065 41130 gene locus_tag LOCUS_05860 42065 41130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 42136 42750 gene locus_tag LOCUS_05870 gene lepB 42136 42750 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257166.1 protein_id gnl|my_center|LOCUS_05870 42747 43322 gene locus_tag LOCUS_05880 gene pyrE 42747 43322 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_05880 44002 43319 gene locus_tag LOCUS_05890 44002 43319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 44049 44774 gene locus_tag LOCUS_05900 44049 44774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 47017 44750 gene locus_tag LOCUS_05910 47017 44750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 47460 46984 gene locus_tag LOCUS_05920 gene cadI 47460 46984 CDS product cadmium-induced metalloenzyme CadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413675.1 protein_id gnl|my_center|LOCUS_05920 48599 47481 gene locus_tag LOCUS_05930 gene ssuD 48599 47481 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104574.1 protein_id gnl|my_center|LOCUS_05930 48723 49148 gene locus_tag LOCUS_05940 48723 49148 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_05940 49204 50025 gene locus_tag LOCUS_05950 49204 50025 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926609.1 protein_id gnl|my_center|LOCUS_05950 50507 50022 gene locus_tag LOCUS_05960 50507 50022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 51339 50587 gene locus_tag LOCUS_05970 51339 50587 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_05970 51481 51921 gene locus_tag LOCUS_05980 51481 51921 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337321.1 protein_id gnl|my_center|LOCUS_05980 51975 53138 gene locus_tag LOCUS_05990 51975 53138 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_05990 53844 53158 gene locus_tag LOCUS_06000 53844 53158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 54327 53863 gene locus_tag LOCUS_06010 54327 53863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 57800 54390 gene locus_tag LOCUS_06020 57800 54390 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965449.1 protein_id gnl|my_center|LOCUS_06020 58326 57871 gene locus_tag LOCUS_06030 58326 57871 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976305.1 protein_id gnl|my_center|LOCUS_06030 58730 58323 gene locus_tag LOCUS_06040 58730 58323 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_06040 59817 58816 gene locus_tag LOCUS_06050 59817 58816 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392294.1 protein_id gnl|my_center|LOCUS_06050 61132 59822 gene locus_tag LOCUS_06060 61132 59822 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528549.1 protein_id gnl|my_center|LOCUS_06060 61203 61949 gene locus_tag LOCUS_06070 61203 61949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 62479 63876 gene locus_tag LOCUS_06080 62479 63876 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 protein_id gnl|my_center|LOCUS_06080 64697 63873 gene locus_tag LOCUS_06090 64697 63873 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_06090 66190 64757 gene locus_tag LOCUS_06100 66190 64757 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857874.1 protein_id gnl|my_center|LOCUS_06100 67677 66187 gene locus_tag LOCUS_06110 67677 66187 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259273.1 protein_id gnl|my_center|LOCUS_06110 68482 67664 gene locus_tag LOCUS_06120 68482 67664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 68563 69054 gene locus_tag LOCUS_06130 68563 69054 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919960.1 protein_id gnl|my_center|LOCUS_06130 69513 69112 gene locus_tag LOCUS_06140 69513 69112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 70473 69562 gene locus_tag LOCUS_06150 70473 69562 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173824.1 protein_id gnl|my_center|LOCUS_06150 72174 70489 gene locus_tag LOCUS_06160 72174 70489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 72403 72918 gene locus_tag LOCUS_06170 72403 72918 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_06170 73113 75116 gene locus_tag LOCUS_06180 73113 75116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 76501 75113 gene locus_tag LOCUS_06190 76501 75113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 77839 76550 gene locus_tag LOCUS_06200 77839 76550 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_06200 77989 79122 gene locus_tag LOCUS_06210 77989 79122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 79617 80510 gene locus_tag LOCUS_06220 79617 80510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 80886 80587 gene locus_tag LOCUS_06230 80886 80587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 82007 80880 gene locus_tag LOCUS_06240 82007 80880 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124033.1 protein_id gnl|my_center|LOCUS_06240 82909 82250 gene locus_tag LOCUS_06250 82909 82250 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940859.1 protein_id gnl|my_center|LOCUS_06250 83672 84463 gene locus_tag LOCUS_06260 83672 84463 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806072.1 protein_id gnl|my_center|LOCUS_06260 84467 85174 gene locus_tag LOCUS_06270 84467 85174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 86544 85276 gene locus_tag LOCUS_06280 86544 85276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 86858 86782 gene locus_tag LOCUS_t00060 86858 86782 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 86879 88057 gene locus_tag LOCUS_06290 86879 88057 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112678.1 protein_id gnl|my_center|LOCUS_06290 88057 88644 gene locus_tag LOCUS_06300 88057 88644 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254574.1 protein_id gnl|my_center|LOCUS_06300 89525 88641 gene locus_tag LOCUS_06310 89525 88641 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140042.1 protein_id gnl|my_center|LOCUS_06310 90446 89562 gene locus_tag LOCUS_06320 90446 89562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06320 92841 90466 gene locus_tag LOCUS_06330 92841 90466 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_06330 93750 92917 gene locus_tag LOCUS_06340 gene fba 93750 92917 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_06340 93829 94449 gene locus_tag LOCUS_06350 93829 94449 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_06350 94682 95851 gene locus_tag LOCUS_06360 94682 95851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 95848 97443 gene locus_tag LOCUS_06370 95848 97443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 97579 98217 gene locus_tag LOCUS_06380 97579 98217 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_06380 98214 99581 gene locus_tag LOCUS_06390 98214 99581 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938495.1 protein_id gnl|my_center|LOCUS_06390 99599 100087 gene locus_tag LOCUS_06400 gene ribH 99599 100087 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403828.1 protein_id gnl|my_center|LOCUS_06400 100525 100169 gene locus_tag LOCUS_06410 100525 100169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 101263 100538 gene locus_tag LOCUS_06420 101263 100538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 101635 101279 gene locus_tag LOCUS_06430 101635 101279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 102337 101648 gene locus_tag LOCUS_06440 102337 101648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 102425 103216 gene locus_tag LOCUS_06450 102425 103216 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063963580.1 protein_id gnl|my_center|LOCUS_06450 103277 104089 gene locus_tag LOCUS_06460 103277 104089 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896244.1 protein_id gnl|my_center|LOCUS_06460 104103 106436 gene locus_tag LOCUS_06470 104103 106436 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727995.1 protein_id gnl|my_center|LOCUS_06470 107326 106466 gene locus_tag LOCUS_06480 107326 106466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 107705 107487 gene locus_tag LOCUS_06490 gene copZ 107705 107487 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832344.1 protein_id gnl|my_center|LOCUS_06490 108188 107754 gene locus_tag LOCUS_06500 108188 107754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence06 114 677 gene locus_tag LOCUS_06510 114 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 1204 2334 gene locus_tag LOCUS_06520 gene glpK 1204 2334 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261933.1 protein_id gnl|my_center|LOCUS_06520 2347 3984 gene locus_tag LOCUS_06530 2347 3984 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_06530 6248 3981 gene locus_tag LOCUS_06540 6248 3981 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337824.1 protein_id gnl|my_center|LOCUS_06540 6588 7811 gene locus_tag LOCUS_06550 6588 7811 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_06550 9194 7830 gene locus_tag LOCUS_06560 9194 7830 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965231.1 protein_id gnl|my_center|LOCUS_06560 9286 10413 gene locus_tag LOCUS_06570 9286 10413 CDS product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532992.1 protein_id gnl|my_center|LOCUS_06570 11789 10488 gene locus_tag LOCUS_06580 11789 10488 CDS product CUAEP/CCAEP-tail radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257877.1 protein_id gnl|my_center|LOCUS_06580 12426 11818 gene locus_tag LOCUS_06590 gene nfuA 12426 11818 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_06590 12499 14232 gene locus_tag LOCUS_06600 12499 14232 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 protein_id gnl|my_center|LOCUS_06600 14245 14571 gene locus_tag LOCUS_06610 14245 14571 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087569.1 protein_id gnl|my_center|LOCUS_06610 15383 14568 gene locus_tag LOCUS_06620 15383 14568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 15465 16424 gene locus_tag LOCUS_06630 15465 16424 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_06630 16464 16973 gene locus_tag LOCUS_06640 16464 16973 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256309.1 protein_id gnl|my_center|LOCUS_06640 16995 17552 gene locus_tag LOCUS_06650 16995 17552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 18454 17627 gene locus_tag LOCUS_06660 gene sppA 18454 17627 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_06660 18591 18968 gene locus_tag LOCUS_06670 18591 18968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 18961 19278 gene locus_tag LOCUS_06680 18961 19278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 19282 19674 gene locus_tag LOCUS_06690 19282 19674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 19702 19896 gene locus_tag LOCUS_06700 19702 19896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 20842 20048 gene locus_tag LOCUS_06710 20842 20048 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244072.1 protein_id gnl|my_center|LOCUS_06710 21760 20954 gene locus_tag LOCUS_06720 21760 20954 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_06720 22673 21882 gene locus_tag LOCUS_06730 gene fabG 22673 21882 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_06730 23661 22870 gene locus_tag LOCUS_06740 gene fabG 23661 22870 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_06740 25005 23695 gene locus_tag LOCUS_06750 25005 23695 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896596.1 protein_id gnl|my_center|LOCUS_06750 25004 25525 gene locus_tag LOCUS_06760 25004 25525 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_06760 25525 26052 gene locus_tag LOCUS_06770 25525 26052 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258430.1 protein_id gnl|my_center|LOCUS_06770 26052 26849 gene locus_tag LOCUS_06780 26052 26849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 26846 27727 gene locus_tag LOCUS_06790 26846 27727 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_06790 28060 28944 gene locus_tag LOCUS_06800 28060 28944 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_06800 28951 29841 gene locus_tag LOCUS_06810 28951 29841 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_06810 30622 29801 gene locus_tag LOCUS_06820 30622 29801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 31825 30629 gene locus_tag LOCUS_06830 31825 30629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 33097 31835 gene locus_tag LOCUS_06840 33097 31835 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_06840 34308 33187 gene locus_tag LOCUS_06850 gene hflX 34308 33187 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_06850 35725 34517 gene locus_tag LOCUS_06860 35725 34517 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_06860 36688 35756 gene locus_tag LOCUS_06870 36688 35756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 37628 36735 gene locus_tag LOCUS_06880 gene dapF 37628 36735 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_06880 38468 37656 gene locus_tag LOCUS_06890 gene miaA 38468 37656 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256258.1 protein_id gnl|my_center|LOCUS_06890 39288 38533 gene locus_tag LOCUS_06900 gene tpiA 39288 38533 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_06900 40526 39288 gene locus_tag LOCUS_06910 40526 39288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06910 41086 40559 gene locus_tag LOCUS_06920 gene rpiB 41086 40559 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_06920 41792 41124 gene locus_tag LOCUS_06930 41792 41124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 41757 43406 gene locus_tag LOCUS_06940 gene guaA 41757 43406 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_06940 43413 43841 gene locus_tag LOCUS_06950 43413 43841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 43851 45113 gene locus_tag LOCUS_06960 gene purD 43851 45113 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_06960 45116 45463 gene locus_tag LOCUS_06970 45116 45463 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660653.1 protein_id gnl|my_center|LOCUS_06970 45463 46755 gene locus_tag LOCUS_06980 gene purB 45463 46755 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572878.1 protein_id gnl|my_center|LOCUS_06980 46759 47595 gene locus_tag LOCUS_06990 46759 47595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 47689 48807 gene locus_tag LOCUS_07000 47689 48807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 49120 50031 gene locus_tag LOCUS_07010 49120 50031 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_07010 50054 50308 gene locus_tag LOCUS_07020 gene purS 50054 50308 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140445.1 protein_id gnl|my_center|LOCUS_07020 50896 50309 gene locus_tag LOCUS_07030 gene hisB 50896 50309 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257804.1 protein_id gnl|my_center|LOCUS_07030 51000 51425 gene locus_tag LOCUS_07040 51000 51425 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173532.1 protein_id gnl|my_center|LOCUS_07040 52291 51434 gene locus_tag LOCUS_07050 gene prpB 52291 51434 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763428.1 protein_id gnl|my_center|LOCUS_07050 53502 52288 gene locus_tag LOCUS_07060 53502 52288 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_07060 54080 53520 gene locus_tag LOCUS_07070 54080 53520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 55258 54143 gene locus_tag LOCUS_07080 gene hisC 55258 54143 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257801.1 protein_id gnl|my_center|LOCUS_07080 56616 55255 gene locus_tag LOCUS_07090 gene hisD 56616 55255 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888771.1 protein_id gnl|my_center|LOCUS_07090 57380 56616 gene locus_tag LOCUS_07100 57380 56616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 57440 58774 gene locus_tag LOCUS_07110 57440 58774 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_07110 58767 59141 gene locus_tag LOCUS_07120 58767 59141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 59593 59225 gene locus_tag LOCUS_07130 gene rplS 59593 59225 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701743.1 protein_id gnl|my_center|LOCUS_07130 60406 59699 gene locus_tag LOCUS_07140 gene trmD 60406 59699 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_07140 61659 60430 gene locus_tag LOCUS_07150 gene ftsZ 61659 60430 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_07150 63035 61755 gene locus_tag LOCUS_07160 gene ftsA 63035 61755 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392368.1 protein_id gnl|my_center|LOCUS_07160 63989 63081 gene locus_tag LOCUS_07170 63989 63081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 65098 63986 gene locus_tag LOCUS_07180 65098 63986 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989595.1 protein_id gnl|my_center|LOCUS_07180 66023 65088 gene locus_tag LOCUS_07190 gene murB 66023 65088 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142314.1 protein_id gnl|my_center|LOCUS_07190 67378 66020 gene locus_tag LOCUS_07200 gene murC 67378 66020 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256647.1 protein_id gnl|my_center|LOCUS_07200 68495 67386 gene locus_tag LOCUS_07210 gene murG 68495 67386 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_07210 69865 68495 gene locus_tag LOCUS_07220 gene ftsW 69865 68495 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256650.1 protein_id gnl|my_center|LOCUS_07220 71208 69862 gene locus_tag LOCUS_07230 gene murD 71208 69862 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_07230 72194 71205 gene locus_tag LOCUS_07240 gene mraY 72194 71205 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_07240 73555 72191 gene locus_tag LOCUS_07250 73555 72191 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256654.1 protein_id gnl|my_center|LOCUS_07250 75402 73552 gene locus_tag LOCUS_07260 75402 73552 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_07260 75871 75479 gene locus_tag LOCUS_07270 75871 75479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 77288 76389 gene locus_tag LOCUS_07280 gene rsmH 77288 76389 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_07280 77755 77285 gene locus_tag LOCUS_07290 gene mraZ 77755 77285 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_07290 78025 78510 gene locus_tag LOCUS_07300 78025 78510 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227870.1 protein_id gnl|my_center|LOCUS_07300 78551 80302 gene locus_tag LOCUS_07310 78551 80302 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_07310 80304 80975 gene locus_tag LOCUS_07320 80304 80975 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_07320 80972 81772 gene locus_tag LOCUS_07330 gene proC 80972 81772 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_07330 81769 82035 gene locus_tag LOCUS_07340 81769 82035 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938667.1 protein_id gnl|my_center|LOCUS_07340 82159 83370 gene locus_tag LOCUS_07350 gene recA 82159 83370 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392593.1 protein_id gnl|my_center|LOCUS_07350 83409 83924 gene locus_tag LOCUS_07360 83409 83924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 84059 85549 gene locus_tag LOCUS_07370 gene rny 84059 85549 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_07370 85565 86401 gene locus_tag LOCUS_07380 85565 86401 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_07380 86398 86850 gene locus_tag LOCUS_07390 gene fabZ 86398 86850 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257317.1 protein_id gnl|my_center|LOCUS_07390 87232 86855 gene locus_tag LOCUS_07400 87232 86855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 87309 87385 gene locus_tag LOCUS_t00070 87309 87385 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 90826 87413 gene locus_tag LOCUS_07410 90826 87413 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112417.1 protein_id gnl|my_center|LOCUS_07410 91940 91044 gene locus_tag LOCUS_07420 91940 91044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 94813 92306 gene locus_tag LOCUS_07430 94813 92306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 94938 96467 gene locus_tag LOCUS_07440 94938 96467 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098014.1 protein_id gnl|my_center|LOCUS_07440 98149 96464 gene locus_tag LOCUS_07450 98149 96464 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811563.1 protein_id gnl|my_center|LOCUS_07450 99874 98231 gene locus_tag LOCUS_07460 99874 98231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031209.1 protein_id gnl|my_center|LOCUS_07460 100419 99958 gene locus_tag LOCUS_07470 100419 99958 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061010.1 protein_id gnl|my_center|LOCUS_07470 100577 101479 gene locus_tag LOCUS_07480 100577 101479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 102710 101499 gene locus_tag LOCUS_07490 102710 101499 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730955.1 protein_id gnl|my_center|LOCUS_07490 102793 104085 gene locus_tag LOCUS_07500 102793 104085 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_07500 104528 104082 gene locus_tag LOCUS_07510 104528 104082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 104862 104533 gene locus_tag LOCUS_07520 104862 104533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 105098 104838 gene locus_tag LOCUS_07530 105098 104838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 105340 105086 gene locus_tag LOCUS_07540 105340 105086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 105523 106317 gene locus_tag LOCUS_07550 105523 106317 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641673.1 protein_id gnl|my_center|LOCUS_07550 <107417 106314 gene locus_tag LOCUS_07560 <107417 106314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028331.1:mandelate racemase/muconate lactonizing enzyme family protein >Feature sequence07 2342 1335 gene locus_tag LOCUS_07570 gene hpnH 2342 1335 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_07570 3095 2427 gene locus_tag LOCUS_07580 3095 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 3633 2986 gene locus_tag LOCUS_07590 3633 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4049 3645 gene locus_tag LOCUS_07600 gene nifU 4049 3645 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_07600 5234 4059 gene locus_tag LOCUS_07610 5234 4059 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_07610 5665 5234 gene locus_tag LOCUS_07620 5665 5234 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894605.1 protein_id gnl|my_center|LOCUS_07620 6834 5662 gene locus_tag LOCUS_07630 6834 5662 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_07630 7430 6909 gene locus_tag LOCUS_07640 7430 6909 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023127.1 protein_id gnl|my_center|LOCUS_07640 8328 7588 gene locus_tag LOCUS_07650 8328 7588 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 protein_id gnl|my_center|LOCUS_07650 8260 8487 gene locus_tag LOCUS_07660 8260 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 8537 10099 gene locus_tag LOCUS_07670 gene gltA 8537 10099 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_07670 10556 10110 gene locus_tag LOCUS_07680 10556 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 12014 10656 gene locus_tag LOCUS_07690 12014 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 12158 12655 gene locus_tag LOCUS_07700 12158 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 13853 12813 gene locus_tag LOCUS_07710 13853 12813 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258396.1 protein_id gnl|my_center|LOCUS_07710 14296 14021 gene locus_tag LOCUS_07720 14296 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 15162 14317 gene locus_tag LOCUS_07730 15162 14317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_07730 16051 15170 gene locus_tag LOCUS_07740 16051 15170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382989.1 protein_id gnl|my_center|LOCUS_07740 16162 16830 gene locus_tag LOCUS_07750 gene npdG 16162 16830 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_07750 16875 17636 gene locus_tag LOCUS_07760 gene cofE 16875 17636 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_07760 17646 18101 gene locus_tag LOCUS_07770 17646 18101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 18101 18556 gene locus_tag LOCUS_07780 18101 18556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 19070 18579 gene locus_tag LOCUS_07790 19070 18579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 20013 19150 gene locus_tag LOCUS_07800 20013 19150 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808075.1 protein_id gnl|my_center|LOCUS_07800 20041 21801 gene locus_tag LOCUS_07810 20041 21801 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193501.1 protein_id gnl|my_center|LOCUS_07810 21743 22327 gene locus_tag LOCUS_07820 21743 22327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 22703 22308 gene locus_tag LOCUS_07830 22703 22308 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090251.1 protein_id gnl|my_center|LOCUS_07830 24121 22700 gene locus_tag LOCUS_07840 gene hpnE 24121 22700 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_07840 25019 24114 gene locus_tag LOCUS_07850 25019 24114 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 protein_id gnl|my_center|LOCUS_07850 25947 25027 gene locus_tag LOCUS_07860 gene hpnC 25947 25027 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_07860 26210 25971 gene locus_tag LOCUS_07870 26210 25971 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_07870 26924 26241 gene locus_tag LOCUS_07880 26924 26241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 28979 27045 gene locus_tag LOCUS_07890 gene shc 28979 27045 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_07890 30041 28989 gene locus_tag LOCUS_07900 30041 28989 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107420324.1 protein_id gnl|my_center|LOCUS_07900 30475 30038 gene locus_tag LOCUS_07910 30475 30038 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_07910 31721 30483 gene locus_tag LOCUS_07920 31721 30483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 32290 31718 gene locus_tag LOCUS_07930 32290 31718 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_07930 32680 32321 gene locus_tag LOCUS_07940 32680 32321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 33330 32707 gene locus_tag LOCUS_07950 33330 32707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 34337 33357 gene locus_tag LOCUS_07960 34337 33357 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030814.1 protein_id gnl|my_center|LOCUS_07960 35377 34376 gene locus_tag LOCUS_07970 35377 34376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 36732 35509 gene locus_tag LOCUS_07980 36732 35509 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_07980 37978 36695 gene locus_tag LOCUS_07990 37978 36695 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_07990 38181 39710 gene locus_tag LOCUS_08000 38181 39710 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 protein_id gnl|my_center|LOCUS_08000 39794 40435 gene locus_tag LOCUS_08010 39794 40435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 40647 40432 gene locus_tag LOCUS_08020 40647 40432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 40804 42309 gene locus_tag LOCUS_08030 gene pnbA 40804 42309 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243926.1 protein_id gnl|my_center|LOCUS_08030 43604 42306 gene locus_tag LOCUS_08040 43604 42306 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129610996.1 protein_id gnl|my_center|LOCUS_08040 43839 45461 gene locus_tag LOCUS_08050 43839 45461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 46491 45445 gene locus_tag LOCUS_08060 46491 45445 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_08060 47158 46610 gene locus_tag LOCUS_08070 47158 46610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 48185 47376 gene locus_tag LOCUS_08080 48185 47376 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965766.1 protein_id gnl|my_center|LOCUS_08080 49264 48242 gene locus_tag LOCUS_08090 49264 48242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 49731 49258 gene locus_tag LOCUS_08100 49731 49258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 49957 50289 gene locus_tag LOCUS_08110 49957 50289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 52980 50548 gene locus_tag LOCUS_08120 52980 50548 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_08120 53324 52977 gene locus_tag LOCUS_08130 53324 52977 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332994.1 protein_id gnl|my_center|LOCUS_08130 54283 53321 gene locus_tag LOCUS_08140 54283 53321 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259101.1 protein_id gnl|my_center|LOCUS_08140 54448 54855 gene locus_tag LOCUS_08150 54448 54855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 54998 55549 gene locus_tag LOCUS_08160 54998 55549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 55644 56345 gene locus_tag LOCUS_08170 55644 56345 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_08170 56754 56479 gene locus_tag LOCUS_08180 56754 56479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 57342 56791 gene locus_tag LOCUS_08190 57342 56791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 57611 59503 gene locus_tag LOCUS_08200 57611 59503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_08200 59504 61498 gene locus_tag LOCUS_08210 59504 61498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530489.1 protein_id gnl|my_center|LOCUS_08210 62453 61527 gene locus_tag LOCUS_08220 62453 61527 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_08220 63412 62450 gene locus_tag LOCUS_08230 63412 62450 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267881.1 protein_id gnl|my_center|LOCUS_08230 65263 63608 gene locus_tag LOCUS_08240 65263 63608 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965798.1 protein_id gnl|my_center|LOCUS_08240 65147 65413 gene locus_tag LOCUS_08250 65147 65413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 66664 65591 gene locus_tag LOCUS_08260 gene ruvB 66664 65591 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_08260 67257 66661 gene locus_tag LOCUS_08270 gene yqeK 67257 66661 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_08270 67799 67254 gene locus_tag LOCUS_08280 67799 67254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 67801 68106 gene locus_tag LOCUS_08290 67801 68106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 69294 68164 gene locus_tag LOCUS_08300 69294 68164 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_08300 69529 71592 gene locus_tag LOCUS_08310 69529 71592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 71791 72306 gene locus_tag LOCUS_08320 71791 72306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 72427 72891 gene locus_tag LOCUS_08330 72427 72891 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730707.1 protein_id gnl|my_center|LOCUS_08330 72943 73407 gene locus_tag LOCUS_08340 gene phnB 72943 73407 CDS product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_08340 73451 73912 gene locus_tag LOCUS_08350 73451 73912 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195008.1 protein_id gnl|my_center|LOCUS_08350 73917 74402 gene locus_tag LOCUS_08360 gene phnB 73917 74402 CDS product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_08360 74413 74871 gene locus_tag LOCUS_08370 74413 74871 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939741.1 protein_id gnl|my_center|LOCUS_08370 74883 75401 gene locus_tag LOCUS_08380 74883 75401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 76225 75389 gene locus_tag LOCUS_08390 76225 75389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08390 77079 76252 gene locus_tag LOCUS_08400 77079 76252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 78794 77151 gene locus_tag LOCUS_08410 78794 77151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 79239 78949 gene locus_tag LOCUS_08420 79239 78949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 79374 80201 gene locus_tag LOCUS_08430 79374 80201 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731410.1 protein_id gnl|my_center|LOCUS_08430 80198 80992 gene locus_tag LOCUS_08440 gene fabG 80198 80992 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252251.1 protein_id gnl|my_center|LOCUS_08440 81119 82321 gene locus_tag LOCUS_08450 81119 82321 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_08450 82369 83250 gene locus_tag LOCUS_08460 82369 83250 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892776.1 protein_id gnl|my_center|LOCUS_08460 83256 84071 gene locus_tag LOCUS_08470 83256 84071 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729564.1 protein_id gnl|my_center|LOCUS_08470 84082 84888 gene locus_tag LOCUS_08480 84082 84888 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228906.1 protein_id gnl|my_center|LOCUS_08480 85886 84900 gene locus_tag LOCUS_08490 85886 84900 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_08490 85975 87408 gene locus_tag LOCUS_08500 85975 87408 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084112.1 protein_id gnl|my_center|LOCUS_08500 87405 87749 gene locus_tag LOCUS_08510 87405 87749 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329331.1 protein_id gnl|my_center|LOCUS_08510 87779 88258 gene locus_tag LOCUS_08520 87779 88258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 88283 89110 gene locus_tag LOCUS_08530 88283 89110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 89441 89878 gene locus_tag LOCUS_08540 89441 89878 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810818.1 protein_id gnl|my_center|LOCUS_08540 89972 90448 gene locus_tag LOCUS_08550 89972 90448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 90473 91309 gene locus_tag LOCUS_08560 90473 91309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 91365 91844 gene locus_tag LOCUS_08570 91365 91844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 91968 92696 gene locus_tag LOCUS_08580 91968 92696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 92736 94931 gene locus_tag LOCUS_08590 gene recQ 92736 94931 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_08590 <96960 94928 gene locus_tag LOCUS_08600 <96960 94928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147933.1:DEAD/DEAH box helicase >Feature sequence08 <1 813 gene locus_tag LOCUS_08610 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878180.1:acetate--CoA ligase 810 1556 gene locus_tag LOCUS_08620 810 1556 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270384.1 protein_id gnl|my_center|LOCUS_08620 2566 1577 gene locus_tag LOCUS_08630 gene htpX 2566 1577 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920366.1 protein_id gnl|my_center|LOCUS_08630 2669 2965 gene locus_tag LOCUS_08640 2669 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4293 3349 gene locus_tag LOCUS_08650 gene fmt 4293 3349 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_08650 4805 4335 gene locus_tag LOCUS_08660 4805 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 5615 4863 gene locus_tag LOCUS_08670 5615 4863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966848.1 protein_id gnl|my_center|LOCUS_08670 6837 5626 gene locus_tag LOCUS_08680 6837 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 7722 6883 gene locus_tag LOCUS_08690 7722 6883 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368402.1 protein_id gnl|my_center|LOCUS_08690 9036 7786 gene locus_tag LOCUS_08700 9036 7786 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173094.1 protein_id gnl|my_center|LOCUS_08700 9752 9033 gene locus_tag LOCUS_08710 9752 9033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_08710 12487 9749 gene locus_tag LOCUS_08720 12487 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 13536 12709 gene locus_tag LOCUS_08730 13536 12709 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_08730 14088 13552 gene locus_tag LOCUS_08740 14088 13552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 15394 14132 gene locus_tag LOCUS_08750 15394 14132 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730955.1 protein_id gnl|my_center|LOCUS_08750 16071 15487 gene locus_tag LOCUS_08760 16071 15487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 16169 16924 gene locus_tag LOCUS_08770 16169 16924 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083449.1 protein_id gnl|my_center|LOCUS_08770 17230 16928 gene locus_tag LOCUS_08780 17230 16928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 17423 18199 gene locus_tag LOCUS_08790 17423 18199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081034.1 protein_id gnl|my_center|LOCUS_08790 18235 21585 gene locus_tag LOCUS_08800 18235 21585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 21578 22414 gene locus_tag LOCUS_08810 21578 22414 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 protein_id gnl|my_center|LOCUS_08810 23655 22411 gene locus_tag LOCUS_08820 23655 22411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08820 24935 23652 gene locus_tag LOCUS_08830 24935 23652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08830 26154 25228 gene locus_tag LOCUS_08840 26154 25228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 27128 26151 gene locus_tag LOCUS_08850 27128 26151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 28346 27195 gene locus_tag LOCUS_08860 28346 27195 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085883.1 protein_id gnl|my_center|LOCUS_08860 28446 28748 gene locus_tag LOCUS_08870 28446 28748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 28808 29152 gene locus_tag LOCUS_08880 28808 29152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 29157 29477 gene locus_tag LOCUS_08890 29157 29477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 29499 30479 gene locus_tag LOCUS_08900 29499 30479 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038431.1 protein_id gnl|my_center|LOCUS_08900 31351 30464 gene locus_tag LOCUS_08910 31351 30464 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881054.1 protein_id gnl|my_center|LOCUS_08910 31662 31354 gene locus_tag LOCUS_08920 31662 31354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 32994 31672 gene locus_tag LOCUS_08930 32994 31672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08930 33173 33805 gene locus_tag LOCUS_08940 33173 33805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 35245 33857 gene locus_tag LOCUS_08950 35245 33857 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_08950 36093 35287 gene locus_tag LOCUS_08960 36093 35287 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 protein_id gnl|my_center|LOCUS_08960 36375 36100 gene locus_tag LOCUS_08970 36375 36100 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_08970 36775 36500 gene locus_tag LOCUS_08980 36775 36500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 37108 36854 gene locus_tag LOCUS_08990 37108 36854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 37590 37321 gene locus_tag LOCUS_09000 37590 37321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 37785 37651 gene locus_tag LOCUS_09010 37785 37651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 37869 38414 gene locus_tag LOCUS_09020 37869 38414 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729630.1 protein_id gnl|my_center|LOCUS_09020 38430 39746 gene locus_tag LOCUS_09030 38430 39746 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503266.1 protein_id gnl|my_center|LOCUS_09030 39753 40298 gene locus_tag LOCUS_09040 39753 40298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 40295 40738 gene locus_tag LOCUS_09050 40295 40738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 41406 40741 gene locus_tag LOCUS_09060 41406 40741 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080706.1 protein_id gnl|my_center|LOCUS_09060 42372 41440 gene locus_tag LOCUS_09070 42372 41440 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775707.1 protein_id gnl|my_center|LOCUS_09070 42855 42466 gene locus_tag LOCUS_09080 42855 42466 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_09080 42982 44499 gene locus_tag LOCUS_09090 42982 44499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 44553 45272 gene locus_tag LOCUS_09100 44553 45272 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09100 46297 45431 gene locus_tag LOCUS_09110 46297 45431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 46241 46462 gene locus_tag LOCUS_09120 46241 46462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 48349 46724 gene locus_tag LOCUS_09130 48349 46724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 49328 48384 gene locus_tag LOCUS_09140 gene nudC 49328 48384 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_09140 50971 49340 gene locus_tag LOCUS_09150 50971 49340 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_09150 51515 51021 gene locus_tag LOCUS_09160 51515 51021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 51502 52581 gene locus_tag LOCUS_09170 51502 52581 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789627.1 protein_id gnl|my_center|LOCUS_09170 52578 53591 gene locus_tag LOCUS_09180 52578 53591 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114458.1 protein_id gnl|my_center|LOCUS_09180 53615 53830 gene locus_tag LOCUS_09190 53615 53830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 53934 56030 gene locus_tag LOCUS_09200 53934 56030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 56248 56027 gene locus_tag LOCUS_09210 56248 56027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 56320 56835 gene locus_tag LOCUS_09220 gene smpB 56320 56835 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_09220 56965 57321 gene locus_tag LOCUS_tm00010 56965 57321 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 57402 57884 gene locus_tag LOCUS_09230 57402 57884 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480093.1 protein_id gnl|my_center|LOCUS_09230 58109 60226 gene locus_tag LOCUS_09240 58109 60226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 60329 61294 gene locus_tag LOCUS_09250 60329 61294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083812.1 protein_id gnl|my_center|LOCUS_09250 61355 62779 gene locus_tag LOCUS_09260 61355 62779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 64783 62888 gene locus_tag LOCUS_09270 gene mutL 64783 62888 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399508.1 protein_id gnl|my_center|LOCUS_09270 67626 64780 gene locus_tag LOCUS_09280 gene mutS 67626 64780 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_09280 69770 67830 gene locus_tag LOCUS_09290 gene nuoF 69770 67830 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_09290 70360 69767 gene locus_tag LOCUS_09300 70360 69767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 71530 70610 gene locus_tag LOCUS_09310 71530 70610 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_09310 71977 71570 gene locus_tag LOCUS_09320 71977 71570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 72161 73108 gene locus_tag LOCUS_09330 72161 73108 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_09330 73206 73901 gene locus_tag LOCUS_09340 73206 73901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 74539 74159 gene locus_tag LOCUS_09350 74539 74159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 74891 74739 gene locus_tag LOCUS_09360 74891 74739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 74829 76583 gene locus_tag LOCUS_09370 74829 76583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence09 143 484 gene locus_tag LOCUS_09380 143 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 773 1069 gene locus_tag LOCUS_09390 gene groES 773 1069 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804491.1 protein_id gnl|my_center|LOCUS_09390 1109 2737 gene locus_tag LOCUS_09400 gene groL 1109 2737 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_09400 7271 2820 gene locus_tag LOCUS_09410 7271 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 11253 7264 gene locus_tag LOCUS_09420 11253 7264 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256763.1 protein_id gnl|my_center|LOCUS_09420 11669 11962 gene locus_tag LOCUS_09430 11669 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 11955 13094 gene locus_tag LOCUS_09440 11955 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 14140 13091 gene locus_tag LOCUS_09450 gene tsaD 14140 13091 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256815.1 protein_id gnl|my_center|LOCUS_09450 16670 14301 gene locus_tag LOCUS_09460 16670 14301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 16873 17325 gene locus_tag LOCUS_09470 16873 17325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 17876 17622 gene locus_tag LOCUS_09480 17876 17622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 17912 18541 gene locus_tag LOCUS_09490 17912 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 19123 18620 gene locus_tag LOCUS_09500 gene moaC 19123 18620 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_09500 20144 19113 gene locus_tag LOCUS_09510 gene moaA 20144 19113 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064345.1 protein_id gnl|my_center|LOCUS_09510 20770 20141 gene locus_tag LOCUS_09520 20770 20141 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_09520 21824 20814 gene locus_tag LOCUS_09530 21824 20814 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_09530 22851 21874 gene locus_tag LOCUS_09540 gene fbp 22851 21874 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345373.1 protein_id gnl|my_center|LOCUS_09540 23067 24527 gene locus_tag LOCUS_09550 23067 24527 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_09550 23391 23308 gene locus_tag LOCUS_t00080 23391 23308 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 24524 25801 gene locus_tag LOCUS_09560 gene fabF 24524 25801 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257800.1 protein_id gnl|my_center|LOCUS_09560 26113 25853 gene locus_tag LOCUS_09570 26113 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 26740 26168 gene locus_tag LOCUS_09580 gene thpR 26740 26168 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_09580 26857 27717 gene locus_tag LOCUS_09590 26857 27717 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_09590 27714 28667 gene locus_tag LOCUS_09600 27714 28667 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_09600 28904 28686 gene locus_tag LOCUS_09610 28904 28686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 29194 28901 gene locus_tag LOCUS_09620 29194 28901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 29950 29225 gene locus_tag LOCUS_09630 29950 29225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 30372 29947 gene locus_tag LOCUS_09640 30372 29947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 30655 30365 gene locus_tag LOCUS_09650 30655 30365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 31669 30680 gene locus_tag LOCUS_09660 31669 30680 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_09660 33000 31693 gene locus_tag LOCUS_09670 gene proA 33000 31693 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095746.1 protein_id gnl|my_center|LOCUS_09670 33393 33055 gene locus_tag LOCUS_09680 33393 33055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 34746 33433 gene locus_tag LOCUS_09690 34746 33433 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230206.1 protein_id gnl|my_center|LOCUS_09690 35297 34743 gene locus_tag LOCUS_09700 35297 34743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 36018 35515 gene locus_tag LOCUS_09710 36018 35515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 36543 36040 gene locus_tag LOCUS_09720 36543 36040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 37485 36568 gene locus_tag LOCUS_09730 37485 36568 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075293048.1 protein_id gnl|my_center|LOCUS_09730 37876 37688 gene locus_tag LOCUS_09740 37876 37688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 38164 39465 gene locus_tag LOCUS_09750 38164 39465 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_09750 39472 40533 gene locus_tag LOCUS_09760 39472 40533 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259330.1 protein_id gnl|my_center|LOCUS_09760 41527 40550 gene locus_tag LOCUS_09770 41527 40550 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_09770 42517 41543 gene locus_tag LOCUS_09780 42517 41543 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_09780 42777 43679 gene locus_tag LOCUS_09790 42777 43679 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_09790 43687 44637 gene locus_tag LOCUS_09800 43687 44637 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_09800 44634 45518 gene locus_tag LOCUS_09810 44634 45518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 45515 46480 gene locus_tag LOCUS_09820 45515 46480 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933926.1 protein_id gnl|my_center|LOCUS_09820 46480 48345 gene locus_tag LOCUS_09830 46480 48345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 51235 48380 gene locus_tag LOCUS_09840 51235 48380 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259434.1 protein_id gnl|my_center|LOCUS_09840 52683 51232 gene locus_tag LOCUS_09850 52683 51232 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259028.1 protein_id gnl|my_center|LOCUS_09850 53675 52725 gene locus_tag LOCUS_09860 53675 52725 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_09860 53817 54971 gene locus_tag LOCUS_09870 53817 54971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 55820 55017 gene locus_tag LOCUS_09880 55820 55017 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_09880 55934 56725 gene locus_tag LOCUS_09890 55934 56725 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_09890 57714 56740 gene locus_tag LOCUS_09900 57714 56740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 58768 57644 gene locus_tag LOCUS_09910 gene dnaJ 58768 57644 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_09910 60743 58851 gene locus_tag LOCUS_09920 gene dnaK 60743 58851 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_09920 61353 60754 gene locus_tag LOCUS_09930 gene grpE 61353 60754 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257941.1 protein_id gnl|my_center|LOCUS_09930 62435 61350 gene locus_tag LOCUS_09940 gene hrcA 62435 61350 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_09940 62623 63870 gene locus_tag LOCUS_09950 gene fabF 62623 63870 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257003.1 protein_id gnl|my_center|LOCUS_09950 63920 64573 gene locus_tag LOCUS_09960 63920 64573 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_09960 64575 66476 gene locus_tag LOCUS_09970 64575 66476 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_09970 66875 66483 gene locus_tag LOCUS_09980 66875 66483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 68155 66878 gene locus_tag LOCUS_09990 gene rho 68155 66878 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_09990 69071 68382 gene locus_tag LOCUS_10000 gene fsa 69071 68382 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393880.1 protein_id gnl|my_center|LOCUS_10000 69845 69369 gene locus_tag LOCUS_10010 69845 69369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 72157 70475 gene locus_tag LOCUS_10020 72157 70475 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257008.1 protein_id gnl|my_center|LOCUS_10020 72417 72154 gene locus_tag LOCUS_10030 72417 72154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 73338 72451 gene locus_tag LOCUS_10040 73338 72451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 73608 74399 gene locus_tag LOCUS_10050 73608 74399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 74508 75254 gene locus_tag LOCUS_10060 74508 75254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence10 1519 386 gene locus_tag LOCUS_10070 1519 386 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665238.1 protein_id gnl|my_center|LOCUS_10070 1914 2900 gene locus_tag LOCUS_10080 1914 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2934 3359 gene locus_tag LOCUS_10090 2934 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 3364 4299 gene locus_tag LOCUS_10100 3364 4299 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_10100 5133 4300 gene locus_tag LOCUS_10110 5133 4300 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_10110 6663 5311 gene locus_tag LOCUS_10120 6663 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 6903 6688 gene locus_tag LOCUS_10130 6903 6688 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985297.1 protein_id gnl|my_center|LOCUS_10130 7040 7243 gene locus_tag LOCUS_10140 7040 7243 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 protein_id gnl|my_center|LOCUS_10140 7496 8035 gene locus_tag LOCUS_10150 gene pyrR 7496 8035 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172875.1 protein_id gnl|my_center|LOCUS_10150 8025 9050 gene locus_tag LOCUS_10160 8025 9050 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257760.1 protein_id gnl|my_center|LOCUS_10160 9047 10366 gene locus_tag LOCUS_10170 9047 10366 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_10170 10366 11487 gene locus_tag LOCUS_10180 gene carA 10366 11487 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_10180 11489 11968 gene locus_tag LOCUS_10190 11489 11968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 11981 12235 gene locus_tag LOCUS_10200 11981 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 12222 15542 gene locus_tag LOCUS_10210 gene carB 12222 15542 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_10210 15563 16369 gene locus_tag LOCUS_10220 15563 16369 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_10220 16412 17257 gene locus_tag LOCUS_10230 16412 17257 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_10230 17302 17838 gene locus_tag LOCUS_10240 17302 17838 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_10240 17829 18287 gene locus_tag LOCUS_10250 17829 18287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 18324 18776 gene locus_tag LOCUS_10260 18324 18776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 18854 18780 gene locus_tag LOCUS_t00090 18854 18780 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 20679 19066 gene locus_tag LOCUS_10270 20679 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 21521 20922 gene locus_tag LOCUS_10280 21521 20922 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892027.1 protein_id gnl|my_center|LOCUS_10280 22461 24056 gene locus_tag LOCUS_10290 gene aceB 22461 24056 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227987.1 protein_id gnl|my_center|LOCUS_10290 24177 25505 gene locus_tag LOCUS_10300 gene aceA 24177 25505 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173860.1 protein_id gnl|my_center|LOCUS_10300 25515 28121 gene locus_tag LOCUS_10310 25515 28121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 29054 28149 gene locus_tag LOCUS_10320 29054 28149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_10320 30013 29051 gene locus_tag LOCUS_10330 30013 29051 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267881.1 protein_id gnl|my_center|LOCUS_10330 31639 30200 gene locus_tag LOCUS_10340 31639 30200 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240985.1 protein_id gnl|my_center|LOCUS_10340 32120 32455 gene locus_tag LOCUS_10350 32120 32455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 32452 32706 gene locus_tag LOCUS_10360 32452 32706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 32779 33720 gene locus_tag LOCUS_10370 32779 33720 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640552.1 protein_id gnl|my_center|LOCUS_10370 33837 36950 gene locus_tag LOCUS_10380 33837 36950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 37961 37293 gene locus_tag LOCUS_10390 37961 37293 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257831.1 protein_id gnl|my_center|LOCUS_10390 38270 38073 gene locus_tag LOCUS_10400 38270 38073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 38732 38289 gene locus_tag LOCUS_10410 38732 38289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 38856 39896 gene locus_tag LOCUS_10420 38856 39896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 40004 43282 gene locus_tag LOCUS_10430 40004 43282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 43510 44433 gene locus_tag LOCUS_10440 43510 44433 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_10440 45405 44452 gene locus_tag LOCUS_10450 45405 44452 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 protein_id gnl|my_center|LOCUS_10450 45515 47494 gene locus_tag LOCUS_10460 gene prlC 45515 47494 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 protein_id gnl|my_center|LOCUS_10460 47589 48803 gene locus_tag LOCUS_10470 47589 48803 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_10470 48812 49438 gene locus_tag LOCUS_10480 48812 49438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 49505 52927 gene locus_tag LOCUS_10490 gene metH 49505 52927 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_10490 53023 54375 gene locus_tag LOCUS_10500 gene nhaA 53023 54375 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_10500 54519 55385 gene locus_tag LOCUS_10510 54519 55385 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_10510 55425 55904 gene locus_tag LOCUS_10520 55425 55904 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968070.1 protein_id gnl|my_center|LOCUS_10520 55941 58244 gene locus_tag LOCUS_10530 55941 58244 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_10530 58323 58586 gene locus_tag LOCUS_10540 58323 58586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 59821 58592 gene locus_tag LOCUS_10550 59821 58592 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_10550 60013 60876 gene locus_tag LOCUS_10560 60013 60876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 61813 60890 gene locus_tag LOCUS_10570 61813 60890 CDS product TIGR03854 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877740.1 protein_id gnl|my_center|LOCUS_10570 62486 61842 gene locus_tag LOCUS_10580 62486 61842 CDS product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409492.1 protein_id gnl|my_center|LOCUS_10580 62968 62660 gene locus_tag LOCUS_10590 62968 62660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 63578 63030 gene locus_tag LOCUS_10600 63578 63030 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975614.1 protein_id gnl|my_center|LOCUS_10600 64563 63658 gene locus_tag LOCUS_10610 64563 63658 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225710.1 protein_id gnl|my_center|LOCUS_10610 65532 64627 gene locus_tag LOCUS_10620 65532 64627 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225710.1 protein_id gnl|my_center|LOCUS_10620 66029 65670 gene locus_tag LOCUS_10630 66029 65670 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 protein_id gnl|my_center|LOCUS_10630 66106 66480 gene locus_tag LOCUS_10640 66106 66480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 66534 67079 gene locus_tag LOCUS_10650 66534 67079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 67042 67728 gene locus_tag LOCUS_10660 67042 67728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 67728 68732 gene locus_tag LOCUS_10670 67728 68732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 68738 70927 gene locus_tag LOCUS_10680 68738 70927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence11 2108 678 gene locus_tag LOCUS_10690 2108 678 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_10690 2136 2840 gene locus_tag LOCUS_10700 gene rph 2136 2840 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256154.1 protein_id gnl|my_center|LOCUS_10700 3658 2831 gene locus_tag LOCUS_10710 3658 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3851 5068 gene locus_tag LOCUS_10720 3851 5068 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_10720 6744 5131 gene locus_tag LOCUS_10730 gene serA 6744 5131 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256188.1 protein_id gnl|my_center|LOCUS_10730 7935 6811 gene locus_tag LOCUS_10740 7935 6811 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582464.1 protein_id gnl|my_center|LOCUS_10740 8057 9463 gene locus_tag LOCUS_10750 gene selA 8057 9463 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_10750 9460 10260 gene locus_tag LOCUS_10760 9460 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 10263 12701 gene locus_tag LOCUS_10770 10263 12701 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_10770 12737 13366 gene locus_tag LOCUS_10780 12737 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 13548 14393 gene locus_tag LOCUS_10790 13548 14393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 14390 15739 gene locus_tag LOCUS_10800 14390 15739 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_10800 15736 16104 gene locus_tag LOCUS_10810 15736 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 16761 16138 gene locus_tag LOCUS_10820 16761 16138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 17300 16776 gene locus_tag LOCUS_10830 17300 16776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 20289 17362 gene locus_tag LOCUS_10840 20289 17362 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_10840 20549 22525 gene locus_tag LOCUS_10850 20549 22525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 23908 22562 gene locus_tag LOCUS_10860 23908 22562 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265823.1 protein_id gnl|my_center|LOCUS_10860 25008 23926 gene locus_tag LOCUS_10870 25008 23926 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189457038.1 protein_id gnl|my_center|LOCUS_10870 25244 25663 gene locus_tag LOCUS_10880 25244 25663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 25790 27322 gene locus_tag LOCUS_10890 25790 27322 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888358.1 protein_id gnl|my_center|LOCUS_10890 29160 27334 gene locus_tag LOCUS_10900 29160 27334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 29825 29148 gene locus_tag LOCUS_10910 29825 29148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 31494 29869 gene locus_tag LOCUS_10920 31494 29869 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153412267.1 protein_id gnl|my_center|LOCUS_10920 31603 32370 gene locus_tag LOCUS_10930 31603 32370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 32428 33048 gene locus_tag LOCUS_10940 32428 33048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081632.1 protein_id gnl|my_center|LOCUS_10940 33452 33045 gene locus_tag LOCUS_10950 33452 33045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 34309 33605 gene locus_tag LOCUS_10960 34309 33605 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404399.1 protein_id gnl|my_center|LOCUS_10960 34485 34724 gene locus_tag LOCUS_10970 34485 34724 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_10970 34721 35107 gene locus_tag LOCUS_10980 34721 35107 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_10980 35886 35113 gene locus_tag LOCUS_10990 35886 35113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525180.1 protein_id gnl|my_center|LOCUS_10990 36634 35888 gene locus_tag LOCUS_11000 36634 35888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_11000 37674 36631 gene locus_tag LOCUS_11010 37674 36631 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_11010 39055 37679 gene locus_tag LOCUS_11020 39055 37679 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928723.1 protein_id gnl|my_center|LOCUS_11020 40279 39101 gene locus_tag LOCUS_11030 40279 39101 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869553.1 protein_id gnl|my_center|LOCUS_11030 41487 40441 gene locus_tag LOCUS_11040 41487 40441 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089439.1 protein_id gnl|my_center|LOCUS_11040 41904 42317 gene locus_tag LOCUS_11050 41904 42317 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088090.1 protein_id gnl|my_center|LOCUS_11050 42359 43681 gene locus_tag LOCUS_11060 42359 43681 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_11060 43839 44192 gene locus_tag LOCUS_11070 43839 44192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 45587 44499 gene locus_tag LOCUS_11080 45587 44499 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_11080 45819 47048 gene locus_tag LOCUS_11090 45819 47048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 47182 47418 gene locus_tag LOCUS_11100 47182 47418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 47446 47829 gene locus_tag LOCUS_11110 gene glxB 47446 47829 CDS product methylglyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243237.1 protein_id gnl|my_center|LOCUS_11110 48991 48101 gene locus_tag LOCUS_11120 48991 48101 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413363.1 protein_id gnl|my_center|LOCUS_11120 49954 49073 gene locus_tag LOCUS_11130 49954 49073 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_11130 52418 52044 gene locus_tag LOCUS_11140 52418 52044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 53040 53984 gene locus_tag LOCUS_11150 53040 53984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 57203 54087 gene locus_tag LOCUS_11160 57203 54087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 60006 58825 gene locus_tag LOCUS_11170 60006 58825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 59962 60162 gene locus_tag LOCUS_11180 59962 60162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 61379 60588 gene locus_tag LOCUS_11190 61379 60588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 61639 65898 gene locus_tag LOCUS_11200 61639 65898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 65999 67339 gene locus_tag LOCUS_11210 65999 67339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 67488 68204 gene locus_tag LOCUS_11220 67488 68204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 68337 69698 gene locus_tag LOCUS_11230 68337 69698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence12 125 316 gene locus_tag LOCUS_11240 125 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 393 581 gene locus_tag LOCUS_11250 393 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 588 785 gene locus_tag LOCUS_11260 588 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 782 3133 gene locus_tag LOCUS_11270 782 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3387 4484 gene locus_tag LOCUS_11280 3387 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 6554 5772 gene locus_tag LOCUS_11290 6554 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 8796 6898 gene locus_tag LOCUS_11300 8796 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 9340 9747 gene locus_tag LOCUS_11310 9340 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 10757 9975 gene locus_tag LOCUS_11320 10757 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 11756 11001 gene locus_tag LOCUS_11330 11756 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 12240 12025 gene locus_tag LOCUS_11340 12240 12025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 12128 12595 gene locus_tag LOCUS_11350 12128 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 12561 13055 gene locus_tag LOCUS_11360 12561 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 14692 13241 gene locus_tag LOCUS_11370 14692 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 15139 14846 gene locus_tag LOCUS_11380 15139 14846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 15593 15243 gene locus_tag LOCUS_11390 15593 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 16644 15874 gene locus_tag LOCUS_11400 16644 15874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 17023 18162 gene locus_tag LOCUS_11410 17023 18162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11410 18240 18722 gene locus_tag LOCUS_11420 18240 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 18725 20428 gene locus_tag LOCUS_11430 18725 20428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 20418 20849 gene locus_tag LOCUS_11440 20418 20849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 21707 20919 gene locus_tag LOCUS_11450 21707 20919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 21784 22251 gene locus_tag LOCUS_11460 21784 22251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 23314 22181 gene locus_tag LOCUS_11470 23314 22181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 23491 23345 gene locus_tag LOCUS_11480 23491 23345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 23704 23513 gene locus_tag LOCUS_11490 23704 23513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 24146 24394 gene locus_tag LOCUS_11500 24146 24394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 24633 24391 gene locus_tag LOCUS_11510 24633 24391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11510 24971 24555 gene locus_tag LOCUS_11520 24971 24555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 25551 25030 gene locus_tag LOCUS_11530 25551 25030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 26607 25636 gene locus_tag LOCUS_11540 26607 25636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 29249 26787 gene locus_tag LOCUS_11550 29249 26787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 31163 29316 gene locus_tag LOCUS_11560 31163 29316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 31370 31705 gene locus_tag LOCUS_11570 31370 31705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 32560 31688 gene locus_tag LOCUS_11580 32560 31688 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777022.1 protein_id gnl|my_center|LOCUS_11580 32797 33093 gene locus_tag LOCUS_11590 32797 33093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 33106 33819 gene locus_tag LOCUS_11600 33106 33819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 35787 34147 gene locus_tag LOCUS_11610 35787 34147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 36096 36446 gene locus_tag LOCUS_11620 36096 36446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 37881 37060 gene locus_tag LOCUS_11630 37881 37060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 38342 39532 gene locus_tag LOCUS_11640 38342 39532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 39532 40935 gene locus_tag LOCUS_11650 39532 40935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 40966 43749 gene locus_tag LOCUS_11660 40966 43749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 43746 44645 gene locus_tag LOCUS_11670 43746 44645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 44642 45259 gene locus_tag LOCUS_11680 gene cas4 44642 45259 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_11680 45454 46263 gene locus_tag LOCUS_11690 gene cas1c 45454 46263 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_11690 46268 46558 gene locus_tag LOCUS_11700 gene cas2 46268 46558 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384683.1 protein_id gnl|my_center|LOCUS_11700 46711 48418 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgtcgccggggatcaacccccg 50560 49028 gene locus_tag LOCUS_11710 50560 49028 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139084167.1 protein_id gnl|my_center|LOCUS_11710 50727 51926 gene locus_tag LOCUS_11720 50727 51926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 51829 52209 gene locus_tag LOCUS_11730 51829 52209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 52206 52538 gene locus_tag LOCUS_11740 52206 52538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 52535 52966 gene locus_tag LOCUS_11750 52535 52966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11750 54195 53413 gene locus_tag LOCUS_11760 54195 53413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 55319 55519 gene locus_tag LOCUS_11770 55319 55519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 55587 55772 gene locus_tag LOCUS_11780 55587 55772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 55818 56138 gene locus_tag LOCUS_11790 55818 56138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 56596 56823 gene locus_tag LOCUS_11800 56596 56823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11800 58276 59160 gene locus_tag LOCUS_11810 58276 59160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 59218 62586 gene locus_tag LOCUS_11820 59218 62586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 63214 63495 gene locus_tag LOCUS_11830 63214 63495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11830 63936 64142 gene locus_tag LOCUS_11840 63936 64142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 64302 67541 gene locus_tag LOCUS_11850 64302 67541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 68351 67614 gene locus_tag LOCUS_11860 68351 67614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 69076 68588 gene locus_tag LOCUS_11870 69076 68588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence13 2750 3061 gene locus_tag LOCUS_11880 gene gatC 2750 3061 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404034.1 protein_id gnl|my_center|LOCUS_11880 3058 4548 gene locus_tag LOCUS_11890 gene gatA 3058 4548 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_11890 4614 5105 gene locus_tag LOCUS_11900 4614 5105 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_11900 5294 6433 gene locus_tag LOCUS_11910 5294 6433 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257780.1 protein_id gnl|my_center|LOCUS_11910 6484 7206 gene locus_tag LOCUS_11920 6484 7206 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020781.1 protein_id gnl|my_center|LOCUS_11920 8073 7213 gene locus_tag LOCUS_11930 8073 7213 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147080.1 protein_id gnl|my_center|LOCUS_11930 8202 9116 gene locus_tag LOCUS_11940 gene ubiA 8202 9116 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467572.1 protein_id gnl|my_center|LOCUS_11940 9182 10750 gene locus_tag LOCUS_11950 9182 10750 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_11950 10795 11256 gene locus_tag LOCUS_11960 10795 11256 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_11960 12258 11257 gene locus_tag LOCUS_11970 gene trpS 12258 11257 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_11970 13960 12278 gene locus_tag LOCUS_11980 gene argS 13960 12278 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_11980 16831 14276 gene locus_tag LOCUS_11990 gene recG 16831 14276 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545417.1 protein_id gnl|my_center|LOCUS_11990 17679 16831 gene locus_tag LOCUS_12000 17679 16831 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459812.1 protein_id gnl|my_center|LOCUS_12000 19341 17749 gene locus_tag LOCUS_12010 19341 17749 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905189.1 protein_id gnl|my_center|LOCUS_12010 19853 20329 gene locus_tag LOCUS_12020 19853 20329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 20366 21499 gene locus_tag LOCUS_12030 20366 21499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 protein_id gnl|my_center|LOCUS_12030 22182 21496 gene locus_tag LOCUS_12040 gene rpe 22182 21496 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174250.1 protein_id gnl|my_center|LOCUS_12040 23714 22179 gene locus_tag LOCUS_12050 gene argH 23714 22179 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_12050 24084 23725 gene locus_tag LOCUS_12060 24084 23725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 25385 24132 gene locus_tag LOCUS_12070 25385 24132 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932792.1 protein_id gnl|my_center|LOCUS_12070 26720 25536 gene locus_tag LOCUS_12080 26720 25536 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_12080 29821 26816 gene locus_tag LOCUS_12090 29821 26816 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_12090 30612 29833 gene locus_tag LOCUS_12100 gene argB 30612 29833 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918172.1 protein_id gnl|my_center|LOCUS_12100 30687 31727 gene locus_tag LOCUS_12110 30687 31727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 31997 31743 gene locus_tag LOCUS_12120 31997 31743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 32328 31972 gene locus_tag LOCUS_12130 32328 31972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 33579 32362 gene locus_tag LOCUS_12140 gene argJ 33579 32362 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_12140 34649 33576 gene locus_tag LOCUS_12150 gene argC 34649 33576 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459299.1 protein_id gnl|my_center|LOCUS_12150 34763 35965 gene locus_tag LOCUS_12160 34763 35965 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064432.1 protein_id gnl|my_center|LOCUS_12160 35969 36760 gene locus_tag LOCUS_12170 gene paaG 35969 36760 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 protein_id gnl|my_center|LOCUS_12170 36774 38018 gene locus_tag LOCUS_12180 36774 38018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 39603 38020 gene locus_tag LOCUS_12190 39603 38020 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812114.1 protein_id gnl|my_center|LOCUS_12190 40996 39596 gene locus_tag LOCUS_12200 40996 39596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 41048 41782 gene locus_tag LOCUS_12210 41048 41782 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_12210 41819 42508 gene locus_tag LOCUS_12220 41819 42508 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_12220 42531 42628 gene locus_tag LOCUS_t00100 42531 42628 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 43762 42647 gene locus_tag LOCUS_12230 43762 42647 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_12230 44532 43765 gene locus_tag LOCUS_12240 44532 43765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 45443 44529 gene locus_tag LOCUS_12250 45443 44529 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 protein_id gnl|my_center|LOCUS_12250 46805 45468 gene locus_tag LOCUS_12260 46805 45468 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222955.1 protein_id gnl|my_center|LOCUS_12260 48085 46949 gene locus_tag LOCUS_12270 48085 46949 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225697.1 protein_id gnl|my_center|LOCUS_12270 48171 49205 gene locus_tag LOCUS_12280 48171 49205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 49889 49206 gene locus_tag LOCUS_12290 49889 49206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 51661 50609 gene locus_tag LOCUS_12300 51661 50609 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461131.1 protein_id gnl|my_center|LOCUS_12300 52146 51661 gene locus_tag LOCUS_12310 52146 51661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 52887 52207 gene locus_tag LOCUS_12320 52887 52207 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_12320 53456 52914 gene locus_tag LOCUS_12330 53456 52914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12330 54179 53466 gene locus_tag LOCUS_12340 54179 53466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12340 54293 55177 gene locus_tag LOCUS_12350 54293 55177 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_12350 55498 56664 gene locus_tag LOCUS_12360 55498 56664 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986854.1 protein_id gnl|my_center|LOCUS_12360 56739 57506 gene locus_tag LOCUS_12370 56739 57506 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728229.1 protein_id gnl|my_center|LOCUS_12370 57506 58741 gene locus_tag LOCUS_12380 57506 58741 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400620.1 protein_id gnl|my_center|LOCUS_12380 60090 58738 gene locus_tag LOCUS_12390 60090 58738 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_12390 60246 60106 gene locus_tag LOCUS_12400 60246 60106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 61638 60286 gene locus_tag LOCUS_12410 61638 60286 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486431.1 protein_id gnl|my_center|LOCUS_12410 62104 61685 gene locus_tag LOCUS_12420 62104 61685 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897979.1 protein_id gnl|my_center|LOCUS_12420 63303 62104 gene locus_tag LOCUS_12430 63303 62104 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731361.1 protein_id gnl|my_center|LOCUS_12430 <65056 63366 gene locus_tag LOCUS_12440 <65056 63366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259183.1:CaiB/BaiF CoA-transferase family protein >Feature sequence14 1686 3002 gene locus_tag LOCUS_12450 1686 3002 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036453339.1 protein_id gnl|my_center|LOCUS_12450 3732 3061 gene locus_tag LOCUS_12460 3732 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 4673 3771 gene locus_tag LOCUS_12470 4673 3771 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730159.1 protein_id gnl|my_center|LOCUS_12470 4786 5685 gene locus_tag LOCUS_12480 4786 5685 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12480 5725 6624 gene locus_tag LOCUS_12490 5725 6624 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_12490 6660 7580 gene locus_tag LOCUS_12500 6660 7580 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_12500 8026 7577 gene locus_tag LOCUS_12510 8026 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 9408 8047 gene locus_tag LOCUS_12520 9408 8047 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459193.1 protein_id gnl|my_center|LOCUS_12520 9497 10687 gene locus_tag LOCUS_12530 9497 10687 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113133.1 protein_id gnl|my_center|LOCUS_12530 11994 10684 gene locus_tag LOCUS_12540 11994 10684 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258743.1 protein_id gnl|my_center|LOCUS_12540 12090 13133 gene locus_tag LOCUS_12550 12090 13133 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594045.1 protein_id gnl|my_center|LOCUS_12550 14538 13111 gene locus_tag LOCUS_12560 14538 13111 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948188.1 protein_id gnl|my_center|LOCUS_12560 14558 15238 gene locus_tag LOCUS_12570 14558 15238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 16667 15231 gene locus_tag LOCUS_12580 16667 15231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 16831 17616 gene locus_tag LOCUS_12590 16831 17616 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395936.1 protein_id gnl|my_center|LOCUS_12590 17627 18736 gene locus_tag LOCUS_12600 17627 18736 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260258.1 protein_id gnl|my_center|LOCUS_12600 18873 19037 gene locus_tag LOCUS_12610 18873 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 19402 19157 gene locus_tag LOCUS_12620 19402 19157 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_12620 20486 19479 gene locus_tag LOCUS_12630 20486 19479 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_12630 20627 21496 gene locus_tag LOCUS_12640 20627 21496 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 protein_id gnl|my_center|LOCUS_12640 21511 22284 gene locus_tag LOCUS_12650 21511 22284 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_12650 22754 22281 gene locus_tag LOCUS_12660 22754 22281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 23167 22751 gene locus_tag LOCUS_12670 23167 22751 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223930.1 protein_id gnl|my_center|LOCUS_12670 23580 23164 gene locus_tag LOCUS_12680 23580 23164 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005123490.1 protein_id gnl|my_center|LOCUS_12680 25898 23826 gene locus_tag LOCUS_12690 25898 23826 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_12690 25989 26756 gene locus_tag LOCUS_12700 25989 26756 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_12700 26778 27263 gene locus_tag LOCUS_12710 26778 27263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 27266 27559 gene locus_tag LOCUS_12720 27266 27559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 28188 27556 gene locus_tag LOCUS_12730 28188 27556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 29522 28188 gene locus_tag LOCUS_12740 29522 28188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 29599 30540 gene locus_tag LOCUS_12750 29599 30540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 31844 30588 gene locus_tag LOCUS_12760 gene eis2 31844 30588 CDS product amikacin resistance N-acetyltransferase Eis2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079811.1 protein_id gnl|my_center|LOCUS_12760 32004 32717 gene locus_tag LOCUS_12770 32004 32717 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461981.1 protein_id gnl|my_center|LOCUS_12770 32790 34295 gene locus_tag LOCUS_12780 32790 34295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 34297 35091 gene locus_tag LOCUS_12790 34297 35091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 35198 36202 gene locus_tag LOCUS_12800 35198 36202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 36233 37288 gene locus_tag LOCUS_12810 36233 37288 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404317.1 protein_id gnl|my_center|LOCUS_12810 37329 38534 gene locus_tag LOCUS_12820 37329 38534 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225686.1 protein_id gnl|my_center|LOCUS_12820 38587 39390 gene locus_tag LOCUS_12830 38587 39390 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_12830 39508 40455 gene locus_tag LOCUS_12840 39508 40455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 40480 41427 gene locus_tag LOCUS_12850 40480 41427 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284372.1 protein_id gnl|my_center|LOCUS_12850 41582 44143 gene locus_tag LOCUS_12860 41582 44143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 44284 45594 gene locus_tag LOCUS_12870 44284 45594 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_12870 45650 46939 gene locus_tag LOCUS_12880 45650 46939 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532975.1 protein_id gnl|my_center|LOCUS_12880 46974 48425 gene locus_tag LOCUS_12890 46974 48425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 49477 48407 gene locus_tag LOCUS_12900 49477 48407 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_12900 50341 49490 gene locus_tag LOCUS_12910 50341 49490 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532983.1 protein_id gnl|my_center|LOCUS_12910 51162 50401 gene locus_tag LOCUS_12920 51162 50401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_12920 51941 51159 gene locus_tag LOCUS_12930 51941 51159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 protein_id gnl|my_center|LOCUS_12930 52313 51951 gene locus_tag LOCUS_12940 52313 51951 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140931.1 protein_id gnl|my_center|LOCUS_12940 52359 53141 gene locus_tag LOCUS_12950 gene gpmA 52359 53141 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807430.1 protein_id gnl|my_center|LOCUS_12950 54085 53213 gene locus_tag LOCUS_12960 54085 53213 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_12960 54375 54725 gene locus_tag LOCUS_12970 54375 54725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 54865 55923 gene locus_tag LOCUS_12980 54865 55923 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_12980 58685 55920 gene locus_tag LOCUS_12990 58685 55920 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056008.1 protein_id gnl|my_center|LOCUS_12990 59612 58743 gene locus_tag LOCUS_13000 59612 58743 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812031.1 protein_id gnl|my_center|LOCUS_13000 60471 59605 gene locus_tag LOCUS_13010 60471 59605 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_13010 61439 60453 gene locus_tag LOCUS_13020 61439 60453 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391451.1 protein_id gnl|my_center|LOCUS_13020 62497 61520 gene locus_tag LOCUS_13030 62497 61520 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_13030 <63244 62529 gene locus_tag LOCUS_13040 <63244 62529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225234.1:SDR family oxidoreductase >Feature sequence15 2882 864 gene locus_tag LOCUS_13050 2882 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4934 2949 gene locus_tag LOCUS_13060 4934 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 6141 4966 gene locus_tag LOCUS_13070 6141 4966 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_13070 6279 8672 gene locus_tag LOCUS_13080 6279 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 8678 9109 gene locus_tag LOCUS_13090 8678 9109 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_13090 10215 9097 gene locus_tag LOCUS_13100 10215 9097 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039287.1 protein_id gnl|my_center|LOCUS_13100 10404 10219 gene locus_tag LOCUS_13110 10404 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 10899 10768 gene locus_tag LOCUS_13120 10899 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 10943 12229 gene locus_tag LOCUS_13130 gene mtaB 10943 12229 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_13130 12226 12819 gene locus_tag LOCUS_13140 gene scpB 12226 12819 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_13140 12816 13109 gene locus_tag LOCUS_13150 12816 13109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 14392 13106 gene locus_tag LOCUS_13160 gene rimO 14392 13106 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257724.1 protein_id gnl|my_center|LOCUS_13160 15168 14392 gene locus_tag LOCUS_13170 15168 14392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 16217 15171 gene locus_tag LOCUS_13180 16217 15171 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_13180 16589 16257 gene locus_tag LOCUS_13190 gene rpsT 16589 16257 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082168.1 protein_id gnl|my_center|LOCUS_13190 16730 18361 gene locus_tag LOCUS_13200 gene murJ 16730 18361 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_13200 18474 18947 gene locus_tag LOCUS_13210 18474 18947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 18976 19296 gene locus_tag LOCUS_13220 18976 19296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 19280 22672 gene locus_tag LOCUS_13230 gene ileS 19280 22672 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258550.1 protein_id gnl|my_center|LOCUS_13230 23789 22680 gene locus_tag LOCUS_13240 23789 22680 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767549.1 protein_id gnl|my_center|LOCUS_13240 23861 24988 gene locus_tag LOCUS_13250 gene proB 23861 24988 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909083.1 protein_id gnl|my_center|LOCUS_13250 25200 25898 gene locus_tag LOCUS_13260 25200 25898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 26091 26969 gene locus_tag LOCUS_13270 26091 26969 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_13270 26979 28088 gene locus_tag LOCUS_13280 26979 28088 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080059.1 protein_id gnl|my_center|LOCUS_13280 28199 29281 gene locus_tag LOCUS_13290 28199 29281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 29887 29297 gene locus_tag LOCUS_13300 29887 29297 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172421.1 protein_id gnl|my_center|LOCUS_13300 31257 30106 gene locus_tag LOCUS_13310 31257 30106 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_13310 31403 32263 gene locus_tag LOCUS_13320 31403 32263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 32287 33000 gene locus_tag LOCUS_13330 32287 33000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 33893 33663 gene locus_tag LOCUS_13340 33893 33663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 33853 34080 gene locus_tag LOCUS_13350 33853 34080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 34198 35598 gene locus_tag LOCUS_13360 34198 35598 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086725.1 protein_id gnl|my_center|LOCUS_13360 35900 35595 gene locus_tag LOCUS_13370 35900 35595 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888483.1 protein_id gnl|my_center|LOCUS_13370 36444 35935 gene locus_tag LOCUS_13380 gene sufU 36444 35935 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 protein_id gnl|my_center|LOCUS_13380 37697 36447 gene locus_tag LOCUS_13390 37697 36447 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376739.1 protein_id gnl|my_center|LOCUS_13390 38010 37699 gene locus_tag LOCUS_13400 38010 37699 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259323.1 protein_id gnl|my_center|LOCUS_13400 39368 38007 gene locus_tag LOCUS_13410 gene sufD 39368 38007 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_13410 40841 39426 gene locus_tag LOCUS_13420 gene sufB 40841 39426 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_13420 41605 40838 gene locus_tag LOCUS_13430 gene sufC 41605 40838 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136057.1 protein_id gnl|my_center|LOCUS_13430 42313 41666 gene locus_tag LOCUS_13440 42313 41666 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_13440 43307 42501 gene locus_tag LOCUS_13450 43307 42501 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028243.1 protein_id gnl|my_center|LOCUS_13450 44181 43423 gene locus_tag LOCUS_13460 44181 43423 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224130.1 protein_id gnl|my_center|LOCUS_13460 44554 45648 gene locus_tag LOCUS_13470 44554 45648 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030013.1 protein_id gnl|my_center|LOCUS_13470 46698 45676 gene locus_tag LOCUS_13480 46698 45676 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615893.1 protein_id gnl|my_center|LOCUS_13480 47724 46801 gene locus_tag LOCUS_13490 47724 46801 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080429.1 protein_id gnl|my_center|LOCUS_13490 48762 48070 gene locus_tag LOCUS_13500 48762 48070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 50228 48939 gene locus_tag LOCUS_13510 50228 48939 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101557.1 protein_id gnl|my_center|LOCUS_13510 51703 50225 gene locus_tag LOCUS_13520 51703 50225 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249190.1 protein_id gnl|my_center|LOCUS_13520 53250 51805 gene locus_tag LOCUS_13530 53250 51805 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101557.1 protein_id gnl|my_center|LOCUS_13530 54022 53291 gene locus_tag LOCUS_13540 54022 53291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 54151 55182 gene locus_tag LOCUS_13550 54151 55182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 55305 56474 gene locus_tag LOCUS_13560 55305 56474 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_13560 56605 57750 gene locus_tag LOCUS_13570 56605 57750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 57820 59172 gene locus_tag LOCUS_13580 57820 59172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 59224 60963 gene locus_tag LOCUS_13590 gene ctaD 59224 60963 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227525.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence16 90 1 gene locus_tag LOCUS_t00110 90 1 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1350 265 gene locus_tag LOCUS_13600 1350 265 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090622.1 protein_id gnl|my_center|LOCUS_13600 1518 1432 gene locus_tag LOCUS_t00120 1518 1432 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4071 1543 gene locus_tag LOCUS_13610 4071 1543 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_13610 4372 4055 gene locus_tag LOCUS_13620 4372 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 4595 5506 gene locus_tag LOCUS_13630 gene argF 4595 5506 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_13630 5589 6497 gene locus_tag LOCUS_13640 gene cdaA 5589 6497 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257450.1 protein_id gnl|my_center|LOCUS_13640 6498 7793 gene locus_tag LOCUS_13650 6498 7793 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461864.1 protein_id gnl|my_center|LOCUS_13650 7786 9195 gene locus_tag LOCUS_13660 gene der 7786 9195 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_13660 9188 9805 gene locus_tag LOCUS_13670 gene plsY 9188 9805 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_13670 9811 10800 gene locus_tag LOCUS_13680 9811 10800 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858849.1 protein_id gnl|my_center|LOCUS_13680 10800 11798 gene locus_tag LOCUS_13690 10800 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 11955 12380 gene locus_tag LOCUS_13700 11955 12380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 12437 13003 gene locus_tag LOCUS_13710 12437 13003 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257130.1 protein_id gnl|my_center|LOCUS_13710 13507 13040 gene locus_tag LOCUS_13720 13507 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 14070 13552 gene locus_tag LOCUS_13730 14070 13552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 14837 14130 gene locus_tag LOCUS_13740 14837 14130 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048417.1 protein_id gnl|my_center|LOCUS_13740 15406 14975 gene locus_tag LOCUS_13750 15406 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 15788 16168 gene locus_tag LOCUS_13760 gene ndhC 15788 16168 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_13760 16170 16769 gene locus_tag LOCUS_13770 16170 16769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 16766 17926 gene locus_tag LOCUS_13780 16766 17926 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257853.1 protein_id gnl|my_center|LOCUS_13780 17923 19239 gene locus_tag LOCUS_13790 17923 19239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 19243 19854 gene locus_tag LOCUS_13800 19243 19854 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_13800 19851 20165 gene locus_tag LOCUS_13810 gene nuoK 19851 20165 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_13810 20173 20367 gene locus_tag LOCUS_13820 20173 20367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 20372 22402 gene locus_tag LOCUS_13830 gene nuoL 20372 22402 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_13830 22412 23965 gene locus_tag LOCUS_13840 22412 23965 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_13840 23965 25434 gene locus_tag LOCUS_13850 23965 25434 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_13850 25532 25912 gene locus_tag LOCUS_13860 25532 25912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 25974 27665 gene locus_tag LOCUS_13870 25974 27665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 28067 28360 gene locus_tag LOCUS_13880 28067 28360 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_13880 28372 29001 gene locus_tag LOCUS_13890 gene recR 28372 29001 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_13890 29001 29828 gene locus_tag LOCUS_13900 gene recO 29001 29828 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_13900 29815 30255 gene locus_tag LOCUS_13910 29815 30255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 31246 30266 gene locus_tag LOCUS_13920 31246 30266 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460185.1 protein_id gnl|my_center|LOCUS_13920 31301 32317 gene locus_tag LOCUS_13930 31301 32317 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_13930 33037 32258 gene locus_tag LOCUS_13940 33037 32258 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_13940 34704 33037 gene locus_tag LOCUS_13950 gene metG 34704 33037 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259302.1 protein_id gnl|my_center|LOCUS_13950 35620 34790 gene locus_tag LOCUS_13960 gene rsmI 35620 34790 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530019.1 protein_id gnl|my_center|LOCUS_13960 35964 36764 gene locus_tag LOCUS_13970 35964 36764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 37045 38265 gene locus_tag LOCUS_13980 37045 38265 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141602.1 protein_id gnl|my_center|LOCUS_13980 39549 38377 gene locus_tag LOCUS_13990 39549 38377 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 protein_id gnl|my_center|LOCUS_13990 40409 39546 gene locus_tag LOCUS_14000 gene prmC 40409 39546 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_14000 41476 40406 gene locus_tag LOCUS_14010 gene prfA 41476 40406 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_14010 42828 41518 gene locus_tag LOCUS_14020 gene hisS 42828 41518 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830876.1 protein_id gnl|my_center|LOCUS_14020 42936 45140 gene locus_tag LOCUS_14030 42936 45140 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_14030 46285 45152 gene locus_tag LOCUS_14040 46285 45152 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_14040 46439 47992 gene locus_tag LOCUS_14050 46439 47992 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_14050 48132 50108 gene locus_tag LOCUS_14060 48132 50108 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 protein_id gnl|my_center|LOCUS_14060 50151 50225 gene locus_tag LOCUS_t00130 50151 50225 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 51060 50242 gene locus_tag LOCUS_14070 51060 50242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 51460 51969 gene locus_tag LOCUS_14080 51460 51969 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_14080 52037 52525 gene locus_tag LOCUS_14090 52037 52525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 52545 52796 gene locus_tag LOCUS_14100 52545 52796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 53280 52858 gene locus_tag LOCUS_14110 53280 52858 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 protein_id gnl|my_center|LOCUS_14110 53804 53319 gene locus_tag LOCUS_14120 53804 53319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 53891 56326 gene locus_tag LOCUS_14130 53891 56326 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence17 278 1552 gene locus_tag LOCUS_14140 278 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1591 2385 gene locus_tag LOCUS_14150 gene pcaD 1591 2385 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_14150 2414 4348 gene locus_tag LOCUS_14160 2414 4348 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232910.1 protein_id gnl|my_center|LOCUS_14160 5193 4354 gene locus_tag LOCUS_14170 5193 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 6117 5239 gene locus_tag LOCUS_14180 gene garR 6117 5239 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 protein_id gnl|my_center|LOCUS_14180 6191 7393 gene locus_tag LOCUS_14190 6191 7393 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811630.1 protein_id gnl|my_center|LOCUS_14190 7383 8669 gene locus_tag LOCUS_14200 7383 8669 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_14200 8692 9078 gene locus_tag LOCUS_14210 8692 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 9091 10260 gene locus_tag LOCUS_14220 9091 10260 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_14220 10344 11105 gene locus_tag LOCUS_14230 10344 11105 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921513.1 protein_id gnl|my_center|LOCUS_14230 13010 11118 gene locus_tag LOCUS_14240 13010 11118 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095490734.1 protein_id gnl|my_center|LOCUS_14240 13099 14385 gene locus_tag LOCUS_14250 13099 14385 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727666.1 protein_id gnl|my_center|LOCUS_14250 15160 14399 gene locus_tag LOCUS_14260 15160 14399 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 protein_id gnl|my_center|LOCUS_14260 16480 15284 gene locus_tag LOCUS_14270 16480 15284 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_14270 18265 16553 gene locus_tag LOCUS_14280 18265 16553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 19478 18315 gene locus_tag LOCUS_14290 19478 18315 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392555.1 protein_id gnl|my_center|LOCUS_14290 20407 19466 gene locus_tag LOCUS_14300 20407 19466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 21131 20397 gene locus_tag LOCUS_14310 21131 20397 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_14310 21764 21192 gene locus_tag LOCUS_14320 gene frr 21764 21192 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_14320 22567 21809 gene locus_tag LOCUS_14330 gene pyrH 22567 21809 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042663.1 protein_id gnl|my_center|LOCUS_14330 23100 22606 gene locus_tag LOCUS_14340 gene tsf 23100 22606 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259403.1 protein_id gnl|my_center|LOCUS_14340 23927 23172 gene locus_tag LOCUS_14350 gene rpsB 23927 23172 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_14350 24082 24396 gene locus_tag LOCUS_14360 24082 24396 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975630.1 protein_id gnl|my_center|LOCUS_14360 24433 24897 gene locus_tag LOCUS_14370 gene dtd 24433 24897 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_14370 25830 24955 gene locus_tag LOCUS_14380 gene nadC 25830 24955 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_14380 27386 25827 gene locus_tag LOCUS_14390 gene nadB 27386 25827 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140848.1 protein_id gnl|my_center|LOCUS_14390 28576 27344 gene locus_tag LOCUS_14400 gene nadA 28576 27344 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_14400 29389 28715 gene locus_tag LOCUS_14410 29389 28715 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_14410 30761 29394 gene locus_tag LOCUS_14420 gene miaB 30761 29394 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258276.1 protein_id gnl|my_center|LOCUS_14420 30871 30782 gene locus_tag LOCUS_t00140 30871 30782 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30945 31928 gene locus_tag LOCUS_14430 30945 31928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 32161 31958 gene locus_tag LOCUS_14440 32161 31958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 33108 32185 gene locus_tag LOCUS_14450 gene sucD 33108 32185 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256597.1 protein_id gnl|my_center|LOCUS_14450 34466 33177 gene locus_tag LOCUS_14460 gene sucC 34466 33177 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721255.1 protein_id gnl|my_center|LOCUS_14460 34549 36165 gene locus_tag LOCUS_14470 34549 36165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 36914 36162 gene locus_tag LOCUS_14480 36914 36162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 37397 36933 gene locus_tag LOCUS_14490 37397 36933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 37915 37556 gene locus_tag LOCUS_14500 37915 37556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 38177 38518 gene locus_tag LOCUS_14510 38177 38518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 38524 39291 gene locus_tag LOCUS_14520 38524 39291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 40326 39241 gene locus_tag LOCUS_14530 40326 39241 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_14530 40432 40797 gene locus_tag LOCUS_14540 40432 40797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 41143 40910 gene locus_tag LOCUS_14550 41143 40910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 41415 41837 gene locus_tag LOCUS_14560 41415 41837 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929743.1 protein_id gnl|my_center|LOCUS_14560 41879 43144 gene locus_tag LOCUS_14570 41879 43144 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085742.1 protein_id gnl|my_center|LOCUS_14570 43246 43686 gene locus_tag LOCUS_14580 43246 43686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 43858 44649 gene locus_tag LOCUS_14590 gene thiD 43858 44649 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403990.1 protein_id gnl|my_center|LOCUS_14590 44642 45289 gene locus_tag LOCUS_14600 gene thiE 44642 45289 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404299.1 protein_id gnl|my_center|LOCUS_14600 45286 46437 gene locus_tag LOCUS_14610 gene thiO 45286 46437 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_14610 46434 47624 gene locus_tag LOCUS_14620 gene thiO 46434 47624 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_14620 47621 47845 gene locus_tag LOCUS_14630 47621 47845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 47854 48675 gene locus_tag LOCUS_14640 47854 48675 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_14640 48719 49357 gene locus_tag LOCUS_14650 gene tenA 48719 49357 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_14650 49354 50379 gene locus_tag LOCUS_14660 49354 50379 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530798.1 protein_id gnl|my_center|LOCUS_14660 50389 51156 gene locus_tag LOCUS_14670 50389 51156 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 protein_id gnl|my_center|LOCUS_14670 51153 51935 gene locus_tag LOCUS_14680 51153 51935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172561.1 protein_id gnl|my_center|LOCUS_14680 51932 52534 gene locus_tag LOCUS_14690 51932 52534 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926997.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence18 <1 962 gene locus_tag LOCUS_14700 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479923.1:leucine--tRNA ligase 988 1791 gene locus_tag LOCUS_14710 988 1791 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259072.1 protein_id gnl|my_center|LOCUS_14710 1867 2820 gene locus_tag LOCUS_14720 1867 2820 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_14720 2842 4104 gene locus_tag LOCUS_14730 gene tyrS 2842 4104 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_14730 4112 4468 gene locus_tag LOCUS_14740 4112 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 4625 4807 gene locus_tag LOCUS_14750 4625 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4808 4984 gene locus_tag LOCUS_14760 4808 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 5027 5947 gene locus_tag LOCUS_14770 5027 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 5947 6966 gene locus_tag LOCUS_14780 5947 6966 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225667.1 protein_id gnl|my_center|LOCUS_14780 7038 7229 gene locus_tag LOCUS_14790 7038 7229 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897302.1 protein_id gnl|my_center|LOCUS_14790 10081 7226 gene locus_tag LOCUS_14800 10081 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 10133 10318 gene locus_tag LOCUS_14810 10133 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 13333 10349 gene locus_tag LOCUS_14820 13333 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 14671 13343 gene locus_tag LOCUS_14830 gene cyp124 14671 13343 CDS product methyl-branched lipid omega-hydroxylase Cyp124 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411654.1 protein_id gnl|my_center|LOCUS_14830 16073 14748 gene locus_tag LOCUS_14840 gene cyp124 16073 14748 CDS product methyl-branched lipid omega-hydroxylase Cyp124 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411654.1 protein_id gnl|my_center|LOCUS_14840 17451 16123 gene locus_tag LOCUS_14850 gene cyp124 17451 16123 CDS product methyl-branched lipid omega-hydroxylase Cyp124 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411654.1 protein_id gnl|my_center|LOCUS_14850 18004 18300 gene locus_tag LOCUS_14860 18004 18300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 18284 19795 gene locus_tag LOCUS_14870 18284 19795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 19824 20684 gene locus_tag LOCUS_14880 19824 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 20947 21615 gene locus_tag LOCUS_14890 20947 21615 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_14890 21647 22459 gene locus_tag LOCUS_14900 21647 22459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 24801 22456 gene locus_tag LOCUS_14910 gene priA 24801 22456 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259672.1 protein_id gnl|my_center|LOCUS_14910 24970 26259 gene locus_tag LOCUS_14920 24970 26259 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085351.1 protein_id gnl|my_center|LOCUS_14920 27774 26269 gene locus_tag LOCUS_14930 gene lysS 27774 26269 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_14930 28272 27832 gene locus_tag LOCUS_14940 gene greA 28272 27832 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_14940 28564 29616 gene locus_tag LOCUS_14950 28564 29616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 29763 31469 gene locus_tag LOCUS_14960 29763 31469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 31469 32050 gene locus_tag LOCUS_14970 gene rsmD 31469 32050 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415001.1 protein_id gnl|my_center|LOCUS_14970 32047 32529 gene locus_tag LOCUS_14980 gene coaD 32047 32529 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459625.1 protein_id gnl|my_center|LOCUS_14980 32641 33186 gene locus_tag LOCUS_14990 32641 33186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 34355 33306 gene locus_tag LOCUS_15000 gene aroF 34355 33306 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258092.1 protein_id gnl|my_center|LOCUS_15000 34836 34372 gene locus_tag LOCUS_15010 gene aroH 34836 34372 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258091.1 protein_id gnl|my_center|LOCUS_15010 35888 35013 gene locus_tag LOCUS_15020 gene trpA 35888 35013 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256579.1 protein_id gnl|my_center|LOCUS_15020 36653 35898 gene locus_tag LOCUS_15030 36653 35898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 37837 36656 gene locus_tag LOCUS_15040 gene trpB 37837 36656 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_15040 38517 37834 gene locus_tag LOCUS_15050 38517 37834 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258566.1 protein_id gnl|my_center|LOCUS_15050 39299 38514 gene locus_tag LOCUS_15060 gene trpC 39299 38514 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_15060 40364 39312 gene locus_tag LOCUS_15070 gene trpD 40364 39312 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_15070 40965 40357 gene locus_tag LOCUS_15080 40965 40357 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_15080 41770 40955 gene locus_tag LOCUS_15090 41770 40955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 43099 41834 gene locus_tag LOCUS_15100 43099 41834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 44607 43099 gene locus_tag LOCUS_15110 gene trpE 44607 43099 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257292.1 protein_id gnl|my_center|LOCUS_15110 45442 44846 gene locus_tag LOCUS_15120 gene gmk 45442 44846 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055909.1 protein_id gnl|my_center|LOCUS_15120 46730 45429 gene locus_tag LOCUS_15130 gene aroA 46730 45429 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460209.1 protein_id gnl|my_center|LOCUS_15130 47763 46735 gene locus_tag LOCUS_15140 47763 46735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 48142 49317 gene locus_tag LOCUS_15150 48142 49317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 49318 49394 gene locus_tag LOCUS_t00150 49318 49394 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 49839 49639 gene locus_tag LOCUS_15160 49839 49639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 49928 51133 gene locus_tag LOCUS_15170 49928 51133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 51250 51579 gene locus_tag LOCUS_15180 51250 51579 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105450.1 protein_id gnl|my_center|LOCUS_15180 51583 51966 gene locus_tag LOCUS_15190 51583 51966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence19 4029 2935 gene locus_tag LOCUS_15200 gene leuB 4029 2935 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399139.1 protein_id gnl|my_center|LOCUS_15200 4248 4087 gene locus_tag LOCUS_15210 4248 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 4607 4449 gene locus_tag LOCUS_15220 4607 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 5364 4774 gene locus_tag LOCUS_15230 gene leuD 5364 4774 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_15230 6309 5419 gene locus_tag LOCUS_15240 6309 5419 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090229.1 protein_id gnl|my_center|LOCUS_15240 7115 6366 gene locus_tag LOCUS_15250 7115 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 8306 7164 gene locus_tag LOCUS_15260 8306 7164 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_15260 9033 8695 gene locus_tag LOCUS_15270 9033 8695 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 protein_id gnl|my_center|LOCUS_15270 9392 9033 gene locus_tag LOCUS_15280 9392 9033 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222856.1 protein_id gnl|my_center|LOCUS_15280 11993 9525 gene locus_tag LOCUS_15290 gene gyrA 11993 9525 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244540.1 protein_id gnl|my_center|LOCUS_15290 12712 12029 gene locus_tag LOCUS_15300 12712 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 12808 13806 gene locus_tag LOCUS_15310 12808 13806 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123535.1 protein_id gnl|my_center|LOCUS_15310 13907 14581 gene locus_tag LOCUS_15320 13907 14581 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_15320 15649 14603 gene locus_tag LOCUS_15330 15649 14603 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_15330 16981 15686 gene locus_tag LOCUS_15340 gene murA 16981 15686 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358006.1 protein_id gnl|my_center|LOCUS_15340 17463 17020 gene locus_tag LOCUS_15350 17463 17020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 18906 17497 gene locus_tag LOCUS_15360 gene atpD 18906 17497 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_15360 19608 18931 gene locus_tag LOCUS_15370 19608 18931 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977711.1 protein_id gnl|my_center|LOCUS_15370 20490 19612 gene locus_tag LOCUS_15380 20490 19612 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258894.1 protein_id gnl|my_center|LOCUS_15380 22061 20535 gene locus_tag LOCUS_15390 gene atpA 22061 20535 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_15390 22623 22084 gene locus_tag LOCUS_15400 22623 22084 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289009.1 protein_id gnl|my_center|LOCUS_15400 23133 22633 gene locus_tag LOCUS_15410 gene atpF 23133 22633 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393859.1 protein_id gnl|my_center|LOCUS_15410 23482 23234 gene locus_tag LOCUS_15420 gene atpE 23482 23234 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258898.1 protein_id gnl|my_center|LOCUS_15420 25125 23572 gene locus_tag LOCUS_15430 25125 23572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 25415 25122 gene locus_tag LOCUS_15440 25415 25122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 26060 25530 gene locus_tag LOCUS_15450 26060 25530 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_15450 27494 26160 gene locus_tag LOCUS_15460 27494 26160 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228796.1 protein_id gnl|my_center|LOCUS_15460 28273 27491 gene locus_tag LOCUS_15470 gene pyrF 28273 27491 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_15470 28357 29130 gene locus_tag LOCUS_15480 28357 29130 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_15480 30549 29086 gene locus_tag LOCUS_15490 30549 29086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 32084 30546 gene locus_tag LOCUS_15500 32084 30546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 33107 32124 gene locus_tag LOCUS_15510 33107 32124 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_15510 33197 34462 gene locus_tag LOCUS_15520 33197 34462 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_15520 35513 34467 gene locus_tag LOCUS_15530 35513 34467 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240578.1 protein_id gnl|my_center|LOCUS_15530 36443 35517 gene locus_tag LOCUS_15540 36443 35517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 36540 36743 gene locus_tag LOCUS_15550 36540 36743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 36904 38112 gene locus_tag LOCUS_15560 36904 38112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 38145 38987 gene locus_tag LOCUS_15570 38145 38987 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902971.1 protein_id gnl|my_center|LOCUS_15570 39169 40143 gene locus_tag LOCUS_15580 39169 40143 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727013.1 protein_id gnl|my_center|LOCUS_15580 41366 40140 gene locus_tag LOCUS_15590 41366 40140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 43027 41603 gene locus_tag LOCUS_15600 43027 41603 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878633.1 protein_id gnl|my_center|LOCUS_15600 44429 43038 gene locus_tag LOCUS_15610 44429 43038 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924850.1 protein_id gnl|my_center|LOCUS_15610 45803 44439 gene locus_tag LOCUS_15620 45803 44439 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878633.1 protein_id gnl|my_center|LOCUS_15620 47221 45803 gene locus_tag LOCUS_15630 47221 45803 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878633.1 protein_id gnl|my_center|LOCUS_15630 48612 47218 gene locus_tag LOCUS_15640 48612 47218 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878633.1 protein_id gnl|my_center|LOCUS_15640 49013 49936 gene locus_tag LOCUS_15650 49013 49936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence20 1508 180 gene locus_tag LOCUS_15660 1508 180 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_15660 3002 1839 gene locus_tag LOCUS_15670 3002 1839 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920848.1 protein_id gnl|my_center|LOCUS_15670 3958 3200 gene locus_tag LOCUS_15680 3958 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 4231 3983 gene locus_tag LOCUS_15690 4231 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 4564 4391 gene locus_tag LOCUS_15700 4564 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5180 4806 gene locus_tag LOCUS_15710 5180 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5520 5203 gene locus_tag LOCUS_15720 5520 5203 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393501.1 protein_id gnl|my_center|LOCUS_15720 6435 5599 gene locus_tag LOCUS_15730 6435 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 7551 6466 gene locus_tag LOCUS_15740 gene ychF 7551 6466 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_15740 8126 7635 gene locus_tag LOCUS_15750 8126 7635 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771224.1 protein_id gnl|my_center|LOCUS_15750 8642 8133 gene locus_tag LOCUS_15760 8642 8133 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493257.1 protein_id gnl|my_center|LOCUS_15760 8783 10843 gene locus_tag LOCUS_15770 gene gyrB 8783 10843 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868886.1 protein_id gnl|my_center|LOCUS_15770 10848 11510 gene locus_tag LOCUS_15780 10848 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 12185 11538 gene locus_tag LOCUS_15790 gene nadD 12185 11538 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895960.1 protein_id gnl|my_center|LOCUS_15790 13447 12173 gene locus_tag LOCUS_15800 gene obgE 13447 12173 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257169.1 protein_id gnl|my_center|LOCUS_15800 15162 13753 gene locus_tag LOCUS_15810 gene dnaA 15162 13753 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815138.1 protein_id gnl|my_center|LOCUS_15810 15555 16331 gene locus_tag LOCUS_15820 15555 16331 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_15820 16328 17572 gene locus_tag LOCUS_15830 gene coaBC 16328 17572 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259488.1 protein_id gnl|my_center|LOCUS_15830 17893 17579 gene locus_tag LOCUS_15840 17893 17579 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_15840 18609 17911 gene locus_tag LOCUS_15850 18609 17911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 18725 20221 gene locus_tag LOCUS_15860 18725 20221 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_15860 20259 20600 gene locus_tag LOCUS_15870 20259 20600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 21087 20794 gene locus_tag LOCUS_15880 21087 20794 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_15880 21593 21249 gene locus_tag LOCUS_15890 21593 21249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 21805 22071 gene locus_tag LOCUS_15900 gene rpsO 21805 22071 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084034.1 protein_id gnl|my_center|LOCUS_15900 22243 24951 gene locus_tag LOCUS_15910 gene pnp 22243 24951 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_15910 24988 25794 gene locus_tag LOCUS_15920 gene dapB 24988 25794 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_15920 25836 26861 gene locus_tag LOCUS_15930 gene asd 25836 26861 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_15930 26890 27837 gene locus_tag LOCUS_15940 26890 27837 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083943.1 protein_id gnl|my_center|LOCUS_15940 27910 28827 gene locus_tag LOCUS_15950 gene dapA 27910 28827 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_15950 28834 29328 gene locus_tag LOCUS_15960 28834 29328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 30072 29356 gene locus_tag LOCUS_15970 30072 29356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 30834 30256 gene locus_tag LOCUS_15980 30834 30256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 31094 30903 gene locus_tag LOCUS_15990 31094 30903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 31162 32724 gene locus_tag LOCUS_16000 31162 32724 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_16000 32921 33901 gene locus_tag LOCUS_16010 32921 33901 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808077.1 protein_id gnl|my_center|LOCUS_16010 33997 35805 gene locus_tag LOCUS_16020 33997 35805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 35954 37792 gene locus_tag LOCUS_16030 35954 37792 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459198.1 protein_id gnl|my_center|LOCUS_16030 37965 38918 gene locus_tag LOCUS_16040 37965 38918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311351.1 protein_id gnl|my_center|LOCUS_16040 38911 39852 gene locus_tag LOCUS_16050 38911 39852 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_16050 40632 39859 gene locus_tag LOCUS_16060 40632 39859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 41435 40644 gene locus_tag LOCUS_16070 41435 40644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 42220 41600 gene locus_tag LOCUS_16080 42220 41600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 43188 42514 gene locus_tag LOCUS_16090 43188 42514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 44392 43505 gene locus_tag LOCUS_16100 44392 43505 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064413.1 protein_id gnl|my_center|LOCUS_16100 45419 44469 gene locus_tag LOCUS_16110 45419 44469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 45958 45425 gene locus_tag LOCUS_16120 45958 45425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 47351 46062 gene locus_tag LOCUS_16130 47351 46062 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205037.1 protein_id gnl|my_center|LOCUS_16130 47508 48062 gene locus_tag LOCUS_16140 47508 48062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 48064 48894 gene locus_tag LOCUS_16150 48064 48894 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393238.1 protein_id gnl|my_center|LOCUS_16150 49389 48898 gene locus_tag LOCUS_16160 49389 48898 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_16160 <50244 49466 gene locus_tag LOCUS_16170 <50244 49466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728068.1:acyl-CoA dehydrogenase family protein >Feature sequence21 1823 3937 gene locus_tag LOCUS_16180 1823 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3986 4252 gene locus_tag LOCUS_16190 3986 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 4328 5056 gene locus_tag LOCUS_16200 4328 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 5056 6462 gene locus_tag LOCUS_16210 5056 6462 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 protein_id gnl|my_center|LOCUS_16210 6473 6832 gene locus_tag LOCUS_16220 6473 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 7365 6811 gene locus_tag LOCUS_16230 7365 6811 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957123.1 protein_id gnl|my_center|LOCUS_16230 7483 10575 gene locus_tag LOCUS_16240 7483 10575 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_16240 11051 11260 gene locus_tag LOCUS_16250 11051 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 11325 11555 gene locus_tag LOCUS_16260 11325 11555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 13768 12107 gene locus_tag LOCUS_16270 13768 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 14088 15026 gene locus_tag LOCUS_16280 14088 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 15060 15899 gene locus_tag LOCUS_16290 15060 15899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 15933 16421 gene locus_tag LOCUS_16300 15933 16421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 16562 17845 gene locus_tag LOCUS_16310 16562 17845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 18570 18295 gene locus_tag LOCUS_16320 18570 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 19278 19721 gene locus_tag LOCUS_16330 19278 19721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 20066 20431 gene locus_tag LOCUS_16340 20066 20431 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224021.1 protein_id gnl|my_center|LOCUS_16340 20770 21846 gene locus_tag LOCUS_16350 20770 21846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 21839 24157 gene locus_tag LOCUS_16360 21839 24157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 24154 25389 gene locus_tag LOCUS_16370 24154 25389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 25398 26033 gene locus_tag LOCUS_16380 25398 26033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 26544 28193 gene locus_tag LOCUS_16390 26544 28193 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495579.1 protein_id gnl|my_center|LOCUS_16390 28190 29038 gene locus_tag LOCUS_16400 28190 29038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 29914 29468 gene locus_tag LOCUS_16410 29914 29468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 30567 31052 gene locus_tag LOCUS_16420 30567 31052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 31668 32507 gene locus_tag LOCUS_16430 31668 32507 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731517.1 protein_id gnl|my_center|LOCUS_16430 33485 36832 gene locus_tag LOCUS_16440 33485 36832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 37463 39322 gene locus_tag LOCUS_16450 37463 39322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793970.1 protein_id gnl|my_center|LOCUS_16450 39777 41825 gene locus_tag LOCUS_16460 39777 41825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 42619 45738 gene locus_tag LOCUS_16470 42619 45738 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533561.1 protein_id gnl|my_center|LOCUS_16470 46044 46415 gene locus_tag LOCUS_16480 46044 46415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 46479 47165 gene locus_tag LOCUS_16490 46479 47165 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074041.1 protein_id gnl|my_center|LOCUS_16490 47759 47355 gene locus_tag LOCUS_16500 47759 47355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 <48970 48037 gene locus_tag LOCUS_16510 <48970 48037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257272.1:Calx-beta domain-containing protein >Feature sequence22 1369 2019 gene locus_tag LOCUS_16520 gene hisH 1369 2019 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256250.1 protein_id gnl|my_center|LOCUS_16520 2016 2777 gene locus_tag LOCUS_16530 gene hisA 2016 2777 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199906.1 protein_id gnl|my_center|LOCUS_16530 2796 3581 gene locus_tag LOCUS_16540 gene hisF 2796 3581 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_16540 3565 3915 gene locus_tag LOCUS_16550 3565 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 3989 4183 gene locus_tag LOCUS_16560 3989 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 4183 4650 gene locus_tag LOCUS_16570 gene hicB 4183 4650 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 protein_id gnl|my_center|LOCUS_16570 4886 4674 gene locus_tag LOCUS_16580 gene rpmE 4886 4674 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_16580 5161 4883 gene locus_tag LOCUS_16590 gene rpmA 5161 4883 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759983.1 protein_id gnl|my_center|LOCUS_16590 5707 5171 gene locus_tag LOCUS_16600 5707 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 7851 5842 gene locus_tag LOCUS_16610 gene ftsH 7851 5842 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_16610 8100 9854 gene locus_tag LOCUS_16620 8100 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 9897 10553 gene locus_tag LOCUS_16630 gene rnhB 9897 10553 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063751.1 protein_id gnl|my_center|LOCUS_16630 10537 10944 gene locus_tag LOCUS_16640 10537 10944 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_16640 10977 11249 gene locus_tag LOCUS_16650 10977 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 11282 11626 gene locus_tag LOCUS_16660 11282 11626 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_16660 11774 13852 gene locus_tag LOCUS_16670 11774 13852 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_16670 14138 13959 gene locus_tag LOCUS_16680 14138 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 14214 15533 gene locus_tag LOCUS_16690 14214 15533 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067967.1 protein_id gnl|my_center|LOCUS_16690 15971 15690 gene locus_tag LOCUS_16700 15971 15690 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858631.1 protein_id gnl|my_center|LOCUS_16700 19057 16133 gene locus_tag LOCUS_16710 gene uvrA 19057 16133 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_16710 19190 21973 gene locus_tag LOCUS_16720 gene polA 19190 21973 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 protein_id gnl|my_center|LOCUS_16720 21991 22842 gene locus_tag LOCUS_16730 21991 22842 CDS product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057029.1 protein_id gnl|my_center|LOCUS_16730 22852 23715 gene locus_tag LOCUS_16740 gene mutM 22852 23715 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257743.1 protein_id gnl|my_center|LOCUS_16740 23740 24129 gene locus_tag LOCUS_16750 23740 24129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 24181 25077 gene locus_tag LOCUS_16760 24181 25077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 25088 25876 gene locus_tag LOCUS_16770 25088 25876 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921388.1 protein_id gnl|my_center|LOCUS_16770 25900 26817 gene locus_tag LOCUS_16780 25900 26817 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_16780 26810 27862 gene locus_tag LOCUS_16790 26810 27862 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_16790 27875 28663 gene locus_tag LOCUS_16800 gene surE 27875 28663 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073291.1 protein_id gnl|my_center|LOCUS_16800 28706 29452 gene locus_tag LOCUS_16810 28706 29452 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393206.1 protein_id gnl|my_center|LOCUS_16810 29462 29956 gene locus_tag LOCUS_16820 gene ruvC 29462 29956 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_16820 29953 30606 gene locus_tag LOCUS_16830 gene ruvA 29953 30606 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_16830 31213 33354 gene locus_tag LOCUS_16840 gene uvrB 31213 33354 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256952.1 protein_id gnl|my_center|LOCUS_16840 33486 34316 gene locus_tag LOCUS_16850 33486 34316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 36719 34326 gene locus_tag LOCUS_16860 36719 34326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 38620 36935 gene locus_tag LOCUS_16870 38620 36935 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256877.1 protein_id gnl|my_center|LOCUS_16870 39285 38647 gene locus_tag LOCUS_16880 39285 38647 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_16880 40933 39983 gene locus_tag LOCUS_16890 gene tatC 40933 39983 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141910.1 protein_id gnl|my_center|LOCUS_16890 41560 40985 gene locus_tag LOCUS_16900 41560 40985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 41900 41643 gene locus_tag LOCUS_16910 gene acpP 41900 41643 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280528.1 protein_id gnl|my_center|LOCUS_16910 42388 41915 gene locus_tag LOCUS_16920 gene nusB 42388 41915 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_16920 43331 42363 gene locus_tag LOCUS_16930 gene fabD 43331 42363 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258269.1 protein_id gnl|my_center|LOCUS_16930 43516 43334 gene locus_tag LOCUS_16940 43516 43334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 44056 43520 gene locus_tag LOCUS_16950 44056 43520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 44240 44935 gene locus_tag LOCUS_16960 44240 44935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 44968 46437 gene locus_tag LOCUS_16970 44968 46437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 46549 46842 gene locus_tag LOCUS_16980 46549 46842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 46821 47159 gene locus_tag LOCUS_16990 46821 47159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 47237 47632 gene locus_tag LOCUS_17000 47237 47632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence23 79 3 gene locus_tag LOCUS_t00160 79 3 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1095 109 gene locus_tag LOCUS_17010 1095 109 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_17010 1396 1172 gene locus_tag LOCUS_17020 1396 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1284 1553 gene locus_tag LOCUS_17030 1284 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1880 3016 gene locus_tag LOCUS_17040 gene apbC 1880 3016 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_17040 3338 3970 gene locus_tag LOCUS_17050 3338 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 4823 3984 gene locus_tag LOCUS_17060 4823 3984 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966131.1 protein_id gnl|my_center|LOCUS_17060 6265 4907 gene locus_tag LOCUS_17070 6265 4907 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_17070 7597 6275 gene locus_tag LOCUS_17080 7597 6275 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 protein_id gnl|my_center|LOCUS_17080 9079 7625 gene locus_tag LOCUS_17090 9079 7625 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_17090 9895 9101 gene locus_tag LOCUS_17100 9895 9101 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132575.1 protein_id gnl|my_center|LOCUS_17100 10403 9912 gene locus_tag LOCUS_17110 10403 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 10739 10419 gene locus_tag LOCUS_17120 10739 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 12097 10787 gene locus_tag LOCUS_17130 12097 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17130 13341 12097 gene locus_tag LOCUS_17140 13341 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17140 13390 14604 gene locus_tag LOCUS_17150 13390 14604 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064432.1 protein_id gnl|my_center|LOCUS_17150 14604 15890 gene locus_tag LOCUS_17160 14604 15890 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 protein_id gnl|my_center|LOCUS_17160 16353 15871 gene locus_tag LOCUS_17170 16353 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 17203 16334 gene locus_tag LOCUS_17180 17203 16334 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892776.1 protein_id gnl|my_center|LOCUS_17180 17478 17209 gene locus_tag LOCUS_17190 17478 17209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 17524 18249 gene locus_tag LOCUS_17200 17524 18249 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 protein_id gnl|my_center|LOCUS_17200 18306 19013 gene locus_tag LOCUS_17210 18306 19013 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_17210 19092 20336 gene locus_tag LOCUS_17220 19092 20336 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228589.1 protein_id gnl|my_center|LOCUS_17220 21442 20333 gene locus_tag LOCUS_17230 21442 20333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 22425 21496 gene locus_tag LOCUS_17240 22425 21496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 23441 22422 gene locus_tag LOCUS_17250 23441 22422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 23502 23891 gene locus_tag LOCUS_17260 23502 23891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 24206 25027 gene locus_tag LOCUS_17270 gene fabG 24206 25027 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_17270 25072 25872 gene locus_tag LOCUS_17280 25072 25872 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921431.1 protein_id gnl|my_center|LOCUS_17280 26453 25869 gene locus_tag LOCUS_17290 26453 25869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 27167 26463 gene locus_tag LOCUS_17300 27167 26463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 27254 28609 gene locus_tag LOCUS_17310 27254 28609 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259633.1 protein_id gnl|my_center|LOCUS_17310 28761 33314 gene locus_tag LOCUS_17320 gene gltB 28761 33314 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_17320 33841 33359 gene locus_tag LOCUS_17330 33841 33359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 35712 33853 gene locus_tag LOCUS_17340 35712 33853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 36293 35802 gene locus_tag LOCUS_17350 36293 35802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 37405 36290 gene locus_tag LOCUS_17360 37405 36290 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_17360 38186 37410 gene locus_tag LOCUS_17370 38186 37410 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_17370 38303 39016 gene locus_tag LOCUS_17380 38303 39016 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_17380 40011 39013 gene locus_tag LOCUS_17390 40011 39013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 40399 40040 gene locus_tag LOCUS_17400 40399 40040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 41654 40401 gene locus_tag LOCUS_17410 41654 40401 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_17410 42664 41663 gene locus_tag LOCUS_17420 42664 41663 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_17420 42810 44057 gene locus_tag LOCUS_17430 42810 44057 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896596.1 protein_id gnl|my_center|LOCUS_17430 45330 44128 gene locus_tag LOCUS_17440 45330 44128 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085742.1 protein_id gnl|my_center|LOCUS_17440 45837 45421 gene locus_tag LOCUS_17450 45837 45421 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_17450 46519 45899 gene locus_tag LOCUS_17460 46519 45899 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939628.1 protein_id gnl|my_center|LOCUS_17460 46920 46615 gene locus_tag LOCUS_17470 46920 46615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence24 <1 807 gene locus_tag LOCUS_17480 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391701.1:aldehyde ferredoxin oxidoreductase family protein 993 1448 gene locus_tag LOCUS_17490 993 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1445 1981 gene locus_tag LOCUS_17500 1445 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2445 1978 gene locus_tag LOCUS_17510 2445 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3040 2558 gene locus_tag LOCUS_17520 3040 2558 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532767.1 protein_id gnl|my_center|LOCUS_17520 3166 3945 gene locus_tag LOCUS_17530 3166 3945 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 protein_id gnl|my_center|LOCUS_17530 3996 4817 gene locus_tag LOCUS_17540 3996 4817 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_17540 5193 4828 gene locus_tag LOCUS_17550 5193 4828 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142681.1 protein_id gnl|my_center|LOCUS_17550 5424 5194 gene locus_tag LOCUS_17560 5424 5194 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_17560 6413 5469 gene locus_tag LOCUS_17570 6413 5469 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877923.1 protein_id gnl|my_center|LOCUS_17570 6863 6456 gene locus_tag LOCUS_17580 6863 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 6747 7316 gene locus_tag LOCUS_17590 6747 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 7320 8366 gene locus_tag LOCUS_17600 7320 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 8508 9464 gene locus_tag LOCUS_17610 8508 9464 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811980.1 protein_id gnl|my_center|LOCUS_17610 9468 10376 gene locus_tag LOCUS_17620 9468 10376 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729761.1 protein_id gnl|my_center|LOCUS_17620 10779 10438 gene locus_tag LOCUS_17630 10779 10438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 10675 12336 gene locus_tag LOCUS_17640 10675 12336 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973850.1 protein_id gnl|my_center|LOCUS_17640 14633 12360 gene locus_tag LOCUS_17650 14633 12360 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_17650 15456 14647 gene locus_tag LOCUS_17660 15456 14647 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_17660 17947 15671 gene locus_tag LOCUS_17670 17947 15671 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_17670 18083 19192 gene locus_tag LOCUS_17680 18083 19192 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815298.1 protein_id gnl|my_center|LOCUS_17680 20235 19345 gene locus_tag LOCUS_17690 20235 19345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_17690 21188 20232 gene locus_tag LOCUS_17700 21188 20232 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267881.1 protein_id gnl|my_center|LOCUS_17700 23120 21273 gene locus_tag LOCUS_17710 23120 21273 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965798.1 protein_id gnl|my_center|LOCUS_17710 24884 23241 gene locus_tag LOCUS_17720 24884 23241 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_17720 24798 25154 gene locus_tag LOCUS_17730 24798 25154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 26379 25207 gene locus_tag LOCUS_17740 gene dgoD 26379 25207 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_17740 29036 26595 gene locus_tag LOCUS_17750 29036 26595 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_17750 29417 30169 gene locus_tag LOCUS_17760 29417 30169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 30216 31445 gene locus_tag LOCUS_17770 30216 31445 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 protein_id gnl|my_center|LOCUS_17770 31473 32705 gene locus_tag LOCUS_17780 31473 32705 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 protein_id gnl|my_center|LOCUS_17780 32752 33054 gene locus_tag LOCUS_17790 32752 33054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 33327 35114 gene locus_tag LOCUS_17800 33327 35114 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_17800 35653 35396 gene locus_tag LOCUS_17810 35653 35396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 35546 37252 gene locus_tag LOCUS_17820 35546 37252 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459110.1 protein_id gnl|my_center|LOCUS_17820 37283 38221 gene locus_tag LOCUS_17830 37283 38221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385604.1 protein_id gnl|my_center|LOCUS_17830 38221 39120 gene locus_tag LOCUS_17840 38221 39120 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538206.1 protein_id gnl|my_center|LOCUS_17840 39185 40300 gene locus_tag LOCUS_17850 39185 40300 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926593.1 protein_id gnl|my_center|LOCUS_17850 41199 40345 gene locus_tag LOCUS_17860 41199 40345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 41885 41226 gene locus_tag LOCUS_17870 41885 41226 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078328667.1 protein_id gnl|my_center|LOCUS_17870 42326 41904 gene locus_tag LOCUS_17880 42326 41904 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071869.1 protein_id gnl|my_center|LOCUS_17880 42450 43340 gene locus_tag LOCUS_17890 42450 43340 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413363.1 protein_id gnl|my_center|LOCUS_17890 43370 43846 gene locus_tag LOCUS_17900 43370 43846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 43930 44406 gene locus_tag LOCUS_17910 43930 44406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence25 1306 281 gene locus_tag LOCUS_17920 gene tilS 1306 281 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057455.1 protein_id gnl|my_center|LOCUS_17920 1795 1328 gene locus_tag LOCUS_17930 1795 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2461 1847 gene locus_tag LOCUS_17940 2461 1847 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256529.1 protein_id gnl|my_center|LOCUS_17940 3135 2458 gene locus_tag LOCUS_17950 3135 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4109 3132 gene locus_tag LOCUS_17960 gene meaB 4109 3132 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255953.1 protein_id gnl|my_center|LOCUS_17960 4537 4106 gene locus_tag LOCUS_17970 4537 4106 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_17970 5380 4568 gene locus_tag LOCUS_17980 5380 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 5860 5408 gene locus_tag LOCUS_17990 5860 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 7646 5967 gene locus_tag LOCUS_18000 7646 5967 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_18000 8392 7733 gene locus_tag LOCUS_18010 8392 7733 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894962.1 protein_id gnl|my_center|LOCUS_18010 8846 8427 gene locus_tag LOCUS_18020 8846 8427 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720981.1 protein_id gnl|my_center|LOCUS_18020 8957 8881 gene locus_tag LOCUS_t00170 8957 8881 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10160 8985 gene locus_tag LOCUS_18030 10160 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 10829 10221 gene locus_tag LOCUS_18040 10829 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 10969 11044 gene locus_tag LOCUS_t00180 10969 11044 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11115 11191 gene locus_tag LOCUS_t00190 11115 11191 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11282 11368 gene locus_tag LOCUS_t00200 11282 11368 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11415 11491 gene locus_tag LOCUS_t00210 11415 11491 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11763 12491 gene locus_tag LOCUS_18050 11763 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 12702 14642 gene locus_tag LOCUS_18060 gene uvrC 12702 14642 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257899.1 protein_id gnl|my_center|LOCUS_18060 15941 14643 gene locus_tag LOCUS_18070 gene eno 15941 14643 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_18070 16898 15984 gene locus_tag LOCUS_18080 gene xerD 16898 15984 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_18080 17106 17657 gene locus_tag LOCUS_18090 17106 17657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 17654 18541 gene locus_tag LOCUS_18100 17654 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 18725 19750 gene locus_tag LOCUS_18110 gene gap 18725 19750 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_18110 19792 21141 gene locus_tag LOCUS_18120 gene ffh 19792 21141 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257918.1 protein_id gnl|my_center|LOCUS_18120 21224 21541 gene locus_tag LOCUS_18130 21224 21541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 21553 21780 gene locus_tag LOCUS_18140 21553 21780 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883358.1 protein_id gnl|my_center|LOCUS_18140 21788 22348 gene locus_tag LOCUS_18150 gene rimM 21788 22348 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_18150 22396 22471 gene locus_tag LOCUS_t00220 22396 22471 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 23320 22571 gene locus_tag LOCUS_18160 23320 22571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 25859 23451 gene locus_tag LOCUS_18170 25859 23451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 26001 35561 gene locus_tag LOCUS_18180 26001 35561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 35731 35552 gene locus_tag LOCUS_18190 35731 35552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 35969 37045 gene locus_tag LOCUS_18200 35969 37045 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_18200 37070 37972 gene locus_tag LOCUS_18210 37070 37972 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_18210 38034 38540 gene locus_tag LOCUS_18220 gene cobO 38034 38540 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258439.1 protein_id gnl|my_center|LOCUS_18220 38559 39632 gene locus_tag LOCUS_18230 gene cobT 38559 39632 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 protein_id gnl|my_center|LOCUS_18230 39629 40390 gene locus_tag LOCUS_18240 gene cobS 39629 40390 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_18240 40399 41073 gene locus_tag LOCUS_18250 gene cobC 40399 41073 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_18250 41077 41616 gene locus_tag LOCUS_18260 gene cobU 41077 41616 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530724.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence26 498 322 gene locus_tag LOCUS_18270 498 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 982 530 gene locus_tag LOCUS_18280 982 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 2080 1052 gene locus_tag LOCUS_18290 2080 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2256 2077 gene locus_tag LOCUS_18300 2256 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2444 2253 gene locus_tag LOCUS_18310 2444 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 3091 2441 gene locus_tag LOCUS_18320 3091 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3340 3143 gene locus_tag LOCUS_18330 3340 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 5098 3389 gene locus_tag LOCUS_18340 5098 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 6066 5662 gene locus_tag LOCUS_18350 6066 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 6542 6168 gene locus_tag LOCUS_18360 6542 6168 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942796.1 protein_id gnl|my_center|LOCUS_18360 7044 6676 gene locus_tag LOCUS_18370 7044 6676 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942796.1 protein_id gnl|my_center|LOCUS_18370 8281 7181 gene locus_tag LOCUS_18380 8281 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 9284 8334 gene locus_tag LOCUS_18390 9284 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 10517 9471 gene locus_tag LOCUS_18400 10517 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 10972 10514 gene locus_tag LOCUS_18410 10972 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 11627 11082 gene locus_tag LOCUS_18420 11627 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 12304 12561 gene locus_tag LOCUS_18430 12304 12561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 15237 13405 gene locus_tag LOCUS_18440 15237 13405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 15862 16068 gene locus_tag LOCUS_18450 15862 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 17348 16116 gene locus_tag LOCUS_18460 17348 16116 CDS product McrBC 5-methylcytosine restriction system component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804187.1 protein_id gnl|my_center|LOCUS_18460 19726 17345 gene locus_tag LOCUS_18470 19726 17345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 22105 20534 gene locus_tag LOCUS_18480 22105 20534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 23564 22638 gene locus_tag LOCUS_18490 23564 22638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 24090 24686 gene locus_tag LOCUS_18500 24090 24686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 24693 25667 gene locus_tag LOCUS_18510 24693 25667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 25822 26124 gene locus_tag LOCUS_18520 25822 26124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 26152 27972 gene locus_tag LOCUS_18530 26152 27972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 27972 28298 gene locus_tag LOCUS_18540 27972 28298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 28316 30583 gene locus_tag LOCUS_18550 28316 30583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 30634 33216 gene locus_tag LOCUS_18560 30634 33216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 33213 34850 gene locus_tag LOCUS_18570 33213 34850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 35241 34876 gene locus_tag LOCUS_18580 35241 34876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 35534 35238 gene locus_tag LOCUS_18590 35534 35238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 35710 35531 gene locus_tag LOCUS_18600 35710 35531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 36885 36124 gene locus_tag LOCUS_18610 36885 36124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 36997 37200 gene locus_tag LOCUS_18620 36997 37200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 37285 38607 gene locus_tag LOCUS_18630 37285 38607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 39436 38789 gene locus_tag LOCUS_18640 39436 38789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 39840 39436 gene locus_tag LOCUS_18650 39840 39436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 40299 40670 gene locus_tag LOCUS_18660 40299 40670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence27 311 790 gene locus_tag LOCUS_18670 311 790 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081451.1 protein_id gnl|my_center|LOCUS_18670 841 1014 gene locus_tag LOCUS_18680 841 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 1459 983 gene locus_tag LOCUS_18690 1459 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 1764 1459 gene locus_tag LOCUS_18700 1764 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1840 2367 gene locus_tag LOCUS_18710 1840 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2438 3289 gene locus_tag LOCUS_18720 2438 3289 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_18720 3315 4097 gene locus_tag LOCUS_18730 3315 4097 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140557.1 protein_id gnl|my_center|LOCUS_18730 4094 4870 gene locus_tag LOCUS_18740 gene xth 4094 4870 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967248.1 protein_id gnl|my_center|LOCUS_18740 6272 4848 gene locus_tag LOCUS_18750 6272 4848 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_18750 8243 6273 gene locus_tag LOCUS_18760 8243 6273 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_18760 8334 11219 gene locus_tag LOCUS_18770 gene ppc 8334 11219 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 protein_id gnl|my_center|LOCUS_18770 11698 11240 gene locus_tag LOCUS_18780 11698 11240 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061010.1 protein_id gnl|my_center|LOCUS_18780 12879 11698 gene locus_tag LOCUS_18790 12879 11698 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730955.1 protein_id gnl|my_center|LOCUS_18790 15700 13220 gene locus_tag LOCUS_18800 15700 13220 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_18800 16040 15810 gene locus_tag LOCUS_18810 16040 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 16221 17099 gene locus_tag LOCUS_18820 16221 17099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 17769 17107 gene locus_tag LOCUS_18830 17769 17107 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_18830 17895 18212 gene locus_tag LOCUS_18840 17895 18212 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 protein_id gnl|my_center|LOCUS_18840 18234 19427 gene locus_tag LOCUS_18850 18234 19427 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 protein_id gnl|my_center|LOCUS_18850 20565 19417 gene locus_tag LOCUS_18860 20565 19417 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086088.1 protein_id gnl|my_center|LOCUS_18860 21811 20597 gene locus_tag LOCUS_18870 21811 20597 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_18870 21872 23233 gene locus_tag LOCUS_18880 gene purB 21872 23233 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345327.1 protein_id gnl|my_center|LOCUS_18880 23402 23701 gene locus_tag LOCUS_18890 23402 23701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 23876 24559 gene locus_tag LOCUS_18900 23876 24559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 24594 25931 gene locus_tag LOCUS_18910 24594 25931 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_18910 26770 25928 gene locus_tag LOCUS_18920 26770 25928 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256673.1 protein_id gnl|my_center|LOCUS_18920 27338 26736 gene locus_tag LOCUS_18930 27338 26736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 27391 29673 gene locus_tag LOCUS_18940 27391 29673 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257189.1 protein_id gnl|my_center|LOCUS_18940 30590 29670 gene locus_tag LOCUS_18950 30590 29670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 30627 31361 gene locus_tag LOCUS_18960 30627 31361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 33184 31340 gene locus_tag LOCUS_18970 33184 31340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 33533 33282 gene locus_tag LOCUS_18980 33533 33282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 33627 33701 gene locus_tag LOCUS_t00230 33627 33701 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33755 35023 gene locus_tag LOCUS_18990 33755 35023 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809990.1 protein_id gnl|my_center|LOCUS_18990 36353 35034 gene locus_tag LOCUS_19000 36353 35034 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814774.1 protein_id gnl|my_center|LOCUS_19000 36905 36375 gene locus_tag LOCUS_19010 36905 36375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 38003 36993 gene locus_tag LOCUS_19020 38003 36993 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_19020 38818 38000 gene locus_tag LOCUS_19030 38818 38000 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222374.1 protein_id gnl|my_center|LOCUS_19030 38856 39581 gene locus_tag LOCUS_19040 38856 39581 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_19040 39913 39590 gene locus_tag LOCUS_19050 39913 39590 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence28 195 386 gene locus_tag LOCUS_19060 195 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1081 326 gene locus_tag LOCUS_19070 1081 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2015 1146 gene locus_tag LOCUS_19080 2015 1146 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_19080 3079 2012 gene locus_tag LOCUS_19090 3079 2012 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_19090 3581 3168 gene locus_tag LOCUS_19100 3581 3168 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_19100 4847 3663 gene locus_tag LOCUS_19110 4847 3663 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967073.1 protein_id gnl|my_center|LOCUS_19110 4948 5601 gene locus_tag LOCUS_19120 4948 5601 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877376.1 protein_id gnl|my_center|LOCUS_19120 5603 6388 gene locus_tag LOCUS_19130 5603 6388 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728686.1 protein_id gnl|my_center|LOCUS_19130 7285 6461 gene locus_tag LOCUS_19140 7285 6461 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087742.1 protein_id gnl|my_center|LOCUS_19140 7424 8623 gene locus_tag LOCUS_19150 7424 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 8680 9909 gene locus_tag LOCUS_19160 gene frc 8680 9909 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226411.1 protein_id gnl|my_center|LOCUS_19160 10025 11245 gene locus_tag LOCUS_19170 gene frc 10025 11245 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972395.1 protein_id gnl|my_center|LOCUS_19170 12139 11258 gene locus_tag LOCUS_19180 12139 11258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368430.1 protein_id gnl|my_center|LOCUS_19180 13077 12139 gene locus_tag LOCUS_19190 13077 12139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385604.1 protein_id gnl|my_center|LOCUS_19190 15048 13150 gene locus_tag LOCUS_19200 15048 13150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 15272 15484 gene locus_tag LOCUS_19210 15272 15484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 15491 15862 gene locus_tag LOCUS_19220 15491 15862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 16410 18818 gene locus_tag LOCUS_19230 16410 18818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 19499 21931 gene locus_tag LOCUS_19240 19499 21931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 22114 23346 gene locus_tag LOCUS_19250 gene frc 22114 23346 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226411.1 protein_id gnl|my_center|LOCUS_19250 23504 24019 gene locus_tag LOCUS_19260 23504 24019 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185796.1 protein_id gnl|my_center|LOCUS_19260 24322 24600 gene locus_tag LOCUS_19270 24322 24600 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_19270 24622 24906 gene locus_tag LOCUS_19280 24622 24906 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_19280 25704 25210 gene locus_tag LOCUS_19290 25704 25210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 25795 26004 gene locus_tag LOCUS_19300 25795 26004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 27194 26250 gene locus_tag LOCUS_19310 27194 26250 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_19310 28388 27201 gene locus_tag LOCUS_19320 gene solA 28388 27201 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_19320 28460 29287 gene locus_tag LOCUS_19330 28460 29287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 29783 29334 gene locus_tag LOCUS_19340 29783 29334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 30924 29884 gene locus_tag LOCUS_19350 gene ephM 30924 29884 CDS product epoxide hydrolase EphM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243419.1 protein_id gnl|my_center|LOCUS_19350 31426 30974 gene locus_tag LOCUS_19360 31426 30974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 31644 31426 gene locus_tag LOCUS_19370 31644 31426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 32694 31717 gene locus_tag LOCUS_19380 32694 31717 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229093.1 protein_id gnl|my_center|LOCUS_19380 33258 35972 gene locus_tag LOCUS_19390 33258 35972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence29 1851 937 gene locus_tag LOCUS_19400 1851 937 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104248.1 protein_id gnl|my_center|LOCUS_19400 4035 1861 gene locus_tag LOCUS_19410 4035 1861 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393788.1 protein_id gnl|my_center|LOCUS_19410 4541 4032 gene locus_tag LOCUS_19420 4541 4032 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942266.1 protein_id gnl|my_center|LOCUS_19420 4628 5782 gene locus_tag LOCUS_19430 4628 5782 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040775.1 protein_id gnl|my_center|LOCUS_19430 6082 5861 gene locus_tag LOCUS_19440 6082 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 6388 6104 gene locus_tag LOCUS_19450 6388 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 7483 6410 gene locus_tag LOCUS_19460 7483 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_19460 7687 9351 gene locus_tag LOCUS_19470 7687 9351 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 protein_id gnl|my_center|LOCUS_19470 9348 10826 gene locus_tag LOCUS_19480 gene tcuA 9348 10826 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_19480 10813 11553 gene locus_tag LOCUS_19490 10813 11553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 11938 11543 gene locus_tag LOCUS_19500 11938 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 12339 12013 gene locus_tag LOCUS_19510 12339 12013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 13933 12371 gene locus_tag LOCUS_19520 13933 12371 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039293.1 protein_id gnl|my_center|LOCUS_19520 16969 14000 gene locus_tag LOCUS_19530 16969 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 20025 16966 gene locus_tag LOCUS_19540 20025 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 20510 20172 gene locus_tag LOCUS_19550 gene glnK1 20510 20172 CDS product P-II family nitrogen regulator GlnK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869551.1 protein_id gnl|my_center|LOCUS_19550 22127 20631 gene locus_tag LOCUS_19560 22127 20631 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256890.1 protein_id gnl|my_center|LOCUS_19560 22893 22534 gene locus_tag LOCUS_19570 22893 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 23018 23836 gene locus_tag LOCUS_19580 23018 23836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 23846 24259 gene locus_tag LOCUS_19590 23846 24259 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111791.1 protein_id gnl|my_center|LOCUS_19590 24764 25849 gene locus_tag LOCUS_19600 24764 25849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 26514 25846 gene locus_tag LOCUS_19610 26514 25846 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170039298.1 protein_id gnl|my_center|LOCUS_19610 26395 26670 gene locus_tag LOCUS_19620 26395 26670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 27647 26679 gene locus_tag LOCUS_19630 27647 26679 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_19630 27779 28711 gene locus_tag LOCUS_19640 27779 28711 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640552.1 protein_id gnl|my_center|LOCUS_19640 28761 29762 gene locus_tag LOCUS_19650 28761 29762 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_19650 31289 29895 gene locus_tag LOCUS_19660 31289 29895 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965744.1 protein_id gnl|my_center|LOCUS_19660 31384 32628 gene locus_tag LOCUS_19670 31384 32628 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970799.1 protein_id gnl|my_center|LOCUS_19670 32684 33778 gene locus_tag LOCUS_19680 32684 33778 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_19680 34881 33790 gene locus_tag LOCUS_19690 34881 33790 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050532079.1 protein_id gnl|my_center|LOCUS_19690 35000 35179 gene locus_tag LOCUS_19700 35000 35179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 <35621 35122 gene locus_tag LOCUS_19710 <35621 35122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085727.1:enoyl-CoA hydratase/isomerase >Feature sequence30 1508 234 gene locus_tag LOCUS_19720 1508 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1592 2365 gene locus_tag LOCUS_19730 1592 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3774 2362 gene locus_tag LOCUS_19740 3774 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3865 4641 gene locus_tag LOCUS_19750 3865 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 4742 6331 gene locus_tag LOCUS_19760 4742 6331 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_19760 7269 6340 gene locus_tag LOCUS_19770 7269 6340 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163264318.1 protein_id gnl|my_center|LOCUS_19770 7390 7860 gene locus_tag LOCUS_19780 7390 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 7968 8984 gene locus_tag LOCUS_19790 7968 8984 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_19790 10265 8988 gene locus_tag LOCUS_19800 10265 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 10976 11902 gene locus_tag LOCUS_19810 10976 11902 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104615281.1 protein_id gnl|my_center|LOCUS_19810 12003 12935 gene locus_tag LOCUS_19820 12003 12935 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728659.1 protein_id gnl|my_center|LOCUS_19820 13454 13071 gene locus_tag LOCUS_19830 13454 13071 CDS product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742207.1 protein_id gnl|my_center|LOCUS_19830 13563 14300 gene locus_tag LOCUS_19840 13563 14300 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971198.1 protein_id gnl|my_center|LOCUS_19840 14980 14318 gene locus_tag LOCUS_19850 14980 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19850 15375 14890 gene locus_tag LOCUS_19860 15375 14890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19860 16028 15399 gene locus_tag LOCUS_19870 16028 15399 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 protein_id gnl|my_center|LOCUS_19870 16675 16049 gene locus_tag LOCUS_19880 16675 16049 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 protein_id gnl|my_center|LOCUS_19880 17868 16687 gene locus_tag LOCUS_19890 17868 16687 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727819.1 protein_id gnl|my_center|LOCUS_19890 18750 17944 gene locus_tag LOCUS_19900 gene fabG 18750 17944 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_19900 18980 20512 gene locus_tag LOCUS_19910 18980 20512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 20620 22251 gene locus_tag LOCUS_19920 20620 22251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 22645 24483 gene locus_tag LOCUS_19930 22645 24483 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_19930 24533 25585 gene locus_tag LOCUS_19940 24533 25585 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_19940 26438 25662 gene locus_tag LOCUS_19950 26438 25662 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_19950 27377 26496 gene locus_tag LOCUS_19960 27377 26496 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_19960 27674 28372 gene locus_tag LOCUS_19970 27674 28372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 28402 29115 gene locus_tag LOCUS_19980 28402 29115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 29871 29272 gene locus_tag LOCUS_19990 29871 29272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 30457 30182 gene locus_tag LOCUS_20000 30457 30182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 30996 30457 gene locus_tag LOCUS_20010 30996 30457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 31200 32438 gene locus_tag LOCUS_20020 31200 32438 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_20020 32540 33790 gene locus_tag LOCUS_20030 32540 33790 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_20030 33790 34584 gene locus_tag LOCUS_20040 33790 34584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence31 94 372 gene locus_tag LOCUS_20050 94 372 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_20050 372 1331 gene locus_tag LOCUS_20060 372 1331 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_20060 1362 2207 gene locus_tag LOCUS_20070 1362 2207 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838531.1 protein_id gnl|my_center|LOCUS_20070 2266 2643 gene locus_tag LOCUS_20080 2266 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2646 3269 gene locus_tag LOCUS_20090 2646 3269 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_20090 3266 3772 gene locus_tag LOCUS_20100 3266 3772 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_20100 3783 4586 gene locus_tag LOCUS_20110 3783 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 4583 5074 gene locus_tag LOCUS_20120 gene folK 4583 5074 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095144.1 protein_id gnl|my_center|LOCUS_20120 5322 5083 gene locus_tag LOCUS_20130 5322 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 5357 6046 gene locus_tag LOCUS_20140 5357 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 6056 6541 gene locus_tag LOCUS_20150 6056 6541 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337340.1 protein_id gnl|my_center|LOCUS_20150 6872 6627 gene locus_tag LOCUS_20160 6872 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 6801 8162 gene locus_tag LOCUS_20170 gene purF 6801 8162 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461475.1 protein_id gnl|my_center|LOCUS_20170 8166 9251 gene locus_tag LOCUS_20180 gene purM 8166 9251 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_20180 9383 9514 gene locus_tag LOCUS_20190 9383 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 9521 10276 gene locus_tag LOCUS_20200 9521 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 10292 11191 gene locus_tag LOCUS_20210 10292 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 11195 11923 gene locus_tag LOCUS_20220 11195 11923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 11985 12986 gene locus_tag LOCUS_20230 11985 12986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 13124 13246 gene locus_tag LOCUS_20240 13124 13246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 13306 13449 gene locus_tag LOCUS_20250 13306 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 13525 13992 gene locus_tag LOCUS_20260 13525 13992 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640683.1 protein_id gnl|my_center|LOCUS_20260 14126 16342 gene locus_tag LOCUS_20270 14126 16342 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_20270 16401 17063 gene locus_tag LOCUS_20280 gene purQ 16401 17063 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666774.1 protein_id gnl|my_center|LOCUS_20280 17065 19314 gene locus_tag LOCUS_20290 gene purL 17065 19314 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_20290 20537 19329 gene locus_tag LOCUS_20300 20537 19329 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_20300 21775 20552 gene locus_tag LOCUS_20310 21775 20552 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064263.1 protein_id gnl|my_center|LOCUS_20310 22528 22208 gene locus_tag LOCUS_20320 22528 22208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 22810 23502 gene locus_tag LOCUS_20330 22810 23502 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552494.1 protein_id gnl|my_center|LOCUS_20330 23505 24179 gene locus_tag LOCUS_20340 23505 24179 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_20340 24237 24782 gene locus_tag LOCUS_20350 24237 24782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 25670 24795 gene locus_tag LOCUS_20360 25670 24795 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972478.1 protein_id gnl|my_center|LOCUS_20360 26579 25683 gene locus_tag LOCUS_20370 26579 25683 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641673.1 protein_id gnl|my_center|LOCUS_20370 27425 26592 gene locus_tag LOCUS_20380 27425 26592 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 protein_id gnl|my_center|LOCUS_20380 28435 27539 gene locus_tag LOCUS_20390 28435 27539 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641673.1 protein_id gnl|my_center|LOCUS_20390 29289 28489 gene locus_tag LOCUS_20400 29289 28489 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730402.1 protein_id gnl|my_center|LOCUS_20400 30206 29403 gene locus_tag LOCUS_20410 30206 29403 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730402.1 protein_id gnl|my_center|LOCUS_20410 30313 31110 gene locus_tag LOCUS_20420 30313 31110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 31181 31447 gene locus_tag LOCUS_20430 31181 31447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 31444 31881 gene locus_tag LOCUS_20440 31444 31881 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406304.1 protein_id gnl|my_center|LOCUS_20440 32867 31878 gene locus_tag LOCUS_20450 32867 31878 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837553.1 protein_id gnl|my_center|LOCUS_20450 34288 32864 gene locus_tag LOCUS_20460 34288 32864 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090734.1 protein_id gnl|my_center|LOCUS_20460 35059 34310 gene locus_tag LOCUS_20470 35059 34310 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410047.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence32 572 1234 gene locus_tag LOCUS_20480 572 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1340 1669 gene locus_tag LOCUS_20490 1340 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1691 2101 gene locus_tag LOCUS_20500 1691 2101 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926524.1 protein_id gnl|my_center|LOCUS_20500 2104 2511 gene locus_tag LOCUS_20510 2104 2511 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966633.1 protein_id gnl|my_center|LOCUS_20510 3354 2584 gene locus_tag LOCUS_20520 3354 2584 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_20520 4209 3445 gene locus_tag LOCUS_20530 4209 3445 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_20530 4826 4251 gene locus_tag LOCUS_20540 4826 4251 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928388.1 protein_id gnl|my_center|LOCUS_20540 4943 6007 gene locus_tag LOCUS_20550 4943 6007 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_20550 6842 5997 gene locus_tag LOCUS_20560 6842 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 9060 6847 gene locus_tag LOCUS_20570 9060 6847 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_20570 9790 9053 gene locus_tag LOCUS_20580 9790 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 10449 10201 gene locus_tag LOCUS_20590 10449 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 10815 10564 gene locus_tag LOCUS_20600 10815 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 10754 11938 gene locus_tag LOCUS_20610 10754 11938 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_20610 12418 11954 gene locus_tag LOCUS_20620 12418 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 13353 12418 gene locus_tag LOCUS_20630 13353 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 15372 13360 gene locus_tag LOCUS_20640 15372 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 15471 16511 gene locus_tag LOCUS_20650 gene gutB 15471 16511 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_20650 16534 17574 gene locus_tag LOCUS_20660 16534 17574 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222782.1 protein_id gnl|my_center|LOCUS_20660 18531 17581 gene locus_tag LOCUS_20670 18531 17581 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030814.1 protein_id gnl|my_center|LOCUS_20670 18654 19814 gene locus_tag LOCUS_20680 18654 19814 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_20680 19840 21000 gene locus_tag LOCUS_20690 19840 21000 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_20690 23666 21036 gene locus_tag LOCUS_20700 23666 21036 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_20700 24942 23734 gene locus_tag LOCUS_20710 24942 23734 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_20710 25637 24987 gene locus_tag LOCUS_20720 25637 24987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 27219 25987 gene locus_tag LOCUS_20730 27219 25987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 28719 27238 gene locus_tag LOCUS_20740 28719 27238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 30870 28825 gene locus_tag LOCUS_20750 30870 28825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 32254 31010 gene locus_tag LOCUS_20760 32254 31010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 33903 32278 gene locus_tag LOCUS_20770 33903 32278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 <35169 34070 gene locus_tag LOCUS_20780 <35169 34070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083038.1:ABC transporter substrate-binding protein >Feature sequence33 <1 558 gene locus_tag LOCUS_20790 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038909.1:cytochrome c oxidase subunit 3 572 1582 gene locus_tag LOCUS_20800 572 1582 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977616.1 protein_id gnl|my_center|LOCUS_20800 2117 3175 gene locus_tag LOCUS_20810 2117 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 3172 4101 gene locus_tag LOCUS_20820 3172 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 4991 4098 gene locus_tag LOCUS_20830 4991 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 5787 4996 gene locus_tag LOCUS_20840 5787 4996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061277.1 protein_id gnl|my_center|LOCUS_20840 6749 5784 gene locus_tag LOCUS_20850 6749 5784 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_20850 6817 8541 gene locus_tag LOCUS_20860 6817 8541 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_20860 8549 9523 gene locus_tag LOCUS_20870 8549 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 11404 9545 gene locus_tag LOCUS_20880 11404 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 11558 12346 gene locus_tag LOCUS_20890 11558 12346 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_20890 12401 13582 gene locus_tag LOCUS_20900 12401 13582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 14068 13676 gene locus_tag LOCUS_20910 14068 13676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 14355 14083 gene locus_tag LOCUS_20920 14355 14083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 14429 15613 gene locus_tag LOCUS_20930 14429 15613 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_20930 15633 17099 gene locus_tag LOCUS_20940 gene tldD 15633 17099 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_20940 17099 18466 gene locus_tag LOCUS_20950 17099 18466 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_20950 18916 18479 gene locus_tag LOCUS_20960 18916 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 19347 18931 gene locus_tag LOCUS_20970 19347 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 19825 19355 gene locus_tag LOCUS_20980 19825 19355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 20381 19920 gene locus_tag LOCUS_20990 20381 19920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 21195 20416 gene locus_tag LOCUS_21000 21195 20416 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_21000 22093 21197 gene locus_tag LOCUS_21010 22093 21197 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323835.1 protein_id gnl|my_center|LOCUS_21010 23093 22134 gene locus_tag LOCUS_21020 23093 22134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 23684 23157 gene locus_tag LOCUS_21030 23684 23157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 23934 23698 gene locus_tag LOCUS_21040 23934 23698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 25391 23994 gene locus_tag LOCUS_21050 25391 23994 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_21050 26600 25431 gene locus_tag LOCUS_21060 26600 25431 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090005.1 protein_id gnl|my_center|LOCUS_21060 27372 26665 gene locus_tag LOCUS_21070 27372 26665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 27879 27373 gene locus_tag LOCUS_21080 27879 27373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 28307 27891 gene locus_tag LOCUS_21090 28307 27891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 28428 29687 gene locus_tag LOCUS_21100 28428 29687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 29687 30595 gene locus_tag LOCUS_21110 29687 30595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 30666 31220 gene locus_tag LOCUS_21120 30666 31220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence34 1 1233 gene locus_tag LOCUS_21130 1 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1334 2224 gene locus_tag LOCUS_21140 1334 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 3365 2229 gene locus_tag LOCUS_21150 3365 2229 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_21150 4542 3370 gene locus_tag LOCUS_21160 4542 3370 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730665.1 protein_id gnl|my_center|LOCUS_21160 5003 4677 gene locus_tag LOCUS_21170 gene trxA 5003 4677 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_21170 6133 5084 gene locus_tag LOCUS_21180 gene plsX 6133 5084 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_21180 7509 6220 gene locus_tag LOCUS_21190 7509 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 8030 7506 gene locus_tag LOCUS_21200 8030 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 7914 8246 gene locus_tag LOCUS_21210 7914 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 8415 8945 gene locus_tag LOCUS_21220 8415 8945 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_21220 8964 9842 gene locus_tag LOCUS_21230 gene mtnP 8964 9842 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_21230 9839 10777 gene locus_tag LOCUS_21240 9839 10777 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_21240 10788 11672 gene locus_tag LOCUS_21250 10788 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 11669 12934 gene locus_tag LOCUS_21260 gene ahcY 11669 12934 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143175.1 protein_id gnl|my_center|LOCUS_21260 12931 14157 gene locus_tag LOCUS_21270 gene metK 12931 14157 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163123.1 protein_id gnl|my_center|LOCUS_21270 14563 14165 gene locus_tag LOCUS_21280 gene rpsI 14563 14165 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258262.1 protein_id gnl|my_center|LOCUS_21280 15001 14567 gene locus_tag LOCUS_21290 gene rplM 15001 14567 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 protein_id gnl|my_center|LOCUS_21290 15682 15047 gene locus_tag LOCUS_21300 gene truA 15682 15047 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_21300 16243 15839 gene locus_tag LOCUS_21310 16243 15839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 17473 16301 gene locus_tag LOCUS_21320 17473 16301 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_21320 18148 17522 gene locus_tag LOCUS_21330 gene rpsD 18148 17522 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_21330 18616 18215 gene locus_tag LOCUS_21340 gene rpsK 18616 18215 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_21340 19036 18656 gene locus_tag LOCUS_21350 gene rpsM 19036 18656 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258255.1 protein_id gnl|my_center|LOCUS_21350 19383 19099 gene locus_tag LOCUS_21360 19383 19099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 20179 19406 gene locus_tag LOCUS_21370 gene map 20179 19406 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_21370 20844 20194 gene locus_tag LOCUS_21380 20844 20194 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723678.1 protein_id gnl|my_center|LOCUS_21380 22610 20862 gene locus_tag LOCUS_21390 22610 20862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 23061 22570 gene locus_tag LOCUS_21400 gene rplO 23061 22570 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919146.1 protein_id gnl|my_center|LOCUS_21400 23249 23061 gene locus_tag LOCUS_21410 gene rpmD 23249 23061 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081798.1 protein_id gnl|my_center|LOCUS_21410 23864 23256 gene locus_tag LOCUS_21420 gene rpsE 23864 23256 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403812.1 protein_id gnl|my_center|LOCUS_21420 24286 23903 gene locus_tag LOCUS_21430 gene rplR 24286 23903 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421141.1 protein_id gnl|my_center|LOCUS_21430 24861 24325 gene locus_tag LOCUS_21440 gene rplF 24861 24325 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_21440 25297 24893 gene locus_tag LOCUS_21450 gene rpsH 25297 24893 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_21450 25920 25345 gene locus_tag LOCUS_21460 gene rplE 25920 25345 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_21460 26234 25920 gene locus_tag LOCUS_21470 gene rplX 26234 25920 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_21470 26606 26235 gene locus_tag LOCUS_21480 gene rplN 26606 26235 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776366.1 protein_id gnl|my_center|LOCUS_21480 26944 26603 gene locus_tag LOCUS_21490 26944 26603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 27268 26948 gene locus_tag LOCUS_21500 27268 26948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 27690 27271 gene locus_tag LOCUS_21510 gene rplP 27690 27271 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_21510 28400 27690 gene locus_tag LOCUS_21520 gene rpsC 28400 27690 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810152.1 protein_id gnl|my_center|LOCUS_21520 28766 28425 gene locus_tag LOCUS_21530 gene rplV 28766 28425 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_21530 29020 28766 gene locus_tag LOCUS_21540 gene rpsS 29020 28766 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_21540 29910 29074 gene locus_tag LOCUS_21550 gene rplB 29910 29074 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258234.1 protein_id gnl|my_center|LOCUS_21550 30211 29912 gene locus_tag LOCUS_21560 gene rplW 30211 29912 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_21560 30851 30204 gene locus_tag LOCUS_21570 gene rplD 30851 30204 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727695.1 protein_id gnl|my_center|LOCUS_21570 31462 30848 gene locus_tag LOCUS_21580 gene rplC 31462 30848 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_21580 31809 31501 gene locus_tag LOCUS_21590 gene rpsJ 31809 31501 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence35 357 88 gene locus_tag LOCUS_21600 357 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 876 1127 gene locus_tag LOCUS_21610 876 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1516 2655 gene locus_tag LOCUS_21620 1516 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 3413 3832 gene locus_tag LOCUS_21630 3413 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 4036 4239 gene locus_tag LOCUS_21640 4036 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 4923 5105 gene locus_tag LOCUS_21650 4923 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 5224 6090 gene locus_tag LOCUS_21660 5224 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 6449 6228 gene locus_tag LOCUS_21670 6449 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 7238 7714 gene locus_tag LOCUS_21680 7238 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 9369 7723 gene locus_tag LOCUS_21690 9369 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 9511 9849 gene locus_tag LOCUS_21700 9511 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 10234 9887 gene locus_tag LOCUS_21710 10234 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 14180 11268 gene locus_tag LOCUS_21720 14180 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 15931 15362 gene locus_tag LOCUS_21730 15931 15362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 17177 16362 gene locus_tag LOCUS_21740 17177 16362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 17453 17232 gene locus_tag LOCUS_21750 17453 17232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 18607 17672 gene locus_tag LOCUS_21760 18607 17672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 18916 19656 gene locus_tag LOCUS_21770 18916 19656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 19756 20490 gene locus_tag LOCUS_21780 19756 20490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21780 20501 21190 gene locus_tag LOCUS_21790 20501 21190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21790 22110 21169 gene locus_tag LOCUS_21800 22110 21169 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_21800 22674 22123 gene locus_tag LOCUS_21810 22674 22123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 23018 22671 gene locus_tag LOCUS_21820 23018 22671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 23225 25303 gene locus_tag LOCUS_21830 23225 25303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 27804 25300 gene locus_tag LOCUS_21840 27804 25300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 28812 29069 gene locus_tag LOCUS_21850 28812 29069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 29562 29191 gene locus_tag LOCUS_21860 29562 29191 CDS product clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327109.1 protein_id gnl|my_center|LOCUS_21860 29828 29559 gene locus_tag LOCUS_21870 29828 29559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence36 429 43 gene locus_tag LOCUS_21880 429 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1252 2388 gene locus_tag LOCUS_21890 gene coxFIC1 1252 2388 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_21890 2434 2507 gene locus_tag LOCUS_t00240 2434 2507 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3011 2700 gene locus_tag LOCUS_21900 3011 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 3147 2905 gene locus_tag LOCUS_21910 3147 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 3859 3635 gene locus_tag LOCUS_21920 3859 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 4835 3996 gene locus_tag LOCUS_21930 4835 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 5060 5272 gene locus_tag LOCUS_21940 5060 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 5391 7892 gene locus_tag LOCUS_21950 5391 7892 CDS product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151756788.1 protein_id gnl|my_center|LOCUS_21950 7889 9538 gene locus_tag LOCUS_21960 7889 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 9798 10004 gene locus_tag LOCUS_21970 9798 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21970 10038 11405 gene locus_tag LOCUS_21980 10038 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 11411 12037 gene locus_tag LOCUS_21990 11411 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 12012 13283 gene locus_tag LOCUS_22000 12012 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 17282 13950 gene locus_tag LOCUS_22010 17282 13950 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_22010 17696 17292 gene locus_tag LOCUS_22020 17696 17292 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227979.1 protein_id gnl|my_center|LOCUS_22020 18012 17683 gene locus_tag LOCUS_22030 18012 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 20917 18044 gene locus_tag LOCUS_22040 20917 18044 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_22040 21672 20914 gene locus_tag LOCUS_22050 21672 20914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 25491 21916 gene locus_tag LOCUS_22060 25491 21916 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_22060 25692 26774 gene locus_tag LOCUS_22070 25692 26774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 26797 27045 gene locus_tag LOCUS_22080 26797 27045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 27060 27317 gene locus_tag LOCUS_22090 27060 27317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 27380 27721 gene locus_tag LOCUS_22100 27380 27721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 27929 29587 gene locus_tag LOCUS_22110 27929 29587 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence37 1661 480 gene locus_tag LOCUS_22120 gene hemW 1661 480 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087641.1 protein_id gnl|my_center|LOCUS_22120 1757 3559 gene locus_tag LOCUS_22130 gene aspS 1757 3559 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_22130 3626 5425 gene locus_tag LOCUS_22140 3626 5425 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_22140 5474 6460 gene locus_tag LOCUS_22150 5474 6460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_22150 6457 7623 gene locus_tag LOCUS_22160 6457 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 7687 9081 gene locus_tag LOCUS_22170 gene tig 7687 9081 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546863.1 protein_id gnl|my_center|LOCUS_22170 9180 9812 gene locus_tag LOCUS_22180 9180 9812 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257401.1 protein_id gnl|my_center|LOCUS_22180 9869 11197 gene locus_tag LOCUS_22190 gene clpX 9869 11197 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_22190 11197 11949 gene locus_tag LOCUS_22200 11197 11949 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_22200 11946 12854 gene locus_tag LOCUS_22210 11946 12854 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_22210 12943 14658 gene locus_tag LOCUS_22220 gene recN 12943 14658 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_22220 14655 15275 gene locus_tag LOCUS_22230 14655 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 15287 15880 gene locus_tag LOCUS_22240 gene nudF 15287 15880 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_22240 15971 17710 gene locus_tag LOCUS_22250 15971 17710 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057217.1 protein_id gnl|my_center|LOCUS_22250 17804 18859 gene locus_tag LOCUS_22260 17804 18859 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142938.1 protein_id gnl|my_center|LOCUS_22260 18931 19809 gene locus_tag LOCUS_22270 18931 19809 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_22270 20978 20028 gene locus_tag LOCUS_22280 20978 20028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_22280 21953 20991 gene locus_tag LOCUS_22290 21953 20991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546375.1 protein_id gnl|my_center|LOCUS_22290 24071 22038 gene locus_tag LOCUS_22300 24071 22038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 24186 24677 gene locus_tag LOCUS_22310 24186 24677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 25683 24685 gene locus_tag LOCUS_22320 25683 24685 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385702.1 protein_id gnl|my_center|LOCUS_22320 27102 25849 gene locus_tag LOCUS_22330 27102 25849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence38 1285 800 gene locus_tag LOCUS_22340 1285 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2030 1323 gene locus_tag LOCUS_22350 2030 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2216 2473 gene locus_tag LOCUS_22360 2216 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 3351 2560 gene locus_tag LOCUS_22370 3351 2560 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887067.1 protein_id gnl|my_center|LOCUS_22370 3590 3405 gene locus_tag LOCUS_22380 3590 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 3699 4517 gene locus_tag LOCUS_22390 3699 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 5693 4530 gene locus_tag LOCUS_22400 gene nifS 5693 4530 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_22400 6124 5954 gene locus_tag LOCUS_22410 6124 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 6320 6703 gene locus_tag LOCUS_22420 gene erpA 6320 6703 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228822.1 protein_id gnl|my_center|LOCUS_22420 6740 7612 gene locus_tag LOCUS_22430 gene metF 6740 7612 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_22430 8080 7637 gene locus_tag LOCUS_22440 8080 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 8158 8370 gene locus_tag LOCUS_22450 8158 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 8377 9195 gene locus_tag LOCUS_22460 8377 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 10234 9338 gene locus_tag LOCUS_22470 10234 9338 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255957.1 protein_id gnl|my_center|LOCUS_22470 10345 11235 gene locus_tag LOCUS_22480 10345 11235 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056662.1 protein_id gnl|my_center|LOCUS_22480 12012 11239 gene locus_tag LOCUS_22490 12012 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 12433 12023 gene locus_tag LOCUS_22500 12433 12023 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881169.1 protein_id gnl|my_center|LOCUS_22500 14580 12478 gene locus_tag LOCUS_22510 14580 12478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 16106 14712 gene locus_tag LOCUS_22520 16106 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 16558 16187 gene locus_tag LOCUS_22530 16558 16187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 17446 16562 gene locus_tag LOCUS_22540 17446 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 17733 17536 gene locus_tag LOCUS_22550 17733 17536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 17653 18042 gene locus_tag LOCUS_22560 17653 18042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 18122 18691 gene locus_tag LOCUS_22570 18122 18691 CDS product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409492.1 protein_id gnl|my_center|LOCUS_22570 22064 18717 gene locus_tag LOCUS_22580 22064 18717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 25306 22064 gene locus_tag LOCUS_22590 25306 22064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 25542 26336 gene locus_tag LOCUS_22600 25542 26336 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395936.1 protein_id gnl|my_center|LOCUS_22600 26434 27729 gene locus_tag LOCUS_22610 26434 27729 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence39 76 2 gene locus_tag LOCUS_t00250 76 2 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 210 872 gene locus_tag LOCUS_22620 210 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1185 889 gene locus_tag LOCUS_22630 1185 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 1801 3219 gene locus_tag LOCUS_22640 gene glnA 1801 3219 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257332.1 protein_id gnl|my_center|LOCUS_22640 3420 4769 gene locus_tag LOCUS_22650 gene glnA 3420 4769 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582594.1 protein_id gnl|my_center|LOCUS_22650 5805 4783 gene locus_tag LOCUS_22660 5805 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 7422 5866 gene locus_tag LOCUS_22670 7422 5866 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_22670 8948 7428 gene locus_tag LOCUS_22680 8948 7428 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_22680 10910 8976 gene locus_tag LOCUS_22690 gene nuoL 10910 8976 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_22690 11241 10927 gene locus_tag LOCUS_22700 gene nuoK 11241 10927 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124336.1 protein_id gnl|my_center|LOCUS_22700 11759 11241 gene locus_tag LOCUS_22710 11759 11241 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_22710 13001 11793 gene locus_tag LOCUS_22720 gene nuoH 13001 11793 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_22720 14266 13103 gene locus_tag LOCUS_22730 14266 13103 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257853.1 protein_id gnl|my_center|LOCUS_22730 15291 14290 gene locus_tag LOCUS_22740 15291 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 15870 15298 gene locus_tag LOCUS_22750 15870 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 16273 15884 gene locus_tag LOCUS_22760 gene ndhC 16273 15884 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_22760 16916 16422 gene locus_tag LOCUS_22770 16916 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 16986 18128 gene locus_tag LOCUS_22780 16986 18128 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_22780 18226 19272 gene locus_tag LOCUS_22790 18226 19272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 19301 19849 gene locus_tag LOCUS_22800 19301 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 22646 19854 gene locus_tag LOCUS_22810 22646 19854 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258507.1 protein_id gnl|my_center|LOCUS_22810 23630 22737 gene locus_tag LOCUS_22820 23630 22737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 26371 23633 gene locus_tag LOCUS_22830 gene secA 26371 23633 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082002.1 protein_id gnl|my_center|LOCUS_22830 26929 26456 gene locus_tag LOCUS_22840 26929 26456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 27956 27009 gene locus_tag LOCUS_22850 27956 27009 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259441.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence40 494 1423 gene locus_tag LOCUS_22860 494 1423 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385604.1 protein_id gnl|my_center|LOCUS_22860 1477 2322 gene locus_tag LOCUS_22870 1477 2322 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368430.1 protein_id gnl|my_center|LOCUS_22870 2772 2479 gene locus_tag LOCUS_22880 2772 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2656 4365 gene locus_tag LOCUS_22890 2656 4365 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975336.1 protein_id gnl|my_center|LOCUS_22890 4482 5453 gene locus_tag LOCUS_22900 4482 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 5475 6770 gene locus_tag LOCUS_22910 5475 6770 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031732.1 protein_id gnl|my_center|LOCUS_22910 7798 6767 gene locus_tag LOCUS_22920 7798 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 7888 9426 gene locus_tag LOCUS_22930 7888 9426 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_22930 9436 10971 gene locus_tag LOCUS_22940 9436 10971 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_22940 12381 10981 gene locus_tag LOCUS_22950 gene leuC 12381 10981 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_22950 13979 12426 gene locus_tag LOCUS_22960 13979 12426 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142287.1 protein_id gnl|my_center|LOCUS_22960 14359 16089 gene locus_tag LOCUS_22970 14359 16089 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_22970 16235 17965 gene locus_tag LOCUS_22980 16235 17965 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_22980 20374 18056 gene locus_tag LOCUS_22990 20374 18056 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_22990 22783 20465 gene locus_tag LOCUS_23000 22783 20465 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_23000 23352 22822 gene locus_tag LOCUS_23010 23352 22822 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073611.1 protein_id gnl|my_center|LOCUS_23010 23439 24368 gene locus_tag LOCUS_23020 23439 24368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 24446 26047 gene locus_tag LOCUS_23030 24446 26047 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_23030 27609 26074 gene locus_tag LOCUS_23040 27609 26074 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528520.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence41 <1 753 gene locus_tag LOCUS_23050 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726861.1:LLM class F420-dependent oxidoreductase 897 1679 gene locus_tag LOCUS_23060 897 1679 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731630.1 protein_id gnl|my_center|LOCUS_23060 1704 2942 gene locus_tag LOCUS_23070 1704 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23070 2939 4159 gene locus_tag LOCUS_23080 2939 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23080 6102 4537 gene locus_tag LOCUS_23090 6102 4537 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113631.1 protein_id gnl|my_center|LOCUS_23090 7434 6127 gene locus_tag LOCUS_23100 7434 6127 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113355.1 protein_id gnl|my_center|LOCUS_23100 8812 7460 gene locus_tag LOCUS_23110 8812 7460 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113355.1 protein_id gnl|my_center|LOCUS_23110 10244 8841 gene locus_tag LOCUS_23120 10244 8841 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113355.1 protein_id gnl|my_center|LOCUS_23120 10449 11384 gene locus_tag LOCUS_23130 10449 11384 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_23130 11411 13975 gene locus_tag LOCUS_23140 11411 13975 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101589575.1 protein_id gnl|my_center|LOCUS_23140 14369 14028 gene locus_tag LOCUS_23150 14369 14028 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_23150 15676 14366 gene locus_tag LOCUS_23160 15676 14366 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938527.1 protein_id gnl|my_center|LOCUS_23160 15834 16598 gene locus_tag LOCUS_23170 gene fabG 15834 16598 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_23170 17139 18179 gene locus_tag LOCUS_23180 gene fabD 17139 18179 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036219.1 protein_id gnl|my_center|LOCUS_23180 18212 19450 gene locus_tag LOCUS_23190 gene fabF 18212 19450 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412656.1 protein_id gnl|my_center|LOCUS_23190 19447 20721 gene locus_tag LOCUS_23200 gene fabF 19447 20721 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_23200 20791 21054 gene locus_tag LOCUS_23210 gene acpP 20791 21054 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_23210 21057 21371 gene locus_tag LOCUS_23220 21057 21371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 22311 21394 gene locus_tag LOCUS_23230 gene truB 22311 21394 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_23230 22733 22308 gene locus_tag LOCUS_23240 gene rbfA 22733 22308 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_23240 24607 22748 gene locus_tag LOCUS_23250 24607 22748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 26265 24805 gene locus_tag LOCUS_23260 26265 24805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 <27474 26400 gene locus_tag LOCUS_23270 <27474 26400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938640.1:proline--tRNA ligase >Feature sequence42 2109 970 gene locus_tag LOCUS_23280 2109 970 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_23280 2701 2198 gene locus_tag LOCUS_23290 2701 2198 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_23290 2759 3010 gene locus_tag LOCUS_23300 2759 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3873 3007 gene locus_tag LOCUS_23310 3873 3007 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_23310 4832 3981 gene locus_tag LOCUS_23320 gene menB 4832 3981 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963885.1 protein_id gnl|my_center|LOCUS_23320 5492 4839 gene locus_tag LOCUS_23330 5492 4839 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804949.1 protein_id gnl|my_center|LOCUS_23330 5524 6252 gene locus_tag LOCUS_23340 gene ubiE 5524 6252 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_23340 6869 6249 gene locus_tag LOCUS_23350 6869 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 7118 6891 gene locus_tag LOCUS_23360 7118 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 7080 8051 gene locus_tag LOCUS_23370 7080 8051 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642307.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23370 9288 8080 gene locus_tag LOCUS_23380 9288 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 10247 9339 gene locus_tag LOCUS_23390 10247 9339 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_23390 10302 11537 gene locus_tag LOCUS_23400 10302 11537 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_23400 12633 11539 gene locus_tag LOCUS_23410 12633 11539 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_23410 13265 12696 gene locus_tag LOCUS_23420 gene plsY 13265 12696 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_23420 14237 13305 gene locus_tag LOCUS_23430 14237 13305 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_23430 15394 14393 gene locus_tag LOCUS_23440 15394 14393 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704826.1 protein_id gnl|my_center|LOCUS_23440 15873 15460 gene locus_tag LOCUS_23450 15873 15460 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966793.1 protein_id gnl|my_center|LOCUS_23450 15939 16844 gene locus_tag LOCUS_23460 15939 16844 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_23460 16870 17520 gene locus_tag LOCUS_23470 16870 17520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 17833 19512 gene locus_tag LOCUS_23480 17833 19512 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_23480 19536 20123 gene locus_tag LOCUS_23490 gene ilvN 19536 20123 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 protein_id gnl|my_center|LOCUS_23490 20204 21208 gene locus_tag LOCUS_23500 gene ilvC 20204 21208 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_23500 21601 21242 gene locus_tag LOCUS_23510 21601 21242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 22208 21717 gene locus_tag LOCUS_23520 22208 21717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 22586 22221 gene locus_tag LOCUS_23530 22586 22221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 22695 23723 gene locus_tag LOCUS_23540 22695 23723 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113131.1 protein_id gnl|my_center|LOCUS_23540 24540 24418 gene locus_tag LOCUS_23550 24540 24418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 24687 25055 gene locus_tag LOCUS_23560 24687 25055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 25520 25104 gene locus_tag LOCUS_23570 25520 25104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence43 <1 1683 gene locus_tag LOCUS_23580 <1 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226763.1:VWA domain-containing protein 2130 1720 gene locus_tag LOCUS_23590 2130 1720 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_23590 2477 2127 gene locus_tag LOCUS_23600 2477 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 3256 2474 gene locus_tag LOCUS_23610 3256 2474 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_23610 3990 3256 gene locus_tag LOCUS_23620 3990 3256 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_23620 4606 4127 gene locus_tag LOCUS_23630 4606 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 5124 4669 gene locus_tag LOCUS_23640 gene mce 5124 4669 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406879.1 protein_id gnl|my_center|LOCUS_23640 5308 6291 gene locus_tag LOCUS_23650 5308 6291 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_23650 7532 6294 gene locus_tag LOCUS_23660 7532 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 8734 7688 gene locus_tag LOCUS_23670 8734 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 8840 9145 gene locus_tag LOCUS_23680 8840 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 9168 10334 gene locus_tag LOCUS_23690 gene recF 9168 10334 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_23690 10542 10372 gene locus_tag LOCUS_23700 10542 10372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 12621 10576 gene locus_tag LOCUS_23710 12621 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 12977 12801 gene locus_tag LOCUS_23720 12977 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 13286 16735 gene locus_tag LOCUS_23730 13286 16735 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_23730 16735 20181 gene locus_tag LOCUS_23740 16735 20181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 20807 20430 gene locus_tag LOCUS_23750 20807 20430 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339592.1 protein_id gnl|my_center|LOCUS_23750 21101 22204 gene locus_tag LOCUS_23760 21101 22204 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_23760 23187 22201 gene locus_tag LOCUS_23770 23187 22201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 24278 23184 gene locus_tag LOCUS_23780 24278 23184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 24720 25010 gene locus_tag LOCUS_23790 24720 25010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence44 3879 154 gene locus_tag LOCUS_23800 3879 154 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_23800 5369 4143 gene locus_tag LOCUS_23810 5369 4143 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583724.1 protein_id gnl|my_center|LOCUS_23810 6292 5366 gene locus_tag LOCUS_23820 gene thrB 6292 5366 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816738.1 protein_id gnl|my_center|LOCUS_23820 6996 6289 gene locus_tag LOCUS_23830 gene tmk 6996 6289 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_23830 8626 6959 gene locus_tag LOCUS_23840 8626 6959 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258096.1 protein_id gnl|my_center|LOCUS_23840 9547 8720 gene locus_tag LOCUS_23850 9547 8720 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030774.1 protein_id gnl|my_center|LOCUS_23850 10640 9579 gene locus_tag LOCUS_23860 10640 9579 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896031.1 protein_id gnl|my_center|LOCUS_23860 11701 10652 gene locus_tag LOCUS_23870 11701 10652 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_23870 12684 11704 gene locus_tag LOCUS_23880 12684 11704 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_23880 12842 13417 gene locus_tag LOCUS_23890 12842 13417 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877376.1 protein_id gnl|my_center|LOCUS_23890 13462 13977 gene locus_tag LOCUS_23900 13462 13977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 14009 14434 gene locus_tag LOCUS_23910 14009 14434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 14437 15099 gene locus_tag LOCUS_23920 14437 15099 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095681.1 protein_id gnl|my_center|LOCUS_23920 15104 15958 gene locus_tag LOCUS_23930 gene pheA 15104 15958 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256077.1 protein_id gnl|my_center|LOCUS_23930 15974 16801 gene locus_tag LOCUS_23940 gene mutM 15974 16801 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_23940 17368 16820 gene locus_tag LOCUS_23950 17368 16820 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_23950 18046 17453 gene locus_tag LOCUS_23960 18046 17453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 18939 18073 gene locus_tag LOCUS_23970 18939 18073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 19566 18943 gene locus_tag LOCUS_23980 19566 18943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 20167 19559 gene locus_tag LOCUS_23990 20167 19559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 20715 20320 gene locus_tag LOCUS_24000 gene rplL 20715 20320 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_24000 21331 20786 gene locus_tag LOCUS_24010 gene rplJ 21331 20786 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_24010 22301 21588 gene locus_tag LOCUS_24020 gene rplA 22301 21588 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_24020 22730 22305 gene locus_tag LOCUS_24030 gene rplK 22730 22305 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_24030 23733 22819 gene locus_tag LOCUS_24040 23733 22819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 24029 23733 gene locus_tag LOCUS_24050 24029 23733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence45 542 823 gene locus_tag LOCUS_24060 542 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 817 1227 gene locus_tag LOCUS_24070 817 1227 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331387.1 protein_id gnl|my_center|LOCUS_24070 2693 1224 gene locus_tag LOCUS_24080 2693 1224 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_24080 3427 2813 gene locus_tag LOCUS_24090 3427 2813 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_24090 3537 4409 gene locus_tag LOCUS_24100 3537 4409 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083337.1 protein_id gnl|my_center|LOCUS_24100 4413 4715 gene locus_tag LOCUS_24110 4413 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 5478 4753 gene locus_tag LOCUS_24120 5478 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 5588 6835 gene locus_tag LOCUS_24130 5588 6835 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_24130 6961 8193 gene locus_tag LOCUS_24140 6961 8193 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 protein_id gnl|my_center|LOCUS_24140 8353 9576 gene locus_tag LOCUS_24150 8353 9576 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259080.1 protein_id gnl|my_center|LOCUS_24150 9589 10866 gene locus_tag LOCUS_24160 9589 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 11164 10871 gene locus_tag LOCUS_24170 11164 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 11475 12326 gene locus_tag LOCUS_24180 11475 12326 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_24180 12355 13083 gene locus_tag LOCUS_24190 12355 13083 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087136.1 protein_id gnl|my_center|LOCUS_24190 13631 14428 gene locus_tag LOCUS_24200 13631 14428 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807958.1 protein_id gnl|my_center|LOCUS_24200 14538 16196 gene locus_tag LOCUS_24210 14538 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 16976 16197 gene locus_tag LOCUS_24220 16976 16197 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_24220 18331 16997 gene locus_tag LOCUS_24230 18331 16997 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101557.1 protein_id gnl|my_center|LOCUS_24230 18981 18373 gene locus_tag LOCUS_24240 18981 18373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 19727 18984 gene locus_tag LOCUS_24250 19727 18984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 19815 20606 gene locus_tag LOCUS_24260 19815 20606 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731530.1 protein_id gnl|my_center|LOCUS_24260 21395 20742 gene locus_tag LOCUS_24270 21395 20742 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880861.1 protein_id gnl|my_center|LOCUS_24270 21731 23023 gene locus_tag LOCUS_24280 21731 23023 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_24280 23041 23127 gene locus_tag LOCUS_t00260 23041 23127 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23142 23215 gene locus_tag LOCUS_t00270 23142 23215 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 23680 23249 gene locus_tag LOCUS_24290 23680 23249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 24434 24359 gene locus_tag LOCUS_t00280 24434 24359 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence46 1685 390 gene locus_tag LOCUS_24300 1685 390 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_24300 2889 1774 gene locus_tag LOCUS_24310 2889 1774 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090622.1 protein_id gnl|my_center|LOCUS_24310 3349 3005 gene locus_tag LOCUS_24320 3349 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 3785 3507 gene locus_tag LOCUS_24330 3785 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 4219 3920 gene locus_tag LOCUS_24340 4219 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 5475 4309 gene locus_tag LOCUS_24350 5475 4309 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727016.1 protein_id gnl|my_center|LOCUS_24350 5906 5604 gene locus_tag LOCUS_24360 5906 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 6339 6121 gene locus_tag LOCUS_24370 6339 6121 CDS product DUF2277 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414489.1 protein_id gnl|my_center|LOCUS_24370 7266 6409 gene locus_tag LOCUS_24380 7266 6409 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965766.1 protein_id gnl|my_center|LOCUS_24380 8308 7295 gene locus_tag LOCUS_24390 8308 7295 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_24390 9349 8336 gene locus_tag LOCUS_24400 gene speB 9349 8336 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_24400 9394 11031 gene locus_tag LOCUS_24410 9394 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 11028 13829 gene locus_tag LOCUS_24420 gene fdhF 11028 13829 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_24420 14782 13844 gene locus_tag LOCUS_24430 14782 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 15841 14801 gene locus_tag LOCUS_24440 15841 14801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 17717 15990 gene locus_tag LOCUS_24450 17717 15990 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084759.1 protein_id gnl|my_center|LOCUS_24450 16065 16140 gene locus_tag LOCUS_t00290 16065 16140 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 19691 18108 gene locus_tag LOCUS_24460 19691 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 21627 19684 gene locus_tag LOCUS_24470 21627 19684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 21693 21866 gene locus_tag LOCUS_24480 21693 21866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 22204 21863 gene locus_tag LOCUS_24490 22204 21863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 22907 23164 gene locus_tag LOCUS_24500 22907 23164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence47 401 69 gene locus_tag LOCUS_24510 401 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 612 2591 gene locus_tag LOCUS_24520 612 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 4834 2615 gene locus_tag LOCUS_24530 4834 2615 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_24530 5347 4910 gene locus_tag LOCUS_24540 5347 4910 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077757.1 protein_id gnl|my_center|LOCUS_24540 5446 6147 gene locus_tag LOCUS_24550 5446 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 6765 6166 gene locus_tag LOCUS_24560 6765 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 7842 6826 gene locus_tag LOCUS_24570 gene alr 7842 6826 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817433.1 protein_id gnl|my_center|LOCUS_24570 8002 10356 gene locus_tag LOCUS_24580 8002 10356 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256869.1 protein_id gnl|my_center|LOCUS_24580 10714 11085 gene locus_tag LOCUS_24590 gene rnpA 10714 11085 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542420.1 protein_id gnl|my_center|LOCUS_24590 11365 12621 gene locus_tag LOCUS_24600 11365 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 12658 13608 gene locus_tag LOCUS_24610 12658 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 14055 14309 gene locus_tag LOCUS_24620 14055 14309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 14303 14761 gene locus_tag LOCUS_24630 14303 14761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 14840 15646 gene locus_tag LOCUS_24640 14840 15646 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_24640 15643 16581 gene locus_tag LOCUS_24650 15643 16581 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528737.1 protein_id gnl|my_center|LOCUS_24650 17950 16586 gene locus_tag LOCUS_24660 17950 16586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 19074 17947 gene locus_tag LOCUS_24670 gene holB 19074 17947 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_24670 20438 19074 gene locus_tag LOCUS_24680 gene lysA 20438 19074 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_24680 20504 21223 gene locus_tag LOCUS_24690 20504 21223 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110825.1 protein_id gnl|my_center|LOCUS_24690 21223 22515 gene locus_tag LOCUS_24700 21223 22515 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_24700 23008 22529 gene locus_tag LOCUS_24710 23008 22529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 <23740 23031 gene locus_tag LOCUS_24720 <23740 23031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460899.1:TIGR03960 family B12-binding radical SAM protein >Feature sequence48 380 1438 gene locus_tag LOCUS_24730 380 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 1405 1572 gene locus_tag LOCUS_24740 1405 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1569 3494 gene locus_tag LOCUS_24750 1569 3494 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120407.1 protein_id gnl|my_center|LOCUS_24750 3380 4189 gene locus_tag LOCUS_24760 3380 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 6950 5142 gene locus_tag LOCUS_24770 6950 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 9043 7712 gene locus_tag LOCUS_24780 9043 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 12246 9064 gene locus_tag LOCUS_24790 12246 9064 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_24790 12390 12749 gene locus_tag LOCUS_24800 12390 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 12737 13192 gene locus_tag LOCUS_24810 12737 13192 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810818.1 protein_id gnl|my_center|LOCUS_24810 16866 13243 gene locus_tag LOCUS_24820 16866 13243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 19867 17273 gene locus_tag LOCUS_24830 19867 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 20406 19915 gene locus_tag LOCUS_24840 20406 19915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 20716 20432 gene locus_tag LOCUS_24850 20716 20432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 22709 21030 gene locus_tag LOCUS_24860 22709 21030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence49 2249 870 gene locus_tag LOCUS_24870 2249 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 3229 2246 gene locus_tag LOCUS_24880 gene pstC 3229 2246 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_24880 4685 3582 gene locus_tag LOCUS_24890 4685 3582 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920994.1 protein_id gnl|my_center|LOCUS_24890 6058 4838 gene locus_tag LOCUS_24900 6058 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 6789 6109 gene locus_tag LOCUS_24910 6789 6109 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_24910 6907 7818 gene locus_tag LOCUS_24920 6907 7818 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113373.1 protein_id gnl|my_center|LOCUS_24920 8509 9189 gene locus_tag LOCUS_24930 8509 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 9164 10027 gene locus_tag LOCUS_24940 9164 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 10020 11144 gene locus_tag LOCUS_24950 10020 11144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 11274 11528 gene locus_tag LOCUS_24960 11274 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 12056 12601 gene locus_tag LOCUS_24970 12056 12601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 13338 12589 gene locus_tag LOCUS_24980 13338 12589 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057978.1 protein_id gnl|my_center|LOCUS_24980 14289 13399 gene locus_tag LOCUS_24990 14289 13399 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_24990 14509 16293 gene locus_tag LOCUS_25000 14509 16293 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_25000 16421 17488 gene locus_tag LOCUS_25010 16421 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 17633 18727 gene locus_tag LOCUS_25020 17633 18727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 19859 18909 gene locus_tag LOCUS_25030 19859 18909 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222332.1 protein_id gnl|my_center|LOCUS_25030 20763 19942 gene locus_tag LOCUS_25040 20763 19942 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061558.1 protein_id gnl|my_center|LOCUS_25040 20794 22065 gene locus_tag LOCUS_25050 20794 22065 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975704.1 protein_id gnl|my_center|LOCUS_25050 23196 22066 gene locus_tag LOCUS_25060 23196 22066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence50 <1 754 gene locus_tag LOCUS_25070 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926642.1:amidohydrolase family protein 761 1828 gene locus_tag LOCUS_25080 761 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 1859 2575 gene locus_tag LOCUS_25090 1859 2575 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243013.1 protein_id gnl|my_center|LOCUS_25090 3334 2585 gene locus_tag LOCUS_25100 3334 2585 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_25100 3445 4299 gene locus_tag LOCUS_25110 3445 4299 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083715.1 protein_id gnl|my_center|LOCUS_25110 4346 5695 gene locus_tag LOCUS_25120 4346 5695 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494076.1 protein_id gnl|my_center|LOCUS_25120 6520 5765 gene locus_tag LOCUS_25130 6520 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 7472 6711 gene locus_tag LOCUS_25140 7472 6711 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731477.1 protein_id gnl|my_center|LOCUS_25140 8779 7583 gene locus_tag LOCUS_25150 8779 7583 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_25150 9883 8837 gene locus_tag LOCUS_25160 9883 8837 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 protein_id gnl|my_center|LOCUS_25160 10990 9902 gene locus_tag LOCUS_25170 10990 9902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 11043 11549 gene locus_tag LOCUS_25180 11043 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 11546 12151 gene locus_tag LOCUS_25190 11546 12151 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085955.1 protein_id gnl|my_center|LOCUS_25190 13040 12156 gene locus_tag LOCUS_25200 13040 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 15550 13097 gene locus_tag LOCUS_25210 15550 13097 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_25210 15667 16053 gene locus_tag LOCUS_25220 15667 16053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 16420 16187 gene locus_tag LOCUS_25230 16420 16187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 16496 18064 gene locus_tag LOCUS_25240 16496 18064 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_25240 18876 18061 gene locus_tag LOCUS_25250 18876 18061 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479178.1 protein_id gnl|my_center|LOCUS_25250 18917 19582 gene locus_tag LOCUS_25260 18917 19582 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_25260 19600 20577 gene locus_tag LOCUS_25270 19600 20577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 21741 20581 gene locus_tag LOCUS_25280 gene ispG 21741 20581 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 protein_id gnl|my_center|LOCUS_25280 21790 22101 gene locus_tag LOCUS_25290 21790 22101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence51 1373 207 gene locus_tag LOCUS_25300 1373 207 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815298.1 protein_id gnl|my_center|LOCUS_25300 2592 1375 gene locus_tag LOCUS_25310 2592 1375 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_25310 3394 3077 gene locus_tag LOCUS_25320 3394 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3513 5516 gene locus_tag LOCUS_25330 3513 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 5615 6595 gene locus_tag LOCUS_25340 5615 6595 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083812.1 protein_id gnl|my_center|LOCUS_25340 6608 7588 gene locus_tag LOCUS_25350 6608 7588 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_25350 9002 7530 gene locus_tag LOCUS_25360 9002 7530 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_25360 9526 9068 gene locus_tag LOCUS_25370 9526 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 9906 9523 gene locus_tag LOCUS_25380 9906 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 10434 10138 gene locus_tag LOCUS_25390 10434 10138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 12339 10477 gene locus_tag LOCUS_25400 12339 10477 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227739.1 protein_id gnl|my_center|LOCUS_25400 12444 12758 gene locus_tag LOCUS_25410 12444 12758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 12755 13213 gene locus_tag LOCUS_25420 12755 13213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 14845 13220 gene locus_tag LOCUS_25430 14845 13220 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_25430 14953 15765 gene locus_tag LOCUS_25440 14953 15765 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172619.1 protein_id gnl|my_center|LOCUS_25440 16813 15782 gene locus_tag LOCUS_25450 16813 15782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 16915 17238 gene locus_tag LOCUS_25460 16915 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 17967 17293 gene locus_tag LOCUS_25470 17967 17293 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_25470 19141 17969 gene locus_tag LOCUS_25480 19141 17969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 20394 19474 gene locus_tag LOCUS_25490 20394 19474 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_25490 20604 20864 gene locus_tag LOCUS_25500 20604 20864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence52 450 2135 gene locus_tag LOCUS_25510 450 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2218 2769 gene locus_tag LOCUS_25520 2218 2769 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258387.1 protein_id gnl|my_center|LOCUS_25520 2890 3495 gene locus_tag LOCUS_25530 2890 3495 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172421.1 protein_id gnl|my_center|LOCUS_25530 3620 4987 gene locus_tag LOCUS_25540 3620 4987 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258475.1 protein_id gnl|my_center|LOCUS_25540 5418 5080 gene locus_tag LOCUS_25550 5418 5080 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_25550 7508 5460 gene locus_tag LOCUS_25560 7508 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 8414 7569 gene locus_tag LOCUS_25570 8414 7569 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921367.1 protein_id gnl|my_center|LOCUS_25570 8747 8427 gene locus_tag LOCUS_25580 8747 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 9359 8841 gene locus_tag LOCUS_25590 9359 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 10428 9472 gene locus_tag LOCUS_25600 10428 9472 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257325.1 protein_id gnl|my_center|LOCUS_25600 10706 10413 gene locus_tag LOCUS_25610 10706 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 11113 10703 gene locus_tag LOCUS_25620 11113 10703 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259070.1 protein_id gnl|my_center|LOCUS_25620 11442 11110 gene locus_tag LOCUS_25630 11442 11110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 12500 11478 gene locus_tag LOCUS_25640 12500 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 13804 12641 gene locus_tag LOCUS_25650 13804 12641 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_25650 15282 13876 gene locus_tag LOCUS_25660 15282 13876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 15629 17383 gene locus_tag LOCUS_25670 15629 17383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 17490 18512 gene locus_tag LOCUS_25680 17490 18512 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_25680 18870 18568 gene locus_tag LOCUS_25690 18870 18568 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969264.1 protein_id gnl|my_center|LOCUS_25690 19783 18968 gene locus_tag LOCUS_25700 19783 18968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 20020 21870 gene locus_tag LOCUS_25710 20020 21870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence53 429 64 gene locus_tag LOCUS_25720 429 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 737 1138 gene locus_tag LOCUS_25730 737 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1904 1101 gene locus_tag LOCUS_25740 1904 1101 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388089.1 protein_id gnl|my_center|LOCUS_25740 3222 1960 gene locus_tag LOCUS_25750 gene serS 3222 1960 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_25750 3740 3219 gene locus_tag LOCUS_25760 3740 3219 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902608.1 protein_id gnl|my_center|LOCUS_25760 3739 4491 gene locus_tag LOCUS_25770 3739 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 4573 5055 gene locus_tag LOCUS_25780 4573 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 5061 5555 gene locus_tag LOCUS_25790 5061 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 6392 5556 gene locus_tag LOCUS_25800 6392 5556 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416061.1 protein_id gnl|my_center|LOCUS_25800 6515 7399 gene locus_tag LOCUS_25810 6515 7399 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_25810 8462 7404 gene locus_tag LOCUS_25820 8462 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_25820 8665 8459 gene locus_tag LOCUS_25830 8665 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 9001 8714 gene locus_tag LOCUS_25840 9001 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 10675 9068 gene locus_tag LOCUS_25850 10675 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 10953 10702 gene locus_tag LOCUS_25860 10953 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 12017 11019 gene locus_tag LOCUS_25870 12017 11019 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_25870 12592 12131 gene locus_tag LOCUS_25880 12592 12131 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 protein_id gnl|my_center|LOCUS_25880 13033 12644 gene locus_tag LOCUS_25890 13033 12644 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866702.1 protein_id gnl|my_center|LOCUS_25890 13145 13471 gene locus_tag LOCUS_25900 13145 13471 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730181.1 protein_id gnl|my_center|LOCUS_25900 13464 14543 gene locus_tag LOCUS_25910 13464 14543 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_25910 14673 15533 gene locus_tag LOCUS_25920 14673 15533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 16390 15530 gene locus_tag LOCUS_25930 16390 15530 CDS product DUF1479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_25930 16989 16396 gene locus_tag LOCUS_25940 16989 16396 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190386.1 protein_id gnl|my_center|LOCUS_25940 19589 16992 gene locus_tag LOCUS_25950 19589 16992 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_25950 20868 19708 gene locus_tag LOCUS_25960 20868 19708 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416097.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence54 <1 596 gene locus_tag LOCUS_25970 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256838.1:50S ribosomal protein L9 654 2141 gene locus_tag LOCUS_25980 gene dnaB 654 2141 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256839.1 protein_id gnl|my_center|LOCUS_25980 2138 2827 gene locus_tag LOCUS_25990 2138 2827 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257454.1 protein_id gnl|my_center|LOCUS_25990 2751 4148 gene locus_tag LOCUS_26000 2751 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 4812 4111 gene locus_tag LOCUS_26010 4812 4111 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_26010 4943 5524 gene locus_tag LOCUS_26020 4943 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 5598 6623 gene locus_tag LOCUS_26030 5598 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 6739 8010 gene locus_tag LOCUS_26040 6739 8010 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_26040 8043 8345 gene locus_tag LOCUS_26050 8043 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 8378 8803 gene locus_tag LOCUS_26060 8378 8803 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_26060 8839 9507 gene locus_tag LOCUS_26070 8839 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 9504 10811 gene locus_tag LOCUS_26080 9504 10811 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816736.1 protein_id gnl|my_center|LOCUS_26080 10792 11808 gene locus_tag LOCUS_26090 10792 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 11801 12889 gene locus_tag LOCUS_26100 gene thrC 11801 12889 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_26100 12889 13464 gene locus_tag LOCUS_26110 gene folE 12889 13464 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459178.1 protein_id gnl|my_center|LOCUS_26110 13461 14456 gene locus_tag LOCUS_26120 13461 14456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 14456 15751 gene locus_tag LOCUS_26130 14456 15751 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257201.1 protein_id gnl|my_center|LOCUS_26130 15794 16588 gene locus_tag LOCUS_26140 15794 16588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 16581 17498 gene locus_tag LOCUS_26150 gene ccsB 16581 17498 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_26150 17784 18221 gene locus_tag LOCUS_26160 gene rpsL 17784 18221 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_26160 18298 18768 gene locus_tag LOCUS_26170 gene rpsG 18298 18768 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081843.1 protein_id gnl|my_center|LOCUS_26170 18891 20945 gene locus_tag LOCUS_26180 gene fusA 18891 20945 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence55 374 721 gene locus_tag LOCUS_26190 374 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 920 1594 gene locus_tag LOCUS_26200 920 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 2138 3802 gene locus_tag LOCUS_26210 gene oxc 2138 3802 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283505.1 protein_id gnl|my_center|LOCUS_26210 5090 3810 gene locus_tag LOCUS_26220 5090 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 5498 5163 gene locus_tag LOCUS_26230 5498 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 5707 6657 gene locus_tag LOCUS_26240 5707 6657 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_26240 6683 7552 gene locus_tag LOCUS_26250 6683 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 7698 9125 gene locus_tag LOCUS_26260 7698 9125 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_26260 9138 9560 gene locus_tag LOCUS_26270 9138 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 9729 11405 gene locus_tag LOCUS_26280 9729 11405 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_26280 11446 12672 gene locus_tag LOCUS_26290 11446 12672 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_26290 13975 12749 gene locus_tag LOCUS_26300 13975 12749 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920947.1 protein_id gnl|my_center|LOCUS_26300 14360 14013 gene locus_tag LOCUS_26310 14360 14013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 15272 14445 gene locus_tag LOCUS_26320 15272 14445 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_26320 16069 17073 gene locus_tag LOCUS_26330 16069 17073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 17121 19568 gene locus_tag LOCUS_26340 17121 19568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 20083 19598 gene locus_tag LOCUS_26350 20083 19598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 >Feature sequence56 915 2201 gene locus_tag LOCUS_26360 915 2201 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087102.1 protein_id gnl|my_center|LOCUS_26360 2496 2420 gene locus_tag LOCUS_t00300 2496 2420 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3660 2521 gene locus_tag LOCUS_26370 gene dgoD 3660 2521 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094786.1 protein_id gnl|my_center|LOCUS_26370 4011 3787 gene locus_tag LOCUS_26380 4011 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 5797 4151 gene locus_tag LOCUS_26390 gene cimA 5797 4151 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_26390 6997 5828 gene locus_tag LOCUS_26400 6997 5828 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788311.1 protein_id gnl|my_center|LOCUS_26400 7898 7017 gene locus_tag LOCUS_26410 7898 7017 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028345.1 protein_id gnl|my_center|LOCUS_26410 8484 7948 gene locus_tag LOCUS_26420 8484 7948 CDS product mycothiol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402240.1 protein_id gnl|my_center|LOCUS_26420 9050 8481 gene locus_tag LOCUS_26430 9050 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 10025 9060 gene locus_tag LOCUS_26440 10025 9060 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235433858.1 protein_id gnl|my_center|LOCUS_26440 10129 11001 gene locus_tag LOCUS_26450 10129 11001 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085343.1 protein_id gnl|my_center|LOCUS_26450 11777 10998 gene locus_tag LOCUS_26460 11777 10998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 14107 11927 gene locus_tag LOCUS_26470 gene katG 14107 11927 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530141.1 protein_id gnl|my_center|LOCUS_26470 15707 14418 gene locus_tag LOCUS_26480 15707 14418 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967050.1 protein_id gnl|my_center|LOCUS_26480 17600 15822 gene locus_tag LOCUS_26490 17600 15822 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267761.1 protein_id gnl|my_center|LOCUS_26490 17484 17732 gene locus_tag LOCUS_26500 17484 17732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 >Feature sequence57 3 94 gene locus_tag LOCUS_t00310 3 94 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 119 208 gene locus_tag LOCUS_t00320 119 208 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1312 410 gene locus_tag LOCUS_26510 1312 410 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_26510 2226 1324 gene locus_tag LOCUS_26520 2226 1324 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_26520 2605 2402 gene locus_tag LOCUS_26530 2605 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 2936 2607 gene locus_tag LOCUS_26540 2936 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 4003 2951 gene locus_tag LOCUS_26550 gene mnmA 4003 2951 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_26550 4035 4430 gene locus_tag LOCUS_26560 gene rsfS 4035 4430 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136424.1 protein_id gnl|my_center|LOCUS_26560 4908 4453 gene locus_tag LOCUS_26570 gene ndk 4908 4453 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_26570 5720 5013 gene locus_tag LOCUS_26580 gene tsaB 5720 5013 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_26580 6241 5720 gene locus_tag LOCUS_26590 6241 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 6240 7301 gene locus_tag LOCUS_26600 6240 7301 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_26600 7342 8241 gene locus_tag LOCUS_26610 7342 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 9483 8353 gene locus_tag LOCUS_26620 9483 8353 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225711.1 protein_id gnl|my_center|LOCUS_26620 9983 10918 gene locus_tag LOCUS_26630 9983 10918 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227226.1 protein_id gnl|my_center|LOCUS_26630 10915 11742 gene locus_tag LOCUS_26640 10915 11742 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225489.1 protein_id gnl|my_center|LOCUS_26640 12209 11739 gene locus_tag LOCUS_26650 12209 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 12996 12223 gene locus_tag LOCUS_26660 12996 12223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 13149 15176 gene locus_tag LOCUS_26670 13149 15176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 15605 15366 gene locus_tag LOCUS_26680 15605 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 15495 17318 gene locus_tag LOCUS_26690 15495 17318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 17743 17306 gene locus_tag LOCUS_26700 17743 17306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence58 42 392 gene locus_tag LOCUS_26710 42 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 461 3367 gene locus_tag LOCUS_26720 461 3367 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 protein_id gnl|my_center|LOCUS_26720 3653 4915 gene locus_tag LOCUS_26730 3653 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 5549 5043 gene locus_tag LOCUS_26740 5549 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26740 5779 5459 gene locus_tag LOCUS_26750 5779 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 6342 6644 gene locus_tag LOCUS_26760 6342 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 6993 7550 gene locus_tag LOCUS_26770 6993 7550 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_26770 7802 8614 gene locus_tag LOCUS_26780 7802 8614 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063963580.1 protein_id gnl|my_center|LOCUS_26780 12029 8673 gene locus_tag LOCUS_26790 12029 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 13414 12026 gene locus_tag LOCUS_26800 13414 12026 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897264.1 protein_id gnl|my_center|LOCUS_26800 14544 13447 gene locus_tag LOCUS_26810 14544 13447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 15646 14537 gene locus_tag LOCUS_26820 15646 14537 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141920.1 protein_id gnl|my_center|LOCUS_26820 16787 15693 gene locus_tag LOCUS_26830 16787 15693 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_26830 16939 17685 gene locus_tag LOCUS_26840 16939 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 18411 17758 gene locus_tag LOCUS_26850 18411 17758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence59 1799 3214 gene locus_tag LOCUS_26860 1799 3214 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813072.1 protein_id gnl|my_center|LOCUS_26860 3278 4723 gene locus_tag LOCUS_26870 3278 4723 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_26870 8129 4731 gene locus_tag LOCUS_26880 8129 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 8319 11738 gene locus_tag LOCUS_26890 8319 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 12332 11988 gene locus_tag LOCUS_26900 12332 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 15668 12405 gene locus_tag LOCUS_26910 15668 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 16336 15761 gene locus_tag LOCUS_26920 16336 15761 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence60 <1 2845 gene locus_tag LOCUS_26930 <1 2845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:FAD-binding and (Fe-S)-binding domain-containing protein 2932 2857 gene locus_tag LOCUS_t00330 2932 2857 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3678 2983 gene locus_tag LOCUS_26940 gene tmk 3678 2983 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814160.1 protein_id gnl|my_center|LOCUS_26940 4415 3675 gene locus_tag LOCUS_26950 gene tmk 4415 3675 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_26950 6213 4567 gene locus_tag LOCUS_26960 6213 4567 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256685.1 protein_id gnl|my_center|LOCUS_26960 8828 6420 gene locus_tag LOCUS_26970 8828 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 9111 9887 gene locus_tag LOCUS_26980 9111 9887 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_26980 10007 10288 gene locus_tag LOCUS_26990 10007 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 10310 10549 gene locus_tag LOCUS_27000 10310 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 10546 11622 gene locus_tag LOCUS_27010 10546 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_27010 12994 11711 gene locus_tag LOCUS_27020 12994 11711 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064432.1 protein_id gnl|my_center|LOCUS_27020 14220 12994 gene locus_tag LOCUS_27030 14220 12994 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_27030 15240 14338 gene locus_tag LOCUS_27040 15240 14338 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368430.1 protein_id gnl|my_center|LOCUS_27040 16178 15240 gene locus_tag LOCUS_27050 16178 15240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385604.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence61 447 2009 gene locus_tag LOCUS_27060 447 2009 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_27060 2065 3408 gene locus_tag LOCUS_27070 2065 3408 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258069.1 protein_id gnl|my_center|LOCUS_27070 3633 4454 gene locus_tag LOCUS_27080 3633 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 11019 4423 gene locus_tag LOCUS_27090 11019 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 11846 11049 gene locus_tag LOCUS_27100 11846 11049 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086373.1 protein_id gnl|my_center|LOCUS_27100 12642 11857 gene locus_tag LOCUS_27110 12642 11857 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878170.1 protein_id gnl|my_center|LOCUS_27110 14001 12760 gene locus_tag LOCUS_27120 14001 12760 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_27120 14164 14814 gene locus_tag LOCUS_27130 14164 14814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 14833 15843 gene locus_tag LOCUS_27140 14833 15843 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761791.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence62 1990 581 gene locus_tag LOCUS_27150 1990 581 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_27150 3044 2043 gene locus_tag LOCUS_27160 3044 2043 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_27160 3096 5213 gene locus_tag LOCUS_27170 3096 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 5396 6616 gene locus_tag LOCUS_27180 5396 6616 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_27180 7619 6651 gene locus_tag LOCUS_27190 7619 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 8882 7632 gene locus_tag LOCUS_27200 8882 7632 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_27200 10338 8971 gene locus_tag LOCUS_27210 10338 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 11379 10627 gene locus_tag LOCUS_27220 11379 10627 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_27220 11722 11510 gene locus_tag LOCUS_27230 11722 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 12995 12141 gene locus_tag LOCUS_27240 12995 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 13819 13112 gene locus_tag LOCUS_27250 13819 13112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 <15125 14104 gene locus_tag LOCUS_27260 <15125 14104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126863657.1:LLM class flavin-dependent oxidoreductase >Feature sequence63 <1 1629 gene locus_tag LOCUS_27270 <1 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076057163.1:S9 family peptidase 1660 2451 gene locus_tag LOCUS_27280 1660 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 2582 3811 gene locus_tag LOCUS_27290 2582 3811 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924850.1 protein_id gnl|my_center|LOCUS_27290 3871 4305 gene locus_tag LOCUS_27300 gene mce 3871 4305 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_27300 4434 5315 gene locus_tag LOCUS_27310 4434 5315 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 protein_id gnl|my_center|LOCUS_27310 5337 6530 gene locus_tag LOCUS_27320 5337 6530 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_27320 6523 7857 gene locus_tag LOCUS_27330 6523 7857 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089133.1 protein_id gnl|my_center|LOCUS_27330 9060 7861 gene locus_tag LOCUS_27340 9060 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 9547 9053 gene locus_tag LOCUS_27350 9547 9053 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537307.1 protein_id gnl|my_center|LOCUS_27350 10353 9559 gene locus_tag LOCUS_27360 10353 9559 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965766.1 protein_id gnl|my_center|LOCUS_27360 10937 10350 gene locus_tag LOCUS_27370 10937 10350 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_27370 11033 11644 gene locus_tag LOCUS_27380 gene coaE 11033 11644 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_27380 11684 13882 gene locus_tag LOCUS_27390 11684 13882 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393063.1 protein_id gnl|my_center|LOCUS_27390 13879 14115 gene locus_tag LOCUS_27400 13879 14115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 14112 14375 gene locus_tag LOCUS_27410 14112 14375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence64 1410 4625 gene locus_tag LOCUS_27420 1410 4625 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_27420 4607 8206 gene locus_tag LOCUS_27430 4607 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 8997 9443 gene locus_tag LOCUS_27440 8997 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 9440 9934 gene locus_tag LOCUS_27450 9440 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 10039 10299 gene locus_tag LOCUS_27460 10039 10299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 10299 10721 gene locus_tag LOCUS_27470 10299 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence65 2823 2248 gene locus_tag LOCUS_27480 2823 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 4989 2944 gene locus_tag LOCUS_27490 4989 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 6665 5211 gene locus_tag LOCUS_27500 6665 5211 CDS product IS1182-like element ISMac1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020521.1 protein_id gnl|my_center|LOCUS_27500 7673 6915 gene locus_tag LOCUS_27510 7673 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 9059 11152 gene locus_tag LOCUS_27520 9059 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 12133 11393 gene locus_tag LOCUS_27530 12133 11393 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence66 25 100 gene locus_tag LOCUS_t00340 25 100 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1203 115 gene locus_tag LOCUS_27540 1203 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 2195 1242 gene locus_tag LOCUS_27550 gene cysK 2195 1242 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 protein_id gnl|my_center|LOCUS_27550 2684 2223 gene locus_tag LOCUS_27560 2684 2223 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_27560 2804 3568 gene locus_tag LOCUS_27570 2804 3568 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_27570 3791 3543 gene locus_tag LOCUS_27580 3791 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 4710 3784 gene locus_tag LOCUS_27590 gene lgt 4710 3784 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171692.1 protein_id gnl|my_center|LOCUS_27590 6883 4703 gene locus_tag LOCUS_27600 6883 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 7953 6889 gene locus_tag LOCUS_27610 7953 6889 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_27610 9143 7953 gene locus_tag LOCUS_27620 9143 7953 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877690.1 protein_id gnl|my_center|LOCUS_27620 10439 9282 gene locus_tag LOCUS_27630 10439 9282 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_27630 11664 10507 gene locus_tag LOCUS_27640 11664 10507 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_27640 11958 11716 gene locus_tag LOCUS_27650 11958 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence67 1931 528 gene locus_tag LOCUS_27660 1931 528 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_27660 3760 1928 gene locus_tag LOCUS_27670 3760 1928 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258686.1 protein_id gnl|my_center|LOCUS_27670 3878 4624 gene locus_tag LOCUS_27680 3878 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 5061 4621 gene locus_tag LOCUS_27690 5061 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 5285 5058 gene locus_tag LOCUS_27700 5285 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 7718 5319 gene locus_tag LOCUS_27710 7718 5319 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_27710 8487 7732 gene locus_tag LOCUS_27720 8487 7732 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_27720 9326 8547 gene locus_tag LOCUS_27730 9326 8547 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385282.1 protein_id gnl|my_center|LOCUS_27730 10219 9362 gene locus_tag LOCUS_27740 10219 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 <11858 10216 gene locus_tag LOCUS_27750 <11858 10216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028475.1:aminopeptidase N >Feature sequence68 378 2489 gene locus_tag LOCUS_27760 378 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2592 3095 gene locus_tag LOCUS_27770 2592 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 3207 4916 gene locus_tag LOCUS_27780 3207 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 8108 4968 gene locus_tag LOCUS_27790 8108 4968 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284781.1 protein_id gnl|my_center|LOCUS_27790 9592 8105 gene locus_tag LOCUS_27800 9592 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 9980 11092 gene locus_tag LOCUS_27810 9980 11092 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268532.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence69 89 475 gene locus_tag LOCUS_27820 89 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 889 1323 gene locus_tag LOCUS_27830 889 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 2554 1457 gene locus_tag LOCUS_27840 2554 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 4579 3041 gene locus_tag LOCUS_27850 4579 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 5153 4776 gene locus_tag LOCUS_27860 5153 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 5231 5344 gene locus_tag LOCUS_r00010 5231 5344 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5662 6987 gene locus_tag LOCUS_27870 gene rpsA 5662 6987 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_27870 7268 9868 gene locus_tag LOCUS_27880 7268 9868 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258333.1 protein_id gnl|my_center|LOCUS_27880 10442 10056 gene locus_tag LOCUS_27890 10442 10056 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776558.1 protein_id gnl|my_center|LOCUS_27890 <10988 10474 gene locus_tag LOCUS_27900 <10988 10474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920901.1:rod shape-determining protein RodA >Feature sequence70 <1 1280 gene locus_tag LOCUS_27910 <1 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165797420.1:helicase-related protein 1332 1634 gene locus_tag LOCUS_27920 1332 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 2678 1932 gene locus_tag LOCUS_27930 2678 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 2971 3141 gene locus_tag LOCUS_27940 2971 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 3193 3495 gene locus_tag LOCUS_27950 3193 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 5182 9060 gene locus_tag LOCUS_27960 5182 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence71 1447 176 gene locus_tag LOCUS_27970 gene ectB 1447 176 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230319.1 protein_id gnl|my_center|LOCUS_27970 3501 1543 gene locus_tag LOCUS_27980 3501 1543 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948595.1 protein_id gnl|my_center|LOCUS_27980 5498 3510 gene locus_tag LOCUS_27990 5498 3510 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728405.1 protein_id gnl|my_center|LOCUS_27990 5757 5512 gene locus_tag LOCUS_28000 5757 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 6649 5930 gene locus_tag LOCUS_28010 6649 5930 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 protein_id gnl|my_center|LOCUS_28010 6751 7233 gene locus_tag LOCUS_28020 6751 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 8587 7319 gene locus_tag LOCUS_28030 8587 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 <9461 8744 gene locus_tag LOCUS_28040 <9461 8744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975732.1:acetyl-CoA C-acetyltransferase >Feature sequence72 339 22 gene locus_tag LOCUS_28050 339 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 1085 396 gene locus_tag LOCUS_28060 1085 396 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_28060 1752 1156 gene locus_tag LOCUS_28070 1752 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 2793 1759 gene locus_tag LOCUS_28080 2793 1759 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141711.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28080 3059 4237 gene locus_tag LOCUS_28090 3059 4237 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_28090 4813 4316 gene locus_tag LOCUS_28100 4813 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 5676 4810 gene locus_tag LOCUS_28110 5676 4810 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899798.1 protein_id gnl|my_center|LOCUS_28110 6674 5673 gene locus_tag LOCUS_28120 6674 5673 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_28120 7386 6694 gene locus_tag LOCUS_28130 7386 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 7553 8338 gene locus_tag LOCUS_28140 7553 8338 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_28140 8382 9149 gene locus_tag LOCUS_28150 8382 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966641.1 protein_id gnl|my_center|LOCUS_28150 >Feature sequence73 158 469 gene locus_tag LOCUS_28160 158 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 2283 466 gene locus_tag LOCUS_28170 2283 466 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 protein_id gnl|my_center|LOCUS_28170 3500 2316 gene locus_tag LOCUS_28180 3500 2316 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_28180 3692 6034 gene locus_tag LOCUS_28190 3692 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 6877 6359 gene locus_tag LOCUS_28200 6877 6359 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256063.1 protein_id gnl|my_center|LOCUS_28200 7885 6899 gene locus_tag LOCUS_28210 7885 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 <9139 8042 gene locus_tag LOCUS_28220 <9139 8042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085891.1:thiamine pyrophosphate-requiring protein >Feature sequence74 2473 1781 gene locus_tag LOCUS_28230 2473 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 3141 2785 gene locus_tag LOCUS_28240 3141 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3386 3150 gene locus_tag LOCUS_28250 3386 3150 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_28250 4242 4742 gene locus_tag LOCUS_28260 4242 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 6546 5209 gene locus_tag LOCUS_28270 6546 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 6883 6575 gene locus_tag LOCUS_28280 6883 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 <8616 6766 gene locus_tag LOCUS_28290 <8616 6766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883927.1:DNA methyltransferase >Feature sequence75 997 266 gene locus_tag LOCUS_28300 997 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 1431 988 gene locus_tag LOCUS_28310 1431 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2252 1752 gene locus_tag LOCUS_28320 2252 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 2692 2237 gene locus_tag LOCUS_28330 2692 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 2988 2689 gene locus_tag LOCUS_28340 2988 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 3170 4369 gene locus_tag LOCUS_28350 3170 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 4381 4998 gene locus_tag LOCUS_28360 4381 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 5999 7072 gene locus_tag LOCUS_28370 5999 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence76 <1 516 gene locus_tag LOCUS_28380 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258188.1:CCA tRNA nucleotidyltransferase 880 1185 gene locus_tag LOCUS_28390 880 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 1331 3082 gene locus_tag LOCUS_28400 1331 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 3079 4281 gene locus_tag LOCUS_28410 3079 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 6170 4278 gene locus_tag LOCUS_28420 gene selB 6170 4278 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_28420 6196 7188 gene locus_tag LOCUS_28430 6196 7188 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence77 495 1205 gene locus_tag LOCUS_28440 495 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 1205 2095 gene locus_tag LOCUS_28450 1205 2095 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812973.1 protein_id gnl|my_center|LOCUS_28450 3285 2092 gene locus_tag LOCUS_28460 3285 2092 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725028.1 protein_id gnl|my_center|LOCUS_28460 4472 3282 gene locus_tag LOCUS_28470 4472 3282 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_28470 5671 4496 gene locus_tag LOCUS_28480 5671 4496 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_28480 6900 5719 gene locus_tag LOCUS_28490 6900 5719 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence78 426 350 gene locus_tag LOCUS_t00350 426 350 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 551 478 gene locus_tag LOCUS_t00360 551 478 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2033 573 gene locus_tag LOCUS_28500 gene gltX 2033 573 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_28500 3462 2416 gene locus_tag LOCUS_28510 3462 2416 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_28510 3893 3459 gene locus_tag LOCUS_28520 gene lspA 3893 3459 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 protein_id gnl|my_center|LOCUS_28520 4191 4823 gene locus_tag LOCUS_28530 4191 4823 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976284.1 protein_id gnl|my_center|LOCUS_28530 4841 5476 gene locus_tag LOCUS_28540 4841 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence79 <1 903 gene locus_tag LOCUS_28550 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869864.1:NAD-dependent DNA ligase LigA 1039 2097 gene locus_tag LOCUS_28560 1039 2097 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_28560 2125 3000 gene locus_tag LOCUS_28570 2125 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 3004 3549 gene locus_tag LOCUS_28580 3004 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 3550 5637 gene locus_tag LOCUS_28590 3550 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence80 584 2875 gene locus_tag LOCUS_28600 584 2875 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003681.1 protein_id gnl|my_center|LOCUS_28600 2865 4187 gene locus_tag LOCUS_28610 2865 4187 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003683.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence81 1425 322 gene locus_tag LOCUS_28620 1425 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 2504 1467 gene locus_tag LOCUS_28630 2504 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3637 2576 gene locus_tag LOCUS_28640 3637 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 4098 3634 gene locus_tag LOCUS_28650 4098 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 4776 4231 gene locus_tag LOCUS_28660 4776 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 5467 5718 gene locus_tag LOCUS_28670 5467 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 5886 6140 gene locus_tag LOCUS_28680 5886 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 >Feature sequence82 1795 1505 gene locus_tag LOCUS_28690 1795 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2259 3206 gene locus_tag LOCUS_28700 2259 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 3203 4411 gene locus_tag LOCUS_28710 3203 4411 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_28710 4434 5144 gene locus_tag LOCUS_28720 4434 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence83 82 1305 gene locus_tag LOCUS_28730 82 1305 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075509875.1 protein_id gnl|my_center|LOCUS_28730 1319 2281 gene locus_tag LOCUS_28740 1319 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2362 2697 gene locus_tag LOCUS_28750 2362 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 3219 4859 gene locus_tag LOCUS_28760 3219 4859 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_28760 4994 5329 gene locus_tag LOCUS_28770 4994 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence84 488 1390 gene locus_tag LOCUS_28780 488 1390 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 protein_id gnl|my_center|LOCUS_28780 2634 1453 gene locus_tag LOCUS_28790 2634 1453 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_28790 2772 4637 gene locus_tag LOCUS_28800 2772 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 <5736 4634 gene locus_tag LOCUS_28810 <5736 4634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528130.1:aminotransferase class III-fold pyridoxal phosphate-dependent enzyme >Feature sequence85 1 76 gene locus_tag LOCUS_t00370 1 76 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1653 19 gene locus_tag LOCUS_28820 1653 19 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120407.1 protein_id gnl|my_center|LOCUS_28820 4357 1877 gene locus_tag LOCUS_28830 4357 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 >Feature sequence86 <1 699 gene locus_tag LOCUS_28840 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258936.1:DEAD/DEAH box helicase 1535 765 gene locus_tag LOCUS_28850 1535 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 1653 1826 gene locus_tag LOCUS_28860 1653 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 2186 1878 gene locus_tag LOCUS_28870 2186 1878 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015575.1 protein_id gnl|my_center|LOCUS_28870 2378 2202 gene locus_tag LOCUS_28880 2378 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 3938 2676 gene locus_tag LOCUS_28890 3938 2676 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459389.1 protein_id gnl|my_center|LOCUS_28890 4347 4024 gene locus_tag LOCUS_28900 4347 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence87 78 3 gene locus_tag LOCUS_t00380 78 3 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1312 125 gene locus_tag LOCUS_28910 1312 125 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_28910 1787 1356 gene locus_tag LOCUS_28920 1787 1356 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_28920 1929 3353 gene locus_tag LOCUS_28930 1929 3353 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_28930 3362 4012 gene locus_tag LOCUS_28940 3362 4012 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_28940 4153 4079 gene locus_tag LOCUS_t00390 4153 4079 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence88 <1 503 gene locus_tag LOCUS_28950 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730136.1:amidohydrolase family protein 1315 3201 gene locus_tag LOCUS_28960 1315 3201 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_28960 <4270 3218 gene locus_tag LOCUS_28970 <4270 3218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972395.1:formyl-CoA transferase >Feature sequence89 725 135 gene locus_tag LOCUS_28980 725 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 758 1555 gene locus_tag LOCUS_28990 gene pcaD 758 1555 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_28990 3011 1629 gene locus_tag LOCUS_29000 3011 1629 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_29000 3225 3013 gene locus_tag LOCUS_29010 3225 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence90 1144 1070 gene locus_tag LOCUS_t00400 1144 1070 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2009 1230 gene locus_tag LOCUS_29020 2009 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 2545 2069 gene locus_tag LOCUS_29030 2545 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 2544 3692 gene locus_tag LOCUS_29040 2544 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence91 1317 796 gene locus_tag LOCUS_29050 1317 796 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902608.1 protein_id gnl|my_center|LOCUS_29050 1316 2068 gene locus_tag LOCUS_29060 1316 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 2102 2575 gene locus_tag LOCUS_29070 2102 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 2581 3075 gene locus_tag LOCUS_29080 2581 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 3912 3076 gene locus_tag LOCUS_29090 3912 3076 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416061.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence92 <1 813 gene locus_tag LOCUS_29100 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064263.1:CoA transferase 1586 810 gene locus_tag LOCUS_29110 1586 810 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_29110 2461 1688 gene locus_tag LOCUS_29120 2461 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 <3816 2616 gene locus_tag LOCUS_29130 <3816 2616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126863657.1:LLM class flavin-dependent oxidoreductase >Feature sequence93 1628 2125 gene locus_tag LOCUS_29140 gene purE 1628 2125 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_29140 2137 2673 gene locus_tag LOCUS_29150 gene def 2137 2673 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948295.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence94 926 1480 gene locus_tag LOCUS_29160 926 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 1740 1477 gene locus_tag LOCUS_29170 1740 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 1621 1854 gene locus_tag LOCUS_29180 1621 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 2126 2662 gene locus_tag LOCUS_29190 2126 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence95 239 57 gene locus_tag LOCUS_29200 239 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 427 236 gene locus_tag LOCUS_29210 427 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 1092 424 gene locus_tag LOCUS_29220 1092 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 1662 1135 gene locus_tag LOCUS_29230 1662 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 2143 1769 gene locus_tag LOCUS_29240 2143 1769 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942796.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence96 <1 519 gene locus_tag LOCUS_29250 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256350.1:serine--tRNA ligase 506 1381 gene locus_tag LOCUS_29260 506 1381 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804646.1 protein_id gnl|my_center|LOCUS_29260 1745 1344 gene locus_tag LOCUS_29270 1745 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 1821 2444 gene locus_tag LOCUS_29280 1821 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence97 77 1 gene locus_tag LOCUS_t00410 77 1 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1569 172 gene locus_tag LOCUS_29290 gene mgtE 1569 172 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_29290 1625 1700 gene locus_tag LOCUS_t00420 1625 1700 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence98 2210 948 gene locus_tag LOCUS_29300 2210 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 >Feature sequence99 191 116 gene locus_tag LOCUS_t00430 191 116 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 375 290 gene locus_tag LOCUS_t00440 375 290 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 565 490 gene locus_tag LOCUS_t00450 565 490 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 699 1436 gene locus_tag LOCUS_29310 699 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 <2120 1440 gene locus_tag LOCUS_29320 <2120 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257711.1:cysteine--tRNA ligase