>Feature sequence001 390 962 gene locus_tag LOCUS_00010 390 962 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259737.1 protein_id gnl|my_center|LOCUS_00010 1040 1840 gene locus_tag LOCUS_00020 1040 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1890 2396 gene locus_tag LOCUS_00030 1890 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2450 3343 gene locus_tag LOCUS_00040 2450 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3424 4770 gene locus_tag LOCUS_00050 3424 4770 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256080.1 protein_id gnl|my_center|LOCUS_00050 4788 5312 gene locus_tag LOCUS_00060 4788 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5390 7369 gene locus_tag LOCUS_00070 5390 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8381 7401 gene locus_tag LOCUS_00080 8381 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8565 10013 gene locus_tag LOCUS_00090 8565 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10034 11170 gene locus_tag LOCUS_00100 10034 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11430 12539 gene locus_tag LOCUS_00110 11430 12539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12577 13338 gene locus_tag LOCUS_00120 12577 13338 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444799.1 protein_id gnl|my_center|LOCUS_00120 13463 13627 gene locus_tag LOCUS_00130 13463 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13617 14429 gene locus_tag LOCUS_00140 13617 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14538 14909 gene locus_tag LOCUS_00150 14538 14909 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730388.1 protein_id gnl|my_center|LOCUS_00150 14966 15772 gene locus_tag LOCUS_00160 14966 15772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15970 15668 gene locus_tag LOCUS_00170 15970 15668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15866 16900 gene locus_tag LOCUS_00180 15866 16900 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902253.1 protein_id gnl|my_center|LOCUS_00180 17898 16936 gene locus_tag LOCUS_00190 17898 16936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18249 19064 gene locus_tag LOCUS_00200 18249 19064 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622595.1 protein_id gnl|my_center|LOCUS_00200 19456 20379 gene locus_tag LOCUS_00210 19456 20379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20445 21197 gene locus_tag LOCUS_00220 20445 21197 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891968.1 protein_id gnl|my_center|LOCUS_00220 21245 22507 gene locus_tag LOCUS_00230 21245 22507 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_00230 22546 23610 gene locus_tag LOCUS_00240 22546 23610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23603 24340 gene locus_tag LOCUS_00250 23603 24340 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667426.1 protein_id gnl|my_center|LOCUS_00250 24484 24957 gene locus_tag LOCUS_00260 24484 24957 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386773.1 protein_id gnl|my_center|LOCUS_00260 25128 26342 gene locus_tag LOCUS_00270 25128 26342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 26486 27289 gene locus_tag LOCUS_00280 26486 27289 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986663.1 protein_id gnl|my_center|LOCUS_00280 27412 27627 gene locus_tag LOCUS_00290 27412 27627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27899 28636 gene locus_tag LOCUS_00300 27899 28636 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027093.1 protein_id gnl|my_center|LOCUS_00300 28633 29694 gene locus_tag LOCUS_00310 28633 29694 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962511.1 protein_id gnl|my_center|LOCUS_00310 29711 30304 gene locus_tag LOCUS_00320 29711 30304 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775785.1 protein_id gnl|my_center|LOCUS_00320 30316 30912 gene locus_tag LOCUS_00330 30316 30912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 30994 31992 gene locus_tag LOCUS_00340 30994 31992 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113326.1 protein_id gnl|my_center|LOCUS_00340 32186 32010 gene locus_tag LOCUS_00350 32186 32010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 32289 33542 gene locus_tag LOCUS_00360 32289 33542 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922300.1 protein_id gnl|my_center|LOCUS_00360 33539 36001 gene locus_tag LOCUS_00370 33539 36001 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616124.1 protein_id gnl|my_center|LOCUS_00370 36259 37281 gene locus_tag LOCUS_00380 36259 37281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 37300 38598 gene locus_tag LOCUS_00390 gene betC 37300 38598 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_00390 39918 38599 gene locus_tag LOCUS_00400 39918 38599 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_00400 40131 40850 gene locus_tag LOCUS_00410 40131 40850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40854 42119 gene locus_tag LOCUS_00420 40854 42119 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_00420 42239 42475 gene locus_tag LOCUS_00430 42239 42475 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_00430 42468 42758 gene locus_tag LOCUS_00440 42468 42758 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_00440 42825 43733 gene locus_tag LOCUS_00450 42825 43733 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009279.1 protein_id gnl|my_center|LOCUS_00450 43768 44430 gene locus_tag LOCUS_00460 43768 44430 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229674.1 protein_id gnl|my_center|LOCUS_00460 45310 44504 gene locus_tag LOCUS_00470 45310 44504 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_00470 45750 46052 gene locus_tag LOCUS_00480 45750 46052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 46188 47255 gene locus_tag LOCUS_00490 46188 47255 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346242.1 protein_id gnl|my_center|LOCUS_00490 47289 48584 gene locus_tag LOCUS_00500 47289 48584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 48581 49507 gene locus_tag LOCUS_00510 48581 49507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 49606 50244 gene locus_tag LOCUS_00520 49606 50244 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887247.1 protein_id gnl|my_center|LOCUS_00520 50241 51005 gene locus_tag LOCUS_00530 50241 51005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 51086 51712 gene locus_tag LOCUS_00540 51086 51712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973694.1 protein_id gnl|my_center|LOCUS_00540 51758 52357 gene locus_tag LOCUS_00550 51758 52357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 52378 53649 gene locus_tag LOCUS_00560 52378 53649 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_00560 53687 54505 gene locus_tag LOCUS_00570 gene aac(3) 53687 54505 CDS product aminoglycoside 3-N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140487.1 protein_id gnl|my_center|LOCUS_00570 54540 55031 gene locus_tag LOCUS_00580 54540 55031 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933501.1 protein_id gnl|my_center|LOCUS_00580 55032 55529 gene locus_tag LOCUS_00590 55032 55529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 56346 55507 gene locus_tag LOCUS_00600 56346 55507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 56582 56968 gene locus_tag LOCUS_00610 56582 56968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 56965 57807 gene locus_tag LOCUS_00620 56965 57807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 57879 59243 gene locus_tag LOCUS_00630 57879 59243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 59332 59913 gene locus_tag LOCUS_00640 59332 59913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 60232 60053 gene locus_tag LOCUS_00650 60232 60053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 60694 60948 gene locus_tag LOCUS_00660 60694 60948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 61052 61897 gene locus_tag LOCUS_00670 61052 61897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 61923 62657 gene locus_tag LOCUS_00680 61923 62657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971044.1 protein_id gnl|my_center|LOCUS_00680 62679 63323 gene locus_tag LOCUS_00690 62679 63323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 63320 63541 gene locus_tag LOCUS_00700 63320 63541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 63573 64079 gene locus_tag LOCUS_00710 63573 64079 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_00710 64099 65592 gene locus_tag LOCUS_00720 64099 65592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 65674 66525 gene locus_tag LOCUS_00730 65674 66525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 66553 67647 gene locus_tag LOCUS_00740 66553 67647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 67685 68500 gene locus_tag LOCUS_00750 67685 68500 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066520.1 protein_id gnl|my_center|LOCUS_00750 68608 68991 gene locus_tag LOCUS_00760 68608 68991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 69024 70247 gene locus_tag LOCUS_00770 69024 70247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 70269 71258 gene locus_tag LOCUS_00780 70269 71258 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461131.1 protein_id gnl|my_center|LOCUS_00780 71259 71753 gene locus_tag LOCUS_00790 71259 71753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 71750 73093 gene locus_tag LOCUS_00800 71750 73093 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928505.1 protein_id gnl|my_center|LOCUS_00800 73124 73579 gene locus_tag LOCUS_00810 73124 73579 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021653.1 protein_id gnl|my_center|LOCUS_00810 73628 74572 gene locus_tag LOCUS_00820 73628 74572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 74762 75490 gene locus_tag LOCUS_00830 74762 75490 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095301.1 protein_id gnl|my_center|LOCUS_00830 75559 75768 gene locus_tag LOCUS_00840 75559 75768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 75862 76380 gene locus_tag LOCUS_00850 75862 76380 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223648.1 protein_id gnl|my_center|LOCUS_00850 76398 76766 gene locus_tag LOCUS_00860 76398 76766 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490570.1 protein_id gnl|my_center|LOCUS_00860 76794 77687 gene locus_tag LOCUS_00870 76794 77687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 77705 79546 gene locus_tag LOCUS_00880 77705 79546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 79589 79978 gene locus_tag LOCUS_00890 79589 79978 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922062.1 protein_id gnl|my_center|LOCUS_00890 79985 80941 gene locus_tag LOCUS_00900 79985 80941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 80925 83762 gene locus_tag LOCUS_00910 80925 83762 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071943.1 protein_id gnl|my_center|LOCUS_00910 83961 86405 gene locus_tag LOCUS_00920 gene mrfA 83961 86405 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_00920 86406 87452 gene locus_tag LOCUS_00930 86406 87452 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250419.1 protein_id gnl|my_center|LOCUS_00930 87466 88137 gene locus_tag LOCUS_00940 gene fsa 87466 88137 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403055.1 protein_id gnl|my_center|LOCUS_00940 89558 88134 gene locus_tag LOCUS_00950 89558 88134 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_00950 91540 89573 gene locus_tag LOCUS_00960 91540 89573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 91679 92515 gene locus_tag LOCUS_00970 91679 92515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 94707 92518 gene locus_tag LOCUS_00980 94707 92518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 94886 95683 gene locus_tag LOCUS_00990 94886 95683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 95702 96814 gene locus_tag LOCUS_01000 95702 96814 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836207.1 protein_id gnl|my_center|LOCUS_01000 96845 97708 gene locus_tag LOCUS_01010 96845 97708 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732022.1 protein_id gnl|my_center|LOCUS_01010 97730 98692 gene locus_tag LOCUS_01020 97730 98692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 98777 100204 gene locus_tag LOCUS_01030 98777 100204 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_01030 100295 101122 gene locus_tag LOCUS_01040 100295 101122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 103116 101194 gene locus_tag LOCUS_01050 gene dnaK 103116 101194 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_01050 103489 103184 gene locus_tag LOCUS_01060 103489 103184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 104900 103734 gene locus_tag LOCUS_01070 gene sucC 104900 103734 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439496.1 protein_id gnl|my_center|LOCUS_01070 106027 104936 gene locus_tag LOCUS_01080 106027 104936 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_01080 108935 106038 gene locus_tag LOCUS_01090 108935 106038 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_01090 110277 109045 gene locus_tag LOCUS_01100 110277 109045 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_01100 111065 110301 gene locus_tag LOCUS_01110 111065 110301 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_01110 111334 111062 gene locus_tag LOCUS_01120 111334 111062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 112188 111337 gene locus_tag LOCUS_01130 112188 111337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 112812 112390 gene locus_tag LOCUS_01140 112812 112390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 114257 112833 gene locus_tag LOCUS_01150 114257 112833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01150 116744 114348 gene locus_tag LOCUS_01160 116744 114348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 117130 116744 gene locus_tag LOCUS_01170 gene mecI 117130 116744 CDS product mecA-type methicillin resistance repressor MecI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369214.1 protein_id gnl|my_center|LOCUS_01170 120363 117277 gene locus_tag LOCUS_01180 120363 117277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 120998 120405 gene locus_tag LOCUS_01190 120998 120405 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 protein_id gnl|my_center|LOCUS_01190 122049 121102 gene locus_tag LOCUS_01200 122049 121102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 122977 122042 gene locus_tag LOCUS_01210 122977 122042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 123313 125682 gene locus_tag LOCUS_01220 123313 125682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 126642 125788 gene locus_tag LOCUS_01230 gene nadC 126642 125788 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_01230 127225 126644 gene locus_tag LOCUS_01240 127225 126644 CDS product MjaI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545491.1 protein_id gnl|my_center|LOCUS_01240 128383 127250 gene locus_tag LOCUS_01250 128383 127250 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831398.1 protein_id gnl|my_center|LOCUS_01250 130379 128391 gene locus_tag LOCUS_01260 gene uvrB 130379 128391 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_01260 130521 131708 gene locus_tag LOCUS_01270 130521 131708 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837907.1 protein_id gnl|my_center|LOCUS_01270 131725 132615 gene locus_tag LOCUS_01280 131725 132615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 132784 133677 gene locus_tag LOCUS_01290 132784 133677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 134943 133738 gene locus_tag LOCUS_01300 134943 133738 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_01300 135540 134956 gene locus_tag LOCUS_01310 135540 134956 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932444.1 protein_id gnl|my_center|LOCUS_01310 135702 136493 gene locus_tag LOCUS_01320 135702 136493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 136509 137513 gene locus_tag LOCUS_01330 136509 137513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 137530 138582 gene locus_tag LOCUS_01340 137530 138582 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_01340 138579 139673 gene locus_tag LOCUS_01350 138579 139673 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_01350 139652 140479 gene locus_tag LOCUS_01360 139652 140479 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_01360 140661 141635 gene locus_tag LOCUS_01370 140661 141635 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_01370 141737 142855 gene locus_tag LOCUS_01380 141737 142855 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_01380 142852 143547 gene locus_tag LOCUS_01390 142852 143547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 143778 145118 gene locus_tag LOCUS_01400 143778 145118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 145131 150803 gene locus_tag LOCUS_01410 145131 150803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 150816 152300 gene locus_tag LOCUS_01420 150816 152300 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_01420 153192 152308 gene locus_tag LOCUS_01430 153192 152308 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_01430 154175 153192 gene locus_tag LOCUS_01440 154175 153192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 155021 154215 gene locus_tag LOCUS_01450 155021 154215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 156074 155142 gene locus_tag LOCUS_01460 156074 155142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 158307 156085 gene locus_tag LOCUS_01470 158307 156085 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_01470 158828 158370 gene locus_tag LOCUS_01480 158828 158370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 159197 159122 gene locus_tag LOCUS_t00010 159197 159122 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 159290 160072 gene locus_tag LOCUS_01490 gene dppA 159290 160072 CDS product D-aminopeptidase DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245814.1 protein_id gnl|my_center|LOCUS_01490 160100 161566 gene locus_tag LOCUS_01500 160100 161566 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836208.1 protein_id gnl|my_center|LOCUS_01500 161559 162638 gene locus_tag LOCUS_01510 161559 162638 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262044.1 protein_id gnl|my_center|LOCUS_01510 164604 162655 gene locus_tag LOCUS_01520 164604 162655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 166084 164693 gene locus_tag LOCUS_01530 166084 164693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 166920 166093 gene locus_tag LOCUS_01540 166920 166093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 168877 166925 gene locus_tag LOCUS_01550 168877 166925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 169688 169050 gene locus_tag LOCUS_01560 169688 169050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 169876 170856 gene locus_tag LOCUS_01570 gene gmd 169876 170856 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_01570 170872 171927 gene locus_tag LOCUS_01580 170872 171927 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967895.1 protein_id gnl|my_center|LOCUS_01580 172443 175370 gene locus_tag LOCUS_01590 172443 175370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 175412 176197 gene locus_tag LOCUS_01600 175412 176197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 177457 176336 gene locus_tag LOCUS_01610 177457 176336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 179609 177477 gene locus_tag LOCUS_01620 179609 177477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 183170 179823 gene locus_tag LOCUS_01630 183170 179823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 183362 184906 gene locus_tag LOCUS_01640 183362 184906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 185299 184958 gene locus_tag LOCUS_01650 185299 184958 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_01650 187042 185465 gene locus_tag LOCUS_01660 187042 185465 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_01660 188213 187389 gene locus_tag LOCUS_01670 188213 187389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 189318 188251 gene locus_tag LOCUS_01680 189318 188251 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090622.1 protein_id gnl|my_center|LOCUS_01680 190641 189343 gene locus_tag LOCUS_01690 190641 189343 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_01690 192585 190654 gene locus_tag LOCUS_01700 192585 190654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 196002 192595 gene locus_tag LOCUS_01710 196002 192595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 197270 196005 gene locus_tag LOCUS_01720 197270 196005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 197858 197409 gene locus_tag LOCUS_01730 197858 197409 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224598.1 protein_id gnl|my_center|LOCUS_01730 198466 197873 gene locus_tag LOCUS_01740 198466 197873 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_01740 199548 198481 gene locus_tag LOCUS_01750 199548 198481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 200625 199621 gene locus_tag LOCUS_01760 200625 199621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 201065 201883 gene locus_tag LOCUS_01770 201065 201883 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_01770 201896 203311 gene locus_tag LOCUS_01780 201896 203311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 203322 204713 gene locus_tag LOCUS_01790 203322 204713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 204750 205883 gene locus_tag LOCUS_01800 204750 205883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence002 1261 1722 gene locus_tag LOCUS_01810 1261 1722 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666808.1 protein_id gnl|my_center|LOCUS_01810 1792 3846 gene locus_tag LOCUS_01820 1792 3846 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120924.1 protein_id gnl|my_center|LOCUS_01820 3945 6389 gene locus_tag LOCUS_01830 gene topA 3945 6389 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_01830 6522 7703 gene locus_tag LOCUS_01840 6522 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 7707 7997 gene locus_tag LOCUS_01850 7707 7997 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034027947.1 protein_id gnl|my_center|LOCUS_01850 8013 8924 gene locus_tag LOCUS_01860 gene xerC 8013 8924 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_01860 9076 10614 gene locus_tag LOCUS_01870 9076 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 10614 11003 gene locus_tag LOCUS_01880 10614 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 11005 13515 gene locus_tag LOCUS_01890 11005 13515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 13676 14539 gene locus_tag LOCUS_01900 13676 14539 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_01900 14547 15401 gene locus_tag LOCUS_01910 gene ubiA 14547 15401 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_01910 15422 16018 gene locus_tag LOCUS_01920 15422 16018 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140532.1 protein_id gnl|my_center|LOCUS_01920 18168 16015 gene locus_tag LOCUS_01930 18168 16015 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141615.1 protein_id gnl|my_center|LOCUS_01930 19674 18250 gene locus_tag LOCUS_01940 19674 18250 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_01940 21186 19714 gene locus_tag LOCUS_01950 21186 19714 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_01950 21727 21410 gene locus_tag LOCUS_01960 21727 21410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 23150 21729 gene locus_tag LOCUS_01970 23150 21729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 25996 23147 gene locus_tag LOCUS_01980 25996 23147 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_01980 26159 27175 gene locus_tag LOCUS_01990 26159 27175 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_01990 27163 27954 gene locus_tag LOCUS_02000 gene kduD 27163 27954 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_02000 28090 29073 gene locus_tag LOCUS_02010 28090 29073 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_02010 29239 29556 gene locus_tag LOCUS_02020 29239 29556 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_02020 29723 30661 gene locus_tag LOCUS_02030 29723 30661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 31128 30718 gene locus_tag LOCUS_02040 31128 30718 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_02040 31500 32534 gene locus_tag LOCUS_02050 31500 32534 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403619.1 protein_id gnl|my_center|LOCUS_02050 32549 34435 gene locus_tag LOCUS_02060 gene metG 32549 34435 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_02060 34494 35030 gene locus_tag LOCUS_02070 34494 35030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 35023 35259 gene locus_tag LOCUS_02080 35023 35259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 35295 36062 gene locus_tag LOCUS_02090 35295 36062 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_02090 36011 36835 gene locus_tag LOCUS_02100 gene rsmA 36011 36835 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966268.1 protein_id gnl|my_center|LOCUS_02100 36857 37777 gene locus_tag LOCUS_02110 gene ilvE 36857 37777 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_02110 37804 38610 gene locus_tag LOCUS_02120 gene proC 37804 38610 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_02120 38612 39214 gene locus_tag LOCUS_02130 gene hisH 38612 39214 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817212.1 protein_id gnl|my_center|LOCUS_02130 39216 40013 gene locus_tag LOCUS_02140 gene hisF 39216 40013 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_02140 40010 41164 gene locus_tag LOCUS_02150 gene proB 40010 41164 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_02150 41197 41565 gene locus_tag LOCUS_02160 41197 41565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 41562 42356 gene locus_tag LOCUS_02170 41562 42356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 42356 42886 gene locus_tag LOCUS_02180 42356 42886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 42883 44421 gene locus_tag LOCUS_02190 42883 44421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 44435 47155 gene locus_tag LOCUS_02200 44435 47155 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_02200 47142 48140 gene locus_tag LOCUS_02210 47142 48140 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_02210 48144 48632 gene locus_tag LOCUS_02220 48144 48632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 48819 49169 gene locus_tag LOCUS_02230 48819 49169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 49183 49596 gene locus_tag LOCUS_02240 49183 49596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 49745 51871 gene locus_tag LOCUS_02250 49745 51871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 53633 51951 gene locus_tag LOCUS_02260 gene thiC 53633 51951 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 protein_id gnl|my_center|LOCUS_02260 54033 55163 gene locus_tag LOCUS_02270 gene thiO 54033 55163 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_02270 55168 55374 gene locus_tag LOCUS_02280 55168 55374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 55355 56173 gene locus_tag LOCUS_02290 55355 56173 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403988.1 protein_id gnl|my_center|LOCUS_02290 56230 56784 gene locus_tag LOCUS_02300 gene thiE 56230 56784 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880880.1 protein_id gnl|my_center|LOCUS_02300 56781 57575 gene locus_tag LOCUS_02310 gene thiD 56781 57575 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403990.1 protein_id gnl|my_center|LOCUS_02310 57609 58220 gene locus_tag LOCUS_02320 gene thiE 57609 58220 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404299.1 protein_id gnl|my_center|LOCUS_02320 58229 60217 gene locus_tag LOCUS_02330 58229 60217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 60187 61827 gene locus_tag LOCUS_02340 60187 61827 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_02340 61820 64636 gene locus_tag LOCUS_02350 gene fdhF 61820 64636 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:62900..62902,aa:Sec) note codon on position 361 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_02350 66140 64680 gene locus_tag LOCUS_02360 66140 64680 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_02360 67084 66149 gene locus_tag LOCUS_02370 67084 66149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 68717 67104 gene locus_tag LOCUS_02380 68717 67104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 70378 68774 gene locus_tag LOCUS_02390 70378 68774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 71443 70421 gene locus_tag LOCUS_02400 71443 70421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 71669 74857 gene locus_tag LOCUS_02410 71669 74857 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_02410 74995 76023 gene locus_tag LOCUS_02420 gene pdxA 74995 76023 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_02420 76381 76004 gene locus_tag LOCUS_02430 76381 76004 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_02430 76574 77011 gene locus_tag LOCUS_02440 76574 77011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 77008 77685 gene locus_tag LOCUS_02450 77008 77685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 77728 78423 gene locus_tag LOCUS_02460 77728 78423 CDS product protocatechuate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922892.1 protein_id gnl|my_center|LOCUS_02460 78499 78852 gene locus_tag LOCUS_02470 78499 78852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 78987 80246 gene locus_tag LOCUS_02480 78987 80246 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_02480 80298 81686 gene locus_tag LOCUS_02490 80298 81686 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_02490 81714 84932 gene locus_tag LOCUS_02500 81714 84932 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542866.1 protein_id gnl|my_center|LOCUS_02500 85013 85369 gene locus_tag LOCUS_02510 85013 85369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 85537 86439 gene locus_tag LOCUS_02520 85537 86439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 87164 86493 gene locus_tag LOCUS_02530 87164 86493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 87344 88981 gene locus_tag LOCUS_02540 gene ggt 87344 88981 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808651.1 protein_id gnl|my_center|LOCUS_02540 88993 90171 gene locus_tag LOCUS_02550 gene rhmD 88993 90171 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319848.1 protein_id gnl|my_center|LOCUS_02550 90186 90731 gene locus_tag LOCUS_02560 90186 90731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 90747 91604 gene locus_tag LOCUS_02570 90747 91604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145860136.1 protein_id gnl|my_center|LOCUS_02570 91622 92371 gene locus_tag LOCUS_02580 91622 92371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085649.1 protein_id gnl|my_center|LOCUS_02580 92751 93242 gene locus_tag LOCUS_02590 gene ilvN 92751 93242 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_02590 93346 93465 gene locus_tag LOCUS_02600 93346 93465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 93475 95031 gene locus_tag LOCUS_02610 93475 95031 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_02610 95219 96616 gene locus_tag LOCUS_02620 gene leuC 95219 96616 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920779.1 protein_id gnl|my_center|LOCUS_02620 96632 97225 gene locus_tag LOCUS_02630 gene leuD 96632 97225 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_02630 97395 98975 gene locus_tag LOCUS_02640 gene cimA 97395 98975 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_02640 98996 100168 gene locus_tag LOCUS_02650 gene alaC 98996 100168 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_02650 100217 101515 gene locus_tag LOCUS_02660 100217 101515 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094854.1 protein_id gnl|my_center|LOCUS_02660 101512 102180 gene locus_tag LOCUS_02670 101512 102180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 102222 103418 gene locus_tag LOCUS_02680 gene argJ 102222 103418 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_02680 103446 103688 gene locus_tag LOCUS_02690 103446 103688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 103749 104954 gene locus_tag LOCUS_02700 103749 104954 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_02700 104968 105936 gene locus_tag LOCUS_02710 104968 105936 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405067.1 protein_id gnl|my_center|LOCUS_02710 108640 106424 gene locus_tag LOCUS_02720 108640 106424 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_02720 108940 109779 gene locus_tag LOCUS_02730 gene truA 108940 109779 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_02730 109791 110900 gene locus_tag LOCUS_02740 109791 110900 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_02740 110922 111653 gene locus_tag LOCUS_02750 gene pssA 110922 111653 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_02750 111680 111958 gene locus_tag LOCUS_02760 111680 111958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 111979 112215 gene locus_tag LOCUS_02770 111979 112215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 112228 113685 gene locus_tag LOCUS_02780 gene gatA 112228 113685 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_02780 113682 115133 gene locus_tag LOCUS_02790 gene gatB 113682 115133 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_02790 115159 115401 gene locus_tag LOCUS_02800 115159 115401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 115398 115661 gene locus_tag LOCUS_02810 115398 115661 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_02810 117086 115728 gene locus_tag LOCUS_02820 117086 115728 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_02820 119025 117112 gene locus_tag LOCUS_02830 119025 117112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 119124 119834 gene locus_tag LOCUS_02840 119124 119834 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_02840 119887 120855 gene locus_tag LOCUS_02850 119887 120855 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729990.1 protein_id gnl|my_center|LOCUS_02850 120864 122042 gene locus_tag LOCUS_02860 gene gguB 120864 122042 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209589.1 protein_id gnl|my_center|LOCUS_02860 122051 122833 gene locus_tag LOCUS_02870 122051 122833 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 protein_id gnl|my_center|LOCUS_02870 122806 124188 gene locus_tag LOCUS_02880 122806 124188 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_02880 124285 125535 gene locus_tag LOCUS_02890 124285 125535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 125724 125572 gene locus_tag LOCUS_02900 125724 125572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 125675 126427 gene locus_tag LOCUS_02910 125675 126427 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_02910 126507 127514 gene locus_tag LOCUS_02920 126507 127514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 128767 127517 gene locus_tag LOCUS_02930 128767 127517 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_02930 128874 129710 gene locus_tag LOCUS_02940 128874 129710 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_02940 129819 131801 gene locus_tag LOCUS_02950 129819 131801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 131821 132567 gene locus_tag LOCUS_02960 131821 132567 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173807.1 protein_id gnl|my_center|LOCUS_02960 132623 133735 gene locus_tag LOCUS_02970 132623 133735 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_02970 133735 134109 gene locus_tag LOCUS_02980 133735 134109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 134155 134925 gene locus_tag LOCUS_02990 134155 134925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 134934 135323 gene locus_tag LOCUS_03000 gene speD 134934 135323 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081137.1 protein_id gnl|my_center|LOCUS_03000 135446 135697 gene locus_tag LOCUS_03010 135446 135697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 135715 136020 gene locus_tag LOCUS_03020 135715 136020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 137168 136029 gene locus_tag LOCUS_03030 137168 136029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 137308 138783 gene locus_tag LOCUS_03040 137308 138783 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_03040 138796 139806 gene locus_tag LOCUS_03050 gene comC 138796 139806 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870943.1 protein_id gnl|my_center|LOCUS_03050 139911 141203 gene locus_tag LOCUS_03060 gene betC 139911 141203 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807791.1 protein_id gnl|my_center|LOCUS_03060 141251 141949 gene locus_tag LOCUS_03070 141251 141949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 144043 141923 gene locus_tag LOCUS_03080 gene ppk1 144043 141923 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_03080 144351 145304 gene locus_tag LOCUS_03090 144351 145304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 145401 146378 gene locus_tag LOCUS_03100 gene pstS 145401 146378 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_03100 146536 148710 gene locus_tag LOCUS_03110 146536 148710 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768357.1 protein_id gnl|my_center|LOCUS_03110 148727 150328 gene locus_tag LOCUS_03120 gene pstA 148727 150328 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_03120 150352 151161 gene locus_tag LOCUS_03130 gene pstB 150352 151161 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_03130 151178 151855 gene locus_tag LOCUS_03140 gene phoU 151178 151855 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_03140 152149 152637 gene locus_tag LOCUS_03150 152149 152637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 152631 153542 gene locus_tag LOCUS_03160 152631 153542 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_03160 153551 154687 gene locus_tag LOCUS_03170 153551 154687 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_03170 154697 155788 gene locus_tag LOCUS_03180 154697 155788 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272343.1 protein_id gnl|my_center|LOCUS_03180 >Feature sequence003 1660 527 gene locus_tag LOCUS_03190 1660 527 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838638.1 protein_id gnl|my_center|LOCUS_03190 1869 1795 gene locus_tag LOCUS_t00020 1869 1795 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2011 2973 gene locus_tag LOCUS_03200 2011 2973 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_03200 2985 3800 gene locus_tag LOCUS_03210 2985 3800 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085172.1 protein_id gnl|my_center|LOCUS_03210 3823 4506 gene locus_tag LOCUS_03220 3823 4506 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027567.1 protein_id gnl|my_center|LOCUS_03220 4615 6348 gene locus_tag LOCUS_03230 4615 6348 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_03230 6375 8054 gene locus_tag LOCUS_03240 6375 8054 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_03240 8110 8183 gene locus_tag LOCUS_t00030 8110 8183 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8672 9103 gene locus_tag LOCUS_03250 8672 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 9277 9201 gene locus_tag LOCUS_t00040 9277 9201 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10284 9337 gene locus_tag LOCUS_03260 10284 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 11307 10291 gene locus_tag LOCUS_03270 11307 10291 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_03270 12395 11319 gene locus_tag LOCUS_03280 12395 11319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 13498 12416 gene locus_tag LOCUS_03290 13498 12416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 15013 13571 gene locus_tag LOCUS_03300 15013 13571 CDS product MOP flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706047.1 protein_id gnl|my_center|LOCUS_03300 16974 15019 gene locus_tag LOCUS_03310 16974 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 17605 17150 gene locus_tag LOCUS_03320 17605 17150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 17881 17654 gene locus_tag LOCUS_03330 17881 17654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 18108 17911 gene locus_tag LOCUS_03340 18108 17911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 18374 18105 gene locus_tag LOCUS_03350 18374 18105 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_03350 18823 18446 gene locus_tag LOCUS_03360 18823 18446 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157153.1 protein_id gnl|my_center|LOCUS_03360 19448 18993 gene locus_tag LOCUS_03370 19448 18993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 19622 20614 gene locus_tag LOCUS_03380 19622 20614 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033831.1 protein_id gnl|my_center|LOCUS_03380 20624 21667 gene locus_tag LOCUS_03390 20624 21667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 21693 22337 gene locus_tag LOCUS_03400 21693 22337 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 protein_id gnl|my_center|LOCUS_03400 22410 22892 gene locus_tag LOCUS_03410 22410 22892 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545067.1 protein_id gnl|my_center|LOCUS_03410 22889 24727 gene locus_tag LOCUS_03420 22889 24727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 24813 26561 gene locus_tag LOCUS_03430 24813 26561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 26770 27516 gene locus_tag LOCUS_03440 26770 27516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 27597 29414 gene locus_tag LOCUS_03450 27597 29414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 29508 30749 gene locus_tag LOCUS_03460 29508 30749 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838314.1 protein_id gnl|my_center|LOCUS_03460 30746 33796 gene locus_tag LOCUS_03470 30746 33796 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839328.1 protein_id gnl|my_center|LOCUS_03470 33797 34912 gene locus_tag LOCUS_03480 gene alr 33797 34912 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_03480 35158 34856 gene locus_tag LOCUS_03490 35158 34856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 35042 36004 gene locus_tag LOCUS_03500 35042 36004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 36001 37689 gene locus_tag LOCUS_03510 36001 37689 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_03510 37695 38522 gene locus_tag LOCUS_03520 37695 38522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 38705 40759 gene locus_tag LOCUS_03530 gene ligA 38705 40759 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031442.1 protein_id gnl|my_center|LOCUS_03530 40824 40897 gene locus_tag LOCUS_t00050 40824 40897 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 40949 42979 gene locus_tag LOCUS_03540 40949 42979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 44966 42984 gene locus_tag LOCUS_03550 44966 42984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 45877 44975 gene locus_tag LOCUS_03560 45877 44975 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_03560 46043 47425 gene locus_tag LOCUS_03570 46043 47425 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_03570 47503 48315 gene locus_tag LOCUS_03580 47503 48315 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031700.1 protein_id gnl|my_center|LOCUS_03580 48352 48777 gene locus_tag LOCUS_03590 48352 48777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 48756 50789 gene locus_tag LOCUS_03600 48756 50789 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925779.1 protein_id gnl|my_center|LOCUS_03600 50786 51619 gene locus_tag LOCUS_03610 50786 51619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 51639 52457 gene locus_tag LOCUS_03620 51639 52457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 53820 52531 gene locus_tag LOCUS_03630 53820 52531 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211475.1 protein_id gnl|my_center|LOCUS_03630 55272 53863 gene locus_tag LOCUS_03640 55272 53863 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869193.1 protein_id gnl|my_center|LOCUS_03640 55415 56815 gene locus_tag LOCUS_03650 55415 56815 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064158.1 protein_id gnl|my_center|LOCUS_03650 56829 57989 gene locus_tag LOCUS_03660 56829 57989 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_03660 58009 60276 gene locus_tag LOCUS_03670 58009 60276 CDS product DUF4962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927915.1 protein_id gnl|my_center|LOCUS_03670 62153 60267 gene locus_tag LOCUS_03680 62153 60267 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_03680 63108 62158 gene locus_tag LOCUS_03690 63108 62158 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888286.1 protein_id gnl|my_center|LOCUS_03690 64431 63121 gene locus_tag LOCUS_03700 64431 63121 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_03700 64579 66123 gene locus_tag LOCUS_03710 64579 66123 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_03710 69492 66193 gene locus_tag LOCUS_03720 69492 66193 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_03720 70130 69477 gene locus_tag LOCUS_03730 70130 69477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_03730 70566 70150 gene locus_tag LOCUS_03740 70566 70150 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_03740 71067 70576 gene locus_tag LOCUS_03750 71067 70576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921838.1 protein_id gnl|my_center|LOCUS_03750 72381 71089 gene locus_tag LOCUS_03760 72381 71089 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_03760 73653 72397 gene locus_tag LOCUS_03770 73653 72397 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_03770 73972 73664 gene locus_tag LOCUS_03780 73972 73664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 75253 73985 gene locus_tag LOCUS_03790 75253 73985 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_03790 77383 75257 gene locus_tag LOCUS_03800 77383 75257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 78674 77433 gene locus_tag LOCUS_03810 78674 77433 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_03810 80051 78705 gene locus_tag LOCUS_03820 80051 78705 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_03820 81217 80048 gene locus_tag LOCUS_03830 81217 80048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 82350 81235 gene locus_tag LOCUS_03840 82350 81235 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_03840 83778 82354 gene locus_tag LOCUS_03850 83778 82354 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_03850 85883 83994 gene locus_tag LOCUS_03860 85883 83994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 87835 85898 gene locus_tag LOCUS_03870 87835 85898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 89023 87935 gene locus_tag LOCUS_03880 89023 87935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_03880 90464 89037 gene locus_tag LOCUS_03890 90464 89037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 92653 90497 gene locus_tag LOCUS_03900 92653 90497 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146514631.1 protein_id gnl|my_center|LOCUS_03900 92861 93595 gene locus_tag LOCUS_03910 92861 93595 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_03910 93623 95611 gene locus_tag LOCUS_03920 93623 95611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 95738 95968 gene locus_tag LOCUS_03930 95738 95968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 95965 96318 gene locus_tag LOCUS_03940 95965 96318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 96528 97244 gene locus_tag LOCUS_03950 96528 97244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 97237 97770 gene locus_tag LOCUS_03960 97237 97770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064440.1 protein_id gnl|my_center|LOCUS_03960 97810 97947 gene locus_tag LOCUS_03970 97810 97947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 98085 98390 gene locus_tag LOCUS_03980 98085 98390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 98557 99522 gene locus_tag LOCUS_03990 98557 99522 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946655.1 protein_id gnl|my_center|LOCUS_03990 99537 99755 gene locus_tag LOCUS_04000 99537 99755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 99766 100926 gene locus_tag LOCUS_04010 99766 100926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 102412 100934 gene locus_tag LOCUS_04020 gene glpK 102412 100934 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_04020 103200 102409 gene locus_tag LOCUS_04030 103200 102409 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_04030 106196 103197 gene locus_tag LOCUS_04040 106196 103197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 107580 106207 gene locus_tag LOCUS_04050 107580 106207 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250139.1 protein_id gnl|my_center|LOCUS_04050 107676 109853 gene locus_tag LOCUS_04060 107676 109853 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_04060 109846 110046 gene locus_tag LOCUS_04070 109846 110046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 110083 110889 gene locus_tag LOCUS_04080 110083 110889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 110894 111619 gene locus_tag LOCUS_04090 110894 111619 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_04090 113248 111620 gene locus_tag LOCUS_04100 113248 111620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 114203 113265 gene locus_tag LOCUS_04110 114203 113265 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338290.1 protein_id gnl|my_center|LOCUS_04110 115146 114220 gene locus_tag LOCUS_04120 115146 114220 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_04120 115307 116473 gene locus_tag LOCUS_04130 115307 116473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 116477 117256 gene locus_tag LOCUS_04140 116477 117256 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_04140 117479 118693 gene locus_tag LOCUS_04150 117479 118693 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962256.1 protein_id gnl|my_center|LOCUS_04150 118705 119139 gene locus_tag LOCUS_04160 118705 119139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 119150 120328 gene locus_tag LOCUS_04170 119150 120328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 120411 122336 gene locus_tag LOCUS_04180 gene dxs 120411 122336 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880536.1 protein_id gnl|my_center|LOCUS_04180 122354 123028 gene locus_tag LOCUS_04190 122354 123028 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962785.1 protein_id gnl|my_center|LOCUS_04190 123887 123093 gene locus_tag LOCUS_04200 123887 123093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 >Feature sequence004 563 1135 gene locus_tag LOCUS_04210 gene rsmD 563 1135 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 protein_id gnl|my_center|LOCUS_04210 1204 1344 gene locus_tag LOCUS_04220 1204 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 4769 1539 gene locus_tag LOCUS_04230 4769 1539 CDS product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767535.1 protein_id gnl|my_center|LOCUS_04230 6525 4840 gene locus_tag LOCUS_04240 6525 4840 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_04240 7609 6512 gene locus_tag LOCUS_04250 7609 6512 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_04250 9025 7622 gene locus_tag LOCUS_04260 9025 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 10372 9191 gene locus_tag LOCUS_04270 10372 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 11899 10604 gene locus_tag LOCUS_04280 11899 10604 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_04280 12927 11920 gene locus_tag LOCUS_04290 12927 11920 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_04290 13021 14796 gene locus_tag LOCUS_04300 13021 14796 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_04300 16318 14810 gene locus_tag LOCUS_04310 16318 14810 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_04310 19573 16844 gene locus_tag LOCUS_04320 19573 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 19798 20022 gene locus_tag LOCUS_04330 19798 20022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 20037 21242 gene locus_tag LOCUS_04340 20037 21242 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092150.1 protein_id gnl|my_center|LOCUS_04340 21239 22183 gene locus_tag LOCUS_04350 21239 22183 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_04350 22267 23181 gene locus_tag LOCUS_04360 22267 23181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 23205 24446 gene locus_tag LOCUS_04370 23205 24446 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_04370 26901 24502 gene locus_tag LOCUS_04380 26901 24502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 27262 28614 gene locus_tag LOCUS_04390 27262 28614 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_04390 28623 29822 gene locus_tag LOCUS_04400 28623 29822 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208716.1 protein_id gnl|my_center|LOCUS_04400 29812 30609 gene locus_tag LOCUS_04410 29812 30609 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_04410 30602 31285 gene locus_tag LOCUS_04420 30602 31285 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456515.1 protein_id gnl|my_center|LOCUS_04420 31287 31898 gene locus_tag LOCUS_04430 gene nqrE 31287 31898 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_04430 31922 33172 gene locus_tag LOCUS_04440 gene nqrF 31922 33172 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095735.1 protein_id gnl|my_center|LOCUS_04440 33729 33280 gene locus_tag LOCUS_04450 33729 33280 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971842.1 protein_id gnl|my_center|LOCUS_04450 34314 35228 gene locus_tag LOCUS_04460 34314 35228 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246830.1 protein_id gnl|my_center|LOCUS_04460 35239 35463 gene locus_tag LOCUS_04470 35239 35463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 35766 35467 gene locus_tag LOCUS_04480 35766 35467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 35913 36482 gene locus_tag LOCUS_04490 35913 36482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 36484 36774 gene locus_tag LOCUS_04500 36484 36774 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_04500 36771 37103 gene locus_tag LOCUS_04510 gene mnhG 36771 37103 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_04510 37096 37635 gene locus_tag LOCUS_04520 37096 37635 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_04520 37632 38057 gene locus_tag LOCUS_04530 37632 38057 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_04530 38054 38410 gene locus_tag LOCUS_04540 38054 38410 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_04540 38403 39881 gene locus_tag LOCUS_04550 38403 39881 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_04550 39878 41347 gene locus_tag LOCUS_04560 39878 41347 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 protein_id gnl|my_center|LOCUS_04560 41344 41622 gene locus_tag LOCUS_04570 41344 41622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 41615 43366 gene locus_tag LOCUS_04580 41615 43366 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_04580 43596 44339 gene locus_tag LOCUS_04590 43596 44339 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_04590 45071 44442 gene locus_tag LOCUS_04600 gene udk 45071 44442 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257573.1 protein_id gnl|my_center|LOCUS_04600 45138 46439 gene locus_tag LOCUS_04610 45138 46439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 47315 46836 gene locus_tag LOCUS_04620 gene rlmH 47315 46836 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 protein_id gnl|my_center|LOCUS_04620 47487 49190 gene locus_tag LOCUS_04630 47487 49190 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_04630 49207 51210 gene locus_tag LOCUS_04640 49207 51210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 51210 51902 gene locus_tag LOCUS_04650 51210 51902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 51909 52553 gene locus_tag LOCUS_04660 51909 52553 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392433.1 protein_id gnl|my_center|LOCUS_04660 52571 53821 gene locus_tag LOCUS_04670 52571 53821 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_04670 53805 54281 gene locus_tag LOCUS_04680 gene ribE 53805 54281 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_04680 54278 54700 gene locus_tag LOCUS_04690 gene nusB 54278 54700 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 protein_id gnl|my_center|LOCUS_04690 54693 55427 gene locus_tag LOCUS_04700 54693 55427 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_04700 55456 58674 gene locus_tag LOCUS_04710 gene secA 55456 58674 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_04710 58694 59164 gene locus_tag LOCUS_04720 58694 59164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 59293 59580 gene locus_tag LOCUS_04730 gene groES 59293 59580 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918572.1 protein_id gnl|my_center|LOCUS_04730 59599 61224 gene locus_tag LOCUS_04740 gene groL 59599 61224 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_04740 61539 61273 gene locus_tag LOCUS_04750 61539 61273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 61601 62518 gene locus_tag LOCUS_04760 61601 62518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 62593 63846 gene locus_tag LOCUS_04770 62593 63846 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_04770 64248 67757 gene locus_tag LOCUS_04780 64248 67757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 67834 69009 gene locus_tag LOCUS_04790 67834 69009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 69158 69538 gene locus_tag LOCUS_04800 69158 69538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 69583 70140 gene locus_tag LOCUS_04810 69583 70140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 71005 70556 gene locus_tag LOCUS_04820 71005 70556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 71135 70953 gene locus_tag LOCUS_04830 71135 70953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 73230 71242 gene locus_tag LOCUS_04840 73230 71242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 73385 76384 gene locus_tag LOCUS_04850 73385 76384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 76403 78802 gene locus_tag LOCUS_04860 76403 78802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 78813 79586 gene locus_tag LOCUS_04870 78813 79586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 79589 81085 gene locus_tag LOCUS_04880 79589 81085 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_04880 81327 82040 gene locus_tag LOCUS_04890 81327 82040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 82069 85323 gene locus_tag LOCUS_04900 82069 85323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 85434 87866 gene locus_tag LOCUS_04910 85434 87866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 87885 88883 gene locus_tag LOCUS_04920 87885 88883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 88908 90827 gene locus_tag LOCUS_04930 88908 90827 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_04930 90805 92223 gene locus_tag LOCUS_04940 90805 92223 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_04940 92322 95798 gene locus_tag LOCUS_04950 92322 95798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 95806 98148 gene locus_tag LOCUS_04960 95806 98148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 98179 100164 gene locus_tag LOCUS_04970 98179 100164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 100241 102100 gene locus_tag LOCUS_04980 100241 102100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 102598 102999 gene locus_tag LOCUS_04990 102598 102999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 103207 107733 gene locus_tag LOCUS_05000 103207 107733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 107940 108140 gene locus_tag LOCUS_05010 107940 108140 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942550.1 protein_id gnl|my_center|LOCUS_05010 108757 108200 gene locus_tag LOCUS_05020 108757 108200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 108960 109913 gene locus_tag LOCUS_05030 108960 109913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 110348 110007 gene locus_tag LOCUS_05040 110348 110007 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973675.1 protein_id gnl|my_center|LOCUS_05040 110676 110323 gene locus_tag LOCUS_05050 110676 110323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 110703 111203 gene locus_tag LOCUS_05060 110703 111203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 111643 111269 gene locus_tag LOCUS_05070 111643 111269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 112630 112244 gene locus_tag LOCUS_05080 112630 112244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 112831 113463 gene locus_tag LOCUS_05090 112831 113463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 113850 114500 gene locus_tag LOCUS_05100 113850 114500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 114701 114862 gene locus_tag LOCUS_05110 114701 114862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 114964 115185 gene locus_tag LOCUS_05120 114964 115185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 115219 115512 gene locus_tag LOCUS_05130 115219 115512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 115573 116466 gene locus_tag LOCUS_05140 115573 116466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 116940 116629 gene locus_tag LOCUS_05150 116940 116629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 117871 117194 gene locus_tag LOCUS_05160 117871 117194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 118303 118554 gene locus_tag LOCUS_05170 118303 118554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 118852 119016 gene locus_tag LOCUS_05180 118852 119016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 119194 119658 gene locus_tag LOCUS_05190 119194 119658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 119669 120286 gene locus_tag LOCUS_05200 119669 120286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 120306 120917 gene locus_tag LOCUS_05210 120306 120917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 121765 121013 gene locus_tag LOCUS_05220 121765 121013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 123292 121808 gene locus_tag LOCUS_05230 123292 121808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence005 1433 279 gene locus_tag LOCUS_05240 1433 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 2675 1584 gene locus_tag LOCUS_05250 2675 1584 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_05250 4644 2698 gene locus_tag LOCUS_05260 4644 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 5841 4897 gene locus_tag LOCUS_05270 5841 4897 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_05270 6752 5856 gene locus_tag LOCUS_05280 6752 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 7295 6861 gene locus_tag LOCUS_05290 7295 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 8431 7298 gene locus_tag LOCUS_05300 8431 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 9511 8447 gene locus_tag LOCUS_05310 9511 8447 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_05310 10143 9868 gene locus_tag LOCUS_05320 10143 9868 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994576.1 protein_id gnl|my_center|LOCUS_05320 10440 10153 gene locus_tag LOCUS_05330 10440 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05330 11543 10554 gene locus_tag LOCUS_05340 11543 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 11798 13051 gene locus_tag LOCUS_05350 11798 13051 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980451.1 protein_id gnl|my_center|LOCUS_05350 16324 13139 gene locus_tag LOCUS_05360 16324 13139 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_05360 18148 16601 gene locus_tag LOCUS_05370 18148 16601 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_05370 21347 18162 gene locus_tag LOCUS_05380 21347 18162 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_05380 22420 21359 gene locus_tag LOCUS_05390 22420 21359 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967371.1 protein_id gnl|my_center|LOCUS_05390 23751 22444 gene locus_tag LOCUS_05400 23751 22444 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_05400 24682 23756 gene locus_tag LOCUS_05410 24682 23756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 25665 24697 gene locus_tag LOCUS_05420 gene hprK 25665 24697 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839617.1 protein_id gnl|my_center|LOCUS_05420 25983 25669 gene locus_tag LOCUS_05430 25983 25669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 26441 25995 gene locus_tag LOCUS_05440 26441 25995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 26686 27903 gene locus_tag LOCUS_05450 26686 27903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 27914 29095 gene locus_tag LOCUS_05460 27914 29095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 30149 29112 gene locus_tag LOCUS_05470 30149 29112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 31446 30277 gene locus_tag LOCUS_05480 31446 30277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 33249 31507 gene locus_tag LOCUS_05490 33249 31507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 33737 33252 gene locus_tag LOCUS_05500 33737 33252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 34494 33730 gene locus_tag LOCUS_05510 gene map 34494 33730 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225828.1 protein_id gnl|my_center|LOCUS_05510 36123 34507 gene locus_tag LOCUS_05520 36123 34507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 36802 36125 gene locus_tag LOCUS_05530 36802 36125 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_05530 38194 36866 gene locus_tag LOCUS_05540 38194 36866 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_05540 39419 38133 gene locus_tag LOCUS_05550 39419 38133 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_05550 40206 39421 gene locus_tag LOCUS_05560 40206 39421 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_05560 41120 40206 gene locus_tag LOCUS_05570 gene mntA 41120 40206 CDS product manganese ABC transporter substrate-binding protein/adhesin MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229060.1 protein_id gnl|my_center|LOCUS_05570 41436 41287 gene locus_tag LOCUS_05580 41436 41287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 43621 41441 gene locus_tag LOCUS_05590 gene feoB 43621 41441 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_05590 43870 43628 gene locus_tag LOCUS_05600 43870 43628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 44394 43870 gene locus_tag LOCUS_05610 44394 43870 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_05610 44593 47286 gene locus_tag LOCUS_05620 44593 47286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 47386 47661 gene locus_tag LOCUS_05630 47386 47661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 48773 47715 gene locus_tag LOCUS_05640 48773 47715 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_05640 48948 49637 gene locus_tag LOCUS_05650 48948 49637 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_05650 49662 50420 gene locus_tag LOCUS_05660 49662 50420 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767091.1 protein_id gnl|my_center|LOCUS_05660 50921 50478 gene locus_tag LOCUS_05670 50921 50478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 52000 50990 gene locus_tag LOCUS_05680 52000 50990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 52752 52108 gene locus_tag LOCUS_05690 52752 52108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615698.1 protein_id gnl|my_center|LOCUS_05690 56491 52757 gene locus_tag LOCUS_05700 56491 52757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 57705 56506 gene locus_tag LOCUS_05710 57705 56506 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166479973.1 protein_id gnl|my_center|LOCUS_05710 58080 57721 gene locus_tag LOCUS_05720 58080 57721 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_05720 59649 58159 gene locus_tag LOCUS_05730 gene betC 59649 58159 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807791.1 protein_id gnl|my_center|LOCUS_05730 60637 59678 gene locus_tag LOCUS_05740 60637 59678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 61703 60639 gene locus_tag LOCUS_05750 61703 60639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 62752 61790 gene locus_tag LOCUS_05760 62752 61790 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728659.1 protein_id gnl|my_center|LOCUS_05760 64224 62764 gene locus_tag LOCUS_05770 64224 62764 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108631.1 protein_id gnl|my_center|LOCUS_05770 65296 64322 gene locus_tag LOCUS_05780 65296 64322 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_05780 65390 66598 gene locus_tag LOCUS_05790 65390 66598 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083303.1 protein_id gnl|my_center|LOCUS_05790 68388 66583 gene locus_tag LOCUS_05800 68388 66583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 69233 69946 gene locus_tag LOCUS_05810 69233 69946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 70226 72286 gene locus_tag LOCUS_05820 70226 72286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 72283 77025 gene locus_tag LOCUS_05830 72283 77025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 77127 77441 gene locus_tag LOCUS_05840 77127 77441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 77638 77910 gene locus_tag LOCUS_05850 77638 77910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 77907 78320 gene locus_tag LOCUS_05860 77907 78320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05860 78600 79424 gene locus_tag LOCUS_05870 78600 79424 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044973.1 protein_id gnl|my_center|LOCUS_05870 79555 81102 gene locus_tag LOCUS_05880 79555 81102 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108010.1 protein_id gnl|my_center|LOCUS_05880 81318 82769 gene locus_tag LOCUS_05890 81318 82769 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_05890 82782 83921 gene locus_tag LOCUS_05900 82782 83921 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_05900 84012 85172 gene locus_tag LOCUS_05910 84012 85172 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_05910 85749 85261 gene locus_tag LOCUS_05920 85749 85261 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_05920 87377 85794 gene locus_tag LOCUS_05930 87377 85794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 87531 87445 gene locus_tag LOCUS_t00060 87531 87445 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 87928 87539 gene locus_tag LOCUS_05940 87928 87539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 88692 87937 gene locus_tag LOCUS_05950 gene tpiA 88692 87937 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_05950 89929 88727 gene locus_tag LOCUS_05960 89929 88727 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933875.1 protein_id gnl|my_center|LOCUS_05960 90998 89961 gene locus_tag LOCUS_05970 gene gap 90998 89961 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_05970 92055 91015 gene locus_tag LOCUS_05980 92055 91015 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_05980 92899 92192 gene locus_tag LOCUS_05990 92899 92192 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083041.1 protein_id gnl|my_center|LOCUS_05990 92993 94951 gene locus_tag LOCUS_06000 92993 94951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 94948 95637 gene locus_tag LOCUS_06010 94948 95637 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867638.1 protein_id gnl|my_center|LOCUS_06010 96422 95634 gene locus_tag LOCUS_06020 96422 95634 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_06020 97123 96431 gene locus_tag LOCUS_06030 gene radC 97123 96431 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_06030 98117 97308 gene locus_tag LOCUS_06040 98117 97308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 101394 98134 gene locus_tag LOCUS_06050 101394 98134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 102948 101407 gene locus_tag LOCUS_06060 102948 101407 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040522.1 protein_id gnl|my_center|LOCUS_06060 104435 102945 gene locus_tag LOCUS_06070 104435 102945 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666312.1 protein_id gnl|my_center|LOCUS_06070 105168 104458 gene locus_tag LOCUS_06080 105168 104458 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262216.1 protein_id gnl|my_center|LOCUS_06080 106772 105204 gene locus_tag LOCUS_06090 106772 105204 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887610.1 protein_id gnl|my_center|LOCUS_06090 108566 106896 gene locus_tag LOCUS_06100 108566 106896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 109921 108572 gene locus_tag LOCUS_06110 109921 108572 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_06110 110092 112089 gene locus_tag LOCUS_06120 110092 112089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 112142 112981 gene locus_tag LOCUS_06130 112142 112981 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_06130 113180 115156 gene locus_tag LOCUS_06140 113180 115156 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence006 398 1138 gene locus_tag LOCUS_06150 398 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 1583 2896 gene locus_tag LOCUS_06160 1583 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 2898 4715 gene locus_tag LOCUS_06170 2898 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 4792 6111 gene locus_tag LOCUS_06180 4792 6111 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_06180 7451 6192 gene locus_tag LOCUS_06190 7451 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_06190 8260 7451 gene locus_tag LOCUS_06200 8260 7451 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_06200 10539 8257 gene locus_tag LOCUS_06210 10539 8257 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_06210 11882 10707 gene locus_tag LOCUS_06220 11882 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 12438 12007 gene locus_tag LOCUS_06230 12438 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 13143 12664 gene locus_tag LOCUS_06240 13143 12664 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_06240 14615 13158 gene locus_tag LOCUS_06250 14615 13158 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 protein_id gnl|my_center|LOCUS_06250 15713 14628 gene locus_tag LOCUS_06260 15713 14628 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_06260 16842 15715 gene locus_tag LOCUS_06270 16842 15715 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_06270 17241 17011 gene locus_tag LOCUS_06280 17241 17011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 17429 18775 gene locus_tag LOCUS_06290 17429 18775 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805980.1 protein_id gnl|my_center|LOCUS_06290 19936 18770 gene locus_tag LOCUS_06300 19936 18770 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_06300 20149 20898 gene locus_tag LOCUS_06310 20149 20898 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 protein_id gnl|my_center|LOCUS_06310 20990 22303 gene locus_tag LOCUS_06320 20990 22303 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_06320 22337 23656 gene locus_tag LOCUS_06330 22337 23656 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_06330 24732 23653 gene locus_tag LOCUS_06340 24732 23653 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_06340 24958 26004 gene locus_tag LOCUS_06350 24958 26004 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086741.1 protein_id gnl|my_center|LOCUS_06350 26025 28388 gene locus_tag LOCUS_06360 26025 28388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 28422 29321 gene locus_tag LOCUS_06370 28422 29321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 29485 32154 gene locus_tag LOCUS_06380 29485 32154 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_06380 32185 33084 gene locus_tag LOCUS_06390 32185 33084 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974694.1 protein_id gnl|my_center|LOCUS_06390 33423 33199 gene locus_tag LOCUS_06400 33423 33199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 33733 33404 gene locus_tag LOCUS_06410 33733 33404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 35091 33733 gene locus_tag LOCUS_06420 35091 33733 CDS product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259035.1 protein_id gnl|my_center|LOCUS_06420 35885 35127 gene locus_tag LOCUS_06430 35885 35127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 37141 35927 gene locus_tag LOCUS_06440 37141 35927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 38415 37165 gene locus_tag LOCUS_06450 38415 37165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 39854 38412 gene locus_tag LOCUS_06460 39854 38412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 40739 39864 gene locus_tag LOCUS_06470 40739 39864 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 protein_id gnl|my_center|LOCUS_06470 41857 40814 gene locus_tag LOCUS_06480 gene purM 41857 40814 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527676.1 protein_id gnl|my_center|LOCUS_06480 43066 41882 gene locus_tag LOCUS_06490 43066 41882 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257079.1 protein_id gnl|my_center|LOCUS_06490 43166 43855 gene locus_tag LOCUS_06500 43166 43855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_06500 43937 46498 gene locus_tag LOCUS_06510 43937 46498 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_06510 47126 46506 gene locus_tag LOCUS_06520 47126 46506 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_06520 47699 49873 gene locus_tag LOCUS_06530 47699 49873 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_06530 49972 51171 gene locus_tag LOCUS_06540 49972 51171 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_06540 51850 51227 gene locus_tag LOCUS_06550 51850 51227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 56608 51857 gene locus_tag LOCUS_06560 56608 51857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 57670 56642 gene locus_tag LOCUS_06570 57670 56642 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_06570 58869 57688 gene locus_tag LOCUS_06580 58869 57688 CDS product GumC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583709.1 protein_id gnl|my_center|LOCUS_06580 60620 58872 gene locus_tag LOCUS_06590 60620 58872 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582972.1 protein_id gnl|my_center|LOCUS_06590 61516 60617 gene locus_tag LOCUS_06600 gene thrB 61516 60617 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_06600 62626 61517 gene locus_tag LOCUS_06610 gene hemW 62626 61517 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_06610 63321 62632 gene locus_tag LOCUS_06620 gene lepB 63321 62632 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_06620 65186 63330 gene locus_tag LOCUS_06630 gene lepA 65186 63330 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_06630 65432 66304 gene locus_tag LOCUS_06640 65432 66304 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_06640 66316 66969 gene locus_tag LOCUS_06650 gene gmk 66316 66969 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974957.1 protein_id gnl|my_center|LOCUS_06650 67047 67274 gene locus_tag LOCUS_06660 67047 67274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 67240 68445 gene locus_tag LOCUS_06670 gene coaBC 67240 68445 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911762.1 protein_id gnl|my_center|LOCUS_06670 68438 69109 gene locus_tag LOCUS_06680 68438 69109 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931900.1 protein_id gnl|my_center|LOCUS_06680 69109 70482 gene locus_tag LOCUS_06690 gene dnaB 69109 70482 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_06690 70494 71861 gene locus_tag LOCUS_06700 gene radA 70494 71861 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_06700 71886 72509 gene locus_tag LOCUS_06710 71886 72509 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909489.1 protein_id gnl|my_center|LOCUS_06710 72552 73460 gene locus_tag LOCUS_06720 72552 73460 CDS product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615923.1 protein_id gnl|my_center|LOCUS_06720 73487 74776 gene locus_tag LOCUS_06730 73487 74776 CDS product DUF2029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838851.1 protein_id gnl|my_center|LOCUS_06730 74865 75347 gene locus_tag LOCUS_06740 74865 75347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 75352 76347 gene locus_tag LOCUS_06750 75352 76347 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_06750 76358 77239 gene locus_tag LOCUS_06760 76358 77239 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_06760 77250 78176 gene locus_tag LOCUS_06770 77250 78176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_06770 78176 78949 gene locus_tag LOCUS_06780 78176 78949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 78963 79958 gene locus_tag LOCUS_06790 78963 79958 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393248.1 protein_id gnl|my_center|LOCUS_06790 81884 80037 gene locus_tag LOCUS_06800 81884 80037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 82085 83566 gene locus_tag LOCUS_06810 82085 83566 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_06810 83581 84540 gene locus_tag LOCUS_06820 83581 84540 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_06820 84546 86012 gene locus_tag LOCUS_06830 84546 86012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 86009 86911 gene locus_tag LOCUS_06840 86009 86911 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_06840 87998 86886 gene locus_tag LOCUS_06850 gene menC 87998 86886 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_06850 88214 88011 gene locus_tag LOCUS_06860 88214 88011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074051.1 protein_id gnl|my_center|LOCUS_06860 88874 88329 gene locus_tag LOCUS_06870 88874 88329 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227885.1 protein_id gnl|my_center|LOCUS_06870 90968 88929 gene locus_tag LOCUS_06880 90968 88929 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_06880 92331 90976 gene locus_tag LOCUS_06890 92331 90976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 92992 92468 gene locus_tag LOCUS_06900 92992 92468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 95159 93102 gene locus_tag LOCUS_06910 95159 93102 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184203568.1 protein_id gnl|my_center|LOCUS_06910 <96118 95197 gene locus_tag LOCUS_06920 <96118 95197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020498.1:ABC transporter permease >Feature sequence007 <1 1081 gene locus_tag LOCUS_06930 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546680.1:phosphoglycerate dehydrogenase 1096 2373 gene locus_tag LOCUS_06940 1096 2373 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_06940 2538 3224 gene locus_tag LOCUS_06950 2538 3224 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114100.1 protein_id gnl|my_center|LOCUS_06950 3573 3301 gene locus_tag LOCUS_06960 3573 3301 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_06960 3859 3536 gene locus_tag LOCUS_06970 3859 3536 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_06970 3975 4760 gene locus_tag LOCUS_06980 3975 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 5705 4719 gene locus_tag LOCUS_06990 5705 4719 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_06990 5809 7455 gene locus_tag LOCUS_07000 5809 7455 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_07000 7414 7452 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7752 8612 gene locus_tag LOCUS_07010 7752 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 8633 9493 gene locus_tag LOCUS_07020 8633 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 10501 9500 gene locus_tag LOCUS_07030 10501 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 11274 10516 gene locus_tag LOCUS_07040 11274 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 12525 11281 gene locus_tag LOCUS_07050 12525 11281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 13064 12528 gene locus_tag LOCUS_07060 13064 12528 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_07060 13498 13148 gene locus_tag LOCUS_07070 13498 13148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 13933 13607 gene locus_tag LOCUS_07080 13933 13607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 14330 14004 gene locus_tag LOCUS_07090 14330 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 15172 16953 gene locus_tag LOCUS_07100 15172 16953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 17277 16957 gene locus_tag LOCUS_07110 17277 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 17878 17651 gene locus_tag LOCUS_07120 17878 17651 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_07120 18990 17902 gene locus_tag LOCUS_07130 18990 17902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 20156 19047 gene locus_tag LOCUS_07140 20156 19047 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_07140 20872 20171 gene locus_tag LOCUS_07150 20872 20171 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466681.1 protein_id gnl|my_center|LOCUS_07150 22062 21001 gene locus_tag LOCUS_07160 22062 21001 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083752.1 protein_id gnl|my_center|LOCUS_07160 22225 23856 gene locus_tag LOCUS_07170 22225 23856 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_07170 24020 24661 gene locus_tag LOCUS_07180 24020 24661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 24751 27642 gene locus_tag LOCUS_07190 24751 27642 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_07190 27665 28618 gene locus_tag LOCUS_07200 27665 28618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 28620 29936 gene locus_tag LOCUS_07210 28620 29936 CDS product polysaccharide lyase 6 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223691.1 protein_id gnl|my_center|LOCUS_07210 30241 29939 gene locus_tag LOCUS_07220 30241 29939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 30419 30589 gene locus_tag LOCUS_07230 30419 30589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 30567 30743 gene locus_tag LOCUS_07240 30567 30743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 30965 31225 gene locus_tag LOCUS_07250 30965 31225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 31300 31788 gene locus_tag LOCUS_07260 31300 31788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 31775 31963 gene locus_tag LOCUS_07270 31775 31963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 31980 32543 gene locus_tag LOCUS_07280 31980 32543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 33030 34238 gene locus_tag LOCUS_07290 gene rhmD 33030 34238 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297916.1 protein_id gnl|my_center|LOCUS_07290 34256 35089 gene locus_tag LOCUS_07300 34256 35089 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494032.1 protein_id gnl|my_center|LOCUS_07300 35830 35201 gene locus_tag LOCUS_07310 35830 35201 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057070.1 protein_id gnl|my_center|LOCUS_07310 35829 36413 gene locus_tag LOCUS_07320 35829 36413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 37961 36465 gene locus_tag LOCUS_07330 37961 36465 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_07330 38595 37975 gene locus_tag LOCUS_07340 38595 37975 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_07340 39659 38592 gene locus_tag LOCUS_07350 39659 38592 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_07350 39912 40241 gene locus_tag LOCUS_07360 39912 40241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 40382 41785 gene locus_tag LOCUS_07370 40382 41785 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_07370 43316 41907 gene locus_tag LOCUS_07380 43316 41907 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804149.1 protein_id gnl|my_center|LOCUS_07380 43569 46853 gene locus_tag LOCUS_07390 43569 46853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 46878 48761 gene locus_tag LOCUS_07400 46878 48761 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693189.1 protein_id gnl|my_center|LOCUS_07400 50024 48762 gene locus_tag LOCUS_07410 50024 48762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 50089 52158 gene locus_tag LOCUS_07420 50089 52158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 55359 52192 gene locus_tag LOCUS_07430 55359 52192 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_07430 55768 56379 gene locus_tag LOCUS_07440 55768 56379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 56383 57432 gene locus_tag LOCUS_07450 56383 57432 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_07450 57541 58950 gene locus_tag LOCUS_07460 57541 58950 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880071.1 protein_id gnl|my_center|LOCUS_07460 60545 59004 gene locus_tag LOCUS_07470 60545 59004 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_07470 61925 60579 gene locus_tag LOCUS_07480 61925 60579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 62202 62116 gene locus_tag LOCUS_t00070 62202 62116 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 62812 62249 gene locus_tag LOCUS_07490 62812 62249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 63894 62908 gene locus_tag LOCUS_07500 gene floA 63894 62908 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_07500 65256 63922 gene locus_tag LOCUS_07510 65256 63922 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_07510 67042 65411 gene locus_tag LOCUS_07520 67042 65411 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_07520 65417 65492 gene locus_tag LOCUS_t00080 65417 65492 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 67350 67147 gene locus_tag LOCUS_07530 67350 67147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 67591 67427 gene locus_tag LOCUS_07540 67591 67427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 68993 68466 gene locus_tag LOCUS_07550 68993 68466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 69379 70422 gene locus_tag LOCUS_07560 69379 70422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 71465 70806 gene locus_tag LOCUS_07570 71465 70806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 72107 71661 gene locus_tag LOCUS_07580 72107 71661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 72525 72815 gene locus_tag LOCUS_07590 72525 72815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 73019 73471 gene locus_tag LOCUS_07600 73019 73471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 73496 74194 gene locus_tag LOCUS_07610 gene radC 73496 74194 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013390.1 protein_id gnl|my_center|LOCUS_07610 74255 74440 gene locus_tag LOCUS_07620 74255 74440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 74475 74711 gene locus_tag LOCUS_07630 74475 74711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 74766 75035 gene locus_tag LOCUS_07640 74766 75035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 75046 75222 gene locus_tag LOCUS_07650 75046 75222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 75226 75432 gene locus_tag LOCUS_07660 75226 75432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 75490 76236 gene locus_tag LOCUS_07670 75490 76236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 76387 76839 gene locus_tag LOCUS_07680 76387 76839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 76911 78812 gene locus_tag LOCUS_07690 76911 78812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 78905 79498 gene locus_tag LOCUS_07700 78905 79498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 79538 79849 gene locus_tag LOCUS_07710 79538 79849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 79846 80064 gene locus_tag LOCUS_07720 79846 80064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 80100 80381 gene locus_tag LOCUS_07730 80100 80381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 80480 80809 gene locus_tag LOCUS_07740 80480 80809 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_07740 81167 81775 gene locus_tag LOCUS_07750 81167 81775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 81919 82605 gene locus_tag LOCUS_07760 81919 82605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 82598 83101 gene locus_tag LOCUS_07770 82598 83101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 83176 83937 gene locus_tag LOCUS_07780 83176 83937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 85760 84054 gene locus_tag LOCUS_07790 85760 84054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 86587 86117 gene locus_tag LOCUS_07800 86587 86117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 <88991 86946 gene locus_tag LOCUS_07810 <88991 86946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001361307.1:formate hydrogenlyase transcriptional activator FlhA >Feature sequence008 3840 1885 gene locus_tag LOCUS_07820 3840 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 5325 4153 gene locus_tag LOCUS_07830 5325 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 5448 5723 gene locus_tag LOCUS_07840 5448 5723 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392154.1 protein_id gnl|my_center|LOCUS_07840 5739 5939 gene locus_tag LOCUS_07850 5739 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 6046 6576 gene locus_tag LOCUS_07860 6046 6576 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464913.1 protein_id gnl|my_center|LOCUS_07860 6922 6635 gene locus_tag LOCUS_07870 6922 6635 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_07870 7223 6933 gene locus_tag LOCUS_07880 7223 6933 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_07880 7269 8465 gene locus_tag LOCUS_07890 7269 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 8557 9390 gene locus_tag LOCUS_07900 8557 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 9400 10179 gene locus_tag LOCUS_07910 9400 10179 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403116.1 protein_id gnl|my_center|LOCUS_07910 10187 10567 gene locus_tag LOCUS_07920 10187 10567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 10662 11102 gene locus_tag LOCUS_07930 10662 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 11117 12112 gene locus_tag LOCUS_07940 11117 12112 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922725.1 protein_id gnl|my_center|LOCUS_07940 12126 13172 gene locus_tag LOCUS_07950 12126 13172 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014888.1 protein_id gnl|my_center|LOCUS_07950 13181 13972 gene locus_tag LOCUS_07960 13181 13972 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349500.1 protein_id gnl|my_center|LOCUS_07960 14008 14244 gene locus_tag LOCUS_07970 14008 14244 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_07970 14241 14597 gene locus_tag LOCUS_07980 14241 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 14684 14914 gene locus_tag LOCUS_07990 14684 14914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 14916 15146 gene locus_tag LOCUS_08000 14916 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 15157 16197 gene locus_tag LOCUS_08010 15157 16197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 16350 17708 gene locus_tag LOCUS_08020 16350 17708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 17705 19015 gene locus_tag LOCUS_08030 17705 19015 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_08030 19016 19879 gene locus_tag LOCUS_08040 19016 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 19989 21026 gene locus_tag LOCUS_08050 19989 21026 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_08050 21037 21900 gene locus_tag LOCUS_08060 21037 21900 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477847.1 protein_id gnl|my_center|LOCUS_08060 21914 22543 gene locus_tag LOCUS_08070 21914 22543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 22559 23611 gene locus_tag LOCUS_08080 22559 23611 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938010.1 protein_id gnl|my_center|LOCUS_08080 23604 24365 gene locus_tag LOCUS_08090 23604 24365 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_08090 24358 26286 gene locus_tag LOCUS_08100 24358 26286 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877524.1 protein_id gnl|my_center|LOCUS_08100 26283 27281 gene locus_tag LOCUS_08110 26283 27281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 27326 28333 gene locus_tag LOCUS_08120 27326 28333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 28330 29235 gene locus_tag LOCUS_08130 28330 29235 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017181.1 protein_id gnl|my_center|LOCUS_08130 29915 29232 gene locus_tag LOCUS_08140 29915 29232 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933301.1 protein_id gnl|my_center|LOCUS_08140 30692 29931 gene locus_tag LOCUS_08150 30692 29931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 30924 31385 gene locus_tag LOCUS_08160 30924 31385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 31402 32247 gene locus_tag LOCUS_08170 31402 32247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 32401 32670 gene locus_tag LOCUS_08180 32401 32670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 32671 33009 gene locus_tag LOCUS_08190 32671 33009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 33067 33426 gene locus_tag LOCUS_08200 33067 33426 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113527.1 protein_id gnl|my_center|LOCUS_08200 33413 33736 gene locus_tag LOCUS_08210 33413 33736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 38039 33966 gene locus_tag LOCUS_08220 38039 33966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143536993.1 protein_id gnl|my_center|LOCUS_08220 38447 38061 gene locus_tag LOCUS_08230 38447 38061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 41224 38600 gene locus_tag LOCUS_08240 gene mutS 41224 38600 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_08240 41812 41246 gene locus_tag LOCUS_08250 41812 41246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 43302 41959 gene locus_tag LOCUS_08260 gene mtaB 43302 41959 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_08260 45334 43385 gene locus_tag LOCUS_08270 gene rpsA 45334 43385 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931980.1 protein_id gnl|my_center|LOCUS_08270 46071 45427 gene locus_tag LOCUS_08280 46071 45427 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_08280 46765 46088 gene locus_tag LOCUS_08290 gene cmk 46765 46088 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_08290 47581 46859 gene locus_tag LOCUS_08300 47581 46859 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_08300 48239 47493 gene locus_tag LOCUS_08310 gene scpB 48239 47493 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932165.1 protein_id gnl|my_center|LOCUS_08310 49026 48232 gene locus_tag LOCUS_08320 49026 48232 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_08320 50090 49023 gene locus_tag LOCUS_08330 gene trpS 50090 49023 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871951.1 protein_id gnl|my_center|LOCUS_08330 50630 50103 gene locus_tag LOCUS_08340 50630 50103 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932408.1 protein_id gnl|my_center|LOCUS_08340 51122 50739 gene locus_tag LOCUS_08350 gene gcvH 51122 50739 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_08350 52509 51166 gene locus_tag LOCUS_08360 gene accC 52509 51166 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124229.1 protein_id gnl|my_center|LOCUS_08360 53087 52602 gene locus_tag LOCUS_08370 gene accB 53087 52602 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_08370 53654 53097 gene locus_tag LOCUS_08380 gene efp 53654 53097 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076127.1 protein_id gnl|my_center|LOCUS_08380 54396 53659 gene locus_tag LOCUS_08390 54396 53659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 55165 54380 gene locus_tag LOCUS_08400 55165 54380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 55473 55994 gene locus_tag LOCUS_08410 55473 55994 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816077.1 protein_id gnl|my_center|LOCUS_08410 56024 57052 gene locus_tag LOCUS_08420 gene bioB 56024 57052 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398967.1 protein_id gnl|my_center|LOCUS_08420 57061 58938 gene locus_tag LOCUS_08430 gene mnmG 57061 58938 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_08430 58935 59765 gene locus_tag LOCUS_08440 58935 59765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 59777 60247 gene locus_tag LOCUS_08450 gene smpB 59777 60247 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_08450 60458 61168 gene locus_tag LOCUS_08460 60458 61168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 61247 61963 gene locus_tag LOCUS_08470 gene rph 61247 61963 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_08470 61975 62580 gene locus_tag LOCUS_08480 61975 62580 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_08480 62577 62726 gene locus_tag LOCUS_08490 62577 62726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 62757 63197 gene locus_tag LOCUS_08500 62757 63197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 63225 63389 gene locus_tag LOCUS_08510 63225 63389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 64238 63492 gene locus_tag LOCUS_08520 64238 63492 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_08520 65058 64240 gene locus_tag LOCUS_08530 gene fabG 65058 64240 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_08530 66179 65055 gene locus_tag LOCUS_08540 gene mutY 66179 65055 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_08540 66368 66183 gene locus_tag LOCUS_08550 66368 66183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 68216 66570 gene locus_tag LOCUS_08560 68216 66570 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187695.1 protein_id gnl|my_center|LOCUS_08560 69299 68220 gene locus_tag LOCUS_08570 gene aroC 69299 68220 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_08570 70346 69393 gene locus_tag LOCUS_08580 70346 69393 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_08580 70427 70954 gene locus_tag LOCUS_08590 70427 70954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 71601 71044 gene locus_tag LOCUS_08600 gene frr 71601 71044 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_08600 72231 71632 gene locus_tag LOCUS_08610 gene tsf 72231 71632 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_08610 73013 72255 gene locus_tag LOCUS_08620 gene rpsB 73013 72255 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424537.1 protein_id gnl|my_center|LOCUS_08620 73518 73123 gene locus_tag LOCUS_08630 gene rpsI 73518 73123 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_08630 73963 73532 gene locus_tag LOCUS_08640 gene rplM 73963 73532 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_08640 75159 74359 gene locus_tag LOCUS_08650 75159 74359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 75224 75679 gene locus_tag LOCUS_08660 75224 75679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 76925 75687 gene locus_tag LOCUS_08670 76925 75687 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404617.1 protein_id gnl|my_center|LOCUS_08670 77945 76932 gene locus_tag LOCUS_08680 gene iolG 77945 76932 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_08680 78093 79244 gene locus_tag LOCUS_08690 78093 79244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537581.1 protein_id gnl|my_center|LOCUS_08690 79291 80352 gene locus_tag LOCUS_08700 79291 80352 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_08700 80465 81214 gene locus_tag LOCUS_08710 80465 81214 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329167.1 protein_id gnl|my_center|LOCUS_08710 81303 81623 gene locus_tag LOCUS_08720 81303 81623 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_08720 81677 82603 gene locus_tag LOCUS_08730 81677 82603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 82853 83956 gene locus_tag LOCUS_08740 82853 83956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 84048 84644 gene locus_tag LOCUS_08750 84048 84644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 84734 84961 gene locus_tag LOCUS_08760 84734 84961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 85564 85938 gene locus_tag LOCUS_08770 85564 85938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 85943 86173 gene locus_tag LOCUS_08780 85943 86173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 86414 87157 gene locus_tag LOCUS_08790 gene map 86414 87157 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 protein_id gnl|my_center|LOCUS_08790 87341 88138 gene locus_tag LOCUS_08800 87341 88138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence009 1014 1982 gene locus_tag LOCUS_08810 1014 1982 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_08810 1987 2469 gene locus_tag LOCUS_08820 1987 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2577 3428 gene locus_tag LOCUS_08830 2577 3428 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 protein_id gnl|my_center|LOCUS_08830 4790 3438 gene locus_tag LOCUS_08840 gene murD 4790 3438 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_08840 5824 4838 gene locus_tag LOCUS_08850 5824 4838 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_08850 7157 5838 gene locus_tag LOCUS_08860 7157 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404588.1 protein_id gnl|my_center|LOCUS_08860 8983 7154 gene locus_tag LOCUS_08870 8983 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 12242 8958 gene locus_tag LOCUS_08880 12242 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 12915 12253 gene locus_tag LOCUS_08890 12915 12253 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403539.1 protein_id gnl|my_center|LOCUS_08890 13290 12952 gene locus_tag LOCUS_08900 13290 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 14448 13306 gene locus_tag LOCUS_08910 14448 13306 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704678.1 protein_id gnl|my_center|LOCUS_08910 14641 16023 gene locus_tag LOCUS_08920 gene murC 14641 16023 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546590.1 protein_id gnl|my_center|LOCUS_08920 16020 16910 gene locus_tag LOCUS_08930 16020 16910 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933889.1 protein_id gnl|my_center|LOCUS_08930 16907 17707 gene locus_tag LOCUS_08940 16907 17707 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_08940 17716 18702 gene locus_tag LOCUS_08950 17716 18702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 20228 18861 gene locus_tag LOCUS_08960 20228 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 21180 20254 gene locus_tag LOCUS_08970 21180 20254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 22568 21312 gene locus_tag LOCUS_08980 gene aroA 22568 21312 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633771.1 protein_id gnl|my_center|LOCUS_08980 22927 26433 gene locus_tag LOCUS_08990 gene dnaE 22927 26433 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_08990 27725 26505 gene locus_tag LOCUS_09000 gene rodA 27725 26505 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125884.1 protein_id gnl|my_center|LOCUS_09000 29612 27747 gene locus_tag LOCUS_09010 gene mrdA 29612 27747 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932253.1 protein_id gnl|my_center|LOCUS_09010 30081 29602 gene locus_tag LOCUS_09020 30081 29602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 31964 30120 gene locus_tag LOCUS_09030 31964 30120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 32694 31978 gene locus_tag LOCUS_09040 32694 31978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 33944 32907 gene locus_tag LOCUS_09050 gene mtnA 33944 32907 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_09050 34344 33961 gene locus_tag LOCUS_09060 34344 33961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 34774 34361 gene locus_tag LOCUS_09070 34774 34361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 35337 34870 gene locus_tag LOCUS_09080 35337 34870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 35511 35795 gene locus_tag LOCUS_09090 35511 35795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 36479 35811 gene locus_tag LOCUS_09100 36479 35811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 37078 36644 gene locus_tag LOCUS_09110 37078 36644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 37314 37078 gene locus_tag LOCUS_09120 37314 37078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 38458 37334 gene locus_tag LOCUS_09130 gene carA 38458 37334 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_09130 39743 38472 gene locus_tag LOCUS_09140 39743 38472 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_09140 41069 39768 gene locus_tag LOCUS_09150 41069 39768 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_09150 42257 41097 gene locus_tag LOCUS_09160 gene yiaY 42257 41097 CDS product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482586.1 protein_id gnl|my_center|LOCUS_09160 45362 42369 gene locus_tag LOCUS_09170 45362 42369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 47372 45384 gene locus_tag LOCUS_09180 47372 45384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 47671 47811 gene locus_tag LOCUS_09190 47671 47811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 47804 48997 gene locus_tag LOCUS_09200 47804 48997 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_09200 49032 50084 gene locus_tag LOCUS_09210 49032 50084 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_09210 51548 50088 gene locus_tag LOCUS_09220 51548 50088 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_09220 51811 53691 gene locus_tag LOCUS_09230 51811 53691 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_09230 53702 55603 gene locus_tag LOCUS_09240 53702 55603 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_09240 55678 56583 gene locus_tag LOCUS_09250 55678 56583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071996.1 protein_id gnl|my_center|LOCUS_09250 56596 57702 gene locus_tag LOCUS_09260 56596 57702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 57752 59164 gene locus_tag LOCUS_09270 57752 59164 CDS product DNA methyltransferase C1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545124.1 protein_id gnl|my_center|LOCUS_09270 59183 59710 gene locus_tag LOCUS_09280 59183 59710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 59897 59676 gene locus_tag LOCUS_09290 59897 59676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 60058 61389 gene locus_tag LOCUS_09300 60058 61389 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886456.1 protein_id gnl|my_center|LOCUS_09300 61449 62990 gene locus_tag LOCUS_09310 61449 62990 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_09310 62995 63174 gene locus_tag LOCUS_09320 62995 63174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 63222 63689 gene locus_tag LOCUS_09330 63222 63689 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436879.1 protein_id gnl|my_center|LOCUS_09330 64539 63682 gene locus_tag LOCUS_09340 64539 63682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 64742 65557 gene locus_tag LOCUS_09350 64742 65557 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032899275.1 protein_id gnl|my_center|LOCUS_09350 65575 66891 gene locus_tag LOCUS_09360 65575 66891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 67986 66895 gene locus_tag LOCUS_09370 67986 66895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 69586 68093 gene locus_tag LOCUS_09380 69586 68093 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_09380 74175 69601 gene locus_tag LOCUS_09390 gene gltB 74175 69601 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_09390 74525 74262 gene locus_tag LOCUS_09400 74525 74262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 75228 74665 gene locus_tag LOCUS_09410 75228 74665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 77466 75238 gene locus_tag LOCUS_09420 77466 75238 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_09420 78587 77577 gene locus_tag LOCUS_09430 gene moaA 78587 77577 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844124.1 protein_id gnl|my_center|LOCUS_09430 79665 78649 gene locus_tag LOCUS_09440 79665 78649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 83388 79774 gene locus_tag LOCUS_09450 gene smc 83388 79774 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403652.1 protein_id gnl|my_center|LOCUS_09450 83364 83522 gene locus_tag LOCUS_09460 83364 83522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 83758 84885 gene locus_tag LOCUS_09470 83758 84885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 84899 85936 gene locus_tag LOCUS_09480 84899 85936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence010 240 2456 gene locus_tag LOCUS_09490 240 2456 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_09490 2477 3382 gene locus_tag LOCUS_09500 2477 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3382 5337 gene locus_tag LOCUS_09510 3382 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 5350 6834 gene locus_tag LOCUS_09520 5350 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 6881 8479 gene locus_tag LOCUS_09530 6881 8479 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_09530 8501 9805 gene locus_tag LOCUS_09540 8501 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 9821 10783 gene locus_tag LOCUS_09550 9821 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 10823 12955 gene locus_tag LOCUS_09560 10823 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 12956 14902 gene locus_tag LOCUS_09570 12956 14902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 14977 16965 gene locus_tag LOCUS_09580 14977 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 16958 20272 gene locus_tag LOCUS_09590 16958 20272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 20269 22059 gene locus_tag LOCUS_09600 20269 22059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 22061 22882 gene locus_tag LOCUS_09610 22061 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 22869 23600 gene locus_tag LOCUS_09620 22869 23600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 23705 24247 gene locus_tag LOCUS_09630 23705 24247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 24258 24932 gene locus_tag LOCUS_09640 24258 24932 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_09640 24920 25834 gene locus_tag LOCUS_09650 24920 25834 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398525.1 protein_id gnl|my_center|LOCUS_09650 25838 26878 gene locus_tag LOCUS_09660 25838 26878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 26881 28278 gene locus_tag LOCUS_09670 26881 28278 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807657.1 protein_id gnl|my_center|LOCUS_09670 29230 28265 gene locus_tag LOCUS_09680 29230 28265 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258396.1 protein_id gnl|my_center|LOCUS_09680 30026 29244 gene locus_tag LOCUS_09690 30026 29244 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529864.1 protein_id gnl|my_center|LOCUS_09690 30397 30023 gene locus_tag LOCUS_09700 30397 30023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 30546 30917 gene locus_tag LOCUS_09710 30546 30917 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246073.1 protein_id gnl|my_center|LOCUS_09710 34236 30982 gene locus_tag LOCUS_09720 34236 30982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 34845 34336 gene locus_tag LOCUS_09730 34845 34336 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 protein_id gnl|my_center|LOCUS_09730 37160 34863 gene locus_tag LOCUS_09740 37160 34863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_09740 38062 37316 gene locus_tag LOCUS_09750 38062 37316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 38178 39209 gene locus_tag LOCUS_09760 38178 39209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 41129 39246 gene locus_tag LOCUS_09770 41129 39246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 42493 41216 gene locus_tag LOCUS_09780 42493 41216 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_09780 43034 42591 gene locus_tag LOCUS_09790 43034 42591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 44094 43156 gene locus_tag LOCUS_09800 44094 43156 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118199.1 protein_id gnl|my_center|LOCUS_09800 45584 44091 gene locus_tag LOCUS_09810 45584 44091 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922314.1 protein_id gnl|my_center|LOCUS_09810 47125 45605 gene locus_tag LOCUS_09820 47125 45605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 48117 47137 gene locus_tag LOCUS_09830 48117 47137 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_09830 48965 48114 gene locus_tag LOCUS_09840 48965 48114 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083715.1 protein_id gnl|my_center|LOCUS_09840 49978 49103 gene locus_tag LOCUS_09850 49978 49103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 51250 50039 gene locus_tag LOCUS_09860 51250 50039 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_09860 52340 51444 gene locus_tag LOCUS_09870 52340 51444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 52904 52455 gene locus_tag LOCUS_09880 52904 52455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 54689 52986 gene locus_tag LOCUS_09890 54689 52986 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671072.1 protein_id gnl|my_center|LOCUS_09890 56062 54689 gene locus_tag LOCUS_09900 56062 54689 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_09900 57166 56066 gene locus_tag LOCUS_09910 57166 56066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 59516 57189 gene locus_tag LOCUS_09920 59516 57189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 60617 59658 gene locus_tag LOCUS_09930 60617 59658 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974694.1 protein_id gnl|my_center|LOCUS_09930 62186 60876 gene locus_tag LOCUS_09940 62186 60876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 63131 62205 gene locus_tag LOCUS_09950 63131 62205 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_09950 64607 63255 gene locus_tag LOCUS_09960 64607 63255 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933564.1 protein_id gnl|my_center|LOCUS_09960 65321 64704 gene locus_tag LOCUS_09970 65321 64704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 65623 65698 gene locus_tag LOCUS_t00090 65623 65698 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 65714 65790 gene locus_tag LOCUS_t00100 65714 65790 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 65895 67253 gene locus_tag LOCUS_09980 65895 67253 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902151.1 protein_id gnl|my_center|LOCUS_09980 67286 67837 gene locus_tag LOCUS_09990 67286 67837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 68397 67915 gene locus_tag LOCUS_10000 gene nrdR 68397 67915 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_10000 69461 68547 gene locus_tag LOCUS_10010 69461 68547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 69754 70515 gene locus_tag LOCUS_10020 69754 70515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 70512 70889 gene locus_tag LOCUS_10030 70512 70889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 71221 70925 gene locus_tag LOCUS_10040 71221 70925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 71530 71240 gene locus_tag LOCUS_10050 71530 71240 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_10050 71762 71686 gene locus_tag LOCUS_t00110 71762 71686 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 73125 71818 gene locus_tag LOCUS_10060 73125 71818 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931023.1 protein_id gnl|my_center|LOCUS_10060 73599 73183 gene locus_tag LOCUS_10070 73599 73183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 75860 73605 gene locus_tag LOCUS_10080 75860 73605 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_10080 76759 75857 gene locus_tag LOCUS_10090 76759 75857 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228398.1 protein_id gnl|my_center|LOCUS_10090 77824 76982 gene locus_tag LOCUS_10100 77824 76982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 78111 77866 gene locus_tag LOCUS_10110 78111 77866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 80044 78269 gene locus_tag LOCUS_10120 gene aspS 80044 78269 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_10120 81346 80054 gene locus_tag LOCUS_10130 gene hisS 81346 80054 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_10130 82741 81476 gene locus_tag LOCUS_10140 82741 81476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 82946 84721 gene locus_tag LOCUS_10150 82946 84721 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 protein_id gnl|my_center|LOCUS_10150 84726 86705 gene locus_tag LOCUS_10160 84726 86705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence011 654 205 gene locus_tag LOCUS_10170 654 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1353 859 gene locus_tag LOCUS_10180 1353 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2464 1397 gene locus_tag LOCUS_10190 2464 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2348 2896 gene locus_tag LOCUS_10200 2348 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 2912 3223 gene locus_tag LOCUS_10210 2912 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 4204 3518 gene locus_tag LOCUS_10220 4204 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 4609 4214 gene locus_tag LOCUS_10230 4609 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 5311 4652 gene locus_tag LOCUS_10240 5311 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 6533 5889 gene locus_tag LOCUS_10250 6533 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 6753 7013 gene locus_tag LOCUS_10260 6753 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 6994 8268 gene locus_tag LOCUS_10270 6994 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 8291 8518 gene locus_tag LOCUS_10280 8291 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 9640 8552 gene locus_tag LOCUS_10290 9640 8552 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530306.1 protein_id gnl|my_center|LOCUS_10290 10239 9640 gene locus_tag LOCUS_10300 10239 9640 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868563.1 protein_id gnl|my_center|LOCUS_10300 12296 10236 gene locus_tag LOCUS_10310 12296 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 12369 13676 gene locus_tag LOCUS_10320 12369 13676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 13838 14680 gene locus_tag LOCUS_10330 13838 14680 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_10330 15530 14682 gene locus_tag LOCUS_10340 15530 14682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 15689 16531 gene locus_tag LOCUS_10350 15689 16531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 16544 17779 gene locus_tag LOCUS_10360 16544 17779 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391965.1 protein_id gnl|my_center|LOCUS_10360 17784 18308 gene locus_tag LOCUS_10370 17784 18308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 18313 19854 gene locus_tag LOCUS_10380 18313 19854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 20823 19924 gene locus_tag LOCUS_10390 20823 19924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 21715 20837 gene locus_tag LOCUS_10400 21715 20837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 22596 21739 gene locus_tag LOCUS_10410 22596 21739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 23687 22842 gene locus_tag LOCUS_10420 23687 22842 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895438.1 protein_id gnl|my_center|LOCUS_10420 23761 24006 gene locus_tag LOCUS_10430 23761 24006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 25567 24008 gene locus_tag LOCUS_10440 25567 24008 CDS product DUF5060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922627.1 protein_id gnl|my_center|LOCUS_10440 26500 25691 gene locus_tag LOCUS_10450 26500 25691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 26933 26682 gene locus_tag LOCUS_10460 26933 26682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 27424 27071 gene locus_tag LOCUS_10470 gene queF 27424 27071 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_10470 27765 27421 gene locus_tag LOCUS_10480 27765 27421 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_10480 28936 27770 gene locus_tag LOCUS_10490 28936 27770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 29172 28975 gene locus_tag LOCUS_10500 29172 28975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 29092 29697 gene locus_tag LOCUS_10510 gene cysC 29092 29697 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 protein_id gnl|my_center|LOCUS_10510 29700 30359 gene locus_tag LOCUS_10520 29700 30359 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258352.1 protein_id gnl|my_center|LOCUS_10520 30376 31737 gene locus_tag LOCUS_10530 30376 31737 CDS product NAD-binding homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390889.1 protein_id gnl|my_center|LOCUS_10530 32492 31905 gene locus_tag LOCUS_10540 32492 31905 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_10540 35173 32492 gene locus_tag LOCUS_10550 gene acnA 35173 32492 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118669.1 protein_id gnl|my_center|LOCUS_10550 35428 35198 gene locus_tag LOCUS_10560 35428 35198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 35573 35421 gene locus_tag LOCUS_10570 35573 35421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 36063 35671 gene locus_tag LOCUS_10580 36063 35671 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_10580 36293 36060 gene locus_tag LOCUS_10590 36293 36060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258117.1 protein_id gnl|my_center|LOCUS_10590 36622 37701 gene locus_tag LOCUS_10600 36622 37701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 37834 39414 gene locus_tag LOCUS_10610 gene gpmI 37834 39414 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_10610 40968 39541 gene locus_tag LOCUS_10620 40968 39541 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_10620 41664 40975 gene locus_tag LOCUS_10630 gene rlmB 41664 40975 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064116.1 protein_id gnl|my_center|LOCUS_10630 42157 41672 gene locus_tag LOCUS_10640 42157 41672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 42795 42181 gene locus_tag LOCUS_10650 42795 42181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 42938 44269 gene locus_tag LOCUS_10660 42938 44269 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_10660 44298 45395 gene locus_tag LOCUS_10670 44298 45395 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064805.1 protein_id gnl|my_center|LOCUS_10670 45817 45401 gene locus_tag LOCUS_10680 45817 45401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 46487 45828 gene locus_tag LOCUS_10690 46487 45828 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108700.1 protein_id gnl|my_center|LOCUS_10690 46566 47675 gene locus_tag LOCUS_10700 gene dctP 46566 47675 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_10700 48998 47679 gene locus_tag LOCUS_10710 48998 47679 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_10710 49519 48995 gene locus_tag LOCUS_10720 49519 48995 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_10720 49819 49553 gene locus_tag LOCUS_10730 49819 49553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 50024 49836 gene locus_tag LOCUS_10740 50024 49836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 50328 51752 gene locus_tag LOCUS_10750 50328 51752 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816500.1 protein_id gnl|my_center|LOCUS_10750 52078 52293 gene locus_tag LOCUS_10760 52078 52293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 52446 53576 gene locus_tag LOCUS_10770 52446 53576 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_10770 53590 54246 gene locus_tag LOCUS_10780 53590 54246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 54368 56152 gene locus_tag LOCUS_10790 54368 56152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_10790 56154 56696 gene locus_tag LOCUS_10800 56154 56696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 58312 56852 gene locus_tag LOCUS_10810 gene dop 58312 56852 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080108.1 protein_id gnl|my_center|LOCUS_10810 59109 58309 gene locus_tag LOCUS_10820 59109 58309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 59909 59106 gene locus_tag LOCUS_10830 gene prcB 59909 59106 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_10830 60104 59913 gene locus_tag LOCUS_10840 60104 59913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 61640 60105 gene locus_tag LOCUS_10850 gene dop 61640 60105 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_10850 63288 61642 gene locus_tag LOCUS_10860 gene arc 63288 61642 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_10860 63918 63352 gene locus_tag LOCUS_10870 63918 63352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 64174 63890 gene locus_tag LOCUS_10880 64174 63890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 65289 64354 gene locus_tag LOCUS_10890 65289 64354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 66311 65301 gene locus_tag LOCUS_10900 66311 65301 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_10900 68581 66491 gene locus_tag LOCUS_10910 68581 66491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 72551 68667 gene locus_tag LOCUS_10920 72551 68667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 78842 72624 gene locus_tag LOCUS_10930 78842 72624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 80409 79483 gene locus_tag LOCUS_10940 80409 79483 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_10940 80612 80409 gene locus_tag LOCUS_10950 80612 80409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence012 1026 508 gene locus_tag LOCUS_10960 1026 508 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_10960 1289 1771 gene locus_tag LOCUS_10970 1289 1771 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_10970 2621 1842 gene locus_tag LOCUS_10980 2621 1842 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405435.1 protein_id gnl|my_center|LOCUS_10980 3721 2621 gene locus_tag LOCUS_10990 3721 2621 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_10990 4575 3718 gene locus_tag LOCUS_11000 4575 3718 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_11000 4898 4575 gene locus_tag LOCUS_11010 4898 4575 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258292.1 protein_id gnl|my_center|LOCUS_11010 5689 4925 gene locus_tag LOCUS_11020 5689 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 8050 5720 gene locus_tag LOCUS_11030 8050 5720 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405431.1 protein_id gnl|my_center|LOCUS_11030 8534 8094 gene locus_tag LOCUS_11040 8534 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 10381 8720 gene locus_tag LOCUS_11050 10381 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 12820 10430 gene locus_tag LOCUS_11060 12820 10430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 14409 13018 gene locus_tag LOCUS_11070 14409 13018 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_11070 15579 14509 gene locus_tag LOCUS_11080 15579 14509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 16841 15600 gene locus_tag LOCUS_11090 16841 15600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_11090 17740 16979 gene locus_tag LOCUS_11100 17740 16979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 18312 17737 gene locus_tag LOCUS_11110 18312 17737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 19452 18334 gene locus_tag LOCUS_11120 19452 18334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 19944 19723 gene locus_tag LOCUS_11130 19944 19723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 20585 19971 gene locus_tag LOCUS_11140 20585 19971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 21325 20624 gene locus_tag LOCUS_11150 21325 20624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 22034 21465 gene locus_tag LOCUS_11160 22034 21465 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243940.1 protein_id gnl|my_center|LOCUS_11160 22324 23301 gene locus_tag LOCUS_11170 22324 23301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 23298 24047 gene locus_tag LOCUS_11180 23298 24047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 24162 26954 gene locus_tag LOCUS_11190 24162 26954 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528850.1 protein_id gnl|my_center|LOCUS_11190 26967 28139 gene locus_tag LOCUS_11200 gene odhB 26967 28139 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705800.1 protein_id gnl|my_center|LOCUS_11200 28201 29622 gene locus_tag LOCUS_11210 gene lpdA 28201 29622 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_11210 29629 31422 gene locus_tag LOCUS_11220 29629 31422 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434478.1 protein_id gnl|my_center|LOCUS_11220 31800 31495 gene locus_tag LOCUS_11230 gene ihfA 31800 31495 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419121.1 protein_id gnl|my_center|LOCUS_11230 32008 31932 gene locus_tag LOCUS_t00120 32008 31932 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 33868 32096 gene locus_tag LOCUS_11240 gene dnaG 33868 32096 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528223.1 protein_id gnl|my_center|LOCUS_11240 35991 34021 gene locus_tag LOCUS_11250 35991 34021 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_11250 36644 36036 gene locus_tag LOCUS_11260 36644 36036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 36925 36728 gene locus_tag LOCUS_11270 gene rpsU 36925 36728 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943714.1 protein_id gnl|my_center|LOCUS_11270 37191 38477 gene locus_tag LOCUS_11280 37191 38477 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839261.1 protein_id gnl|my_center|LOCUS_11280 38507 40081 gene locus_tag LOCUS_11290 38507 40081 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_11290 40091 40534 gene locus_tag LOCUS_11300 gene tsaE 40091 40534 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966123.1 protein_id gnl|my_center|LOCUS_11300 40646 41362 gene locus_tag LOCUS_11310 40646 41362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 41839 41381 gene locus_tag LOCUS_11320 41839 41381 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_11320 42573 41836 gene locus_tag LOCUS_11330 42573 41836 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225011.1 protein_id gnl|my_center|LOCUS_11330 43568 42588 gene locus_tag LOCUS_11340 43568 42588 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_11340 44696 43581 gene locus_tag LOCUS_11350 44696 43581 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_11350 45695 44727 gene locus_tag LOCUS_11360 45695 44727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 46705 45713 gene locus_tag LOCUS_11370 46705 45713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 47274 46702 gene locus_tag LOCUS_11380 47274 46702 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549852.1 protein_id gnl|my_center|LOCUS_11380 47498 49126 gene locus_tag LOCUS_11390 47498 49126 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085891.1 protein_id gnl|my_center|LOCUS_11390 50019 49135 gene locus_tag LOCUS_11400 50019 49135 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116510.1 protein_id gnl|my_center|LOCUS_11400 50260 50547 gene locus_tag LOCUS_11410 50260 50547 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_11410 51275 50520 gene locus_tag LOCUS_11420 51275 50520 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_11420 51453 51590 gene locus_tag LOCUS_11430 51453 51590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11430 52178 51768 gene locus_tag LOCUS_11440 52178 51768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 52465 52199 gene locus_tag LOCUS_11450 52465 52199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 53187 52573 gene locus_tag LOCUS_11460 53187 52573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 54236 53190 gene locus_tag LOCUS_11470 54236 53190 CDS product ATP/GTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616490.1 protein_id gnl|my_center|LOCUS_11470 55326 54400 gene locus_tag LOCUS_11480 55326 54400 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083703.1 protein_id gnl|my_center|LOCUS_11480 56204 55323 gene locus_tag LOCUS_11490 56204 55323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 57122 56247 gene locus_tag LOCUS_11500 57122 56247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 58047 57169 gene locus_tag LOCUS_11510 58047 57169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 58939 58085 gene locus_tag LOCUS_11520 58939 58085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 60485 59058 gene locus_tag LOCUS_11530 60485 59058 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035535025.1 protein_id gnl|my_center|LOCUS_11530 60580 61527 gene locus_tag LOCUS_11540 60580 61527 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_11540 62805 61534 gene locus_tag LOCUS_11550 62805 61534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 63720 62917 gene locus_tag LOCUS_11560 63720 62917 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681582.1 protein_id gnl|my_center|LOCUS_11560 64555 63725 gene locus_tag LOCUS_11570 64555 63725 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956754.1 protein_id gnl|my_center|LOCUS_11570 65516 64539 gene locus_tag LOCUS_11580 65516 64539 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_11580 66310 65726 gene locus_tag LOCUS_11590 gene nfuA 66310 65726 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_11590 66812 66330 gene locus_tag LOCUS_11600 66812 66330 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_11600 67278 66841 gene locus_tag LOCUS_11610 67278 66841 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971890.1 protein_id gnl|my_center|LOCUS_11610 67736 67275 gene locus_tag LOCUS_11620 67736 67275 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_11620 69016 67736 gene locus_tag LOCUS_11630 69016 67736 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_11630 70338 69013 gene locus_tag LOCUS_11640 gene sufD 70338 69013 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_11640 71059 70298 gene locus_tag LOCUS_11650 gene sufC 71059 70298 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_11650 72554 71085 gene locus_tag LOCUS_11660 gene sufB 72554 71085 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_11660 73114 72692 gene locus_tag LOCUS_11670 73114 72692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 74095 73154 gene locus_tag LOCUS_11680 74095 73154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 74322 74951 gene locus_tag LOCUS_11690 gene lexA 74322 74951 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence013 2409 700 gene locus_tag LOCUS_11700 2409 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3412 2435 gene locus_tag LOCUS_11710 3412 2435 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_11710 4755 3424 gene locus_tag LOCUS_11720 gene rfbH 4755 3424 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_11720 5704 4766 gene locus_tag LOCUS_11730 5704 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6804 5701 gene locus_tag LOCUS_11740 6804 5701 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105806.1 protein_id gnl|my_center|LOCUS_11740 7867 6794 gene locus_tag LOCUS_11750 gene rfbG 7867 6794 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 protein_id gnl|my_center|LOCUS_11750 8646 7867 gene locus_tag LOCUS_11760 gene rfbF 8646 7867 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_11760 10344 8971 gene locus_tag LOCUS_11770 10344 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 12105 10543 gene locus_tag LOCUS_11780 12105 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 12473 13330 gene locus_tag LOCUS_11790 12473 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 13989 13384 gene locus_tag LOCUS_11800 13989 13384 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062451.1 protein_id gnl|my_center|LOCUS_11800 14396 15235 gene locus_tag LOCUS_11810 14396 15235 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_11810 15783 15340 gene locus_tag LOCUS_11820 gene rplI 15783 15340 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_11820 16049 15798 gene locus_tag LOCUS_11830 gene rpsR 16049 15798 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869404.1 protein_id gnl|my_center|LOCUS_11830 16383 16042 gene locus_tag LOCUS_11840 gene rpsF 16383 16042 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975025.1 protein_id gnl|my_center|LOCUS_11840 18448 16454 gene locus_tag LOCUS_11850 18448 16454 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_11850 19022 18465 gene locus_tag LOCUS_11860 gene pth 19022 18465 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082100.1 protein_id gnl|my_center|LOCUS_11860 19707 19012 gene locus_tag LOCUS_11870 19707 19012 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157650.1 protein_id gnl|my_center|LOCUS_11870 20604 19753 gene locus_tag LOCUS_11880 gene ispE 20604 19753 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356061.1 protein_id gnl|my_center|LOCUS_11880 20729 24628 gene locus_tag LOCUS_11890 20729 24628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 24631 26151 gene locus_tag LOCUS_11900 24631 26151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 26233 27702 gene locus_tag LOCUS_11910 26233 27702 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 protein_id gnl|my_center|LOCUS_11910 27714 28838 gene locus_tag LOCUS_11920 27714 28838 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_11920 28860 29780 gene locus_tag LOCUS_11930 gene xerD 28860 29780 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932289.1 protein_id gnl|my_center|LOCUS_11930 29856 30089 gene locus_tag LOCUS_11940 29856 30089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 31930 30116 gene locus_tag LOCUS_11950 gene uvrC 31930 30116 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_11950 32439 31945 gene locus_tag LOCUS_11960 32439 31945 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_11960 32615 33493 gene locus_tag LOCUS_11970 gene hisG 32615 33493 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_11970 33522 35921 gene locus_tag LOCUS_11980 33522 35921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 35937 37232 gene locus_tag LOCUS_11990 gene hisD 35937 37232 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404855.1 protein_id gnl|my_center|LOCUS_11990 37229 38299 gene locus_tag LOCUS_12000 gene hisC 37229 38299 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017744.1 protein_id gnl|my_center|LOCUS_12000 38400 39824 gene locus_tag LOCUS_12010 38400 39824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 39910 40500 gene locus_tag LOCUS_12020 gene hisB 39910 40500 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_12020 40497 41048 gene locus_tag LOCUS_12030 gene gmhB 40497 41048 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_12030 41059 42180 gene locus_tag LOCUS_12040 41059 42180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 42177 44546 gene locus_tag LOCUS_12050 42177 44546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933858.1 protein_id gnl|my_center|LOCUS_12050 44527 46047 gene locus_tag LOCUS_12060 44527 46047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 46161 47228 gene locus_tag LOCUS_12070 46161 47228 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130607213.1 protein_id gnl|my_center|LOCUS_12070 47254 48390 gene locus_tag LOCUS_12080 47254 48390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 48474 49430 gene locus_tag LOCUS_12090 48474 49430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 49459 50517 gene locus_tag LOCUS_12100 49459 50517 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_12100 50514 52052 gene locus_tag LOCUS_12110 50514 52052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 52134 53063 gene locus_tag LOCUS_12120 52134 53063 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_12120 53064 54188 gene locus_tag LOCUS_12130 53064 54188 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_12130 54346 54185 gene locus_tag LOCUS_12140 54346 54185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 54587 55870 gene locus_tag LOCUS_12150 gene serS 54587 55870 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963346.1 protein_id gnl|my_center|LOCUS_12150 56116 56691 gene locus_tag LOCUS_12160 56116 56691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 59634 57277 gene locus_tag LOCUS_12170 59634 57277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 60101 63367 gene locus_tag LOCUS_12180 60101 63367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 63721 66300 gene locus_tag LOCUS_12190 63721 66300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 66379 66843 gene locus_tag LOCUS_12200 66379 66843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 67255 67848 gene locus_tag LOCUS_12210 67255 67848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 67833 68798 gene locus_tag LOCUS_12220 67833 68798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 69343 72978 gene locus_tag LOCUS_12230 69343 72978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence014 524 1303 gene locus_tag LOCUS_12240 524 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2379 1309 gene locus_tag LOCUS_12250 2379 1309 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_12250 3397 2393 gene locus_tag LOCUS_12260 3397 2393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256222.1 protein_id gnl|my_center|LOCUS_12260 3934 3665 gene locus_tag LOCUS_12270 3934 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 5555 3966 gene locus_tag LOCUS_12280 5555 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 6566 5613 gene locus_tag LOCUS_12290 gene cbiB 6566 5613 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391129.1 protein_id gnl|my_center|LOCUS_12290 7717 6557 gene locus_tag LOCUS_12300 7717 6557 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_12300 8228 7677 gene locus_tag LOCUS_12310 gene cobO 8228 7677 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258439.1 protein_id gnl|my_center|LOCUS_12310 9540 8263 gene locus_tag LOCUS_12320 9540 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259338.1 protein_id gnl|my_center|LOCUS_12320 11691 9595 gene locus_tag LOCUS_12330 11691 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 12885 11794 gene locus_tag LOCUS_12340 12885 11794 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_12340 13453 13211 gene locus_tag LOCUS_12350 gene rpmB 13453 13211 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258648.1 protein_id gnl|my_center|LOCUS_12350 13640 13476 gene locus_tag LOCUS_12360 gene rpmG 13640 13476 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006079871.1 protein_id gnl|my_center|LOCUS_12360 13828 14178 gene locus_tag LOCUS_12370 gene hinT 13828 14178 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705043.1 protein_id gnl|my_center|LOCUS_12370 14511 15356 gene locus_tag LOCUS_12380 gene folE2 14511 15356 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_12380 15833 15414 gene locus_tag LOCUS_12390 15833 15414 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532659.1 protein_id gnl|my_center|LOCUS_12390 16823 15843 gene locus_tag LOCUS_12400 gene hemB 16823 15843 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_12400 18339 16834 gene locus_tag LOCUS_12410 gene cysS 18339 16834 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237701980.1 protein_id gnl|my_center|LOCUS_12410 19122 18376 gene locus_tag LOCUS_12420 19122 18376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 20252 19131 gene locus_tag LOCUS_12430 20252 19131 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690162.1 protein_id gnl|my_center|LOCUS_12430 20926 20270 gene locus_tag LOCUS_12440 20926 20270 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930124.1 protein_id gnl|my_center|LOCUS_12440 21294 20923 gene locus_tag LOCUS_12450 21294 20923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 21761 21375 gene locus_tag LOCUS_12460 21761 21375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 22857 21820 gene locus_tag LOCUS_12470 22857 21820 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_12470 23736 22888 gene locus_tag LOCUS_12480 23736 22888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 25198 23750 gene locus_tag LOCUS_12490 25198 23750 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816500.1 protein_id gnl|my_center|LOCUS_12490 26422 25208 gene locus_tag LOCUS_12500 26422 25208 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940860.1 protein_id gnl|my_center|LOCUS_12500 26806 26462 gene locus_tag LOCUS_12510 26806 26462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 26911 27036 gene locus_tag LOCUS_12520 26911 27036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 27049 27381 gene locus_tag LOCUS_12530 27049 27381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 27378 27740 gene locus_tag LOCUS_12540 27378 27740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 28953 27841 gene locus_tag LOCUS_12550 28953 27841 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_12550 30209 28995 gene locus_tag LOCUS_12560 30209 28995 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_12560 31979 30240 gene locus_tag LOCUS_12570 31979 30240 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_12570 32232 33314 gene locus_tag LOCUS_12580 32232 33314 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926593.1 protein_id gnl|my_center|LOCUS_12580 34131 33322 gene locus_tag LOCUS_12590 34131 33322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 34524 34147 gene locus_tag LOCUS_12600 34524 34147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 35593 34586 gene locus_tag LOCUS_12610 35593 34586 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186989.1 protein_id gnl|my_center|LOCUS_12610 36709 35609 gene locus_tag LOCUS_12620 gene dgoD 36709 35609 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_12620 37067 38188 gene locus_tag LOCUS_12630 37067 38188 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 protein_id gnl|my_center|LOCUS_12630 38517 40187 gene locus_tag LOCUS_12640 38517 40187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_12640 40198 41427 gene locus_tag LOCUS_12650 40198 41427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 42193 41420 gene locus_tag LOCUS_12660 42193 41420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 42965 42204 gene locus_tag LOCUS_12670 42965 42204 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889481.1 protein_id gnl|my_center|LOCUS_12670 43145 45136 gene locus_tag LOCUS_12680 43145 45136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 45989 45153 gene locus_tag LOCUS_12690 45989 45153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 46641 46039 gene locus_tag LOCUS_12700 46641 46039 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_12700 47153 46638 gene locus_tag LOCUS_12710 gene pyrE 47153 46638 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417034.1 protein_id gnl|my_center|LOCUS_12710 48731 47190 gene locus_tag LOCUS_12720 48731 47190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 49585 48749 gene locus_tag LOCUS_12730 49585 48749 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205539.1 protein_id gnl|my_center|LOCUS_12730 49724 52636 gene locus_tag LOCUS_12740 49724 52636 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_12740 52646 53950 gene locus_tag LOCUS_12750 52646 53950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 57197 54030 gene locus_tag LOCUS_12760 57197 54030 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_12760 58132 57344 gene locus_tag LOCUS_12770 58132 57344 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105427165.1 protein_id gnl|my_center|LOCUS_12770 58921 58145 gene locus_tag LOCUS_12780 58921 58145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 59693 58932 gene locus_tag LOCUS_12790 59693 58932 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_12790 60574 59714 gene locus_tag LOCUS_12800 60574 59714 CDS product DUF1479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_12800 61523 60621 gene locus_tag LOCUS_12810 gene yihU 61523 60621 CDS product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065003.1 protein_id gnl|my_center|LOCUS_12810 62020 61547 gene locus_tag LOCUS_12820 62020 61547 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061809.1 protein_id gnl|my_center|LOCUS_12820 63508 62042 gene locus_tag LOCUS_12830 63508 62042 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_12830 64268 63498 gene locus_tag LOCUS_12840 64268 63498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 65150 64296 gene locus_tag LOCUS_12850 65150 64296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 66129 65239 gene locus_tag LOCUS_12860 66129 65239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 67061 66141 gene locus_tag LOCUS_12870 67061 66141 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_12870 67913 67077 gene locus_tag LOCUS_12880 67913 67077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 68672 67932 gene locus_tag LOCUS_12890 68672 67932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 68697 70019 gene locus_tag LOCUS_12900 68697 70019 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_12900 71948 70143 gene locus_tag LOCUS_12910 71948 70143 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence015 <1 837 gene locus_tag LOCUS_12920 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545027.1:lipoprotein-releasing ABC transporter permease subunit 830 2101 gene locus_tag LOCUS_12930 830 2101 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_12930 2104 2559 gene locus_tag LOCUS_12940 2104 2559 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016387.1 protein_id gnl|my_center|LOCUS_12940 2572 4161 gene locus_tag LOCUS_12950 2572 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4162 4902 gene locus_tag LOCUS_12960 4162 4902 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932495.1 protein_id gnl|my_center|LOCUS_12960 4915 6084 gene locus_tag LOCUS_12970 4915 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 6384 6127 gene locus_tag LOCUS_12980 gene yoeB 6384 6127 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_12980 6632 6381 gene locus_tag LOCUS_12990 6632 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 7895 6777 gene locus_tag LOCUS_13000 gene dgoD 7895 6777 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_13000 9917 7911 gene locus_tag LOCUS_13010 9917 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 10970 9987 gene locus_tag LOCUS_13020 10970 9987 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397899.1 protein_id gnl|my_center|LOCUS_13020 11425 11156 gene locus_tag LOCUS_13030 11425 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 11682 11422 gene locus_tag LOCUS_13040 11682 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 12867 11866 gene locus_tag LOCUS_13050 12867 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 13737 12904 gene locus_tag LOCUS_13060 13737 12904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 14528 13749 gene locus_tag LOCUS_13070 14528 13749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 15636 14542 gene locus_tag LOCUS_13080 15636 14542 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090843.1 protein_id gnl|my_center|LOCUS_13080 16600 15770 gene locus_tag LOCUS_13090 16600 15770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 17322 16600 gene locus_tag LOCUS_13100 gene ureG 17322 16600 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055912.1 protein_id gnl|my_center|LOCUS_13100 18007 17333 gene locus_tag LOCUS_13110 18007 17333 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729212.1 protein_id gnl|my_center|LOCUS_13110 19707 18004 gene locus_tag LOCUS_13120 gene ureC 19707 18004 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055860.1 protein_id gnl|my_center|LOCUS_13120 20458 19694 gene locus_tag LOCUS_13130 20458 19694 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889578.1 protein_id gnl|my_center|LOCUS_13130 21191 20472 gene locus_tag LOCUS_13140 gene urtE 21191 20472 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_13140 21985 21212 gene locus_tag LOCUS_13150 gene urtD 21985 21212 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_13150 23081 21987 gene locus_tag LOCUS_13160 gene urtC 23081 21987 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 protein_id gnl|my_center|LOCUS_13160 24674 23094 gene locus_tag LOCUS_13170 gene urtB 24674 23094 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535962.1 protein_id gnl|my_center|LOCUS_13170 25759 24860 gene locus_tag LOCUS_13180 25759 24860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 27074 25809 gene locus_tag LOCUS_13190 gene urtA 27074 25809 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 protein_id gnl|my_center|LOCUS_13190 27989 27396 gene locus_tag LOCUS_13200 27989 27396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 30829 28052 gene locus_tag LOCUS_13210 30829 28052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 31258 31665 gene locus_tag LOCUS_13220 31258 31665 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942259.1 protein_id gnl|my_center|LOCUS_13220 31671 32816 gene locus_tag LOCUS_13230 gene pelA 31671 32816 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_13230 32806 33750 gene locus_tag LOCUS_13240 32806 33750 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559357.1 protein_id gnl|my_center|LOCUS_13240 33750 34739 gene locus_tag LOCUS_13250 gene yiaK 33750 34739 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869037.1 protein_id gnl|my_center|LOCUS_13250 34807 35655 gene locus_tag LOCUS_13260 34807 35655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 35674 36318 gene locus_tag LOCUS_13270 35674 36318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 36332 37060 gene locus_tag LOCUS_13280 36332 37060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 37083 38444 gene locus_tag LOCUS_13290 37083 38444 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404780.1 protein_id gnl|my_center|LOCUS_13290 38530 39447 gene locus_tag LOCUS_13300 38530 39447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 39573 41282 gene locus_tag LOCUS_13310 39573 41282 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495579.1 protein_id gnl|my_center|LOCUS_13310 41275 43593 gene locus_tag LOCUS_13320 41275 43593 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109412.1 protein_id gnl|my_center|LOCUS_13320 43596 44738 gene locus_tag LOCUS_13330 43596 44738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 44749 45483 gene locus_tag LOCUS_13340 44749 45483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 45714 46943 gene locus_tag LOCUS_13350 45714 46943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 46968 48896 gene locus_tag LOCUS_13360 46968 48896 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_13360 48908 49873 gene locus_tag LOCUS_13370 48908 49873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 49902 51026 gene locus_tag LOCUS_13380 49902 51026 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_13380 52199 51081 gene locus_tag LOCUS_13390 52199 51081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 52828 52232 gene locus_tag LOCUS_13400 52828 52232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 53478 52867 gene locus_tag LOCUS_13410 53478 52867 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_13410 53686 55680 gene locus_tag LOCUS_13420 gene acs 53686 55680 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_13420 56015 55713 gene locus_tag LOCUS_13430 56015 55713 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528325.1 protein_id gnl|my_center|LOCUS_13430 57121 56039 gene locus_tag LOCUS_13440 57121 56039 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259167.1 protein_id gnl|my_center|LOCUS_13440 57807 57118 gene locus_tag LOCUS_13450 gene bioD 57807 57118 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_13450 59171 57804 gene locus_tag LOCUS_13460 gene bioA 59171 57804 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_13460 60161 59175 gene locus_tag LOCUS_13470 60161 59175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842007.1 protein_id gnl|my_center|LOCUS_13470 61142 60168 gene locus_tag LOCUS_13480 61142 60168 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_13480 62070 61159 gene locus_tag LOCUS_13490 62070 61159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 62226 63074 gene locus_tag LOCUS_13500 62226 63074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 63079 65295 gene locus_tag LOCUS_13510 63079 65295 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121777.1 protein_id gnl|my_center|LOCUS_13510 65397 66239 gene locus_tag LOCUS_13520 65397 66239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 67099 66275 gene locus_tag LOCUS_13530 67099 66275 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027042.1 protein_id gnl|my_center|LOCUS_13530 68021 67110 gene locus_tag LOCUS_13540 68021 67110 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence016 1186 311 gene locus_tag LOCUS_13550 1186 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2220 1207 gene locus_tag LOCUS_13560 2220 1207 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061680.1 protein_id gnl|my_center|LOCUS_13560 4871 2235 gene locus_tag LOCUS_13570 4871 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 4956 5252 gene locus_tag LOCUS_13580 4956 5252 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_13580 5242 5538 gene locus_tag LOCUS_13590 5242 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 6888 5599 gene locus_tag LOCUS_13600 6888 5599 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_13600 7296 6955 gene locus_tag LOCUS_13610 7296 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13610 7527 7315 gene locus_tag LOCUS_13620 7527 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 9017 7542 gene locus_tag LOCUS_13630 9017 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 9355 9822 gene locus_tag LOCUS_13640 9355 9822 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_13640 11111 9819 gene locus_tag LOCUS_13650 11111 9819 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105104.1 protein_id gnl|my_center|LOCUS_13650 11453 12418 gene locus_tag LOCUS_13660 11453 12418 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_13660 12704 12498 gene locus_tag LOCUS_13670 12704 12498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 12636 13478 gene locus_tag LOCUS_13680 12636 13478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 13486 14601 gene locus_tag LOCUS_13690 13486 14601 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_13690 14617 15735 gene locus_tag LOCUS_13700 14617 15735 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_13700 16548 15748 gene locus_tag LOCUS_13710 16548 15748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 16830 18305 gene locus_tag LOCUS_13720 16830 18305 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_13720 18325 18552 gene locus_tag LOCUS_13730 18325 18552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 18542 19114 gene locus_tag LOCUS_13740 18542 19114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 19176 19493 gene locus_tag LOCUS_13750 19176 19493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 19626 20330 gene locus_tag LOCUS_13760 19626 20330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 21122 20898 gene locus_tag LOCUS_13770 21122 20898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 21930 21172 gene locus_tag LOCUS_13780 gene larB 21930 21172 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392116.1 protein_id gnl|my_center|LOCUS_13780 22910 21927 gene locus_tag LOCUS_13790 gene dusB 22910 21927 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_13790 23757 22903 gene locus_tag LOCUS_13800 23757 22903 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_13800 24537 23779 gene locus_tag LOCUS_13810 24537 23779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 25573 24701 gene locus_tag LOCUS_13820 gene dapF 25573 24701 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_13820 26973 25606 gene locus_tag LOCUS_13830 26973 25606 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_13830 27837 27004 gene locus_tag LOCUS_13840 27837 27004 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 protein_id gnl|my_center|LOCUS_13840 29159 27936 gene locus_tag LOCUS_13850 29159 27936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210308580.1 protein_id gnl|my_center|LOCUS_13850 30961 29453 gene locus_tag LOCUS_13860 30961 29453 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942011.1 protein_id gnl|my_center|LOCUS_13860 31475 31179 gene locus_tag LOCUS_13870 31475 31179 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_13870 31769 31491 gene locus_tag LOCUS_13880 31769 31491 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_13880 31912 32292 gene locus_tag LOCUS_13890 31912 32292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 32662 32357 gene locus_tag LOCUS_13900 32662 32357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 33762 32722 gene locus_tag LOCUS_13910 33762 32722 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_13910 34628 33786 gene locus_tag LOCUS_13920 34628 33786 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881170.1 protein_id gnl|my_center|LOCUS_13920 35552 34653 gene locus_tag LOCUS_13930 35552 34653 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206177.1 protein_id gnl|my_center|LOCUS_13930 35974 35582 gene locus_tag LOCUS_13940 35974 35582 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403363.1 protein_id gnl|my_center|LOCUS_13940 36287 35961 gene locus_tag LOCUS_13950 36287 35961 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_13950 41439 36346 gene locus_tag LOCUS_13960 41439 36346 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966317.1 protein_id gnl|my_center|LOCUS_13960 42432 41461 gene locus_tag LOCUS_13970 42432 41461 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967605.1 protein_id gnl|my_center|LOCUS_13970 44389 42470 gene locus_tag LOCUS_13980 44389 42470 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_13980 45379 44444 gene locus_tag LOCUS_13990 45379 44444 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_13990 46608 45460 gene locus_tag LOCUS_14000 46608 45460 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_14000 47615 46617 gene locus_tag LOCUS_14010 47615 46617 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814134.1 protein_id gnl|my_center|LOCUS_14010 50134 47690 gene locus_tag LOCUS_14020 50134 47690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 54673 50156 gene locus_tag LOCUS_14030 54673 50156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 56657 54666 gene locus_tag LOCUS_14040 56657 54666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 56869 56944 gene locus_tag LOCUS_t00130 56869 56944 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 57844 57053 gene locus_tag LOCUS_14050 57844 57053 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044973.1 protein_id gnl|my_center|LOCUS_14050 58657 57929 gene locus_tag LOCUS_14060 58657 57929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 59847 58654 gene locus_tag LOCUS_14070 59847 58654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 61334 59844 gene locus_tag LOCUS_14080 61334 59844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 62085 61762 gene locus_tag LOCUS_14090 62085 61762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 62459 62085 gene locus_tag LOCUS_14100 62459 62085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 62686 62528 gene locus_tag LOCUS_14110 62686 62528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 64049 62730 gene locus_tag LOCUS_14120 64049 62730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 66036 64261 gene locus_tag LOCUS_14130 66036 64261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence017 587 2302 gene locus_tag LOCUS_14140 587 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2606 2533 gene locus_tag LOCUS_t00140 2606 2533 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3006 2662 gene locus_tag LOCUS_14150 3006 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 5914 3020 gene locus_tag LOCUS_14160 5914 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 6164 5925 gene locus_tag LOCUS_14170 6164 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 6391 7086 gene locus_tag LOCUS_14180 6391 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 7101 7952 gene locus_tag LOCUS_14190 7101 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 9215 8028 gene locus_tag LOCUS_14200 9215 8028 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436675.1 protein_id gnl|my_center|LOCUS_14200 10109 9216 gene locus_tag LOCUS_14210 10109 9216 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461128.1 protein_id gnl|my_center|LOCUS_14210 11046 10186 gene locus_tag LOCUS_14220 11046 10186 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_14220 11296 11805 gene locus_tag LOCUS_14230 11296 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 11896 12336 gene locus_tag LOCUS_14240 11896 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 12420 14975 gene locus_tag LOCUS_14250 12420 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 15889 15188 gene locus_tag LOCUS_14260 15889 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 16074 15998 gene locus_tag LOCUS_t00150 16074 15998 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17012 16140 gene locus_tag LOCUS_14270 17012 16140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 17934 17023 gene locus_tag LOCUS_14280 17934 17023 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 protein_id gnl|my_center|LOCUS_14280 18681 17938 gene locus_tag LOCUS_14290 18681 17938 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_14290 19458 18685 gene locus_tag LOCUS_14300 19458 18685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405213.1 protein_id gnl|my_center|LOCUS_14300 20474 19623 gene locus_tag LOCUS_14310 20474 19623 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062346.1 protein_id gnl|my_center|LOCUS_14310 20808 22148 gene locus_tag LOCUS_14320 20808 22148 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205874.1 protein_id gnl|my_center|LOCUS_14320 22170 23771 gene locus_tag LOCUS_14330 22170 23771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 24262 23825 gene locus_tag LOCUS_14340 24262 23825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 26897 24627 gene locus_tag LOCUS_14350 26897 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 28261 26939 gene locus_tag LOCUS_14360 gene hemL 28261 26939 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875867.1 protein_id gnl|my_center|LOCUS_14360 29024 28275 gene locus_tag LOCUS_14370 29024 28275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 29763 29017 gene locus_tag LOCUS_14380 29763 29017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 30194 29778 gene locus_tag LOCUS_14390 30194 29778 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877569.1 protein_id gnl|my_center|LOCUS_14390 31437 30187 gene locus_tag LOCUS_14400 31437 30187 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931147.1 protein_id gnl|my_center|LOCUS_14400 32323 31448 gene locus_tag LOCUS_14410 32323 31448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 33844 32396 gene locus_tag LOCUS_14420 33844 32396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 34986 33853 gene locus_tag LOCUS_14430 34986 33853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 37020 35008 gene locus_tag LOCUS_14440 37020 35008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 37387 37010 gene locus_tag LOCUS_14450 37387 37010 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730101.1 protein_id gnl|my_center|LOCUS_14450 38533 37388 gene locus_tag LOCUS_14460 38533 37388 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_14460 38703 39704 gene locus_tag LOCUS_14470 38703 39704 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868280.1 protein_id gnl|my_center|LOCUS_14470 39811 40593 gene locus_tag LOCUS_14480 gene iolE 39811 40593 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 protein_id gnl|my_center|LOCUS_14480 40624 41148 gene locus_tag LOCUS_14490 40624 41148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965423.1 protein_id gnl|my_center|LOCUS_14490 41156 42613 gene locus_tag LOCUS_14500 41156 42613 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040522.1 protein_id gnl|my_center|LOCUS_14500 42629 44104 gene locus_tag LOCUS_14510 42629 44104 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200059.1 protein_id gnl|my_center|LOCUS_14510 44178 44699 gene locus_tag LOCUS_14520 44178 44699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 44724 46061 gene locus_tag LOCUS_14530 44724 46061 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_14530 46083 48938 gene locus_tag LOCUS_14540 46083 48938 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_14540 48935 49642 gene locus_tag LOCUS_14550 48935 49642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 49667 50764 gene locus_tag LOCUS_14560 49667 50764 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904740.1 protein_id gnl|my_center|LOCUS_14560 50775 51482 gene locus_tag LOCUS_14570 50775 51482 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087136.1 protein_id gnl|my_center|LOCUS_14570 51485 52219 gene locus_tag LOCUS_14580 51485 52219 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089566.1 protein_id gnl|my_center|LOCUS_14580 52216 53481 gene locus_tag LOCUS_14590 52216 53481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_14590 53484 54740 gene locus_tag LOCUS_14600 gene larA 53484 54740 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_14600 56326 54746 gene locus_tag LOCUS_14610 gene pckA 56326 54746 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 protein_id gnl|my_center|LOCUS_14610 56480 57331 gene locus_tag LOCUS_14620 56480 57331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 57328 58785 gene locus_tag LOCUS_14630 57328 58785 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_14630 58808 59674 gene locus_tag LOCUS_14640 58808 59674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 59875 60660 gene locus_tag LOCUS_14650 59875 60660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 60673 61956 gene locus_tag LOCUS_14660 60673 61956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 62016 63383 gene locus_tag LOCUS_14670 gene gabT 62016 63383 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039517.1 protein_id gnl|my_center|LOCUS_14670 63389 64558 gene locus_tag LOCUS_14680 gene chrA 63389 64558 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_14680 64561 65451 gene locus_tag LOCUS_14690 64561 65451 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence018 1701 919 gene locus_tag LOCUS_14700 1701 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3482 1737 gene locus_tag LOCUS_14710 3482 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3650 4249 gene locus_tag LOCUS_14720 3650 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4261 5076 gene locus_tag LOCUS_14730 4261 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 7600 5111 gene locus_tag LOCUS_14740 7600 5111 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_14740 10071 7672 gene locus_tag LOCUS_14750 10071 7672 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_14750 12511 10124 gene locus_tag LOCUS_14760 12511 10124 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_14760 13843 12809 gene locus_tag LOCUS_14770 13843 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 14475 13888 gene locus_tag LOCUS_14780 14475 13888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931931.1 protein_id gnl|my_center|LOCUS_14780 14891 14520 gene locus_tag LOCUS_14790 14891 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 15139 14939 gene locus_tag LOCUS_14800 15139 14939 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_14800 16085 15195 gene locus_tag LOCUS_14810 16085 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 17151 16135 gene locus_tag LOCUS_14820 17151 16135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 18027 17221 gene locus_tag LOCUS_14830 18027 17221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 18790 18077 gene locus_tag LOCUS_14840 18790 18077 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973635.1 protein_id gnl|my_center|LOCUS_14840 19323 18823 gene locus_tag LOCUS_14850 19323 18823 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869659.1 protein_id gnl|my_center|LOCUS_14850 19684 19340 gene locus_tag LOCUS_14860 19684 19340 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526838.1 protein_id gnl|my_center|LOCUS_14860 20262 19762 gene locus_tag LOCUS_14870 20262 19762 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042597552.1 protein_id gnl|my_center|LOCUS_14870 20734 20288 gene locus_tag LOCUS_14880 20734 20288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 21684 20764 gene locus_tag LOCUS_14890 21684 20764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 22093 21791 gene locus_tag LOCUS_14900 22093 21791 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259549.1 protein_id gnl|my_center|LOCUS_14900 22374 22105 gene locus_tag LOCUS_14910 22374 22105 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301196.1 protein_id gnl|my_center|LOCUS_14910 23784 22543 gene locus_tag LOCUS_14920 23784 22543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 23890 23726 gene locus_tag LOCUS_14930 23890 23726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 24407 23934 gene locus_tag LOCUS_14940 24407 23934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 27092 24645 gene locus_tag LOCUS_14950 27092 24645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_14950 27531 27250 gene locus_tag LOCUS_14960 27531 27250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 27723 27947 gene locus_tag LOCUS_14970 27723 27947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 27944 28393 gene locus_tag LOCUS_14980 27944 28393 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_14980 28750 28517 gene locus_tag LOCUS_14990 28750 28517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 29082 28717 gene locus_tag LOCUS_15000 29082 28717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 29883 29110 gene locus_tag LOCUS_15010 29883 29110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 32407 29930 gene locus_tag LOCUS_15020 32407 29930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_15020 34848 32422 gene locus_tag LOCUS_15030 34848 32422 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_15030 35532 34909 gene locus_tag LOCUS_15040 35532 34909 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964247.1 protein_id gnl|my_center|LOCUS_15040 36366 35563 gene locus_tag LOCUS_15050 36366 35563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 38811 36376 gene locus_tag LOCUS_15060 38811 36376 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_15060 39076 40233 gene locus_tag LOCUS_15070 39076 40233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 42215 40278 gene locus_tag LOCUS_15080 42215 40278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 43649 42276 gene locus_tag LOCUS_15090 43649 42276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 44831 43758 gene locus_tag LOCUS_15100 44831 43758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 46913 44844 gene locus_tag LOCUS_15110 46913 44844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 50088 46990 gene locus_tag LOCUS_15120 50088 46990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 50996 50193 gene locus_tag LOCUS_15130 50996 50193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 51746 51027 gene locus_tag LOCUS_15140 51746 51027 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083339.1 protein_id gnl|my_center|LOCUS_15140 51916 53268 gene locus_tag LOCUS_15150 51916 53268 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259633.1 protein_id gnl|my_center|LOCUS_15150 53838 53272 gene locus_tag LOCUS_15160 53838 53272 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_15160 55055 53868 gene locus_tag LOCUS_15170 55055 53868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 56042 55056 gene locus_tag LOCUS_15180 56042 55056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 56143 56886 gene locus_tag LOCUS_15190 56143 56886 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530431.1 protein_id gnl|my_center|LOCUS_15190 57434 56952 gene locus_tag LOCUS_15200 57434 56952 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403299.1 protein_id gnl|my_center|LOCUS_15200 57708 58655 gene locus_tag LOCUS_15210 57708 58655 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810847.1 protein_id gnl|my_center|LOCUS_15210 58666 59856 gene locus_tag LOCUS_15220 58666 59856 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 protein_id gnl|my_center|LOCUS_15220 59870 61804 gene locus_tag LOCUS_15230 59870 61804 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_15230 61811 64237 gene locus_tag LOCUS_15240 61811 64237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence019 152 544 gene locus_tag LOCUS_15250 152 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1639 611 gene locus_tag LOCUS_15260 gene trmB 1639 611 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228808.1 protein_id gnl|my_center|LOCUS_15260 2473 1643 gene locus_tag LOCUS_15270 2473 1643 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616169.1 protein_id gnl|my_center|LOCUS_15270 3699 2491 gene locus_tag LOCUS_15280 3699 2491 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122999.1 protein_id gnl|my_center|LOCUS_15280 5517 3730 gene locus_tag LOCUS_15290 5517 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 5619 6611 gene locus_tag LOCUS_15300 5619 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 8163 6613 gene locus_tag LOCUS_15310 8163 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 9133 8177 gene locus_tag LOCUS_15320 9133 8177 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090585.1 protein_id gnl|my_center|LOCUS_15320 10017 9148 gene locus_tag LOCUS_15330 10017 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 12443 10026 gene locus_tag LOCUS_15340 12443 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 12614 14632 gene locus_tag LOCUS_15350 12614 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 14629 16245 gene locus_tag LOCUS_15360 14629 16245 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_15360 18200 16248 gene locus_tag LOCUS_15370 18200 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 20597 18219 gene locus_tag LOCUS_15380 20597 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 21261 20599 gene locus_tag LOCUS_15390 21261 20599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_15390 22432 21263 gene locus_tag LOCUS_15400 22432 21263 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_15400 22827 22411 gene locus_tag LOCUS_15410 22827 22411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 23057 24733 gene locus_tag LOCUS_15420 23057 24733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 25788 24775 gene locus_tag LOCUS_15430 25788 24775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 28345 25847 gene locus_tag LOCUS_15440 28345 25847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 31756 28409 gene locus_tag LOCUS_15450 31756 28409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 32527 31784 gene locus_tag LOCUS_15460 32527 31784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 32846 33535 gene locus_tag LOCUS_15470 32846 33535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 36212 33597 gene locus_tag LOCUS_15480 36212 33597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 38640 36220 gene locus_tag LOCUS_15490 38640 36220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 40399 38657 gene locus_tag LOCUS_15500 40399 38657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 41567 40506 gene locus_tag LOCUS_15510 gene ogl 41567 40506 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210841.1 protein_id gnl|my_center|LOCUS_15510 42785 41586 gene locus_tag LOCUS_15520 42785 41586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 43677 42829 gene locus_tag LOCUS_15530 43677 42829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 44488 43670 gene locus_tag LOCUS_15540 44488 43670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 45962 44499 gene locus_tag LOCUS_15550 45962 44499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 46962 46024 gene locus_tag LOCUS_15560 46962 46024 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_15560 47878 46997 gene locus_tag LOCUS_15570 47878 46997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 50316 47887 gene locus_tag LOCUS_15580 50316 47887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 52667 50355 gene locus_tag LOCUS_15590 52667 50355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 53775 52702 gene locus_tag LOCUS_15600 53775 52702 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966124.1 protein_id gnl|my_center|LOCUS_15600 54590 53778 gene locus_tag LOCUS_15610 54590 53778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 55850 54612 gene locus_tag LOCUS_15620 55850 54612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 56537 55866 gene locus_tag LOCUS_15630 56537 55866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 56750 57604 gene locus_tag LOCUS_15640 56750 57604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 57616 59670 gene locus_tag LOCUS_15650 57616 59670 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_15650 59693 60625 gene locus_tag LOCUS_15660 59693 60625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 60667 62409 gene locus_tag LOCUS_15670 60667 62409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_15670 62438 63388 gene locus_tag LOCUS_15680 62438 63388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 63421 64275 gene locus_tag LOCUS_15690 63421 64275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence020 1174 77 gene locus_tag LOCUS_15700 gene dprA 1174 77 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_15700 2809 1331 gene locus_tag LOCUS_15710 2809 1331 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_15710 4110 2830 gene locus_tag LOCUS_15720 4110 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 4242 4712 gene locus_tag LOCUS_15730 4242 4712 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125362.1 protein_id gnl|my_center|LOCUS_15730 6141 4780 gene locus_tag LOCUS_15740 6141 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 6314 9055 gene locus_tag LOCUS_15750 6314 9055 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090068.1 protein_id gnl|my_center|LOCUS_15750 9048 9956 gene locus_tag LOCUS_15760 gene murQ 9048 9956 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837885.1 protein_id gnl|my_center|LOCUS_15760 11482 9953 gene locus_tag LOCUS_15770 11482 9953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 11613 13328 gene locus_tag LOCUS_15780 gene rqcH 11613 13328 CDS product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 protein_id gnl|my_center|LOCUS_15780 13435 14166 gene locus_tag LOCUS_15790 13435 14166 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889481.1 protein_id gnl|my_center|LOCUS_15790 15113 14232 gene locus_tag LOCUS_15800 gene folD 15113 14232 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_15800 16721 15312 gene locus_tag LOCUS_15810 16721 15312 CDS product BNR-4 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921364.1 protein_id gnl|my_center|LOCUS_15810 16867 17619 gene locus_tag LOCUS_15820 16867 17619 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267863.1 protein_id gnl|my_center|LOCUS_15820 17723 19090 gene locus_tag LOCUS_15830 17723 19090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 19180 19521 gene locus_tag LOCUS_15840 19180 19521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 19647 19868 gene locus_tag LOCUS_15850 19647 19868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 19861 20112 gene locus_tag LOCUS_15860 19861 20112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 20198 20845 gene locus_tag LOCUS_15870 20198 20845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 20845 21495 gene locus_tag LOCUS_15880 20845 21495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 21946 21659 gene locus_tag LOCUS_15890 21946 21659 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_15890 23090 22038 gene locus_tag LOCUS_15900 23090 22038 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064863.1 protein_id gnl|my_center|LOCUS_15900 24940 23198 gene locus_tag LOCUS_15910 24940 23198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 26235 24955 gene locus_tag LOCUS_15920 26235 24955 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_15920 27669 26254 gene locus_tag LOCUS_15930 27669 26254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 27888 29405 gene locus_tag LOCUS_15940 27888 29405 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_15940 29654 29992 gene locus_tag LOCUS_15950 29654 29992 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_15950 30435 31604 gene locus_tag LOCUS_15960 30435 31604 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_15960 31601 32023 gene locus_tag LOCUS_15970 31601 32023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 32020 33192 gene locus_tag LOCUS_15980 32020 33192 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_15980 33189 35351 gene locus_tag LOCUS_15990 33189 35351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 35396 36778 gene locus_tag LOCUS_16000 gene amt 35396 36778 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383316.1 protein_id gnl|my_center|LOCUS_16000 37719 36733 gene locus_tag LOCUS_16010 37719 36733 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_16010 38185 37688 gene locus_tag LOCUS_16020 gene lspA 38185 37688 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_16020 38566 38195 gene locus_tag LOCUS_16030 38566 38195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 39032 38568 gene locus_tag LOCUS_16040 39032 38568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 39935 39060 gene locus_tag LOCUS_16050 gene mtnP 39935 39060 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_16050 40449 39928 gene locus_tag LOCUS_16060 40449 39928 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_16060 41062 40475 gene locus_tag LOCUS_16070 41062 40475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 41749 41066 gene locus_tag LOCUS_16080 41749 41066 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_16080 41959 43893 gene locus_tag LOCUS_16090 41959 43893 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_16090 44677 43919 gene locus_tag LOCUS_16100 44677 43919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240183.1 protein_id gnl|my_center|LOCUS_16100 46173 44692 gene locus_tag LOCUS_16110 gene pap 46173 44692 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065389.1 protein_id gnl|my_center|LOCUS_16110 47301 46177 gene locus_tag LOCUS_16120 47301 46177 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027183.1 protein_id gnl|my_center|LOCUS_16120 49005 47323 gene locus_tag LOCUS_16130 gene recJ 49005 47323 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_16130 49168 49563 gene locus_tag LOCUS_16140 49168 49563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 49650 50360 gene locus_tag LOCUS_16150 49650 50360 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930705.1 protein_id gnl|my_center|LOCUS_16150 50445 50990 gene locus_tag LOCUS_16160 50445 50990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 52351 50996 gene locus_tag LOCUS_16170 52351 50996 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 protein_id gnl|my_center|LOCUS_16170 53443 52598 gene locus_tag LOCUS_16180 53443 52598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 54171 53440 gene locus_tag LOCUS_16190 54171 53440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 55687 54224 gene locus_tag LOCUS_16200 55687 54224 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_16200 56546 55839 gene locus_tag LOCUS_16210 56546 55839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 57299 56550 gene locus_tag LOCUS_16220 57299 56550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 58646 57318 gene locus_tag LOCUS_16230 58646 57318 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_16230 58862 60697 gene locus_tag LOCUS_16240 58862 60697 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941216.1 protein_id gnl|my_center|LOCUS_16240 61126 60800 gene locus_tag LOCUS_16250 gene trxA 61126 60800 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_16250 62223 61198 gene locus_tag LOCUS_16260 gene holA 62223 61198 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_16260 <64230 62435 gene locus_tag LOCUS_16270 <64230 62435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403686.1:efflux RND transporter permease subunit >Feature sequence021 1443 2393 gene locus_tag LOCUS_16280 1443 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 3449 2400 gene locus_tag LOCUS_16290 3449 2400 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_16290 3570 4013 gene locus_tag LOCUS_16300 3570 4013 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086163.1 protein_id gnl|my_center|LOCUS_16300 4795 4016 gene locus_tag LOCUS_16310 4795 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 4932 6389 gene locus_tag LOCUS_16320 4932 6389 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555683.1 protein_id gnl|my_center|LOCUS_16320 6391 7170 gene locus_tag LOCUS_16330 6391 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 7181 8020 gene locus_tag LOCUS_16340 7181 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 8041 9435 gene locus_tag LOCUS_16350 8041 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 10209 9439 gene locus_tag LOCUS_16360 10209 9439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 10985 10218 gene locus_tag LOCUS_16370 10985 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 11956 11138 gene locus_tag LOCUS_16380 11956 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 13424 11985 gene locus_tag LOCUS_16390 gene gcvPB 13424 11985 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_16390 14755 13424 gene locus_tag LOCUS_16400 gene gcvPA 14755 13424 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_16400 15354 14752 gene locus_tag LOCUS_16410 gene coaE 15354 14752 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_16410 16283 15351 gene locus_tag LOCUS_16420 16283 15351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 17236 16376 gene locus_tag LOCUS_16430 17236 16376 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_16430 18212 17238 gene locus_tag LOCUS_16440 gene hflK 18212 17238 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_16440 19222 18212 gene locus_tag LOCUS_16450 19222 18212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 21422 19329 gene locus_tag LOCUS_16460 gene recG 21422 19329 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403048.1 protein_id gnl|my_center|LOCUS_16460 21812 21429 gene locus_tag LOCUS_16470 21812 21429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 22598 21843 gene locus_tag LOCUS_16480 22598 21843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 22724 24574 gene locus_tag LOCUS_16490 22724 24574 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_16490 24663 26351 gene locus_tag LOCUS_16500 24663 26351 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063696.1 protein_id gnl|my_center|LOCUS_16500 26384 28858 gene locus_tag LOCUS_16510 26384 28858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 28983 29438 gene locus_tag LOCUS_16520 28983 29438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 29779 30969 gene locus_tag LOCUS_16530 29779 30969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 31752 30979 gene locus_tag LOCUS_16540 gene fabG 31752 30979 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_16540 33044 31848 gene locus_tag LOCUS_16550 33044 31848 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155697526.1 protein_id gnl|my_center|LOCUS_16550 33028 34077 gene locus_tag LOCUS_16560 33028 34077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 34074 34922 gene locus_tag LOCUS_16570 gene hpnD 34074 34922 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_16570 34925 36238 gene locus_tag LOCUS_16580 gene hpnE 34925 36238 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_16580 37393 36227 gene locus_tag LOCUS_16590 37393 36227 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_16590 38798 37461 gene locus_tag LOCUS_16600 gene zraR 38798 37461 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148553.1 protein_id gnl|my_center|LOCUS_16600 42882 39016 gene locus_tag LOCUS_16610 42882 39016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 43350 42913 gene locus_tag LOCUS_16620 43350 42913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 44252 43425 gene locus_tag LOCUS_16630 44252 43425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 47529 44254 gene locus_tag LOCUS_16640 47529 44254 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_16640 49175 47535 gene locus_tag LOCUS_16650 49175 47535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 49640 49254 gene locus_tag LOCUS_16660 49640 49254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 50126 49653 gene locus_tag LOCUS_16670 50126 49653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 50736 50128 gene locus_tag LOCUS_16680 gene rpoE 50736 50128 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_16680 51173 50763 gene locus_tag LOCUS_16690 51173 50763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 51799 51176 gene locus_tag LOCUS_16700 51799 51176 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_16700 52655 51804 gene locus_tag LOCUS_16710 52655 51804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 54175 52679 gene locus_tag LOCUS_16720 54175 52679 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_16720 54453 55250 gene locus_tag LOCUS_16730 54453 55250 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_16730 55268 56020 gene locus_tag LOCUS_16740 55268 56020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 56038 56994 gene locus_tag LOCUS_16750 56038 56994 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_16750 57009 58091 gene locus_tag LOCUS_16760 57009 58091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 58220 58627 gene locus_tag LOCUS_16770 58220 58627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 59795 58671 gene locus_tag LOCUS_16780 59795 58671 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732907.1 protein_id gnl|my_center|LOCUS_16780 59872 60186 gene locus_tag LOCUS_16790 59872 60186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 60179 60889 gene locus_tag LOCUS_16800 60179 60889 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336892.1 protein_id gnl|my_center|LOCUS_16800 60908 62311 gene locus_tag LOCUS_16810 60908 62311 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_16810 62339 63727 gene locus_tag LOCUS_16820 62339 63727 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816500.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence022 <1 566 gene locus_tag LOCUS_16830 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase 706 1449 gene locus_tag LOCUS_16840 706 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1545 1985 gene locus_tag LOCUS_16850 1545 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2036 4375 gene locus_tag LOCUS_16860 2036 4375 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035989.1 protein_id gnl|my_center|LOCUS_16860 4439 4927 gene locus_tag LOCUS_16870 gene argR 4439 4927 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_16870 4930 5862 gene locus_tag LOCUS_16880 gene argC 4930 5862 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820599.1 protein_id gnl|my_center|LOCUS_16880 5869 6615 gene locus_tag LOCUS_16890 5869 6615 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640437.1 protein_id gnl|my_center|LOCUS_16890 6616 7506 gene locus_tag LOCUS_16900 gene argB 6616 7506 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_16900 7530 8729 gene locus_tag LOCUS_16910 7530 8729 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257809.1 protein_id gnl|my_center|LOCUS_16910 9976 8726 gene locus_tag LOCUS_16920 9976 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 11413 9986 gene locus_tag LOCUS_16930 11413 9986 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_16930 11575 13290 gene locus_tag LOCUS_16940 11575 13290 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_16940 13772 13293 gene locus_tag LOCUS_16950 13772 13293 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_16950 14962 13784 gene locus_tag LOCUS_16960 gene dgoD 14962 13784 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_16960 16282 14972 gene locus_tag LOCUS_16970 16282 14972 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816500.1 protein_id gnl|my_center|LOCUS_16970 17747 16374 gene locus_tag LOCUS_16980 17747 16374 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 protein_id gnl|my_center|LOCUS_16980 19050 17935 gene locus_tag LOCUS_16990 19050 17935 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105217984.1 protein_id gnl|my_center|LOCUS_16990 20382 19165 gene locus_tag LOCUS_17000 20382 19165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 20740 21807 gene locus_tag LOCUS_17010 20740 21807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 21797 23329 gene locus_tag LOCUS_17020 21797 23329 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076961.1 protein_id gnl|my_center|LOCUS_17020 24991 23360 gene locus_tag LOCUS_17030 24991 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_17030 25091 26563 gene locus_tag LOCUS_17040 25091 26563 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_17040 26733 26548 gene locus_tag LOCUS_17050 26733 26548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 27111 26923 gene locus_tag LOCUS_17060 27111 26923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 27205 28314 gene locus_tag LOCUS_17070 27205 28314 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_17070 28356 29141 gene locus_tag LOCUS_17080 28356 29141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 30346 29216 gene locus_tag LOCUS_17090 30346 29216 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_17090 30813 30409 gene locus_tag LOCUS_17100 30813 30409 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030951.1 protein_id gnl|my_center|LOCUS_17100 32150 30915 gene locus_tag LOCUS_17110 32150 30915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 34166 32247 gene locus_tag LOCUS_17120 34166 32247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_17120 36047 34263 gene locus_tag LOCUS_17130 36047 34263 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_17130 37506 36061 gene locus_tag LOCUS_17140 37506 36061 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_17140 38473 37538 gene locus_tag LOCUS_17150 38473 37538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 38654 40051 gene locus_tag LOCUS_17160 38654 40051 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_17160 40064 40183 gene locus_tag LOCUS_17170 40064 40183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 41089 40226 gene locus_tag LOCUS_17180 41089 40226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 41835 41101 gene locus_tag LOCUS_17190 gene fabG 41835 41101 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_17190 42469 41969 gene locus_tag LOCUS_17200 42469 41969 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_17200 42653 43414 gene locus_tag LOCUS_17210 42653 43414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 43816 43439 gene locus_tag LOCUS_17220 43816 43439 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770889.1 protein_id gnl|my_center|LOCUS_17220 44051 43806 gene locus_tag LOCUS_17230 44051 43806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 44685 44461 gene locus_tag LOCUS_17240 44685 44461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 44970 44710 gene locus_tag LOCUS_17250 44970 44710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 45278 44967 gene locus_tag LOCUS_17260 45278 44967 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_17260 45464 45321 gene locus_tag LOCUS_17270 45464 45321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 46552 45512 gene locus_tag LOCUS_17280 46552 45512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 47636 46635 gene locus_tag LOCUS_17290 47636 46635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 48543 48040 gene locus_tag LOCUS_17300 48543 48040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 49714 48971 gene locus_tag LOCUS_17310 49714 48971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 51674 49722 gene locus_tag LOCUS_17320 51674 49722 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945510.1 protein_id gnl|my_center|LOCUS_17320 52434 51697 gene locus_tag LOCUS_17330 52434 51697 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_17330 53703 52579 gene locus_tag LOCUS_17340 gene dgoD 53703 52579 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_17340 54544 53723 gene locus_tag LOCUS_17350 54544 53723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 54741 55406 gene locus_tag LOCUS_17360 54741 55406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 55455 56762 gene locus_tag LOCUS_17370 55455 56762 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_17370 56903 57862 gene locus_tag LOCUS_17380 gene msrP 56903 57862 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_17380 58001 58228 gene locus_tag LOCUS_17390 58001 58228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 58499 58590 gene locus_tag LOCUS_t00160 58499 58590 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 58897 59868 gene locus_tag LOCUS_17400 gene selD 58897 59868 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_17400 59871 59968 gene locus_tag LOCUS_t00170 59871 59968 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 60155 61048 gene locus_tag LOCUS_17410 60155 61048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 61205 62104 gene locus_tag LOCUS_17420 61205 62104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 62107 63072 gene locus_tag LOCUS_17430 62107 63072 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_17430 63072 63812 gene locus_tag LOCUS_17440 63072 63812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence023 <1 2733 gene locus_tag LOCUS_17450 <1 2733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943878.1:UvrD-helicase domain-containing protein 4034 2730 gene locus_tag LOCUS_17460 4034 2730 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_17460 5180 4047 gene locus_tag LOCUS_17470 5180 4047 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844385.1 protein_id gnl|my_center|LOCUS_17470 6043 5201 gene locus_tag LOCUS_17480 6043 5201 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767091.1 protein_id gnl|my_center|LOCUS_17480 7069 6140 gene locus_tag LOCUS_17490 7069 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 7865 7482 gene locus_tag LOCUS_17500 7865 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 8132 7878 gene locus_tag LOCUS_17510 8132 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 8474 8310 gene locus_tag LOCUS_17520 8474 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 8649 8467 gene locus_tag LOCUS_17530 8649 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 11112 8671 gene locus_tag LOCUS_17540 11112 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 13482 11179 gene locus_tag LOCUS_17550 13482 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 14382 13576 gene locus_tag LOCUS_17560 14382 13576 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_17560 17692 14384 gene locus_tag LOCUS_17570 17692 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 18596 17682 gene locus_tag LOCUS_17580 18596 17682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 19774 18593 gene locus_tag LOCUS_17590 gene nifS 19774 18593 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670052.1 protein_id gnl|my_center|LOCUS_17590 20358 20609 gene locus_tag LOCUS_17600 20358 20609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 23171 20736 gene locus_tag LOCUS_17610 23171 20736 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_17610 23544 23287 gene locus_tag LOCUS_17620 23544 23287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 25644 23545 gene locus_tag LOCUS_17630 25644 23545 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927193.1 protein_id gnl|my_center|LOCUS_17630 27348 25741 gene locus_tag LOCUS_17640 gene ilvB 27348 25741 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146975.1 protein_id gnl|my_center|LOCUS_17640 28437 27361 gene locus_tag LOCUS_17650 28437 27361 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840078.1 protein_id gnl|my_center|LOCUS_17650 29432 28440 gene locus_tag LOCUS_17660 29432 28440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 30397 29495 gene locus_tag LOCUS_17670 gene galU 30397 29495 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202213.1 protein_id gnl|my_center|LOCUS_17670 30511 31452 gene locus_tag LOCUS_17680 30511 31452 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566323.1 protein_id gnl|my_center|LOCUS_17680 31445 32569 gene locus_tag LOCUS_17690 31445 32569 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100954.1 protein_id gnl|my_center|LOCUS_17690 32587 33471 gene locus_tag LOCUS_17700 32587 33471 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173962.1 protein_id gnl|my_center|LOCUS_17700 33704 33474 gene locus_tag LOCUS_17710 33704 33474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 33945 33697 gene locus_tag LOCUS_17720 33945 33697 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056230.1 protein_id gnl|my_center|LOCUS_17720 34155 35198 gene locus_tag LOCUS_17730 34155 35198 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728439.1 protein_id gnl|my_center|LOCUS_17730 35242 36828 gene locus_tag LOCUS_17740 gene ggt 35242 36828 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_17740 36867 37985 gene locus_tag LOCUS_17750 36867 37985 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085398.1 protein_id gnl|my_center|LOCUS_17750 38042 38230 gene locus_tag LOCUS_17760 38042 38230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 38436 39419 gene locus_tag LOCUS_17770 38436 39419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 39652 39960 gene locus_tag LOCUS_17780 39652 39960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 39964 40398 gene locus_tag LOCUS_17790 39964 40398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 40501 41292 gene locus_tag LOCUS_17800 40501 41292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 41476 42723 gene locus_tag LOCUS_17810 41476 42723 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_17810 42819 46859 gene locus_tag LOCUS_17820 42819 46859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 47038 48411 gene locus_tag LOCUS_17830 47038 48411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 48427 48885 gene locus_tag LOCUS_17840 48427 48885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 48966 49460 gene locus_tag LOCUS_17850 48966 49460 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065261.1 protein_id gnl|my_center|LOCUS_17850 49520 50350 gene locus_tag LOCUS_17860 49520 50350 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582467.1 protein_id gnl|my_center|LOCUS_17860 50317 50817 gene locus_tag LOCUS_17870 50317 50817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 52206 50911 gene locus_tag LOCUS_17880 gene hflX 52206 50911 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016249.1 protein_id gnl|my_center|LOCUS_17880 52788 52285 gene locus_tag LOCUS_17890 52788 52285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 53252 52785 gene locus_tag LOCUS_17900 53252 52785 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902885.1 protein_id gnl|my_center|LOCUS_17900 53856 53257 gene locus_tag LOCUS_17910 53856 53257 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390927.1 protein_id gnl|my_center|LOCUS_17910 54214 53933 gene locus_tag LOCUS_17920 54214 53933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 54867 54247 gene locus_tag LOCUS_17930 54867 54247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 55765 54920 gene locus_tag LOCUS_17940 55765 54920 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379005.1 protein_id gnl|my_center|LOCUS_17940 56074 56388 gene locus_tag LOCUS_17950 gene tnpA 56074 56388 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606465.1 protein_id gnl|my_center|LOCUS_17950 56388 57494 gene locus_tag LOCUS_17960 56388 57494 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 protein_id gnl|my_center|LOCUS_17960 58287 57592 gene locus_tag LOCUS_17970 58287 57592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 59053 58361 gene locus_tag LOCUS_17980 59053 58361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 59820 59119 gene locus_tag LOCUS_17990 59820 59119 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977883.1 protein_id gnl|my_center|LOCUS_17990 60401 59967 gene locus_tag LOCUS_18000 60401 59967 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140128.1 protein_id gnl|my_center|LOCUS_18000 <62648 60619 gene locus_tag LOCUS_18010 <62648 60619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071716.1:prolyl oligopeptidase family serine peptidase >Feature sequence024 476 153 gene locus_tag LOCUS_18020 476 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 942 514 gene locus_tag LOCUS_18030 942 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1353 946 gene locus_tag LOCUS_18040 1353 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 5185 1529 gene locus_tag LOCUS_18050 gene metH 5185 1529 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 protein_id gnl|my_center|LOCUS_18050 5926 5195 gene locus_tag LOCUS_18060 5926 5195 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845492.1 protein_id gnl|my_center|LOCUS_18060 5972 7216 gene locus_tag LOCUS_18070 5972 7216 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064985.1 protein_id gnl|my_center|LOCUS_18070 8033 7287 gene locus_tag LOCUS_18080 8033 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 8217 8142 gene locus_tag LOCUS_t00180 8217 8142 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9179 8259 gene locus_tag LOCUS_18090 gene miaA 9179 8259 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_18090 10975 9182 gene locus_tag LOCUS_18100 gene mutL 10975 9182 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_18100 11275 11808 gene locus_tag LOCUS_18110 gene hpt 11275 11808 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_18110 12511 11831 gene locus_tag LOCUS_18120 12511 11831 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_18120 12970 12605 gene locus_tag LOCUS_18130 12970 12605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 13783 13196 gene locus_tag LOCUS_18140 13783 13196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 16125 13831 gene locus_tag LOCUS_18150 16125 13831 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_18150 16617 16141 gene locus_tag LOCUS_18160 16617 16141 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_18160 17497 16622 gene locus_tag LOCUS_18170 17497 16622 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 protein_id gnl|my_center|LOCUS_18170 18802 17762 gene locus_tag LOCUS_18180 18802 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 19336 18896 gene locus_tag LOCUS_18190 19336 18896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 19524 20561 gene locus_tag LOCUS_18200 19524 20561 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_18200 20604 22007 gene locus_tag LOCUS_18210 20604 22007 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161935.1 protein_id gnl|my_center|LOCUS_18210 23980 22022 gene locus_tag LOCUS_18220 23980 22022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 25130 23994 gene locus_tag LOCUS_18230 25130 23994 CDS product phosphonoacetaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202931.1 protein_id gnl|my_center|LOCUS_18230 25171 26001 gene locus_tag LOCUS_18240 gene phnX 25171 26001 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687375.1 protein_id gnl|my_center|LOCUS_18240 28566 26056 gene locus_tag LOCUS_18250 28566 26056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 28949 28569 gene locus_tag LOCUS_18260 28949 28569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 29579 28953 gene locus_tag LOCUS_18270 gene fdoI 29579 28953 CDS product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829017.1 protein_id gnl|my_center|LOCUS_18270 29731 29576 gene locus_tag LOCUS_18280 29731 29576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 30720 29731 gene locus_tag LOCUS_18290 30720 29731 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224905.1 protein_id gnl|my_center|LOCUS_18290 33132 30736 gene locus_tag LOCUS_18300 33132 30736 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258859.1 protein_id gnl|my_center|LOCUS_18300 33777 33133 gene locus_tag LOCUS_18310 33777 33133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 34724 33798 gene locus_tag LOCUS_18320 34724 33798 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258385.1 protein_id gnl|my_center|LOCUS_18320 35610 34729 gene locus_tag LOCUS_18330 35610 34729 CDS product NotI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909241.1 protein_id gnl|my_center|LOCUS_18330 36565 35699 gene locus_tag LOCUS_18340 36565 35699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 36780 38279 gene locus_tag LOCUS_18350 gene putP 36780 38279 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 protein_id gnl|my_center|LOCUS_18350 38302 40281 gene locus_tag LOCUS_18360 38302 40281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 41661 40285 gene locus_tag LOCUS_18370 41661 40285 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_18370 41769 42779 gene locus_tag LOCUS_18380 41769 42779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 42811 43287 gene locus_tag LOCUS_18390 42811 43287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 43316 44308 gene locus_tag LOCUS_18400 43316 44308 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_18400 45786 44326 gene locus_tag LOCUS_18410 45786 44326 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_18410 45944 46675 gene locus_tag LOCUS_18420 45944 46675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 46867 48141 gene locus_tag LOCUS_18430 46867 48141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 48143 48673 gene locus_tag LOCUS_18440 48143 48673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 48682 50046 gene locus_tag LOCUS_18450 48682 50046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 50055 51431 gene locus_tag LOCUS_18460 50055 51431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 51428 53128 gene locus_tag LOCUS_18470 51428 53128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 55639 53216 gene locus_tag LOCUS_18480 55639 53216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 57956 55692 gene locus_tag LOCUS_18490 57956 55692 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_18490 59000 57960 gene locus_tag LOCUS_18500 59000 57960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 <61369 59195 gene locus_tag LOCUS_18510 <61369 59195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000365367.1:ATP-dependent chaperone ClpB >Feature sequence025 3304 1361 gene locus_tag LOCUS_18520 3304 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3806 5062 gene locus_tag LOCUS_18530 3806 5062 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_18530 5089 6858 gene locus_tag LOCUS_18540 5089 6858 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109250.1 protein_id gnl|my_center|LOCUS_18540 6879 7694 gene locus_tag LOCUS_18550 6879 7694 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_18550 7711 8658 gene locus_tag LOCUS_18560 7711 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 8711 9622 gene locus_tag LOCUS_18570 8711 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 9661 10434 gene locus_tag LOCUS_18580 9661 10434 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284299.1 protein_id gnl|my_center|LOCUS_18580 11537 10548 gene locus_tag LOCUS_18590 11537 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 12868 11567 gene locus_tag LOCUS_18600 12868 11567 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674204.1 protein_id gnl|my_center|LOCUS_18600 13587 12871 gene locus_tag LOCUS_18610 13587 12871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 14777 13584 gene locus_tag LOCUS_18620 14777 13584 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842634.1 protein_id gnl|my_center|LOCUS_18620 15743 14943 gene locus_tag LOCUS_18630 15743 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 17214 15769 gene locus_tag LOCUS_18640 17214 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 17732 17313 gene locus_tag LOCUS_18650 17732 17313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 19457 17886 gene locus_tag LOCUS_18660 19457 17886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 19919 19479 gene locus_tag LOCUS_18670 19919 19479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 20521 19931 gene locus_tag LOCUS_18680 20521 19931 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_18680 21163 20717 gene locus_tag LOCUS_18690 21163 20717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 21398 21129 gene locus_tag LOCUS_18700 21398 21129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 22003 21509 gene locus_tag LOCUS_18710 22003 21509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 23203 22118 gene locus_tag LOCUS_18720 23203 22118 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_18720 23344 24267 gene locus_tag LOCUS_18730 23344 24267 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345646.1 protein_id gnl|my_center|LOCUS_18730 25442 24273 gene locus_tag LOCUS_18740 gene thiI 25442 24273 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_18740 26806 25451 gene locus_tag LOCUS_18750 26806 25451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 28434 27025 gene locus_tag LOCUS_18760 28434 27025 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_18760 29700 28447 gene locus_tag LOCUS_18770 29700 28447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 31279 29705 gene locus_tag LOCUS_18780 31279 29705 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785160.1 protein_id gnl|my_center|LOCUS_18780 31904 31302 gene locus_tag LOCUS_18790 31904 31302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 32593 32015 gene locus_tag LOCUS_18800 32593 32015 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_18800 32834 32664 gene locus_tag LOCUS_18810 32834 32664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 33233 32871 gene locus_tag LOCUS_18820 33233 32871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 33478 33257 gene locus_tag LOCUS_18830 33478 33257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 33705 33490 gene locus_tag LOCUS_18840 33705 33490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 34380 33709 gene locus_tag LOCUS_18850 34380 33709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 35050 34373 gene locus_tag LOCUS_18860 35050 34373 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_18860 35368 36846 gene locus_tag LOCUS_18870 35368 36846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 39037 36851 gene locus_tag LOCUS_18880 gene copA 39037 36851 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_18880 40176 39058 gene locus_tag LOCUS_18890 40176 39058 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_18890 40277 41041 gene locus_tag LOCUS_18900 gene hisA 40277 41041 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923355.1 protein_id gnl|my_center|LOCUS_18900 41043 42038 gene locus_tag LOCUS_18910 gene thiL 41043 42038 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_18910 42376 42035 gene locus_tag LOCUS_18920 42376 42035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 43739 42462 gene locus_tag LOCUS_18930 gene rpsA 43739 42462 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_18930 43932 44405 gene locus_tag LOCUS_18940 43932 44405 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065175.1 protein_id gnl|my_center|LOCUS_18940 44402 45160 gene locus_tag LOCUS_18950 44402 45160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 45160 46719 gene locus_tag LOCUS_18960 45160 46719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 46732 48411 gene locus_tag LOCUS_18970 46732 48411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 48441 49301 gene locus_tag LOCUS_18980 48441 49301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 49458 49859 gene locus_tag LOCUS_18990 49458 49859 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258465.1 protein_id gnl|my_center|LOCUS_18990 50162 51322 gene locus_tag LOCUS_19000 50162 51322 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986854.1 protein_id gnl|my_center|LOCUS_19000 52528 51413 gene locus_tag LOCUS_19010 52528 51413 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142291.1 protein_id gnl|my_center|LOCUS_19010 53735 52515 gene locus_tag LOCUS_19020 53735 52515 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666936.1 protein_id gnl|my_center|LOCUS_19020 53906 54124 gene locus_tag LOCUS_19030 53906 54124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 54232 54735 gene locus_tag LOCUS_19040 54232 54735 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927009.1 protein_id gnl|my_center|LOCUS_19040 54839 56041 gene locus_tag LOCUS_19050 54839 56041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 56797 56078 gene locus_tag LOCUS_19060 56797 56078 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_19060 57782 56784 gene locus_tag LOCUS_19070 57782 56784 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_19070 58419 57805 gene locus_tag LOCUS_19080 58419 57805 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120859.1 protein_id gnl|my_center|LOCUS_19080 59156 58416 gene locus_tag LOCUS_19090 59156 58416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 60858 59200 gene locus_tag LOCUS_19100 60858 59200 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence026 657 1994 gene locus_tag LOCUS_19110 657 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3150 2062 gene locus_tag LOCUS_19120 3150 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 4315 3155 gene locus_tag LOCUS_19130 4315 3155 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066535.1 protein_id gnl|my_center|LOCUS_19130 4866 7754 gene locus_tag LOCUS_19140 4866 7754 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873439.1 protein_id gnl|my_center|LOCUS_19140 8001 9410 gene locus_tag LOCUS_19150 8001 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 10685 9528 gene locus_tag LOCUS_19160 10685 9528 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198598615.1 protein_id gnl|my_center|LOCUS_19160 11085 11309 gene locus_tag LOCUS_19170 11085 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 12083 11772 gene locus_tag LOCUS_19180 12083 11772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 12620 12087 gene locus_tag LOCUS_19190 12620 12087 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013556.1 protein_id gnl|my_center|LOCUS_19190 12802 12647 gene locus_tag LOCUS_19200 12802 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 13862 12966 gene locus_tag LOCUS_19210 13862 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 14546 15733 gene locus_tag LOCUS_19220 14546 15733 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873440.1 protein_id gnl|my_center|LOCUS_19220 17084 15831 gene locus_tag LOCUS_19230 gene epmA 17084 15831 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388833.1 protein_id gnl|my_center|LOCUS_19230 17196 18041 gene locus_tag LOCUS_19240 17196 18041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 18057 19436 gene locus_tag LOCUS_19250 18057 19436 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616190.1 protein_id gnl|my_center|LOCUS_19250 19552 20709 gene locus_tag LOCUS_19260 19552 20709 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_19260 21458 20721 gene locus_tag LOCUS_19270 21458 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 22514 21525 gene locus_tag LOCUS_19280 22514 21525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 23497 22583 gene locus_tag LOCUS_19290 23497 22583 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529508.1 protein_id gnl|my_center|LOCUS_19290 24318 23497 gene locus_tag LOCUS_19300 24318 23497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 24601 24311 gene locus_tag LOCUS_19310 24601 24311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 25469 24864 gene locus_tag LOCUS_19320 25469 24864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19320 25749 25501 gene locus_tag LOCUS_19330 25749 25501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 26038 25862 gene locus_tag LOCUS_19340 26038 25862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 26530 26042 gene locus_tag LOCUS_19350 26530 26042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 26833 26534 gene locus_tag LOCUS_19360 26833 26534 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704380.1 protein_id gnl|my_center|LOCUS_19360 29232 26845 gene locus_tag LOCUS_19370 29232 26845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_19370 29432 31378 gene locus_tag LOCUS_19380 29432 31378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 31650 31877 gene locus_tag LOCUS_19390 31650 31877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 31867 32289 gene locus_tag LOCUS_19400 31867 32289 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_19400 32476 34308 gene locus_tag LOCUS_19410 32476 34308 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922636.1 protein_id gnl|my_center|LOCUS_19410 34378 36330 gene locus_tag LOCUS_19420 34378 36330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 36377 38959 gene locus_tag LOCUS_19430 36377 38959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 40205 38970 gene locus_tag LOCUS_19440 40205 38970 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_19440 40498 41424 gene locus_tag LOCUS_19450 40498 41424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 41514 51572 gene locus_tag LOCUS_19460 41514 51572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 51663 51902 gene locus_tag LOCUS_19470 51663 51902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 52031 53782 gene locus_tag LOCUS_19480 52031 53782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 55206 53767 gene locus_tag LOCUS_19490 55206 53767 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_19490 56070 55294 gene locus_tag LOCUS_19500 56070 55294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 57230 56085 gene locus_tag LOCUS_19510 57230 56085 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973629.1 protein_id gnl|my_center|LOCUS_19510 58105 57233 gene locus_tag LOCUS_19520 58105 57233 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173824.1 protein_id gnl|my_center|LOCUS_19520 58226 59458 gene locus_tag LOCUS_19530 58226 59458 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence027 90 509 gene locus_tag LOCUS_19540 90 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 592 1122 gene locus_tag LOCUS_19550 gene ripB 592 1122 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_19550 1119 1976 gene locus_tag LOCUS_19560 gene citE 1119 1976 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640115.1 protein_id gnl|my_center|LOCUS_19560 1978 3183 gene locus_tag LOCUS_19570 1978 3183 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_19570 4555 3188 gene locus_tag LOCUS_19580 4555 3188 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_19580 4776 5492 gene locus_tag LOCUS_19590 4776 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 5480 6505 gene locus_tag LOCUS_19600 5480 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 6566 6787 gene locus_tag LOCUS_19610 6566 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 6928 7812 gene locus_tag LOCUS_19620 gene hpaI 6928 7812 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144460629.1 protein_id gnl|my_center|LOCUS_19620 8099 7809 gene locus_tag LOCUS_19630 8099 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 9039 8221 gene locus_tag LOCUS_19640 9039 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 9153 9473 gene locus_tag LOCUS_19650 9153 9473 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_19650 10487 9618 gene locus_tag LOCUS_19660 10487 9618 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_19660 11976 10504 gene locus_tag LOCUS_19670 11976 10504 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_19670 12130 12933 gene locus_tag LOCUS_19680 12130 12933 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_19680 12961 13968 gene locus_tag LOCUS_19690 12961 13968 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969225.1 protein_id gnl|my_center|LOCUS_19690 14997 13975 gene locus_tag LOCUS_19700 14997 13975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 16039 15020 gene locus_tag LOCUS_19710 gene gutB 16039 15020 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_19710 16136 17155 gene locus_tag LOCUS_19720 16136 17155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 17177 18256 gene locus_tag LOCUS_19730 gene iolX 17177 18256 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_19730 19124 18264 gene locus_tag LOCUS_19740 19124 18264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 19148 19924 gene locus_tag LOCUS_19750 19148 19924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 19940 20968 gene locus_tag LOCUS_19760 19940 20968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 20985 21701 gene locus_tag LOCUS_19770 20985 21701 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_19770 22763 21831 gene locus_tag LOCUS_19780 22763 21831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 23291 23043 gene locus_tag LOCUS_19790 23291 23043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 23654 23313 gene locus_tag LOCUS_19800 23654 23313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 26823 23647 gene locus_tag LOCUS_19810 26823 23647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 27484 26867 gene locus_tag LOCUS_19820 27484 26867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 30542 27486 gene locus_tag LOCUS_19830 30542 27486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 30720 30469 gene locus_tag LOCUS_19840 30720 30469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 30965 30708 gene locus_tag LOCUS_19850 30965 30708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 32073 31012 gene locus_tag LOCUS_19860 32073 31012 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438698.1 protein_id gnl|my_center|LOCUS_19860 33127 32087 gene locus_tag LOCUS_19870 33127 32087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 34192 33143 gene locus_tag LOCUS_19880 34192 33143 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_19880 35017 34196 gene locus_tag LOCUS_19890 35017 34196 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228709.1 protein_id gnl|my_center|LOCUS_19890 36178 35033 gene locus_tag LOCUS_19900 36178 35033 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_19900 36420 36496 gene locus_tag LOCUS_t00190 36420 36496 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 36564 37814 gene locus_tag LOCUS_19910 36564 37814 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_19910 37870 37945 gene locus_tag LOCUS_t00200 37870 37945 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 38208 38035 gene locus_tag LOCUS_19920 38208 38035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 38646 38443 gene locus_tag LOCUS_19930 38646 38443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 38962 39600 gene locus_tag LOCUS_19940 gene udk 38962 39600 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700143.1 protein_id gnl|my_center|LOCUS_19940 39780 40607 gene locus_tag LOCUS_19950 39780 40607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 42314 40608 gene locus_tag LOCUS_19960 gene ilvD 42314 40608 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922486.1 protein_id gnl|my_center|LOCUS_19960 42408 42920 gene locus_tag LOCUS_19970 42408 42920 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966411.1 protein_id gnl|my_center|LOCUS_19970 42931 44340 gene locus_tag LOCUS_19980 42931 44340 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803772.1 protein_id gnl|my_center|LOCUS_19980 45755 44343 gene locus_tag LOCUS_19990 gene lpdA 45755 44343 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035792.1 protein_id gnl|my_center|LOCUS_19990 47029 45770 gene locus_tag LOCUS_20000 47029 45770 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174158.1 protein_id gnl|my_center|LOCUS_20000 49760 47055 gene locus_tag LOCUS_20010 gene aceE 49760 47055 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_20010 50415 50023 gene locus_tag LOCUS_20020 50415 50023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 51456 50428 gene locus_tag LOCUS_20030 51456 50428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 51582 52361 gene locus_tag LOCUS_20040 51582 52361 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_20040 53650 52358 gene locus_tag LOCUS_20050 gene hflX 53650 52358 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016249.1 protein_id gnl|my_center|LOCUS_20050 53698 54219 gene locus_tag LOCUS_20060 53698 54219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 55383 54223 gene locus_tag LOCUS_20070 55383 54223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence028 1693 431 gene locus_tag LOCUS_20080 gene tyrS 1693 431 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808246.1 protein_id gnl|my_center|LOCUS_20080 2320 1715 gene locus_tag LOCUS_20090 2320 1715 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545776.1 protein_id gnl|my_center|LOCUS_20090 3101 2310 gene locus_tag LOCUS_20100 gene trpC 3101 2310 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_20100 4180 3116 gene locus_tag LOCUS_20110 4180 3116 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776531.1 protein_id gnl|my_center|LOCUS_20110 5209 4196 gene locus_tag LOCUS_20120 gene trpD 5209 4196 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_20120 5795 5232 gene locus_tag LOCUS_20130 5795 5232 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_20130 7267 5792 gene locus_tag LOCUS_20140 gene trpE 7267 5792 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_20140 8297 7527 gene locus_tag LOCUS_20150 8297 7527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_20150 8989 8318 gene locus_tag LOCUS_20160 8989 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 9793 9074 gene locus_tag LOCUS_20170 9793 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 10679 9786 gene locus_tag LOCUS_20180 10679 9786 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803426.1 protein_id gnl|my_center|LOCUS_20180 12145 10679 gene locus_tag LOCUS_20190 12145 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 12557 12294 gene locus_tag LOCUS_20200 12557 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 12861 13925 gene locus_tag LOCUS_20210 gene porV 12861 13925 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_20210 13981 15324 gene locus_tag LOCUS_20220 13981 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 15334 18327 gene locus_tag LOCUS_20230 15334 18327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 18401 21442 gene locus_tag LOCUS_20240 18401 21442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 21457 22128 gene locus_tag LOCUS_20250 21457 22128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 22133 22762 gene locus_tag LOCUS_20260 22133 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 22765 24291 gene locus_tag LOCUS_20270 22765 24291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 24316 25908 gene locus_tag LOCUS_20280 24316 25908 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_20280 26824 25889 gene locus_tag LOCUS_20290 26824 25889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 27502 26828 gene locus_tag LOCUS_20300 27502 26828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_20300 28601 27684 gene locus_tag LOCUS_20310 28601 27684 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226710.1 protein_id gnl|my_center|LOCUS_20310 29835 28780 gene locus_tag LOCUS_20320 29835 28780 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_20320 30662 29832 gene locus_tag LOCUS_20330 30662 29832 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_20330 32589 30679 gene locus_tag LOCUS_20340 32589 30679 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776685.1 protein_id gnl|my_center|LOCUS_20340 34597 32657 gene locus_tag LOCUS_20350 34597 32657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 36210 34606 gene locus_tag LOCUS_20360 36210 34606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 36428 36826 gene locus_tag LOCUS_20370 gene ndk 36428 36826 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403833.1 protein_id gnl|my_center|LOCUS_20370 36844 37359 gene locus_tag LOCUS_20380 36844 37359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 37634 38629 gene locus_tag LOCUS_20390 37634 38629 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402830.1 protein_id gnl|my_center|LOCUS_20390 38630 39559 gene locus_tag LOCUS_20400 gene fabD 38630 39559 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_20400 39556 40302 gene locus_tag LOCUS_20410 gene fabG 39556 40302 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_20410 40337 40576 gene locus_tag LOCUS_20420 40337 40576 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405458.1 protein_id gnl|my_center|LOCUS_20420 40627 41877 gene locus_tag LOCUS_20430 gene fabF 40627 41877 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_20430 41889 42665 gene locus_tag LOCUS_20440 gene rnc 41889 42665 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440969.1 protein_id gnl|my_center|LOCUS_20440 42734 43507 gene locus_tag LOCUS_20450 gene lipM 42734 43507 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 protein_id gnl|my_center|LOCUS_20450 43485 43916 gene locus_tag LOCUS_20460 43485 43916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 43879 44232 gene locus_tag LOCUS_20470 43879 44232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 44225 46012 gene locus_tag LOCUS_20480 44225 46012 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_20480 46104 47222 gene locus_tag LOCUS_20490 46104 47222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 47245 48450 gene locus_tag LOCUS_20500 47245 48450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 48466 49125 gene locus_tag LOCUS_20510 48466 49125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 49122 49952 gene locus_tag LOCUS_20520 49122 49952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 49949 50680 gene locus_tag LOCUS_20530 49949 50680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 50764 51726 gene locus_tag LOCUS_20540 50764 51726 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 protein_id gnl|my_center|LOCUS_20540 51738 52688 gene locus_tag LOCUS_20550 51738 52688 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence029 2353 728 gene locus_tag LOCUS_20560 2353 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 3320 2397 gene locus_tag LOCUS_20570 3320 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 3847 3437 gene locus_tag LOCUS_20580 3847 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 4677 3844 gene locus_tag LOCUS_20590 4677 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 5227 4667 gene locus_tag LOCUS_20600 5227 4667 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256305.1 protein_id gnl|my_center|LOCUS_20600 5473 6162 gene locus_tag LOCUS_20610 5473 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 6348 6635 gene locus_tag LOCUS_20620 6348 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 6733 7080 gene locus_tag LOCUS_20630 6733 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 7107 10265 gene locus_tag LOCUS_20640 7107 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 11781 10237 gene locus_tag LOCUS_20650 11781 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 12074 14533 gene locus_tag LOCUS_20660 12074 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 14646 15065 gene locus_tag LOCUS_20670 14646 15065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20670 15067 16047 gene locus_tag LOCUS_20680 15067 16047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20680 16391 16777 gene locus_tag LOCUS_20690 16391 16777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 16774 17175 gene locus_tag LOCUS_20700 16774 17175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 17321 17473 gene locus_tag LOCUS_20710 17321 17473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 17427 18377 gene locus_tag LOCUS_20720 17427 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 18652 21075 gene locus_tag LOCUS_20730 18652 21075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 21980 21570 gene locus_tag LOCUS_20740 21980 21570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 23164 21980 gene locus_tag LOCUS_20750 23164 21980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 24006 23161 gene locus_tag LOCUS_20760 24006 23161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 25015 24215 gene locus_tag LOCUS_20770 25015 24215 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_20770 27142 25022 gene locus_tag LOCUS_20780 27142 25022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 28960 27149 gene locus_tag LOCUS_20790 28960 27149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20790 30411 28963 gene locus_tag LOCUS_20800 30411 28963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20800 31919 30429 gene locus_tag LOCUS_20810 31919 30429 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_20810 31851 32033 gene locus_tag LOCUS_20820 31851 32033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 32243 32330 gene locus_tag LOCUS_t00210 32243 32330 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32387 32478 gene locus_tag LOCUS_t00220 32387 32478 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32501 33922 gene locus_tag LOCUS_20830 gene gltX 32501 33922 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583633.1 protein_id gnl|my_center|LOCUS_20830 35576 33945 gene locus_tag LOCUS_20840 35576 33945 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_20840 33959 34032 gene locus_tag LOCUS_t00230 33959 34032 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 35935 35759 gene locus_tag LOCUS_20850 35935 35759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 36179 36015 gene locus_tag LOCUS_20860 36179 36015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 36445 36176 gene locus_tag LOCUS_20870 36445 36176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 36795 36496 gene locus_tag LOCUS_20880 36795 36496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 37599 38237 gene locus_tag LOCUS_20890 37599 38237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 40357 38816 gene locus_tag LOCUS_20900 40357 38816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 41157 40414 gene locus_tag LOCUS_20910 41157 40414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 42154 41876 gene locus_tag LOCUS_20920 42154 41876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 42827 42306 gene locus_tag LOCUS_20930 42827 42306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 43003 43452 gene locus_tag LOCUS_20940 43003 43452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 43477 44175 gene locus_tag LOCUS_20950 gene radC 43477 44175 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013390.1 protein_id gnl|my_center|LOCUS_20950 44230 44415 gene locus_tag LOCUS_20960 44230 44415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 44430 44666 gene locus_tag LOCUS_20970 44430 44666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 44716 44973 gene locus_tag LOCUS_20980 44716 44973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 44984 45163 gene locus_tag LOCUS_20990 44984 45163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 45165 45371 gene locus_tag LOCUS_21000 45165 45371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 45429 46175 gene locus_tag LOCUS_21010 45429 46175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 46323 46730 gene locus_tag LOCUS_21020 46323 46730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 46828 47421 gene locus_tag LOCUS_21030 46828 47421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 47443 47661 gene locus_tag LOCUS_21040 47443 47661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 47787 48125 gene locus_tag LOCUS_21050 47787 48125 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_21050 48467 48922 gene locus_tag LOCUS_21060 48467 48922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 49262 50326 gene locus_tag LOCUS_21070 49262 50326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 50358 50495 gene locus_tag LOCUS_21080 50358 50495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 50699 51175 gene locus_tag LOCUS_21090 50699 51175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 51494 52045 gene locus_tag LOCUS_21100 51494 52045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 52901 52170 gene locus_tag LOCUS_21110 52901 52170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21110 53329 53018 gene locus_tag LOCUS_21120 53329 53018 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234794028.1 protein_id gnl|my_center|LOCUS_21120 53496 53293 gene locus_tag LOCUS_21130 53496 53293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 54214 53849 gene locus_tag LOCUS_21140 54214 53849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence030 293 931 gene locus_tag LOCUS_21150 293 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1036 1704 gene locus_tag LOCUS_21160 1036 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2728 1820 gene locus_tag LOCUS_21170 2728 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3009 2725 gene locus_tag LOCUS_21180 3009 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 3119 4885 gene locus_tag LOCUS_21190 3119 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 5019 6266 gene locus_tag LOCUS_21200 5019 6266 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037469338.1 protein_id gnl|my_center|LOCUS_21200 7456 6275 gene locus_tag LOCUS_21210 7456 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 8280 8459 gene locus_tag LOCUS_21220 8280 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 9093 9779 gene locus_tag LOCUS_21230 9093 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 9947 10753 gene locus_tag LOCUS_21240 9947 10753 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_21240 11541 12014 gene locus_tag LOCUS_21250 11541 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21250 12185 12988 gene locus_tag LOCUS_21260 12185 12988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 14142 14594 gene locus_tag LOCUS_21270 14142 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 16369 14738 gene locus_tag LOCUS_21280 16369 14738 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085891.1 protein_id gnl|my_center|LOCUS_21280 17283 16390 gene locus_tag LOCUS_21290 gene yghX 17283 16390 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 protein_id gnl|my_center|LOCUS_21290 18089 17310 gene locus_tag LOCUS_21300 18089 17310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 18384 19550 gene locus_tag LOCUS_21310 18384 19550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 19953 20501 gene locus_tag LOCUS_21320 19953 20501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 20518 21636 gene locus_tag LOCUS_21330 20518 21636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 21798 22049 gene locus_tag LOCUS_21340 21798 22049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 22169 24826 gene locus_tag LOCUS_21350 22169 24826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 24861 25085 gene locus_tag LOCUS_21360 24861 25085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 25082 26326 gene locus_tag LOCUS_21370 25082 26326 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928674.1 protein_id gnl|my_center|LOCUS_21370 26313 26900 gene locus_tag LOCUS_21380 26313 26900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 26913 27464 gene locus_tag LOCUS_21390 26913 27464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 29092 27539 gene locus_tag LOCUS_21400 29092 27539 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_21400 30564 29113 gene locus_tag LOCUS_21410 30564 29113 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_21410 31334 30561 gene locus_tag LOCUS_21420 31334 30561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 32758 31343 gene locus_tag LOCUS_21430 32758 31343 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_21430 33994 32855 gene locus_tag LOCUS_21440 gene dgoD 33994 32855 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_21440 35267 34005 gene locus_tag LOCUS_21450 35267 34005 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810317.1 protein_id gnl|my_center|LOCUS_21450 37037 35295 gene locus_tag LOCUS_21460 37037 35295 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813188.1 protein_id gnl|my_center|LOCUS_21460 37996 37034 gene locus_tag LOCUS_21470 37996 37034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 38801 37983 gene locus_tag LOCUS_21480 38801 37983 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_21480 39837 38818 gene locus_tag LOCUS_21490 39837 38818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 40983 39850 gene locus_tag LOCUS_21500 40983 39850 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_21500 42145 41246 gene locus_tag LOCUS_21510 42145 41246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 43074 42163 gene locus_tag LOCUS_21520 43074 42163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 45085 43097 gene locus_tag LOCUS_21530 45085 43097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 46548 45082 gene locus_tag LOCUS_21540 46548 45082 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803772.1 protein_id gnl|my_center|LOCUS_21540 47497 46550 gene locus_tag LOCUS_21550 47497 46550 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_21550 49480 47510 gene locus_tag LOCUS_21560 49480 47510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 50231 49494 gene locus_tag LOCUS_21570 50231 49494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 53587 50288 gene locus_tag LOCUS_21580 53587 50288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 53962 54162 gene locus_tag LOCUS_21590 53962 54162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence031 1269 37 gene locus_tag LOCUS_21600 1269 37 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_21600 1402 4263 gene locus_tag LOCUS_21610 1402 4263 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_21610 4280 4792 gene locus_tag LOCUS_21620 4280 4792 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_21620 4808 4883 gene locus_tag LOCUS_t00240 4808 4883 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5033 5278 gene locus_tag LOCUS_21630 5033 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 5339 5707 gene locus_tag LOCUS_21640 5339 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 6672 5830 gene locus_tag LOCUS_21650 6672 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 7300 6695 gene locus_tag LOCUS_21660 7300 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 7900 7349 gene locus_tag LOCUS_21670 7900 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 8140 7913 gene locus_tag LOCUS_21680 8140 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 8655 9710 gene locus_tag LOCUS_21690 8655 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 9726 11177 gene locus_tag LOCUS_21700 9726 11177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 11293 13530 gene locus_tag LOCUS_21710 11293 13530 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_21710 13553 15796 gene locus_tag LOCUS_21720 13553 15796 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_21720 15809 16483 gene locus_tag LOCUS_21730 15809 16483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 16496 18169 gene locus_tag LOCUS_21740 16496 18169 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_21740 18228 18974 gene locus_tag LOCUS_21750 18228 18974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 19041 20186 gene locus_tag LOCUS_21760 19041 20186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 20179 21447 gene locus_tag LOCUS_21770 20179 21447 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494209.1 protein_id gnl|my_center|LOCUS_21770 21458 22117 gene locus_tag LOCUS_21780 21458 22117 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086324.1 protein_id gnl|my_center|LOCUS_21780 22130 22891 gene locus_tag LOCUS_21790 22130 22891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 23760 22993 gene locus_tag LOCUS_21800 gene fabG 23760 22993 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_21800 23984 24460 gene locus_tag LOCUS_21810 23984 24460 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243293.1 protein_id gnl|my_center|LOCUS_21810 24444 25967 gene locus_tag LOCUS_21820 24444 25967 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_21820 25984 26730 gene locus_tag LOCUS_21830 25984 26730 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_21830 27493 26807 gene locus_tag LOCUS_21840 27493 26807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 27715 29238 gene locus_tag LOCUS_21850 27715 29238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 29228 30004 gene locus_tag LOCUS_21860 29228 30004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 30017 33214 gene locus_tag LOCUS_21870 30017 33214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 33290 33637 gene locus_tag LOCUS_21880 33290 33637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 33630 33806 gene locus_tag LOCUS_21890 33630 33806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 33860 34228 gene locus_tag LOCUS_21900 33860 34228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 34225 35250 gene locus_tag LOCUS_21910 gene mltG 34225 35250 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933876.1 protein_id gnl|my_center|LOCUS_21910 35276 37447 gene locus_tag LOCUS_21920 gene pcrA 35276 37447 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_21920 37481 38422 gene locus_tag LOCUS_21930 37481 38422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 38435 38902 gene locus_tag LOCUS_21940 38435 38902 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142427.1 protein_id gnl|my_center|LOCUS_21940 38960 40939 gene locus_tag LOCUS_21950 38960 40939 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_21950 41178 41462 gene locus_tag LOCUS_21960 gene gatC 41178 41462 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_21960 41526 43307 gene locus_tag LOCUS_21970 gene pyrG 41526 43307 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023212.1 protein_id gnl|my_center|LOCUS_21970 43279 43803 gene locus_tag LOCUS_21980 43279 43803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 44022 45203 gene locus_tag LOCUS_21990 44022 45203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 45200 45925 gene locus_tag LOCUS_22000 gene lptB 45200 45925 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016586.1 protein_id gnl|my_center|LOCUS_22000 46019 46567 gene locus_tag LOCUS_22010 46019 46567 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929177.1 protein_id gnl|my_center|LOCUS_22010 46571 48058 gene locus_tag LOCUS_22020 gene rpoN 46571 48058 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403901.1 protein_id gnl|my_center|LOCUS_22020 48925 48140 gene locus_tag LOCUS_22030 48925 48140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 49233 51407 gene locus_tag LOCUS_22040 49233 51407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 51460 51741 gene locus_tag LOCUS_22050 51460 51741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 52261 51965 gene locus_tag LOCUS_22060 52261 51965 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931006.1 protein_id gnl|my_center|LOCUS_22060 52419 53249 gene locus_tag LOCUS_22070 gene fdhD 52419 53249 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence032 <1 1199 gene locus_tag LOCUS_22080 <1 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815367.1:TlpA disulfide reductase family protein 1239 3527 gene locus_tag LOCUS_22090 1239 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 4765 3563 gene locus_tag LOCUS_22100 gene galK 4765 3563 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_22100 6891 4735 gene locus_tag LOCUS_22110 6891 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 7123 7596 gene locus_tag LOCUS_22120 gene greA 7123 7596 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958124.1 protein_id gnl|my_center|LOCUS_22120 8092 7706 gene locus_tag LOCUS_22130 8092 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 9177 8161 gene locus_tag LOCUS_22140 9177 8161 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061621.1 protein_id gnl|my_center|LOCUS_22140 9752 9204 gene locus_tag LOCUS_22150 gene rpsD 9752 9204 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933816.1 protein_id gnl|my_center|LOCUS_22150 10239 9856 gene locus_tag LOCUS_22160 gene rpsK 10239 9856 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393910.1 protein_id gnl|my_center|LOCUS_22160 10645 10271 gene locus_tag LOCUS_22170 gene rpsM 10645 10271 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_22170 12154 10811 gene locus_tag LOCUS_22180 gene secY 12154 10811 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933822.1 protein_id gnl|my_center|LOCUS_22180 12620 12174 gene locus_tag LOCUS_22190 gene rplO 12620 12174 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_22190 12825 12637 gene locus_tag LOCUS_22200 gene rpmD 12825 12637 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140433.1 protein_id gnl|my_center|LOCUS_22200 13343 12828 gene locus_tag LOCUS_22210 gene rpsE 13343 12828 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_22210 13572 13360 gene locus_tag LOCUS_22220 13572 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 14319 13753 gene locus_tag LOCUS_22230 gene rplF 14319 13753 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_22230 14735 14340 gene locus_tag LOCUS_22240 gene rpsH 14735 14340 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_22240 15519 14971 gene locus_tag LOCUS_22250 gene rplE 15519 14971 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_22250 15850 15530 gene locus_tag LOCUS_22260 gene rplX 15850 15530 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_22260 16241 15873 gene locus_tag LOCUS_22270 gene rplN 16241 15873 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_22270 16513 16253 gene locus_tag LOCUS_22280 gene rpsQ 16513 16253 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357552.1 protein_id gnl|my_center|LOCUS_22280 16746 16534 gene locus_tag LOCUS_22290 gene rpmC 16746 16534 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081820.1 protein_id gnl|my_center|LOCUS_22290 17162 16743 gene locus_tag LOCUS_22300 gene rplP 17162 16743 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_22300 17834 17184 gene locus_tag LOCUS_22310 gene rpsC 17834 17184 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_22310 18186 17845 gene locus_tag LOCUS_22320 18186 17845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 18499 18209 gene locus_tag LOCUS_22330 gene rpsS 18499 18209 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_22330 19340 18516 gene locus_tag LOCUS_22340 gene rplB 19340 18516 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_22340 19631 19344 gene locus_tag LOCUS_22350 gene rplW 19631 19344 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_22350 20260 19628 gene locus_tag LOCUS_22360 gene rplD 20260 19628 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_22360 20901 20278 gene locus_tag LOCUS_22370 gene rplC 20901 20278 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_22370 21212 20904 gene locus_tag LOCUS_22380 gene rpsJ 21212 20904 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567567.1 protein_id gnl|my_center|LOCUS_22380 22426 21233 gene locus_tag LOCUS_22390 gene tuf 22426 21233 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_22390 24566 22473 gene locus_tag LOCUS_22400 gene fusA 24566 22473 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_22400 25043 24576 gene locus_tag LOCUS_22410 gene rpsG 25043 24576 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004624018.1 protein_id gnl|my_center|LOCUS_22410 25501 25130 gene locus_tag LOCUS_22420 gene rpsL 25501 25130 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_22420 29648 25557 gene locus_tag LOCUS_22430 gene rpoC 29648 25557 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546248.1 protein_id gnl|my_center|LOCUS_22430 33452 29679 gene locus_tag LOCUS_22440 gene rpoB 33452 29679 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051010823.1 protein_id gnl|my_center|LOCUS_22440 33894 33526 gene locus_tag LOCUS_22450 gene rplL 33894 33526 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_22450 34471 33938 gene locus_tag LOCUS_22460 gene rplJ 34471 33938 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112001.1 protein_id gnl|my_center|LOCUS_22460 35190 34489 gene locus_tag LOCUS_22470 gene rplA 35190 34489 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_22470 35628 35203 gene locus_tag LOCUS_22480 gene rplK 35628 35203 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_22480 36177 35641 gene locus_tag LOCUS_22490 gene nusG 36177 35641 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_22490 36392 36207 gene locus_tag LOCUS_22500 gene secE 36392 36207 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943499.1 protein_id gnl|my_center|LOCUS_22500 36483 36408 gene locus_tag LOCUS_t00250 36483 36408 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 36571 36496 gene locus_tag LOCUS_t00260 36571 36496 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 36672 36596 gene locus_tag LOCUS_t00270 36672 36596 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 36973 36888 gene locus_tag LOCUS_t00280 36973 36888 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 37137 38051 gene locus_tag LOCUS_22510 37137 38051 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393753.1 protein_id gnl|my_center|LOCUS_22510 38881 38123 gene locus_tag LOCUS_22520 38881 38123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 40076 38883 gene locus_tag LOCUS_22530 40076 38883 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_22530 41677 40316 gene locus_tag LOCUS_22540 gene thrC 41677 40316 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257816.1 protein_id gnl|my_center|LOCUS_22540 42449 41691 gene locus_tag LOCUS_22550 42449 41691 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_22550 44209 42461 gene locus_tag LOCUS_22560 44209 42461 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405278.1 protein_id gnl|my_center|LOCUS_22560 45002 44286 gene locus_tag LOCUS_22570 45002 44286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 46045 45020 gene locus_tag LOCUS_22580 46045 45020 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_22580 47041 46046 gene locus_tag LOCUS_22590 47041 46046 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_22590 47958 47041 gene locus_tag LOCUS_22600 47958 47041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 49353 47968 gene locus_tag LOCUS_22610 49353 47968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 50832 49438 gene locus_tag LOCUS_22620 50832 49438 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_22620 51964 50843 gene locus_tag LOCUS_22630 51964 50843 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_22630 <52770 51961 gene locus_tag LOCUS_22640 <52770 51961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583303.1:acetate kinase >Feature sequence033 1854 1372 gene locus_tag LOCUS_22650 1854 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 3131 1842 gene locus_tag LOCUS_22660 gene hemL 3131 1842 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933753.1 protein_id gnl|my_center|LOCUS_22660 3258 3332 gene locus_tag LOCUS_t00290 3258 3332 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3396 6167 gene locus_tag LOCUS_22670 gene uvrA 3396 6167 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045572.1 protein_id gnl|my_center|LOCUS_22670 7301 6288 gene locus_tag LOCUS_22680 gene rfbB 7301 6288 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_22680 7793 7599 gene locus_tag LOCUS_22690 7793 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 8218 7949 gene locus_tag LOCUS_22700 8218 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 8479 8240 gene locus_tag LOCUS_22710 8479 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 8694 8512 gene locus_tag LOCUS_22720 8694 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 9173 8700 gene locus_tag LOCUS_22730 9173 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 9503 9225 gene locus_tag LOCUS_22740 9503 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 9715 10500 gene locus_tag LOCUS_22750 9715 10500 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_22750 11435 10497 gene locus_tag LOCUS_22760 11435 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 12477 11443 gene locus_tag LOCUS_22770 12477 11443 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_22770 13266 12493 gene locus_tag LOCUS_22780 13266 12493 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_22780 15588 13285 gene locus_tag LOCUS_22790 15588 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 15736 16902 gene locus_tag LOCUS_22800 gene bioF 15736 16902 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_22800 17025 17792 gene locus_tag LOCUS_22810 17025 17792 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_22810 19158 17809 gene locus_tag LOCUS_22820 19158 17809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_22820 19291 20325 gene locus_tag LOCUS_22830 gene pdxA 19291 20325 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047748.1 protein_id gnl|my_center|LOCUS_22830 20410 22716 gene locus_tag LOCUS_22840 20410 22716 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_22840 22734 23108 gene locus_tag LOCUS_22850 22734 23108 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124480.1 protein_id gnl|my_center|LOCUS_22850 23108 23641 gene locus_tag LOCUS_22860 gene nuoB 23108 23641 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236331.1 protein_id gnl|my_center|LOCUS_22860 23638 24096 gene locus_tag LOCUS_22870 23638 24096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 24179 25309 gene locus_tag LOCUS_22880 gene nuoD 24179 25309 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_22880 25317 26291 gene locus_tag LOCUS_22890 gene nuoH 25317 26291 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_22890 26311 26850 gene locus_tag LOCUS_22900 gene nuoI 26311 26850 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_22900 26864 27376 gene locus_tag LOCUS_22910 26864 27376 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_22910 27373 27678 gene locus_tag LOCUS_22920 gene nuoK 27373 27678 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_22920 27678 29501 gene locus_tag LOCUS_22930 gene nuoL 27678 29501 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568473.1 protein_id gnl|my_center|LOCUS_22930 29505 30980 gene locus_tag LOCUS_22940 29505 30980 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_22940 30982 32406 gene locus_tag LOCUS_22950 gene nuoN 30982 32406 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 protein_id gnl|my_center|LOCUS_22950 32488 32802 gene locus_tag LOCUS_22960 32488 32802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 33447 32905 gene locus_tag LOCUS_22970 33447 32905 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_22970 33655 34581 gene locus_tag LOCUS_22980 gene ftsY 33655 34581 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_22980 34615 35775 gene locus_tag LOCUS_22990 34615 35775 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_22990 35793 36602 gene locus_tag LOCUS_23000 35793 36602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 36689 37609 gene locus_tag LOCUS_23010 36689 37609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23010 37622 37867 gene locus_tag LOCUS_23020 37622 37867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23020 39009 37942 gene locus_tag LOCUS_23030 39009 37942 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_23030 39961 39020 gene locus_tag LOCUS_23040 39961 39020 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529530.1 protein_id gnl|my_center|LOCUS_23040 40341 39958 gene locus_tag LOCUS_23050 40341 39958 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 protein_id gnl|my_center|LOCUS_23050 41696 40356 gene locus_tag LOCUS_23060 41696 40356 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 protein_id gnl|my_center|LOCUS_23060 42508 41816 gene locus_tag LOCUS_23070 42508 41816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23070 44202 42499 gene locus_tag LOCUS_23080 44202 42499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23080 46056 44464 gene locus_tag LOCUS_23090 46056 44464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 46872 46126 gene locus_tag LOCUS_23100 46872 46126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 47731 47039 gene locus_tag LOCUS_23110 47731 47039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963589.1 protein_id gnl|my_center|LOCUS_23110 48099 47728 gene locus_tag LOCUS_23120 48099 47728 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583004.1 protein_id gnl|my_center|LOCUS_23120 48893 48141 gene locus_tag LOCUS_23130 48893 48141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 50433 49048 gene locus_tag LOCUS_23140 50433 49048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence034 565 101 gene locus_tag LOCUS_23150 565 101 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769725.1 protein_id gnl|my_center|LOCUS_23150 1914 574 gene locus_tag LOCUS_23160 gene rimO 1914 574 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_23160 2464 1937 gene locus_tag LOCUS_23170 2464 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 3360 2461 gene locus_tag LOCUS_23180 3360 2461 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873305.1 protein_id gnl|my_center|LOCUS_23180 4023 3376 gene locus_tag LOCUS_23190 4023 3376 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_23190 4202 5638 gene locus_tag LOCUS_23200 4202 5638 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615932.1 protein_id gnl|my_center|LOCUS_23200 5652 6572 gene locus_tag LOCUS_23210 5652 6572 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209809385.1 protein_id gnl|my_center|LOCUS_23210 6837 8132 gene locus_tag LOCUS_23220 6837 8132 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 protein_id gnl|my_center|LOCUS_23220 8401 8913 gene locus_tag LOCUS_23230 8401 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 8918 9139 gene locus_tag LOCUS_23240 8918 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 9170 9586 gene locus_tag LOCUS_23250 9170 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 9867 11258 gene locus_tag LOCUS_23260 9867 11258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 11572 11886 gene locus_tag LOCUS_23270 11572 11886 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_23270 12142 11960 gene locus_tag LOCUS_23280 12142 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 12390 12629 gene locus_tag LOCUS_23290 12390 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404912.1 protein_id gnl|my_center|LOCUS_23290 13131 13877 gene locus_tag LOCUS_23300 13131 13877 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067521.1 protein_id gnl|my_center|LOCUS_23300 13877 14551 gene locus_tag LOCUS_23310 13877 14551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 14551 15354 gene locus_tag LOCUS_23320 14551 15354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 15370 16557 gene locus_tag LOCUS_23330 15370 16557 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966992.1 protein_id gnl|my_center|LOCUS_23330 16557 17363 gene locus_tag LOCUS_23340 16557 17363 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_23340 18255 17365 gene locus_tag LOCUS_23350 18255 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 19679 18270 gene locus_tag LOCUS_23360 19679 18270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 20697 19852 gene locus_tag LOCUS_23370 20697 19852 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392169.1 protein_id gnl|my_center|LOCUS_23370 20912 23359 gene locus_tag LOCUS_23380 20912 23359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_23380 24062 23430 gene locus_tag LOCUS_23390 24062 23430 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 protein_id gnl|my_center|LOCUS_23390 24239 26434 gene locus_tag LOCUS_23400 24239 26434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 26500 27438 gene locus_tag LOCUS_23410 26500 27438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 28737 27484 gene locus_tag LOCUS_23420 28737 27484 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_23420 28888 29736 gene locus_tag LOCUS_23430 28888 29736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 29743 32118 gene locus_tag LOCUS_23440 29743 32118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_23440 32261 33949 gene locus_tag LOCUS_23450 32261 33949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 34069 35010 gene locus_tag LOCUS_23460 34069 35010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 35761 35033 gene locus_tag LOCUS_23470 35761 35033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 37062 35773 gene locus_tag LOCUS_23480 gene eno 37062 35773 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889260.1 protein_id gnl|my_center|LOCUS_23480 37622 37059 gene locus_tag LOCUS_23490 37622 37059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 38609 37626 gene locus_tag LOCUS_23500 38609 37626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 38854 39786 gene locus_tag LOCUS_23510 38854 39786 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 protein_id gnl|my_center|LOCUS_23510 39789 41732 gene locus_tag LOCUS_23520 39789 41732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 42903 41725 gene locus_tag LOCUS_23530 42903 41725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966440.1 protein_id gnl|my_center|LOCUS_23530 43130 45331 gene locus_tag LOCUS_23540 43130 45331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 45343 45480 gene locus_tag LOCUS_23550 45343 45480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 45629 45943 gene locus_tag LOCUS_23560 45629 45943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 46071 46868 gene locus_tag LOCUS_23570 46071 46868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 46870 47943 gene locus_tag LOCUS_23580 46870 47943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 47963 49102 gene locus_tag LOCUS_23590 47963 49102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 49107 49457 gene locus_tag LOCUS_23600 49107 49457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence035 3605 396 gene locus_tag LOCUS_23610 3605 396 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_23610 4765 3602 gene locus_tag LOCUS_23620 4765 3602 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_23620 5597 4785 gene locus_tag LOCUS_23630 5597 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 6790 5810 gene locus_tag LOCUS_23640 6790 5810 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 protein_id gnl|my_center|LOCUS_23640 7464 7012 gene locus_tag LOCUS_23650 7464 7012 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124736.1 protein_id gnl|my_center|LOCUS_23650 8199 7480 gene locus_tag LOCUS_23660 8199 7480 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399313.1 protein_id gnl|my_center|LOCUS_23660 10216 8228 gene locus_tag LOCUS_23670 10216 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 10992 10219 gene locus_tag LOCUS_23680 10992 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 12354 11011 gene locus_tag LOCUS_23690 12354 11011 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_23690 14713 12371 gene locus_tag LOCUS_23700 14713 12371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 15671 14940 gene locus_tag LOCUS_23710 15671 14940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 16054 15758 gene locus_tag LOCUS_23720 16054 15758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 18799 16256 gene locus_tag LOCUS_23730 18799 16256 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_23730 19319 19107 gene locus_tag LOCUS_23740 19319 19107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 19966 19385 gene locus_tag LOCUS_23750 19966 19385 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_23750 20191 19994 gene locus_tag LOCUS_23760 20191 19994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 20566 20754 gene locus_tag LOCUS_23770 20566 20754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 22025 20964 gene locus_tag LOCUS_23780 gene modC 22025 20964 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388460.1 protein_id gnl|my_center|LOCUS_23780 22712 22032 gene locus_tag LOCUS_23790 gene modB 22712 22032 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158971.1 protein_id gnl|my_center|LOCUS_23790 24512 22725 gene locus_tag LOCUS_23800 24512 22725 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086692.1 protein_id gnl|my_center|LOCUS_23800 24710 25474 gene locus_tag LOCUS_23810 24710 25474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 25615 25691 gene locus_tag LOCUS_t00300 25615 25691 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25810 26532 gene locus_tag LOCUS_23820 25810 26532 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_23820 26529 26951 gene locus_tag LOCUS_23830 26529 26951 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546858.1 protein_id gnl|my_center|LOCUS_23830 27384 28193 gene locus_tag LOCUS_23840 gene pyrF 27384 28193 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_23840 28263 30137 gene locus_tag LOCUS_23850 28263 30137 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 protein_id gnl|my_center|LOCUS_23850 30646 30209 gene locus_tag LOCUS_23860 gene fabZ 30646 30209 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939641.1 protein_id gnl|my_center|LOCUS_23860 31288 30740 gene locus_tag LOCUS_23870 31288 30740 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404582.1 protein_id gnl|my_center|LOCUS_23870 33575 31359 gene locus_tag LOCUS_23880 gene bamA 33575 31359 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_23880 36402 33793 gene locus_tag LOCUS_23890 36402 33793 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_23890 37191 36517 gene locus_tag LOCUS_23900 37191 36517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_23900 38716 37184 gene locus_tag LOCUS_23910 gene lysS 38716 37184 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_23910 39830 38844 gene locus_tag LOCUS_23920 gene prfB 39830 38844 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_23920 40662 39982 gene locus_tag LOCUS_23930 40662 39982 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943821.1 protein_id gnl|my_center|LOCUS_23930 43076 40659 gene locus_tag LOCUS_23940 43076 40659 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_23940 44052 43195 gene locus_tag LOCUS_23950 44052 43195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 46198 44054 gene locus_tag LOCUS_23960 46198 44054 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_23960 47250 46201 gene locus_tag LOCUS_23970 gene tsaD 47250 46201 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_23970 47603 47412 gene locus_tag LOCUS_23980 47603 47412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence036 28 693 gene locus_tag LOCUS_23990 28 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2124 718 gene locus_tag LOCUS_24000 2124 718 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_24000 2477 2187 gene locus_tag LOCUS_24010 2477 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2645 2478 gene locus_tag LOCUS_24020 2645 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 3684 2581 gene locus_tag LOCUS_24030 3684 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 4434 3709 gene locus_tag LOCUS_24040 4434 3709 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_24040 5502 4537 gene locus_tag LOCUS_24050 5502 4537 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140270.1 protein_id gnl|my_center|LOCUS_24050 5690 7588 gene locus_tag LOCUS_24060 5690 7588 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393174.1 protein_id gnl|my_center|LOCUS_24060 7614 7991 gene locus_tag LOCUS_24070 7614 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 8150 9310 gene locus_tag LOCUS_24080 8150 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 9335 10330 gene locus_tag LOCUS_24090 9335 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 10496 10837 gene locus_tag LOCUS_24100 10496 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 11053 10895 gene locus_tag LOCUS_24110 11053 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 11724 12386 gene locus_tag LOCUS_24120 11724 12386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 12594 15539 gene locus_tag LOCUS_24130 12594 15539 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393172.1 protein_id gnl|my_center|LOCUS_24130 15532 15825 gene locus_tag LOCUS_24140 15532 15825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 16753 16007 gene locus_tag LOCUS_24150 16753 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 17731 16763 gene locus_tag LOCUS_24160 17731 16763 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728439.1 protein_id gnl|my_center|LOCUS_24160 19519 17759 gene locus_tag LOCUS_24170 19519 17759 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 protein_id gnl|my_center|LOCUS_24170 21592 19616 gene locus_tag LOCUS_24180 21592 19616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 22688 21726 gene locus_tag LOCUS_24190 22688 21726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 25074 22699 gene locus_tag LOCUS_24200 25074 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 28119 25093 gene locus_tag LOCUS_24210 28119 25093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 28832 28140 gene locus_tag LOCUS_24220 28832 28140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 29924 29154 gene locus_tag LOCUS_24230 29924 29154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 31090 29975 gene locus_tag LOCUS_24240 31090 29975 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384956.1 protein_id gnl|my_center|LOCUS_24240 31870 31094 gene locus_tag LOCUS_24250 31870 31094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 33319 31946 gene locus_tag LOCUS_24260 33319 31946 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582573.1 protein_id gnl|my_center|LOCUS_24260 34198 33410 gene locus_tag LOCUS_24270 34198 33410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 35522 34215 gene locus_tag LOCUS_24280 35522 34215 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_24280 35640 36542 gene locus_tag LOCUS_24290 35640 36542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 37963 36548 gene locus_tag LOCUS_24300 37963 36548 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_24300 38963 37980 gene locus_tag LOCUS_24310 38963 37980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 39810 38974 gene locus_tag LOCUS_24320 39810 38974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 41349 39844 gene locus_tag LOCUS_24330 41349 39844 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 protein_id gnl|my_center|LOCUS_24330 41498 42550 gene locus_tag LOCUS_24340 41498 42550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 42560 43732 gene locus_tag LOCUS_24350 gene solA 42560 43732 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872828.1 protein_id gnl|my_center|LOCUS_24350 43734 44465 gene locus_tag LOCUS_24360 43734 44465 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_24360 44477 45379 gene locus_tag LOCUS_24370 44477 45379 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_24370 45868 45488 gene locus_tag LOCUS_24380 45868 45488 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_24380 46323 45940 gene locus_tag LOCUS_24390 46323 45940 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681772.1 protein_id gnl|my_center|LOCUS_24390 46544 46320 gene locus_tag LOCUS_24400 46544 46320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 <47473 46680 gene locus_tag LOCUS_24410 <47473 46680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000954677.1:phytanoyl-CoA dioxygenase family protein >Feature sequence037 1407 652 gene locus_tag LOCUS_24420 1407 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2196 1423 gene locus_tag LOCUS_24430 2196 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 3819 2686 gene locus_tag LOCUS_24440 3819 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 6372 3868 gene locus_tag LOCUS_24450 6372 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 6461 7480 gene locus_tag LOCUS_24460 6461 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 10252 7484 gene locus_tag LOCUS_24470 10252 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 11471 10359 gene locus_tag LOCUS_24480 11471 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 13643 11487 gene locus_tag LOCUS_24490 13643 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 16931 13725 gene locus_tag LOCUS_24500 16931 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 20787 17317 gene locus_tag LOCUS_24510 20787 17317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 20927 23773 gene locus_tag LOCUS_24520 20927 23773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 23813 25069 gene locus_tag LOCUS_24530 23813 25069 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258810.1 protein_id gnl|my_center|LOCUS_24530 25091 26071 gene locus_tag LOCUS_24540 25091 26071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842007.1 protein_id gnl|my_center|LOCUS_24540 26274 27545 gene locus_tag LOCUS_24550 26274 27545 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922300.1 protein_id gnl|my_center|LOCUS_24550 27548 30013 gene locus_tag LOCUS_24560 27548 30013 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922964.1 protein_id gnl|my_center|LOCUS_24560 30328 31104 gene locus_tag LOCUS_24570 30328 31104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 31120 34182 gene locus_tag LOCUS_24580 31120 34182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 34204 36543 gene locus_tag LOCUS_24590 34204 36543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 36562 37545 gene locus_tag LOCUS_24600 36562 37545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 37772 39751 gene locus_tag LOCUS_24610 37772 39751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 39772 41757 gene locus_tag LOCUS_24620 39772 41757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 42267 42058 gene locus_tag LOCUS_24630 42267 42058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 42169 44241 gene locus_tag LOCUS_24640 42169 44241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 44368 46788 gene locus_tag LOCUS_24650 44368 46788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence038 2424 994 gene locus_tag LOCUS_24660 2424 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 4387 2441 gene locus_tag LOCUS_24670 4387 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 5930 4458 gene locus_tag LOCUS_24680 5930 4458 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_24680 7294 5945 gene locus_tag LOCUS_24690 7294 5945 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_24690 9295 7307 gene locus_tag LOCUS_24700 9295 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 10385 9396 gene locus_tag LOCUS_24710 10385 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 12659 10401 gene locus_tag LOCUS_24720 12659 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 15727 12674 gene locus_tag LOCUS_24730 15727 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 16450 15740 gene locus_tag LOCUS_24740 16450 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 16944 16543 gene locus_tag LOCUS_24750 16944 16543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 19026 17263 gene locus_tag LOCUS_24760 19026 17263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 20178 19111 gene locus_tag LOCUS_24770 20178 19111 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_24770 21166 20273 gene locus_tag LOCUS_24780 21166 20273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 22315 21170 gene locus_tag LOCUS_24790 gene dgoD 22315 21170 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_24790 23712 22312 gene locus_tag LOCUS_24800 23712 22312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 23879 25192 gene locus_tag LOCUS_24810 23879 25192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 25288 26415 gene locus_tag LOCUS_24820 25288 26415 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530831.1 protein_id gnl|my_center|LOCUS_24820 26573 27241 gene locus_tag LOCUS_24830 26573 27241 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_24830 27238 30234 gene locus_tag LOCUS_24840 27238 30234 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_24840 30227 31627 gene locus_tag LOCUS_24850 gene nrfD 30227 31627 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_24850 31640 32173 gene locus_tag LOCUS_24860 31640 32173 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_24860 32157 32789 gene locus_tag LOCUS_24870 32157 32789 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256521.1 protein_id gnl|my_center|LOCUS_24870 32796 33986 gene locus_tag LOCUS_24880 32796 33986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_24880 33988 34365 gene locus_tag LOCUS_24890 33988 34365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 34369 35172 gene locus_tag LOCUS_24900 34369 35172 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_24900 35220 36170 gene locus_tag LOCUS_24910 gene coxB 35220 36170 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_24910 36177 37808 gene locus_tag LOCUS_24920 gene ctaD 36177 37808 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258008.1 protein_id gnl|my_center|LOCUS_24920 37808 38479 gene locus_tag LOCUS_24930 37808 38479 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_24930 38479 38796 gene locus_tag LOCUS_24940 38479 38796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 40779 38866 gene locus_tag LOCUS_24950 40779 38866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 41907 40912 gene locus_tag LOCUS_24960 41907 40912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 43163 42027 gene locus_tag LOCUS_24970 43163 42027 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_24970 44573 43185 gene locus_tag LOCUS_24980 44573 43185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 44858 45640 gene locus_tag LOCUS_24990 44858 45640 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235568.1 protein_id gnl|my_center|LOCUS_24990 46349 45657 gene locus_tag LOCUS_25000 46349 45657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence039 888 64 gene locus_tag LOCUS_25010 888 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 1488 907 gene locus_tag LOCUS_25020 1488 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 1806 1504 gene locus_tag LOCUS_25030 1806 1504 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_25030 3238 1784 gene locus_tag LOCUS_25040 3238 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 3712 3359 gene locus_tag LOCUS_25050 3712 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 4666 3779 gene locus_tag LOCUS_25060 4666 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 5298 4900 gene locus_tag LOCUS_25070 5298 4900 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_25070 5546 5295 gene locus_tag LOCUS_25080 5546 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 6269 5595 gene locus_tag LOCUS_25090 6269 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 7108 6302 gene locus_tag LOCUS_25100 7108 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 7269 9551 gene locus_tag LOCUS_25110 7269 9551 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_25110 10305 9538 gene locus_tag LOCUS_25120 gene gctB 10305 9538 CDS product glutaconate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 protein_id gnl|my_center|LOCUS_25120 11305 10298 gene locus_tag LOCUS_25130 11305 10298 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_25130 12086 11316 gene locus_tag LOCUS_25140 gene kduD 12086 11316 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_25140 15007 12101 gene locus_tag LOCUS_25150 15007 12101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 16012 15401 gene locus_tag LOCUS_25160 gene clpP 16012 15401 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631995.1 protein_id gnl|my_center|LOCUS_25160 19126 16124 gene locus_tag LOCUS_25170 19126 16124 CDS product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767535.1 protein_id gnl|my_center|LOCUS_25170 20400 19144 gene locus_tag LOCUS_25180 20400 19144 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494076.1 protein_id gnl|my_center|LOCUS_25180 21218 20397 gene locus_tag LOCUS_25190 21218 20397 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_25190 22710 21322 gene locus_tag LOCUS_25200 22710 21322 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_25200 22810 23160 gene locus_tag LOCUS_25210 22810 23160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 23316 23738 gene locus_tag LOCUS_25220 23316 23738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 23735 24004 gene locus_tag LOCUS_25230 23735 24004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 24803 24126 gene locus_tag LOCUS_25240 24803 24126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 25257 24796 gene locus_tag LOCUS_25250 25257 24796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 27266 25254 gene locus_tag LOCUS_25260 27266 25254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 27951 27517 gene locus_tag LOCUS_25270 27951 27517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 28435 27848 gene locus_tag LOCUS_25280 28435 27848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 29943 28612 gene locus_tag LOCUS_25290 29943 28612 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921564.1 protein_id gnl|my_center|LOCUS_25290 31382 29925 gene locus_tag LOCUS_25300 31382 29925 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644028.1 protein_id gnl|my_center|LOCUS_25300 32055 31393 gene locus_tag LOCUS_25310 32055 31393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 32945 32169 gene locus_tag LOCUS_25320 32945 32169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 34399 32945 gene locus_tag LOCUS_25330 34399 32945 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_25330 34806 34402 gene locus_tag LOCUS_25340 34806 34402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 36317 34809 gene locus_tag LOCUS_25350 36317 34809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 36685 36323 gene locus_tag LOCUS_25360 36685 36323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 36938 36699 gene locus_tag LOCUS_25370 36938 36699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 38317 36941 gene locus_tag LOCUS_25380 38317 36941 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_25380 39604 38342 gene locus_tag LOCUS_25390 39604 38342 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_25390 39764 40612 gene locus_tag LOCUS_25400 39764 40612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 41463 40609 gene locus_tag LOCUS_25410 41463 40609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 42764 41481 gene locus_tag LOCUS_25420 42764 41481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 <44246 42777 gene locus_tag LOCUS_25430 <44246 42777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118507.1:arylsulfatase >Feature sequence040 960 1784 gene locus_tag LOCUS_25440 960 1784 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_25440 2670 1822 gene locus_tag LOCUS_25450 2670 1822 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878779.1 protein_id gnl|my_center|LOCUS_25450 3916 2684 gene locus_tag LOCUS_25460 3916 2684 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_25460 3986 5233 gene locus_tag LOCUS_25470 3986 5233 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_25470 6449 5241 gene locus_tag LOCUS_25480 gene hemL 6449 5241 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_25480 6619 7656 gene locus_tag LOCUS_25490 6619 7656 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096411.1 protein_id gnl|my_center|LOCUS_25490 7713 7955 gene locus_tag LOCUS_25500 7713 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 7952 8170 gene locus_tag LOCUS_25510 7952 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 8179 10644 gene locus_tag LOCUS_25520 8179 10644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 11919 10738 gene locus_tag LOCUS_25530 11919 10738 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947551.1 protein_id gnl|my_center|LOCUS_25530 12337 12657 gene locus_tag LOCUS_25540 12337 12657 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268830.1 protein_id gnl|my_center|LOCUS_25540 12759 13055 gene locus_tag LOCUS_25550 12759 13055 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404129.1 protein_id gnl|my_center|LOCUS_25550 13309 13385 gene locus_tag LOCUS_t00310 13309 13385 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14423 13449 gene locus_tag LOCUS_25560 gene obgE 14423 13449 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933866.1 protein_id gnl|my_center|LOCUS_25560 15193 14435 gene locus_tag LOCUS_25570 15193 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 16054 15197 gene locus_tag LOCUS_25580 16054 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 16503 16051 gene locus_tag LOCUS_25590 16503 16051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 22719 16516 gene locus_tag LOCUS_25600 22719 16516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 22931 24205 gene locus_tag LOCUS_25610 22931 24205 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404815.1 protein_id gnl|my_center|LOCUS_25610 24208 25278 gene locus_tag LOCUS_25620 24208 25278 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057410.1 protein_id gnl|my_center|LOCUS_25620 25306 26757 gene locus_tag LOCUS_25630 25306 26757 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_25630 26889 29696 gene locus_tag LOCUS_25640 26889 29696 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942970.1 protein_id gnl|my_center|LOCUS_25640 29788 30765 gene locus_tag LOCUS_25650 29788 30765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 31909 30770 gene locus_tag LOCUS_25660 31909 30770 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528042.1 protein_id gnl|my_center|LOCUS_25660 33520 31979 gene locus_tag LOCUS_25670 33520 31979 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_25670 33709 35481 gene locus_tag LOCUS_25680 33709 35481 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_25680 35770 39126 gene locus_tag LOCUS_25690 35770 39126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 39178 41352 gene locus_tag LOCUS_25700 39178 41352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 41368 42423 gene locus_tag LOCUS_25710 gene porV 41368 42423 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence041 <1 658 gene locus_tag LOCUS_25720 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966548.1:leucine-rich repeat domain-containing protein 783 1871 gene locus_tag LOCUS_25730 783 1871 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525885.1 protein_id gnl|my_center|LOCUS_25730 1879 2748 gene locus_tag LOCUS_25740 1879 2748 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_25740 3980 2745 gene locus_tag LOCUS_25750 3980 2745 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480116.1 protein_id gnl|my_center|LOCUS_25750 4953 4090 gene locus_tag LOCUS_25760 4953 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 6224 4992 gene locus_tag LOCUS_25770 6224 4992 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228554.1 protein_id gnl|my_center|LOCUS_25770 6356 7330 gene locus_tag LOCUS_25780 gene comC 6356 7330 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876829.1 protein_id gnl|my_center|LOCUS_25780 7664 8692 gene locus_tag LOCUS_25790 gene dapA 7664 8692 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_25790 8714 9520 gene locus_tag LOCUS_25800 gene dapB 8714 9520 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_25800 9630 11537 gene locus_tag LOCUS_25810 9630 11537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 12144 11575 gene locus_tag LOCUS_25820 12144 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 13369 12215 gene locus_tag LOCUS_25830 gene dnaJ 13369 12215 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405069.1 protein_id gnl|my_center|LOCUS_25830 14096 13419 gene locus_tag LOCUS_25840 gene grpE 14096 13419 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182211.1 protein_id gnl|my_center|LOCUS_25840 15140 14115 gene locus_tag LOCUS_25850 gene hrcA 15140 14115 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933152.1 protein_id gnl|my_center|LOCUS_25850 16917 15316 gene locus_tag LOCUS_25860 16917 15316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 17272 18690 gene locus_tag LOCUS_25870 gene glnA 17272 18690 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_25870 19573 18785 gene locus_tag LOCUS_25880 19573 18785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 20099 19590 gene locus_tag LOCUS_25890 20099 19590 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_25890 20361 21104 gene locus_tag LOCUS_25900 20361 21104 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_25900 21086 21913 gene locus_tag LOCUS_25910 21086 21913 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_25910 21919 23073 gene locus_tag LOCUS_25920 21919 23073 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_25920 23088 24413 gene locus_tag LOCUS_25930 gene rseP 23088 24413 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_25930 24907 24551 gene locus_tag LOCUS_25940 24907 24551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 25138 25584 gene locus_tag LOCUS_25950 gene mraZ 25138 25584 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644614.1 protein_id gnl|my_center|LOCUS_25950 25662 26636 gene locus_tag LOCUS_25960 gene rsmH 25662 26636 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403329.1 protein_id gnl|my_center|LOCUS_25960 26633 26926 gene locus_tag LOCUS_25970 26633 26926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 26926 28980 gene locus_tag LOCUS_25980 26926 28980 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_25980 28984 30438 gene locus_tag LOCUS_25990 28984 30438 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_25990 30438 31814 gene locus_tag LOCUS_26000 30438 31814 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_26000 31858 33063 gene locus_tag LOCUS_26010 gene ftsW 31858 33063 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_26010 33075 34436 gene locus_tag LOCUS_26020 gene murC 33075 34436 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403337.1 protein_id gnl|my_center|LOCUS_26020 34441 35358 gene locus_tag LOCUS_26030 gene murB 34441 35358 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943692.1 protein_id gnl|my_center|LOCUS_26030 35381 36199 gene locus_tag LOCUS_26040 35381 36199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 36225 37445 gene locus_tag LOCUS_26050 gene ftsA 36225 37445 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_26050 37527 38744 gene locus_tag LOCUS_26060 gene ftsZ 37527 38744 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_26060 38754 39674 gene locus_tag LOCUS_26070 38754 39674 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 protein_id gnl|my_center|LOCUS_26070 39741 41282 gene locus_tag LOCUS_26080 gene betC 39741 41282 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776263.1 protein_id gnl|my_center|LOCUS_26080 41316 41720 gene locus_tag LOCUS_26090 41316 41720 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815713.1 protein_id gnl|my_center|LOCUS_26090 42416 41709 gene locus_tag LOCUS_26100 42416 41709 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403732.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence042 1063 626 gene locus_tag LOCUS_26110 1063 626 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_26110 1818 1561 gene locus_tag LOCUS_26120 1818 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 1924 4458 gene locus_tag LOCUS_26130 1924 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 5351 4455 gene locus_tag LOCUS_26140 gene glaH 5351 4455 CDS product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993092.1 protein_id gnl|my_center|LOCUS_26140 6768 5362 gene locus_tag LOCUS_26150 6768 5362 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_26150 7176 8252 gene locus_tag LOCUS_26160 gene asd 7176 8252 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963889.1 protein_id gnl|my_center|LOCUS_26160 9223 8255 gene locus_tag LOCUS_26170 9223 8255 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_26170 9323 10795 gene locus_tag LOCUS_26180 9323 10795 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_26180 11605 10811 gene locus_tag LOCUS_26190 gene mreC 11605 10811 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_26190 12627 11608 gene locus_tag LOCUS_26200 12627 11608 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_26200 12917 13804 gene locus_tag LOCUS_26210 gene galU 12917 13804 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937189.1 protein_id gnl|my_center|LOCUS_26210 14278 13799 gene locus_tag LOCUS_26220 14278 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 14444 14289 gene locus_tag LOCUS_26230 14444 14289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 15505 14459 gene locus_tag LOCUS_26240 15505 14459 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_26240 16380 15574 gene locus_tag LOCUS_26250 16380 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 17961 16465 gene locus_tag LOCUS_26260 gene cobA 17961 16465 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_26260 20055 17971 gene locus_tag LOCUS_26270 20055 17971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 20984 20052 gene locus_tag LOCUS_26280 gene hemC 20984 20052 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392763.1 protein_id gnl|my_center|LOCUS_26280 22273 20981 gene locus_tag LOCUS_26290 gene hemA 22273 20981 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_26290 22887 22258 gene locus_tag LOCUS_26300 22887 22258 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_26300 23715 22891 gene locus_tag LOCUS_26310 gene ccsB 23715 22891 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944563.1 protein_id gnl|my_center|LOCUS_26310 24969 23791 gene locus_tag LOCUS_26320 gene anmK 24969 23791 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_26320 26053 24971 gene locus_tag LOCUS_26330 26053 24971 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840140.1 protein_id gnl|my_center|LOCUS_26330 27129 26053 gene locus_tag LOCUS_26340 27129 26053 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_26340 27283 28662 gene locus_tag LOCUS_26350 gene merA 27283 28662 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193219.1 protein_id gnl|my_center|LOCUS_26350 29987 28647 gene locus_tag LOCUS_26360 29987 28647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 31150 29999 gene locus_tag LOCUS_26370 gene dgoD 31150 29999 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731095.1 protein_id gnl|my_center|LOCUS_26370 32270 31152 gene locus_tag LOCUS_26380 32270 31152 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_26380 34703 32301 gene locus_tag LOCUS_26390 34703 32301 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_26390 35866 34712 gene locus_tag LOCUS_26400 35866 34712 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_26400 36903 35863 gene locus_tag LOCUS_26410 36903 35863 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 protein_id gnl|my_center|LOCUS_26410 37467 36913 gene locus_tag LOCUS_26420 37467 36913 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_26420 38336 37479 gene locus_tag LOCUS_26430 38336 37479 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_26430 39589 38384 gene locus_tag LOCUS_26440 39589 38384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 41406 39595 gene locus_tag LOCUS_26450 41406 39595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence043 159 1181 gene locus_tag LOCUS_26460 159 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1990 1205 gene locus_tag LOCUS_26470 1990 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 2453 2046 gene locus_tag LOCUS_26480 2453 2046 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888313.1 protein_id gnl|my_center|LOCUS_26480 2992 2588 gene locus_tag LOCUS_26490 2992 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 4088 3225 gene locus_tag LOCUS_26500 4088 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 6310 4241 gene locus_tag LOCUS_26510 6310 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 7376 6333 gene locus_tag LOCUS_26520 7376 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 8106 7693 gene locus_tag LOCUS_26530 8106 7693 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268734.1 protein_id gnl|my_center|LOCUS_26530 8331 8146 gene locus_tag LOCUS_26540 8331 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 10506 8437 gene locus_tag LOCUS_26550 10506 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 11674 10655 gene locus_tag LOCUS_26560 gene trpD 11674 10655 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911946.1 protein_id gnl|my_center|LOCUS_26560 12575 11787 gene locus_tag LOCUS_26570 12575 11787 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909235.1 protein_id gnl|my_center|LOCUS_26570 13646 12654 gene locus_tag LOCUS_26580 gene mgrA 13646 12654 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_26580 14409 13660 gene locus_tag LOCUS_26590 14409 13660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 14826 14518 gene locus_tag LOCUS_26600 14826 14518 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_26600 16340 14982 gene locus_tag LOCUS_26610 16340 14982 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_26610 17406 16645 gene locus_tag LOCUS_26620 17406 16645 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479988.1 protein_id gnl|my_center|LOCUS_26620 18325 17435 gene locus_tag LOCUS_26630 18325 17435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 19110 18487 gene locus_tag LOCUS_26640 19110 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 19561 19115 gene locus_tag LOCUS_26650 19561 19115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 20149 19655 gene locus_tag LOCUS_26660 20149 19655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 21010 20195 gene locus_tag LOCUS_26670 21010 20195 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279230.1 protein_id gnl|my_center|LOCUS_26670 22336 21023 gene locus_tag LOCUS_26680 22336 21023 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530194.1 protein_id gnl|my_center|LOCUS_26680 23241 22381 gene locus_tag LOCUS_26690 gene thpD 23241 22381 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063968.1 protein_id gnl|my_center|LOCUS_26690 24762 23338 gene locus_tag LOCUS_26700 24762 23338 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 protein_id gnl|my_center|LOCUS_26700 26052 24784 gene locus_tag LOCUS_26710 26052 24784 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_26710 26548 26090 gene locus_tag LOCUS_26720 26548 26090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 28349 26754 gene locus_tag LOCUS_26730 28349 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 30239 28440 gene locus_tag LOCUS_26740 30239 28440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 31197 30253 gene locus_tag LOCUS_26750 31197 30253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 32127 31225 gene locus_tag LOCUS_26760 32127 31225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 32648 32316 gene locus_tag LOCUS_26770 32648 32316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 34349 32727 gene locus_tag LOCUS_26780 34349 32727 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_26780 35472 34558 gene locus_tag LOCUS_26790 35472 34558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 36341 35547 gene locus_tag LOCUS_26800 36341 35547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 37476 36349 gene locus_tag LOCUS_26810 37476 36349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 38057 37509 gene locus_tag LOCUS_26820 38057 37509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 <40601 38354 gene locus_tag LOCUS_26830 <40601 38354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009195517.1:ABC transporter permease >Feature sequence044 471 3971 gene locus_tag LOCUS_26840 471 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 3990 5057 gene locus_tag LOCUS_26850 3990 5057 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242957.1 protein_id gnl|my_center|LOCUS_26850 5054 8119 gene locus_tag LOCUS_26860 5054 8119 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766163.1 protein_id gnl|my_center|LOCUS_26860 8116 12843 gene locus_tag LOCUS_26870 8116 12843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 12914 13543 gene locus_tag LOCUS_26880 12914 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 13668 14330 gene locus_tag LOCUS_26890 13668 14330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 15222 14602 gene locus_tag LOCUS_26900 15222 14602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 15451 16542 gene locus_tag LOCUS_26910 gene gcvT 15451 16542 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_26910 19059 16621 gene locus_tag LOCUS_26920 gene leuS 19059 16621 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_26920 20368 19073 gene locus_tag LOCUS_26930 gene asnS 20368 19073 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 protein_id gnl|my_center|LOCUS_26930 22579 20462 gene locus_tag LOCUS_26940 gene pnp 22579 20462 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_26940 22941 22672 gene locus_tag LOCUS_26950 gene rpsO 22941 22672 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354983.1 protein_id gnl|my_center|LOCUS_26950 23882 22932 gene locus_tag LOCUS_26960 23882 22932 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404517.1 protein_id gnl|my_center|LOCUS_26960 24760 23885 gene locus_tag LOCUS_26970 gene truB 24760 23885 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703596.1 protein_id gnl|my_center|LOCUS_26970 25102 24761 gene locus_tag LOCUS_26980 gene rbfA 25102 24761 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216910.1 protein_id gnl|my_center|LOCUS_26980 25385 25104 gene locus_tag LOCUS_26990 25385 25104 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220950.1 protein_id gnl|my_center|LOCUS_26990 27829 25385 gene locus_tag LOCUS_27000 27829 25385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 29176 27836 gene locus_tag LOCUS_27010 gene nusA 29176 27836 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527896.1 protein_id gnl|my_center|LOCUS_27010 29638 29198 gene locus_tag LOCUS_27020 gene rimP 29638 29198 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_27020 30201 29824 gene locus_tag LOCUS_27030 30201 29824 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831050.1 protein_id gnl|my_center|LOCUS_27030 31511 30207 gene locus_tag LOCUS_27040 gene der 31511 30207 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_27040 32939 31515 gene locus_tag LOCUS_27050 32939 31515 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_27050 33144 33836 gene locus_tag LOCUS_27060 33144 33836 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_27060 34150 33854 gene locus_tag LOCUS_27070 34150 33854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 34423 34172 gene locus_tag LOCUS_27080 34423 34172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 35047 34460 gene locus_tag LOCUS_27090 gene nadD 35047 34460 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_27090 35814 35059 gene locus_tag LOCUS_27100 35814 35059 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337247.1 protein_id gnl|my_center|LOCUS_27100 36104 37018 gene locus_tag LOCUS_27110 gene rbsK 36104 37018 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_27110 37112 37288 gene locus_tag LOCUS_27120 37112 37288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 37337 37537 gene locus_tag LOCUS_27130 37337 37537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 <39043 37962 gene locus_tag LOCUS_27140 <39043 37962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226876.1:glycosyl hydrolase family 18 protein >Feature sequence045 135 2003 gene locus_tag LOCUS_27150 gene iolD 135 2003 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_27150 2101 4635 gene locus_tag LOCUS_27160 2101 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 4649 6028 gene locus_tag LOCUS_27170 4649 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 7001 6117 gene locus_tag LOCUS_27180 7001 6117 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390908.1 protein_id gnl|my_center|LOCUS_27180 7557 6985 gene locus_tag LOCUS_27190 7557 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 7615 9123 gene locus_tag LOCUS_27200 7615 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 9196 10143 gene locus_tag LOCUS_27210 9196 10143 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932827.1 protein_id gnl|my_center|LOCUS_27210 10484 11704 gene locus_tag LOCUS_27220 10484 11704 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941480.1 protein_id gnl|my_center|LOCUS_27220 11739 13193 gene locus_tag LOCUS_27230 11739 13193 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064606.1 protein_id gnl|my_center|LOCUS_27230 13398 14048 gene locus_tag LOCUS_27240 13398 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 14063 16495 gene locus_tag LOCUS_27250 14063 16495 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402856.1 protein_id gnl|my_center|LOCUS_27250 16501 17292 gene locus_tag LOCUS_27260 16501 17292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 17292 18794 gene locus_tag LOCUS_27270 17292 18794 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973724.1 protein_id gnl|my_center|LOCUS_27270 20151 18787 gene locus_tag LOCUS_27280 20151 18787 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_27280 20274 20882 gene locus_tag LOCUS_27290 20274 20882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 20901 21605 gene locus_tag LOCUS_27300 20901 21605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 21686 23149 gene locus_tag LOCUS_27310 21686 23149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 23233 24195 gene locus_tag LOCUS_27320 23233 24195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_27320 24208 24990 gene locus_tag LOCUS_27330 24208 24990 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_27330 25022 26167 gene locus_tag LOCUS_27340 25022 26167 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_27340 26170 28092 gene locus_tag LOCUS_27350 26170 28092 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_27350 28106 29476 gene locus_tag LOCUS_27360 28106 29476 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_27360 29454 29927 gene locus_tag LOCUS_27370 29454 29927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 29930 30124 gene locus_tag LOCUS_27380 29930 30124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 30436 31215 gene locus_tag LOCUS_27390 30436 31215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 31196 31948 gene locus_tag LOCUS_27400 31196 31948 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860382.1 protein_id gnl|my_center|LOCUS_27400 32199 32543 gene locus_tag LOCUS_27410 32199 32543 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526838.1 protein_id gnl|my_center|LOCUS_27410 32554 33378 gene locus_tag LOCUS_27420 32554 33378 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783346.1 protein_id gnl|my_center|LOCUS_27420 33383 34228 gene locus_tag LOCUS_27430 33383 34228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 34209 34691 gene locus_tag LOCUS_27440 34209 34691 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978052.1 protein_id gnl|my_center|LOCUS_27440 34706 35242 gene locus_tag LOCUS_27450 gene dcd 34706 35242 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_27450 35235 35783 gene locus_tag LOCUS_27460 35235 35783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 35780 36223 gene locus_tag LOCUS_27470 35780 36223 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444459.1 protein_id gnl|my_center|LOCUS_27470 36337 36687 gene locus_tag LOCUS_27480 36337 36687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 36684 36959 gene locus_tag LOCUS_27490 36684 36959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 37023 37766 gene locus_tag LOCUS_27500 37023 37766 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530431.1 protein_id gnl|my_center|LOCUS_27500 >Feature sequence046 1855 884 gene locus_tag LOCUS_27510 1855 884 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256068.1 protein_id gnl|my_center|LOCUS_27510 2604 1867 gene locus_tag LOCUS_27520 2604 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 3853 2651 gene locus_tag LOCUS_27530 3853 2651 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_27530 4893 3859 gene locus_tag LOCUS_27540 gene bdhA 4893 3859 CDS product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645822.1 protein_id gnl|my_center|LOCUS_27540 6450 4918 gene locus_tag LOCUS_27550 6450 4918 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_27550 6612 8252 gene locus_tag LOCUS_27560 6612 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 8404 8712 gene locus_tag LOCUS_27570 8404 8712 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_27570 8702 9043 gene locus_tag LOCUS_27580 8702 9043 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_27580 9040 10107 gene locus_tag LOCUS_27590 9040 10107 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966124.1 protein_id gnl|my_center|LOCUS_27590 10120 11223 gene locus_tag LOCUS_27600 10120 11223 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_27600 11238 11960 gene locus_tag LOCUS_27610 11238 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 13061 12027 gene locus_tag LOCUS_27620 13061 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 14401 13091 gene locus_tag LOCUS_27630 14401 13091 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529494.1 protein_id gnl|my_center|LOCUS_27630 14423 14581 gene locus_tag LOCUS_27640 14423 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 14635 16290 gene locus_tag LOCUS_27650 14635 16290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 16324 17115 gene locus_tag LOCUS_27660 16324 17115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 17130 18164 gene locus_tag LOCUS_27670 17130 18164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 18176 19267 gene locus_tag LOCUS_27680 18176 19267 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_27680 19339 20298 gene locus_tag LOCUS_27690 19339 20298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 20299 21357 gene locus_tag LOCUS_27700 20299 21357 CDS product threonine aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967204.1 protein_id gnl|my_center|LOCUS_27700 21373 22182 gene locus_tag LOCUS_27710 21373 22182 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_27710 22199 23269 gene locus_tag LOCUS_27720 22199 23269 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_27720 23266 24615 gene locus_tag LOCUS_27730 23266 24615 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_27730 25569 24625 gene locus_tag LOCUS_27740 25569 24625 CDS product bifunctional glyoxylate/hydroxypyruvate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886621.1 protein_id gnl|my_center|LOCUS_27740 25733 26590 gene locus_tag LOCUS_27750 25733 26590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 26612 26920 gene locus_tag LOCUS_27760 26612 26920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 26941 27603 gene locus_tag LOCUS_27770 26941 27603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 27614 27931 gene locus_tag LOCUS_27780 27614 27931 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113105.1 protein_id gnl|my_center|LOCUS_27780 27976 28512 gene locus_tag LOCUS_27790 27976 28512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 29560 28586 gene locus_tag LOCUS_27800 29560 28586 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_27800 30173 29673 gene locus_tag LOCUS_27810 30173 29673 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804308.1 protein_id gnl|my_center|LOCUS_27810 30644 30180 gene locus_tag LOCUS_27820 30644 30180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 31363 30641 gene locus_tag LOCUS_27830 31363 30641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 31727 31434 gene locus_tag LOCUS_27840 31727 31434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 31760 32803 gene locus_tag LOCUS_27850 31760 32803 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_27850 32830 34161 gene locus_tag LOCUS_27860 32830 34161 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_27860 35313 34264 gene locus_tag LOCUS_27870 gene nadA 35313 34264 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404647.1 protein_id gnl|my_center|LOCUS_27870 35469 36533 gene locus_tag LOCUS_27880 35469 36533 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_27880 36661 37158 gene locus_tag LOCUS_27890 36661 37158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence047 1942 791 gene locus_tag LOCUS_27900 1942 791 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_27900 2708 1965 gene locus_tag LOCUS_27910 2708 1965 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 protein_id gnl|my_center|LOCUS_27910 2940 3719 gene locus_tag LOCUS_27920 2940 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 3738 4730 gene locus_tag LOCUS_27930 3738 4730 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228993.1 protein_id gnl|my_center|LOCUS_27930 5429 4731 gene locus_tag LOCUS_27940 5429 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 6736 5426 gene locus_tag LOCUS_27950 6736 5426 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_27950 6981 7187 gene locus_tag LOCUS_27960 6981 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 7201 8946 gene locus_tag LOCUS_27970 7201 8946 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_27970 8933 10780 gene locus_tag LOCUS_27980 8933 10780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583012.1 protein_id gnl|my_center|LOCUS_27980 10793 11524 gene locus_tag LOCUS_27990 10793 11524 CDS product chlorinating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525107.1 protein_id gnl|my_center|LOCUS_27990 11521 12111 gene locus_tag LOCUS_28000 11521 12111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 12463 12747 gene locus_tag LOCUS_28010 12463 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 13647 14198 gene locus_tag LOCUS_28020 13647 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 16325 14148 gene locus_tag LOCUS_28030 16325 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 17950 16322 gene locus_tag LOCUS_28040 17950 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 18211 18357 gene locus_tag LOCUS_28050 18211 18357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 18413 19420 gene locus_tag LOCUS_28060 18413 19420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 19424 20755 gene locus_tag LOCUS_28070 19424 20755 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_28070 20766 23063 gene locus_tag LOCUS_28080 20766 23063 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972694.1 protein_id gnl|my_center|LOCUS_28080 23098 24273 gene locus_tag LOCUS_28090 23098 24273 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_28090 24276 25982 gene locus_tag LOCUS_28100 24276 25982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 26010 27305 gene locus_tag LOCUS_28110 26010 27305 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_28110 27335 28501 gene locus_tag LOCUS_28120 27335 28501 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_28120 28498 29052 gene locus_tag LOCUS_28130 28498 29052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 29097 29969 gene locus_tag LOCUS_28140 29097 29969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 30001 31284 gene locus_tag LOCUS_28150 30001 31284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 31305 31511 gene locus_tag LOCUS_28160 31305 31511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 31644 32585 gene locus_tag LOCUS_28170 31644 32585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 33236 32610 gene locus_tag LOCUS_28180 33236 32610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459261.1 protein_id gnl|my_center|LOCUS_28180 33584 35152 gene locus_tag LOCUS_28190 33584 35152 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922251.1 protein_id gnl|my_center|LOCUS_28190 35185 36501 gene locus_tag LOCUS_28200 35185 36501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence048 244 1692 gene locus_tag LOCUS_28210 244 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 3052 1757 gene locus_tag LOCUS_28220 3052 1757 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_28220 4978 3068 gene locus_tag LOCUS_28230 4978 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 5694 5065 gene locus_tag LOCUS_28240 gene tmk 5694 5065 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814160.1 protein_id gnl|my_center|LOCUS_28240 6372 5779 gene locus_tag LOCUS_28250 6372 5779 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_28250 7311 6688 gene locus_tag LOCUS_28260 7311 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 7562 8422 gene locus_tag LOCUS_28270 7562 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 8829 8479 gene locus_tag LOCUS_28280 8829 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 9276 9779 gene locus_tag LOCUS_28290 9276 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 10602 9973 gene locus_tag LOCUS_28300 10602 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 12111 10765 gene locus_tag LOCUS_28310 gene mnmE 12111 10765 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016067.1 protein_id gnl|my_center|LOCUS_28310 13828 12125 gene locus_tag LOCUS_28320 gene yidC 13828 12125 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_28320 14211 13882 gene locus_tag LOCUS_28330 14211 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 14885 16267 gene locus_tag LOCUS_28340 gene dnaA 14885 16267 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931696.1 protein_id gnl|my_center|LOCUS_28340 16881 17498 gene locus_tag LOCUS_28350 16881 17498 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_28350 17530 18888 gene locus_tag LOCUS_28360 17530 18888 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072542480.1 protein_id gnl|my_center|LOCUS_28360 19979 18891 gene locus_tag LOCUS_28370 19979 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 20983 19976 gene locus_tag LOCUS_28380 20983 19976 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_28380 21985 21014 gene locus_tag LOCUS_28390 21985 21014 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_28390 23269 21998 gene locus_tag LOCUS_28400 23269 21998 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_28400 23575 23285 gene locus_tag LOCUS_28410 23575 23285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 25004 23592 gene locus_tag LOCUS_28420 25004 23592 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_28420 25477 25019 gene locus_tag LOCUS_28430 25477 25019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 26282 25503 gene locus_tag LOCUS_28440 26282 25503 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922035.1 protein_id gnl|my_center|LOCUS_28440 27375 26293 gene locus_tag LOCUS_28450 gene eltD 27375 26293 CDS product erythritol/L-threitol dehyrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728938.1 protein_id gnl|my_center|LOCUS_28450 27482 28777 gene locus_tag LOCUS_28460 27482 28777 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_28460 31431 28852 gene locus_tag LOCUS_28470 gene gyrA 31431 28852 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_28470 33381 31450 gene locus_tag LOCUS_28480 gene gyrB 33381 31450 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933913.1 protein_id gnl|my_center|LOCUS_28480 33836 33471 gene locus_tag LOCUS_28490 33836 33471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 34927 33842 gene locus_tag LOCUS_28500 gene recF 34927 33842 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 protein_id gnl|my_center|LOCUS_28500 36102 34927 gene locus_tag LOCUS_28510 gene dnaN 36102 34927 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402793.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence049 123 836 gene locus_tag LOCUS_28520 123 836 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617263.1 protein_id gnl|my_center|LOCUS_28520 1162 833 gene locus_tag LOCUS_28530 1162 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 1530 4016 gene locus_tag LOCUS_28540 1530 4016 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_28540 4120 5478 gene locus_tag LOCUS_28550 4120 5478 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_28550 5510 6187 gene locus_tag LOCUS_28560 5510 6187 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_28560 6200 8635 gene locus_tag LOCUS_28570 6200 8635 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_28570 8663 8920 gene locus_tag LOCUS_28580 8663 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 8931 9605 gene locus_tag LOCUS_28590 8931 9605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_28590 9742 10254 gene locus_tag LOCUS_28600 9742 10254 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194622.1 protein_id gnl|my_center|LOCUS_28600 10416 12797 gene locus_tag LOCUS_28610 10416 12797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_28610 12820 15222 gene locus_tag LOCUS_28620 12820 15222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_28620 17017 15299 gene locus_tag LOCUS_28630 17017 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 18633 17074 gene locus_tag LOCUS_28640 18633 17074 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085749.1 protein_id gnl|my_center|LOCUS_28640 18883 19968 gene locus_tag LOCUS_28650 18883 19968 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653868.1 protein_id gnl|my_center|LOCUS_28650 19958 21007 gene locus_tag LOCUS_28660 19958 21007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 21019 22509 gene locus_tag LOCUS_28670 21019 22509 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427770.1 protein_id gnl|my_center|LOCUS_28670 22506 23288 gene locus_tag LOCUS_28680 22506 23288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 23393 24802 gene locus_tag LOCUS_28690 23393 24802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 24806 27028 gene locus_tag LOCUS_28700 24806 27028 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_28700 27037 28596 gene locus_tag LOCUS_28710 27037 28596 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120298.1 protein_id gnl|my_center|LOCUS_28710 28574 29788 gene locus_tag LOCUS_28720 28574 29788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 29785 30861 gene locus_tag LOCUS_28730 29785 30861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 30879 32282 gene locus_tag LOCUS_28740 30879 32282 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_28740 32297 33952 gene locus_tag LOCUS_28750 32297 33952 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_28750 34662 34297 gene locus_tag LOCUS_28760 34662 34297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 >Feature sequence050 1504 734 gene locus_tag LOCUS_28770 1504 734 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090177.1 protein_id gnl|my_center|LOCUS_28770 1984 1568 gene locus_tag LOCUS_28780 1984 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 3388 2078 gene locus_tag LOCUS_28790 gene sthA 3388 2078 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120816.1 protein_id gnl|my_center|LOCUS_28790 4200 3445 gene locus_tag LOCUS_28800 4200 3445 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_28800 5894 4215 gene locus_tag LOCUS_28810 gene ettA 5894 4215 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_28810 6603 5896 gene locus_tag LOCUS_28820 6603 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 7609 6629 gene locus_tag LOCUS_28830 7609 6629 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027021.1 protein_id gnl|my_center|LOCUS_28830 8489 7650 gene locus_tag LOCUS_28840 gene fabG 8489 7650 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_28840 11401 8486 gene locus_tag LOCUS_28850 11401 8486 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_28850 12019 11543 gene locus_tag LOCUS_28860 12019 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 12304 12047 gene locus_tag LOCUS_28870 12304 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 13501 12305 gene locus_tag LOCUS_28880 13501 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 14369 13602 gene locus_tag LOCUS_28890 14369 13602 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_28890 14608 15828 gene locus_tag LOCUS_28900 14608 15828 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_28900 15865 17106 gene locus_tag LOCUS_28910 15865 17106 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_28910 17123 17485 gene locus_tag LOCUS_28920 17123 17485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 18159 17482 gene locus_tag LOCUS_28930 18159 17482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 18118 18315 gene locus_tag LOCUS_28940 18118 18315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 18322 18459 gene locus_tag LOCUS_28950 18322 18459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 18651 20717 gene locus_tag LOCUS_28960 18651 20717 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582700.1 protein_id gnl|my_center|LOCUS_28960 22505 20733 gene locus_tag LOCUS_28970 22505 20733 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922210.1 protein_id gnl|my_center|LOCUS_28970 23428 22526 gene locus_tag LOCUS_28980 gene spo0J 23428 22526 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_28980 24182 23421 gene locus_tag LOCUS_28990 24182 23421 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_28990 24625 26829 gene locus_tag LOCUS_29000 24625 26829 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089686.1 protein_id gnl|my_center|LOCUS_29000 29572 26927 gene locus_tag LOCUS_29010 gene ppdK 29572 26927 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_29010 30917 29703 gene locus_tag LOCUS_29020 30917 29703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 30995 31068 gene locus_tag LOCUS_t00320 30995 31068 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 31285 32025 gene locus_tag LOCUS_29030 31285 32025 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403200.1 protein_id gnl|my_center|LOCUS_29030 32145 33089 gene locus_tag LOCUS_29040 gene cysM 32145 33089 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930733.1 protein_id gnl|my_center|LOCUS_29040 33092 33547 gene locus_tag LOCUS_29050 33092 33547 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106151.1 protein_id gnl|my_center|LOCUS_29050 33570 33854 gene locus_tag LOCUS_29060 33570 33854 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_29060 33874 34305 gene locus_tag LOCUS_29070 33874 34305 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259066.1 protein_id gnl|my_center|LOCUS_29070 >Feature sequence051 443 1408 gene locus_tag LOCUS_29080 443 1408 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_29080 1420 2178 gene locus_tag LOCUS_29090 1420 2178 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405187.1 protein_id gnl|my_center|LOCUS_29090 2175 3701 gene locus_tag LOCUS_29100 2175 3701 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035422.1 protein_id gnl|my_center|LOCUS_29100 3732 4427 gene locus_tag LOCUS_29110 3732 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 4574 4990 gene locus_tag LOCUS_29120 4574 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 5036 5386 gene locus_tag LOCUS_29130 5036 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 5668 5345 gene locus_tag LOCUS_29140 5668 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 6026 5652 gene locus_tag LOCUS_29150 6026 5652 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368791.1 protein_id gnl|my_center|LOCUS_29150 7204 6671 gene locus_tag LOCUS_29160 7204 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 8885 7836 gene locus_tag LOCUS_29170 8885 7836 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_29170 10429 8951 gene locus_tag LOCUS_29180 10429 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 11757 10498 gene locus_tag LOCUS_29190 11757 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 12800 11787 gene locus_tag LOCUS_29200 12800 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 12977 13915 gene locus_tag LOCUS_29210 12977 13915 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145034007.1 protein_id gnl|my_center|LOCUS_29210 14968 13922 gene locus_tag LOCUS_29220 14968 13922 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 protein_id gnl|my_center|LOCUS_29220 16493 14961 gene locus_tag LOCUS_29230 16493 14961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 17398 16583 gene locus_tag LOCUS_29240 17398 16583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 18176 17385 gene locus_tag LOCUS_29250 18176 17385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 19230 18193 gene locus_tag LOCUS_29260 19230 18193 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_29260 19437 22139 gene locus_tag LOCUS_29270 19437 22139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 22891 22136 gene locus_tag LOCUS_29280 22891 22136 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_29280 25075 22913 gene locus_tag LOCUS_29290 25075 22913 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 protein_id gnl|my_center|LOCUS_29290 25934 25095 gene locus_tag LOCUS_29300 25934 25095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 27548 25944 gene locus_tag LOCUS_29310 27548 25944 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922209.1 protein_id gnl|my_center|LOCUS_29310 29525 27558 gene locus_tag LOCUS_29320 29525 27558 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_29320 29629 30873 gene locus_tag LOCUS_29330 29629 30873 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_29330 32078 30891 gene locus_tag LOCUS_29340 32078 30891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 32781 32170 gene locus_tag LOCUS_29350 32781 32170 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812379.1 protein_id gnl|my_center|LOCUS_29350 33370 32858 gene locus_tag LOCUS_29360 33370 32858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 33855 33400 gene locus_tag LOCUS_29370 gene purE 33855 33400 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_29370 <34932 33884 gene locus_tag LOCUS_29380 <34932 33884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104158.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence052 130 1575 gene locus_tag LOCUS_29390 130 1575 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_29390 1586 2398 gene locus_tag LOCUS_29400 1586 2398 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_29400 2426 3256 gene locus_tag LOCUS_29410 2426 3256 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064422.1 protein_id gnl|my_center|LOCUS_29410 4080 3253 gene locus_tag LOCUS_29420 gene fabG 4080 3253 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_29420 4237 7041 gene locus_tag LOCUS_29430 4237 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 7914 7048 gene locus_tag LOCUS_29440 gene rfbA 7914 7048 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674717.1 protein_id gnl|my_center|LOCUS_29440 8031 8720 gene locus_tag LOCUS_29450 8031 8720 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838531.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29450 8882 10339 gene locus_tag LOCUS_29460 gene betC 8882 10339 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_29460 10361 12697 gene locus_tag LOCUS_29470 10361 12697 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_29470 12810 13898 gene locus_tag LOCUS_29480 12810 13898 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442722.1 protein_id gnl|my_center|LOCUS_29480 13976 15058 gene locus_tag LOCUS_29490 13976 15058 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182199.1 protein_id gnl|my_center|LOCUS_29490 15055 15519 gene locus_tag LOCUS_29500 15055 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 15610 15897 gene locus_tag LOCUS_29510 15610 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 16386 15976 gene locus_tag LOCUS_29520 16386 15976 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_29520 17118 16405 gene locus_tag LOCUS_29530 17118 16405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 18710 17115 gene locus_tag LOCUS_29540 18710 17115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 20499 18712 gene locus_tag LOCUS_29550 20499 18712 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121863.1 protein_id gnl|my_center|LOCUS_29550 21194 20505 gene locus_tag LOCUS_29560 21194 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 22247 21279 gene locus_tag LOCUS_29570 22247 21279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 22583 22401 gene locus_tag LOCUS_29580 22583 22401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 22738 23871 gene locus_tag LOCUS_29590 22738 23871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 23868 24878 gene locus_tag LOCUS_29600 23868 24878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 24890 25732 gene locus_tag LOCUS_29610 24890 25732 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392169.1 protein_id gnl|my_center|LOCUS_29610 25826 28591 gene locus_tag LOCUS_29620 25826 28591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 28600 29796 gene locus_tag LOCUS_29630 28600 29796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 30034 30807 gene locus_tag LOCUS_29640 30034 30807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 30820 34095 gene locus_tag LOCUS_29650 30820 34095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence053 589 665 gene locus_tag LOCUS_t00330 589 665 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 682 757 gene locus_tag LOCUS_t00340 682 757 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 898 3926 gene locus_tag LOCUS_r00010 898 3926 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3998 4109 gene locus_tag LOCUS_r00020 3998 4109 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4264 6345 gene locus_tag LOCUS_29660 gene fusA 4264 6345 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_29660 6436 7305 gene locus_tag LOCUS_29670 gene prpB 6436 7305 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052202.1 protein_id gnl|my_center|LOCUS_29670 7380 8483 gene locus_tag LOCUS_29680 gene prpC 7380 8483 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103050.1 protein_id gnl|my_center|LOCUS_29680 8500 9927 gene locus_tag LOCUS_29690 8500 9927 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444489.1 protein_id gnl|my_center|LOCUS_29690 10009 10755 gene locus_tag LOCUS_29700 10009 10755 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_29700 10806 11429 gene locus_tag LOCUS_29710 10806 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 11434 12030 gene locus_tag LOCUS_29720 gene ruvA 11434 12030 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_29720 12048 13073 gene locus_tag LOCUS_29730 gene ruvB 12048 13073 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_29730 13070 13789 gene locus_tag LOCUS_29740 gene tsaB 13070 13789 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_29740 13782 14285 gene locus_tag LOCUS_29750 gene rimI 13782 14285 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_29750 16241 14286 gene locus_tag LOCUS_29760 16241 14286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 17294 16248 gene locus_tag LOCUS_29770 17294 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 18261 17323 gene locus_tag LOCUS_29780 gene cysK 18261 17323 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_29780 18789 18277 gene locus_tag LOCUS_29790 18789 18277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 19148 18786 gene locus_tag LOCUS_29800 19148 18786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 19901 19293 gene locus_tag LOCUS_29810 19901 19293 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_29810 19966 21111 gene locus_tag LOCUS_29820 19966 21111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 21240 21704 gene locus_tag LOCUS_29830 21240 21704 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_29830 21715 24048 gene locus_tag LOCUS_29840 21715 24048 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_29840 24052 24909 gene locus_tag LOCUS_29850 24052 24909 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_29850 24965 25408 gene locus_tag LOCUS_29860 24965 25408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 25456 25818 gene locus_tag LOCUS_29870 25456 25818 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_29870 25845 26654 gene locus_tag LOCUS_29880 25845 26654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 26798 27724 gene locus_tag LOCUS_29890 26798 27724 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_29890 28102 27803 gene locus_tag LOCUS_29900 28102 27803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 28481 28095 gene locus_tag LOCUS_29910 28481 28095 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681202.1 protein_id gnl|my_center|LOCUS_29910 29893 28610 gene locus_tag LOCUS_29920 29893 28610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 31125 29902 gene locus_tag LOCUS_29930 31125 29902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 32170 31331 gene locus_tag LOCUS_29940 32170 31331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 32331 32495 gene locus_tag LOCUS_29950 32331 32495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 >Feature sequence054 91 438 gene locus_tag LOCUS_29960 gene rplS 91 438 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186516.1 protein_id gnl|my_center|LOCUS_29960 449 706 gene locus_tag LOCUS_29970 449 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 724 800 gene locus_tag LOCUS_t00350 724 800 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 959 2110 gene locus_tag LOCUS_29980 959 2110 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 protein_id gnl|my_center|LOCUS_29980 2161 3321 gene locus_tag LOCUS_29990 2161 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 3354 4553 gene locus_tag LOCUS_30000 3354 4553 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_30000 4584 5381 gene locus_tag LOCUS_30010 4584 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 5392 6114 gene locus_tag LOCUS_30020 5392 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 6126 7091 gene locus_tag LOCUS_30030 6126 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_30030 9147 7168 gene locus_tag LOCUS_30040 9147 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 12425 9156 gene locus_tag LOCUS_30050 12425 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 12640 13476 gene locus_tag LOCUS_30060 12640 13476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 13480 14901 gene locus_tag LOCUS_30070 13480 14901 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 protein_id gnl|my_center|LOCUS_30070 14914 16344 gene locus_tag LOCUS_30080 14914 16344 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828465.1 protein_id gnl|my_center|LOCUS_30080 16367 17134 gene locus_tag LOCUS_30090 16367 17134 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085705.1 protein_id gnl|my_center|LOCUS_30090 17188 18561 gene locus_tag LOCUS_30100 17188 18561 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040522.1 protein_id gnl|my_center|LOCUS_30100 20741 18573 gene locus_tag LOCUS_30110 20741 18573 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926008.1 protein_id gnl|my_center|LOCUS_30110 22342 20804 gene locus_tag LOCUS_30120 22342 20804 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_30120 23773 22529 gene locus_tag LOCUS_30130 23773 22529 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120382.1 protein_id gnl|my_center|LOCUS_30130 24938 23799 gene locus_tag LOCUS_30140 24938 23799 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_30140 25599 24955 gene locus_tag LOCUS_30150 25599 24955 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963240.1 protein_id gnl|my_center|LOCUS_30150 26776 25625 gene locus_tag LOCUS_30160 26776 25625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 28051 26855 gene locus_tag LOCUS_30170 28051 26855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 28863 28216 gene locus_tag LOCUS_30180 28863 28216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 29274 28867 gene locus_tag LOCUS_30190 29274 28867 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_30190 29694 29290 gene locus_tag LOCUS_30200 29694 29290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 30318 29698 gene locus_tag LOCUS_30210 30318 29698 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_30210 31575 30379 gene locus_tag LOCUS_30220 31575 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 32234 33541 gene locus_tag LOCUS_30230 gene guaB 32234 33541 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_30230 >Feature sequence055 441 184 gene locus_tag LOCUS_30240 gene rpsT 441 184 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 protein_id gnl|my_center|LOCUS_30240 600 1550 gene locus_tag LOCUS_30250 600 1550 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808077.1 protein_id gnl|my_center|LOCUS_30250 3211 1559 gene locus_tag LOCUS_30260 3211 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 3958 3317 gene locus_tag LOCUS_30270 3958 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 6055 4028 gene locus_tag LOCUS_30280 6055 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 6441 6052 gene locus_tag LOCUS_30290 6441 6052 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929155.1 protein_id gnl|my_center|LOCUS_30290 7555 6575 gene locus_tag LOCUS_30300 7555 6575 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_30300 8587 7580 gene locus_tag LOCUS_30310 8587 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 9562 8627 gene locus_tag LOCUS_30320 9562 8627 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_30320 10146 9559 gene locus_tag LOCUS_30330 10146 9559 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879988.1 protein_id gnl|my_center|LOCUS_30330 10249 10860 gene locus_tag LOCUS_30340 10249 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 12051 10882 gene locus_tag LOCUS_30350 gene xylA 12051 10882 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_30350 12177 13412 gene locus_tag LOCUS_30360 12177 13412 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249495.1 protein_id gnl|my_center|LOCUS_30360 13928 13419 gene locus_tag LOCUS_30370 13928 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 14186 14962 gene locus_tag LOCUS_30380 14186 14962 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968957.1 protein_id gnl|my_center|LOCUS_30380 14968 16437 gene locus_tag LOCUS_30390 14968 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 16454 16597 gene locus_tag LOCUS_30400 16454 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 16576 17709 gene locus_tag LOCUS_30410 16576 17709 CDS product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029020.1 protein_id gnl|my_center|LOCUS_30410 17740 18867 gene locus_tag LOCUS_30420 17740 18867 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525264.1 protein_id gnl|my_center|LOCUS_30420 18854 19870 gene locus_tag LOCUS_30430 18854 19870 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975777.1 protein_id gnl|my_center|LOCUS_30430 21009 19897 gene locus_tag LOCUS_30440 21009 19897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 21921 21022 gene locus_tag LOCUS_30450 21921 21022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 22127 23143 gene locus_tag LOCUS_30460 22127 23143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 23234 24124 gene locus_tag LOCUS_30470 23234 24124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 24259 25275 gene locus_tag LOCUS_30480 24259 25275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 25373 27244 gene locus_tag LOCUS_30490 25373 27244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 27269 27541 gene locus_tag LOCUS_30500 27269 27541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 29029 27644 gene locus_tag LOCUS_30510 29029 27644 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_30510 29502 29945 gene locus_tag LOCUS_30520 29502 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 >Feature sequence056 2396 783 gene locus_tag LOCUS_30530 2396 783 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_30530 3481 2393 gene locus_tag LOCUS_30540 3481 2393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390916.1 protein_id gnl|my_center|LOCUS_30540 4646 3540 gene locus_tag LOCUS_30550 4646 3540 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_30550 6484 4652 gene locus_tag LOCUS_30560 6484 4652 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_30560 6663 7406 gene locus_tag LOCUS_30570 6663 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 9207 7417 gene locus_tag LOCUS_30580 9207 7417 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_30580 10363 9236 gene locus_tag LOCUS_30590 10363 9236 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258904.1 protein_id gnl|my_center|LOCUS_30590 10659 10396 gene locus_tag LOCUS_30600 10659 10396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 11058 10804 gene locus_tag LOCUS_30610 11058 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 11684 11139 gene locus_tag LOCUS_30620 11684 11139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 12813 11761 gene locus_tag LOCUS_30630 12813 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 13279 12791 gene locus_tag LOCUS_30640 13279 12791 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_30640 14282 13290 gene locus_tag LOCUS_30650 14282 13290 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328373.1 protein_id gnl|my_center|LOCUS_30650 15267 14299 gene locus_tag LOCUS_30660 15267 14299 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_30660 16625 15264 gene locus_tag LOCUS_30670 16625 15264 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_30670 18073 16637 gene locus_tag LOCUS_30680 18073 16637 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067535.1 protein_id gnl|my_center|LOCUS_30680 19293 18070 gene locus_tag LOCUS_30690 19293 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 19773 19405 gene locus_tag LOCUS_30700 gene crcB 19773 19405 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 protein_id gnl|my_center|LOCUS_30700 20197 19775 gene locus_tag LOCUS_30710 20197 19775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 21232 20360 gene locus_tag LOCUS_30720 21232 20360 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079927.1 protein_id gnl|my_center|LOCUS_30720 22576 21257 gene locus_tag LOCUS_30730 22576 21257 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_30730 23648 22611 gene locus_tag LOCUS_30740 23648 22611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 26459 23667 gene locus_tag LOCUS_30750 26459 23667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 27291 26473 gene locus_tag LOCUS_30760 27291 26473 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551782.1 protein_id gnl|my_center|LOCUS_30760 28230 27319 gene locus_tag LOCUS_30770 28230 27319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 29086 28259 gene locus_tag LOCUS_30780 29086 28259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 30171 29083 gene locus_tag LOCUS_30790 30171 29083 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_30790 30963 30184 gene locus_tag LOCUS_30800 30963 30184 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_30800 31487 33193 gene locus_tag LOCUS_30810 31487 33193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 >Feature sequence057 <1 781 gene locus_tag LOCUS_30820 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521294.1:2-hydroxy-3-oxopropionate reductase 837 3137 gene locus_tag LOCUS_30830 837 3137 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_30830 3165 3431 gene locus_tag LOCUS_30840 3165 3431 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_30840 3778 3512 gene locus_tag LOCUS_30850 3778 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 5087 3975 gene locus_tag LOCUS_30860 5087 3975 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616070.1 protein_id gnl|my_center|LOCUS_30860 5280 6905 gene locus_tag LOCUS_30870 gene ggt 5280 6905 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_30870 6932 8110 gene locus_tag LOCUS_30880 6932 8110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 8121 9143 gene locus_tag LOCUS_30890 8121 9143 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_30890 9759 9214 gene locus_tag LOCUS_30900 9759 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 10476 9889 gene locus_tag LOCUS_30910 gene lpoB 10476 9889 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706416.1 protein_id gnl|my_center|LOCUS_30910 11327 10512 gene locus_tag LOCUS_30920 11327 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 12704 11346 gene locus_tag LOCUS_30930 12704 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817955.1 protein_id gnl|my_center|LOCUS_30930 14974 12878 gene locus_tag LOCUS_30940 14974 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 16562 14967 gene locus_tag LOCUS_30950 16562 14967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 17677 16571 gene locus_tag LOCUS_30960 17677 16571 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_30960 18621 17674 gene locus_tag LOCUS_30970 18621 17674 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_30970 19999 18614 gene locus_tag LOCUS_30980 19999 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 21174 20059 gene locus_tag LOCUS_30990 21174 20059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 22994 21390 gene locus_tag LOCUS_31000 22994 21390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 23178 23876 gene locus_tag LOCUS_31010 23178 23876 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865105.1 protein_id gnl|my_center|LOCUS_31010 23873 24145 gene locus_tag LOCUS_31020 23873 24145 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388663.1 protein_id gnl|my_center|LOCUS_31020 24168 24452 gene locus_tag LOCUS_31030 24168 24452 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_31030 24456 24746 gene locus_tag LOCUS_31040 24456 24746 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_31040 24829 26265 gene locus_tag LOCUS_31050 24829 26265 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075665.1 protein_id gnl|my_center|LOCUS_31050 26289 26552 gene locus_tag LOCUS_31060 26289 26552 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810291.1 protein_id gnl|my_center|LOCUS_31060 26618 26890 gene locus_tag LOCUS_31070 26618 26890 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 protein_id gnl|my_center|LOCUS_31070 26899 27705 gene locus_tag LOCUS_31080 26899 27705 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_31080 27958 27770 gene locus_tag LOCUS_31090 27958 27770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 28070 28309 gene locus_tag LOCUS_31100 28070 28309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 28383 29906 gene locus_tag LOCUS_31110 28383 29906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 30042 30224 gene locus_tag LOCUS_31120 30042 30224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 30221 30448 gene locus_tag LOCUS_31130 30221 30448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 30441 31739 gene locus_tag LOCUS_31140 30441 31739 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_31140 31753 32958 gene locus_tag LOCUS_31150 31753 32958 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477167.1 protein_id gnl|my_center|LOCUS_31150 >Feature sequence058 888 2132 gene locus_tag LOCUS_31160 888 2132 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877563.1 protein_id gnl|my_center|LOCUS_31160 2298 3098 gene locus_tag LOCUS_31170 2298 3098 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_31170 3103 4347 gene locus_tag LOCUS_31180 3103 4347 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_31180 4360 5901 gene locus_tag LOCUS_31190 gene putP 4360 5901 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431680.1 protein_id gnl|my_center|LOCUS_31190 5911 7446 gene locus_tag LOCUS_31200 5911 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 7464 7583 gene locus_tag LOCUS_31210 7464 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 7596 8075 gene locus_tag LOCUS_31220 7596 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 8868 8080 gene locus_tag LOCUS_31230 8868 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 10114 8882 gene locus_tag LOCUS_31240 10114 8882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 10854 10135 gene locus_tag LOCUS_31250 10854 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 12101 10857 gene locus_tag LOCUS_31260 12101 10857 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_31260 12604 12116 gene locus_tag LOCUS_31270 12604 12116 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090633.1 protein_id gnl|my_center|LOCUS_31270 14504 12693 gene locus_tag LOCUS_31280 14504 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 15521 14517 gene locus_tag LOCUS_31290 gene dcyD 15521 14517 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128192.1 protein_id gnl|my_center|LOCUS_31290 16582 15533 gene locus_tag LOCUS_31300 16582 15533 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_31300 16747 17991 gene locus_tag LOCUS_31310 16747 17991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615918.1 protein_id gnl|my_center|LOCUS_31310 17996 20071 gene locus_tag LOCUS_31320 17996 20071 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404999.1 protein_id gnl|my_center|LOCUS_31320 21628 20084 gene locus_tag LOCUS_31330 21628 20084 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327245.1 protein_id gnl|my_center|LOCUS_31330 22741 21638 gene locus_tag LOCUS_31340 gene aroB 22741 21638 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_31340 23405 22857 gene locus_tag LOCUS_31350 23405 22857 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350371.1 protein_id gnl|my_center|LOCUS_31350 25134 23428 gene locus_tag LOCUS_31360 gene argS 25134 23428 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_31360 25642 25178 gene locus_tag LOCUS_31370 25642 25178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 26414 25644 gene locus_tag LOCUS_31380 gene ubiE 26414 25644 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_31380 27341 26463 gene locus_tag LOCUS_31390 gene aroE 27341 26463 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_31390 27496 27341 gene locus_tag LOCUS_31400 27496 27341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 28151 27480 gene locus_tag LOCUS_31410 28151 27480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 29271 28162 gene locus_tag LOCUS_31420 29271 28162 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_31420 30324 29299 gene locus_tag LOCUS_31430 30324 29299 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_31430 30619 30338 gene locus_tag LOCUS_31440 30619 30338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 31423 30623 gene locus_tag LOCUS_31450 gene trpA 31423 30623 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_31450 32628 31423 gene locus_tag LOCUS_31460 gene trpB 32628 31423 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_31460 <33361 32642 gene locus_tag LOCUS_31470 <33361 32642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461003.1:aldolase catalytic domain-containing protein >Feature sequence059 1717 2007 gene locus_tag LOCUS_31480 1717 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2352 1972 gene locus_tag LOCUS_31490 2352 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 3362 2583 gene locus_tag LOCUS_31500 3362 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 5054 3501 gene locus_tag LOCUS_31510 5054 3501 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_31510 6146 5148 gene locus_tag LOCUS_31520 6146 5148 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_31520 7323 6166 gene locus_tag LOCUS_31530 7323 6166 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_31530 8547 7405 gene locus_tag LOCUS_31540 8547 7405 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_31540 9399 8638 gene locus_tag LOCUS_31550 9399 8638 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_31550 10665 9409 gene locus_tag LOCUS_31560 10665 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 11551 10769 gene locus_tag LOCUS_31570 11551 10769 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 protein_id gnl|my_center|LOCUS_31570 11823 11999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13698 12721 gene locus_tag LOCUS_31580 13698 12721 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_31580 15254 13695 gene locus_tag LOCUS_31590 15254 13695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 15402 16442 gene locus_tag LOCUS_31600 15402 16442 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089014.1 protein_id gnl|my_center|LOCUS_31600 16457 17662 gene locus_tag LOCUS_31610 16457 17662 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525362.1 protein_id gnl|my_center|LOCUS_31610 17683 18924 gene locus_tag LOCUS_31620 17683 18924 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_31620 19036 19944 gene locus_tag LOCUS_31630 19036 19944 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_31630 19974 20276 gene locus_tag LOCUS_31640 19974 20276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 20298 21335 gene locus_tag LOCUS_31650 20298 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 21351 22760 gene locus_tag LOCUS_31660 gene betC 21351 22760 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768150.1 protein_id gnl|my_center|LOCUS_31660 23541 22768 gene locus_tag LOCUS_31670 23541 22768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 24745 23669 gene locus_tag LOCUS_31680 24745 23669 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728149.1 protein_id gnl|my_center|LOCUS_31680 25525 24764 gene locus_tag LOCUS_31690 25525 24764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 25629 26585 gene locus_tag LOCUS_31700 gene ala 25629 26585 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_31700 29799 26587 gene locus_tag LOCUS_31710 29799 26587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 30236 31072 gene locus_tag LOCUS_31720 30236 31072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 31251 31919 gene locus_tag LOCUS_31730 31251 31919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 32014 32352 gene locus_tag LOCUS_31740 32014 32352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 32316 32627 gene locus_tag LOCUS_31750 32316 32627 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234794028.1 protein_id gnl|my_center|LOCUS_31750 >Feature sequence060 1343 195 gene locus_tag LOCUS_31760 1343 195 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_31760 2756 1416 gene locus_tag LOCUS_31770 2756 1416 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_31770 4276 2804 gene locus_tag LOCUS_31780 4276 2804 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108631.1 protein_id gnl|my_center|LOCUS_31780 5665 4280 gene locus_tag LOCUS_31790 5665 4280 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803769.1 protein_id gnl|my_center|LOCUS_31790 7245 5767 gene locus_tag LOCUS_31800 7245 5767 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_31800 8826 7357 gene locus_tag LOCUS_31810 8826 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 9990 8923 gene locus_tag LOCUS_31820 9990 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 10259 11836 gene locus_tag LOCUS_31830 10259 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 12986 11949 gene locus_tag LOCUS_31840 12986 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 14522 13095 gene locus_tag LOCUS_31850 14522 13095 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_31850 15967 14618 gene locus_tag LOCUS_31860 15967 14618 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108982.1 protein_id gnl|my_center|LOCUS_31860 16717 16259 gene locus_tag LOCUS_31870 16717 16259 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_31870 16850 16659 gene locus_tag LOCUS_31880 16850 16659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 17809 16955 gene locus_tag LOCUS_31890 17809 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 19451 17841 gene locus_tag LOCUS_31900 19451 17841 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_31900 21464 19473 gene locus_tag LOCUS_31910 21464 19473 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_31910 22940 21558 gene locus_tag LOCUS_31920 22940 21558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 23307 22993 gene locus_tag LOCUS_31930 gene rhaM 23307 22993 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_31930 25441 23342 gene locus_tag LOCUS_31940 25441 23342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 27724 25490 gene locus_tag LOCUS_31950 27724 25490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence061 929 105 gene locus_tag LOCUS_31960 929 105 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121747.1 protein_id gnl|my_center|LOCUS_31960 1126 1674 gene locus_tag LOCUS_31970 gene msrA 1126 1674 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_31970 1671 2696 gene locus_tag LOCUS_31980 1671 2696 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339517.1 protein_id gnl|my_center|LOCUS_31980 5891 2721 gene locus_tag LOCUS_31990 5891 2721 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_31990 6077 7153 gene locus_tag LOCUS_32000 6077 7153 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728943.1 protein_id gnl|my_center|LOCUS_32000 7176 7889 gene locus_tag LOCUS_32010 7176 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477484.1 protein_id gnl|my_center|LOCUS_32010 8541 7918 gene locus_tag LOCUS_32020 8541 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 9740 8538 gene locus_tag LOCUS_32030 9740 8538 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_32030 11486 9750 gene locus_tag LOCUS_32040 gene pabB 11486 9750 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_32040 12367 11603 gene locus_tag LOCUS_32050 12367 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 13658 12384 gene locus_tag LOCUS_32060 13658 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 15179 14394 gene locus_tag LOCUS_32070 15179 14394 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921315.1 protein_id gnl|my_center|LOCUS_32070 15307 16641 gene locus_tag LOCUS_32080 15307 16641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 16781 17965 gene locus_tag LOCUS_32090 16781 17965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 18083 19096 gene locus_tag LOCUS_32100 18083 19096 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_32100 19116 20207 gene locus_tag LOCUS_32110 19116 20207 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_32110 20204 21418 gene locus_tag LOCUS_32120 20204 21418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 21437 22684 gene locus_tag LOCUS_32130 21437 22684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 22699 24135 gene locus_tag LOCUS_32140 22699 24135 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_32140 25881 25546 gene locus_tag LOCUS_32150 25881 25546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 26488 25889 gene locus_tag LOCUS_32160 gene nthA 26488 25889 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174055.1 protein_id gnl|my_center|LOCUS_32160 27188 26517 gene locus_tag LOCUS_32170 gene nthB 27188 26517 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087268.1 protein_id gnl|my_center|LOCUS_32170 28184 27297 gene locus_tag LOCUS_32180 28184 27297 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147018.1 protein_id gnl|my_center|LOCUS_32180 28339 28253 gene locus_tag LOCUS_t00360 28339 28253 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29375 28416 gene locus_tag LOCUS_32190 29375 28416 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_32190 >Feature sequence062 <1 4574 gene locus_tag LOCUS_32200 <1 4574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618881.1:leishmanolysin-related zinc metalloendopeptidase 4633 6354 gene locus_tag LOCUS_32210 4633 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 6651 8831 gene locus_tag LOCUS_32220 6651 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 8881 11598 gene locus_tag LOCUS_32230 8881 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 11617 12528 gene locus_tag LOCUS_32240 11617 12528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 12600 13643 gene locus_tag LOCUS_32250 12600 13643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 13693 15180 gene locus_tag LOCUS_32260 13693 15180 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_32260 15190 16332 gene locus_tag LOCUS_32270 15190 16332 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680500.1 protein_id gnl|my_center|LOCUS_32270 17855 16329 gene locus_tag LOCUS_32280 17855 16329 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039375.1 protein_id gnl|my_center|LOCUS_32280 17959 19308 gene locus_tag LOCUS_32290 17959 19308 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_32290 19349 20590 gene locus_tag LOCUS_32300 19349 20590 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093999.1 protein_id gnl|my_center|LOCUS_32300 22106 20601 gene locus_tag LOCUS_32310 22106 20601 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680713.1 protein_id gnl|my_center|LOCUS_32310 23725 22298 gene locus_tag LOCUS_32320 23725 22298 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931965.1 protein_id gnl|my_center|LOCUS_32320 26180 23736 gene locus_tag LOCUS_32330 gene priA 26180 23736 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405449.1 protein_id gnl|my_center|LOCUS_32330 27151 26198 gene locus_tag LOCUS_32340 27151 26198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 27773 27141 gene locus_tag LOCUS_32350 27773 27141 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_32350 28213 27770 gene locus_tag LOCUS_32360 gene dtd 28213 27770 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173028.1 protein_id gnl|my_center|LOCUS_32360 28491 29687 gene locus_tag LOCUS_32370 28491 29687 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015670.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence063 830 42 gene locus_tag LOCUS_32380 830 42 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014665.1 protein_id gnl|my_center|LOCUS_32380 1037 843 gene locus_tag LOCUS_32390 1037 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 1253 1128 gene locus_tag LOCUS_32400 1253 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 2135 1257 gene locus_tag LOCUS_32410 2135 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 2958 2308 gene locus_tag LOCUS_32420 2958 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32420 3821 3081 gene locus_tag LOCUS_32430 3821 3081 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_32430 4984 3896 gene locus_tag LOCUS_32440 4984 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 5120 5045 gene locus_tag LOCUS_t00370 5120 5045 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5706 5236 gene locus_tag LOCUS_32450 5706 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 6467 5703 gene locus_tag LOCUS_32460 6467 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 7012 6539 gene locus_tag LOCUS_32470 gene moaC 7012 6539 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_32470 8242 7019 gene locus_tag LOCUS_32480 8242 7019 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_32480 8374 9093 gene locus_tag LOCUS_32490 8374 9093 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340751.1 protein_id gnl|my_center|LOCUS_32490 9111 10652 gene locus_tag LOCUS_32500 gene rng 9111 10652 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_32500 10771 11088 gene locus_tag LOCUS_32510 gene rplU 10771 11088 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_32510 11106 11357 gene locus_tag LOCUS_32520 gene rpmA 11106 11357 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419086.1 protein_id gnl|my_center|LOCUS_32520 11375 12301 gene locus_tag LOCUS_32530 gene mdh 11375 12301 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933173.1 protein_id gnl|my_center|LOCUS_32530 12887 14353 gene locus_tag LOCUS_32540 12887 14353 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_32540 14625 14849 gene locus_tag LOCUS_32550 14625 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 15038 16930 gene locus_tag LOCUS_32560 15038 16930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 17423 17025 gene locus_tag LOCUS_32570 17423 17025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180554.1 protein_id gnl|my_center|LOCUS_32570 17768 18994 gene locus_tag LOCUS_32580 17768 18994 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_32580 19004 20449 gene locus_tag LOCUS_32590 19004 20449 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_32590 20461 21402 gene locus_tag LOCUS_32600 20461 21402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 21527 24532 gene locus_tag LOCUS_32610 21527 24532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 24617 26278 gene locus_tag LOCUS_32620 24617 26278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 26374 28296 gene locus_tag LOCUS_32630 26374 28296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 <29807 28414 gene locus_tag LOCUS_32640 <29807 28414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257272.1:Calx-beta domain-containing protein >Feature sequence064 <1 554 gene locus_tag LOCUS_32650 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201996915.1:IS3 family transposase 613 894 gene locus_tag LOCUS_32660 613 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 1189 2712 gene locus_tag LOCUS_32670 1189 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 2872 3069 gene locus_tag LOCUS_32680 2872 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 3312 2998 gene locus_tag LOCUS_32690 3312 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 3832 4344 gene locus_tag LOCUS_32700 3832 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 5111 4326 gene locus_tag LOCUS_32710 5111 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 5281 5718 gene locus_tag LOCUS_32720 5281 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 6860 5787 gene locus_tag LOCUS_32730 6860 5787 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 protein_id gnl|my_center|LOCUS_32730 7037 8653 gene locus_tag LOCUS_32740 7037 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 8665 10068 gene locus_tag LOCUS_32750 gene selA 8665 10068 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_32750 10156 12051 gene locus_tag LOCUS_32760 gene selB 10156 12051 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_32760 12309 12995 gene locus_tag LOCUS_32770 12309 12995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 12992 13213 gene locus_tag LOCUS_32780 12992 13213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 13229 13441 gene locus_tag LOCUS_32790 13229 13441 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024015.1 protein_id gnl|my_center|LOCUS_32790 13438 13668 gene locus_tag LOCUS_32800 13438 13668 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020810.1 protein_id gnl|my_center|LOCUS_32800 14972 13956 gene locus_tag LOCUS_32810 14972 13956 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096411.1 protein_id gnl|my_center|LOCUS_32810 16711 14990 gene locus_tag LOCUS_32820 16711 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 17847 16744 gene locus_tag LOCUS_32830 17847 16744 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_32830 19355 17901 gene locus_tag LOCUS_32840 19355 17901 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_32840 20181 19381 gene locus_tag LOCUS_32850 20181 19381 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_32850 20400 20822 gene locus_tag LOCUS_32860 20400 20822 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011019287.1 protein_id gnl|my_center|LOCUS_32860 20819 22903 gene locus_tag LOCUS_32870 20819 22903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 23759 22851 gene locus_tag LOCUS_32880 23759 22851 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027042.1 protein_id gnl|my_center|LOCUS_32880 24475 23756 gene locus_tag LOCUS_32890 24475 23756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 25645 24611 gene locus_tag LOCUS_32900 25645 24611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 26890 25664 gene locus_tag LOCUS_32910 26890 25664 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_32910 27177 26908 gene locus_tag LOCUS_32920 27177 26908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 27434 27186 gene locus_tag LOCUS_32930 27434 27186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 27681 27442 gene locus_tag LOCUS_32940 27681 27442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 28666 27776 gene locus_tag LOCUS_32950 28666 27776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 <29771 28700 gene locus_tag LOCUS_32960 <29771 28700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776859.1:sulfatase-like hydrolase/transferase >Feature sequence065 553 1047 gene locus_tag LOCUS_32970 553 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 2858 1125 gene locus_tag LOCUS_32980 2858 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 5406 2863 gene locus_tag LOCUS_32990 5406 2863 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_32990 6446 5424 gene locus_tag LOCUS_33000 6446 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 7143 6460 gene locus_tag LOCUS_33010 7143 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 7320 12980 gene locus_tag LOCUS_33020 gene uvrA 7320 12980 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121648.1 protein_id gnl|my_center|LOCUS_33020 13087 13686 gene locus_tag LOCUS_33030 13087 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 13689 14087 gene locus_tag LOCUS_33040 13689 14087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 14391 15575 gene locus_tag LOCUS_33050 14391 15575 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925262.1 protein_id gnl|my_center|LOCUS_33050 15954 16733 gene locus_tag LOCUS_33060 15954 16733 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530852.1 protein_id gnl|my_center|LOCUS_33060 16744 17739 gene locus_tag LOCUS_33070 16744 17739 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532966.1 protein_id gnl|my_center|LOCUS_33070 17736 18329 gene locus_tag LOCUS_33080 17736 18329 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_33080 18355 20208 gene locus_tag LOCUS_33090 18355 20208 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903521.1 protein_id gnl|my_center|LOCUS_33090 20214 21245 gene locus_tag LOCUS_33100 20214 21245 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_33100 22033 21335 gene locus_tag LOCUS_33110 22033 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 22280 22083 gene locus_tag LOCUS_33120 22280 22083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 23767 22361 gene locus_tag LOCUS_33130 23767 22361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 24169 23783 gene locus_tag LOCUS_33140 24169 23783 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583104.1 protein_id gnl|my_center|LOCUS_33140 24401 27028 gene locus_tag LOCUS_33150 24401 27028 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_33150 27809 27111 gene locus_tag LOCUS_33160 27809 27111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 <29735 27910 gene locus_tag LOCUS_33170 <29735 27910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924857.1:tetratricopeptide repeat protein >Feature sequence066 110 622 gene locus_tag LOCUS_33180 110 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 1259 843 gene locus_tag LOCUS_33190 1259 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 1927 1274 gene locus_tag LOCUS_33200 1927 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 2351 3136 gene locus_tag LOCUS_33210 2351 3136 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357656.1 protein_id gnl|my_center|LOCUS_33210 3478 3164 gene locus_tag LOCUS_33220 3478 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 6014 3588 gene locus_tag LOCUS_33230 6014 3588 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_33230 8500 6071 gene locus_tag LOCUS_33240 8500 6071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_33240 10847 8523 gene locus_tag LOCUS_33250 10847 8523 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_33250 13378 10877 gene locus_tag LOCUS_33260 13378 10877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_33260 13932 13663 gene locus_tag LOCUS_33270 13932 13663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 14107 13925 gene locus_tag LOCUS_33280 14107 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 16528 14147 gene locus_tag LOCUS_33290 16528 14147 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_33290 17134 16553 gene locus_tag LOCUS_33300 gene rpoE 17134 16553 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_33300 18577 17414 gene locus_tag LOCUS_33310 18577 17414 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965428.1 protein_id gnl|my_center|LOCUS_33310 18892 18587 gene locus_tag LOCUS_33320 18892 18587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 19156 20316 gene locus_tag LOCUS_33330 19156 20316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_33330 20413 21156 gene locus_tag LOCUS_33340 20413 21156 CDS product chlorinating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525107.1 protein_id gnl|my_center|LOCUS_33340 21168 22355 gene locus_tag LOCUS_33350 21168 22355 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 protein_id gnl|my_center|LOCUS_33350 22365 23102 gene locus_tag LOCUS_33360 22365 23102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 23121 23552 gene locus_tag LOCUS_33370 gene fucU 23121 23552 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648572.1 protein_id gnl|my_center|LOCUS_33370 23667 25433 gene locus_tag LOCUS_33380 23667 25433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 25927 25535 gene locus_tag LOCUS_33390 25927 25535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 26504 25941 gene locus_tag LOCUS_33400 gene rpoE 26504 25941 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420724.1 protein_id gnl|my_center|LOCUS_33400 27935 27018 gene locus_tag LOCUS_33410 27935 27018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 28303 27956 gene locus_tag LOCUS_33420 28303 27956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 28844 28506 gene locus_tag LOCUS_33430 28844 28506 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_33430 28915 29112 gene locus_tag LOCUS_33440 28915 29112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 29187 29573 gene locus_tag LOCUS_33450 29187 29573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 >Feature sequence067 1351 503 gene locus_tag LOCUS_33460 1351 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 1568 2836 gene locus_tag LOCUS_33470 1568 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 2844 3452 gene locus_tag LOCUS_33480 2844 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3475 4917 gene locus_tag LOCUS_33490 3475 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 4914 6275 gene locus_tag LOCUS_33500 4914 6275 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_33500 7506 6352 gene locus_tag LOCUS_33510 gene metK 7506 6352 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_33510 9309 7528 gene locus_tag LOCUS_33520 gene ptsP 9309 7528 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_33520 9573 9313 gene locus_tag LOCUS_33530 9573 9313 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_33530 10499 9609 gene locus_tag LOCUS_33540 10499 9609 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_33540 11333 10572 gene locus_tag LOCUS_33550 11333 10572 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_33550 13945 11330 gene locus_tag LOCUS_33560 gene alaS 13945 11330 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259677.1 protein_id gnl|my_center|LOCUS_33560 14474 13953 gene locus_tag LOCUS_33570 gene recX 14474 13953 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947526.1 protein_id gnl|my_center|LOCUS_33570 17525 14580 gene locus_tag LOCUS_33580 17525 14580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 18719 17670 gene locus_tag LOCUS_33590 gene recA 18719 17670 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_33590 19335 18856 gene locus_tag LOCUS_33600 19335 18856 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932028.1 protein_id gnl|my_center|LOCUS_33600 20005 19364 gene locus_tag LOCUS_33610 gene pgsA 20005 19364 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932027.1 protein_id gnl|my_center|LOCUS_33610 20599 20006 gene locus_tag LOCUS_33620 gene recR 20599 20006 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_33620 20971 20645 gene locus_tag LOCUS_33630 20971 20645 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_33630 22735 21014 gene locus_tag LOCUS_33640 gene dnaX 22735 21014 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_33640 23189 23114 gene locus_tag LOCUS_t00380 23189 23114 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 23563 23192 gene locus_tag LOCUS_33650 23563 23192 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_33650 23672 23583 gene locus_tag LOCUS_t00390 23672 23583 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23818 23729 gene locus_tag LOCUS_t00400 23818 23729 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24282 23824 gene locus_tag LOCUS_33660 gene tadA 24282 23824 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815124.1 protein_id gnl|my_center|LOCUS_33660 25129 24359 gene locus_tag LOCUS_33670 25129 24359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 25942 25160 gene locus_tag LOCUS_33680 25942 25160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 26073 26148 gene locus_tag LOCUS_t00410 26073 26148 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 28861 26420 gene locus_tag LOCUS_33690 28861 26420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 >Feature sequence068 386 111 gene locus_tag LOCUS_33700 gene acpP 386 111 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_33700 2296 395 gene locus_tag LOCUS_33710 2296 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 3014 2289 gene locus_tag LOCUS_33720 3014 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 3782 3042 gene locus_tag LOCUS_33730 3782 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 4493 3801 gene locus_tag LOCUS_33740 4493 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 5116 4712 gene locus_tag LOCUS_33750 5116 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 6887 5172 gene locus_tag LOCUS_33760 6887 5172 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052919.1 protein_id gnl|my_center|LOCUS_33760 8182 6896 gene locus_tag LOCUS_33770 8182 6896 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680368.1 protein_id gnl|my_center|LOCUS_33770 9044 8280 gene locus_tag LOCUS_33780 9044 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 11377 9683 gene locus_tag LOCUS_33790 11377 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 13633 11393 gene locus_tag LOCUS_33800 13633 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 13809 14582 gene locus_tag LOCUS_33810 13809 14582 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_33810 14605 15114 gene locus_tag LOCUS_33820 14605 15114 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256302.1 protein_id gnl|my_center|LOCUS_33820 15129 17504 gene locus_tag LOCUS_33830 15129 17504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 18231 17506 gene locus_tag LOCUS_33840 18231 17506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 19640 18264 gene locus_tag LOCUS_33850 19640 18264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 20343 19654 gene locus_tag LOCUS_33860 20343 19654 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_33860 21248 20373 gene locus_tag LOCUS_33870 gene dapA 21248 20373 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919078.1 protein_id gnl|my_center|LOCUS_33870 22030 21269 gene locus_tag LOCUS_33880 gene surE 22030 21269 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902899.1 protein_id gnl|my_center|LOCUS_33880 23511 22039 gene locus_tag LOCUS_33890 23511 22039 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_33890 23966 23526 gene locus_tag LOCUS_33900 23966 23526 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090630.1 protein_id gnl|my_center|LOCUS_33900 25066 23975 gene locus_tag LOCUS_33910 25066 23975 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090631.1 protein_id gnl|my_center|LOCUS_33910 25803 26231 gene locus_tag LOCUS_33920 25803 26231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 26191 26484 gene locus_tag LOCUS_33930 26191 26484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 26522 26827 gene locus_tag LOCUS_33940 26522 26827 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390589.1 protein_id gnl|my_center|LOCUS_33940 26838 27059 gene locus_tag LOCUS_33950 26838 27059 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229283.1 protein_id gnl|my_center|LOCUS_33950 28397 27078 gene locus_tag LOCUS_33960 28397 27078 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_33960 >Feature sequence069 <1 511 gene locus_tag LOCUS_33970 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393153.1:Fe-S cluster assembly scaffold protein NifU 566 1675 gene locus_tag LOCUS_33980 gene queG 566 1675 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037446.1 protein_id gnl|my_center|LOCUS_33980 1689 3065 gene locus_tag LOCUS_33990 gene miaB 1689 3065 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114512.1 protein_id gnl|my_center|LOCUS_33990 3065 3952 gene locus_tag LOCUS_34000 gene lipA 3065 3952 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_34000 4038 5411 gene locus_tag LOCUS_34010 4038 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 5421 9026 gene locus_tag LOCUS_34020 5421 9026 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115449.1 protein_id gnl|my_center|LOCUS_34020 9146 10291 gene locus_tag LOCUS_34030 9146 10291 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_34030 10363 11367 gene locus_tag LOCUS_34040 gene dusA 10363 11367 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073658.1 protein_id gnl|my_center|LOCUS_34040 12296 11346 gene locus_tag LOCUS_34050 12296 11346 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861974.1 protein_id gnl|my_center|LOCUS_34050 12449 13969 gene locus_tag LOCUS_34060 12449 13969 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817390.1 protein_id gnl|my_center|LOCUS_34060 13987 15078 gene locus_tag LOCUS_34070 13987 15078 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090622.1 protein_id gnl|my_center|LOCUS_34070 15094 15894 gene locus_tag LOCUS_34080 15094 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 15906 16670 gene locus_tag LOCUS_34090 15906 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 17559 16681 gene locus_tag LOCUS_34100 17559 16681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 17650 18534 gene locus_tag LOCUS_34110 gene garR 17650 18534 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 protein_id gnl|my_center|LOCUS_34110 18554 19414 gene locus_tag LOCUS_34120 18554 19414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 19425 20867 gene locus_tag LOCUS_34130 19425 20867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 21108 23594 gene locus_tag LOCUS_34140 21108 23594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 24400 23648 gene locus_tag LOCUS_34150 24400 23648 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_34150 24613 25827 gene locus_tag LOCUS_34160 24613 25827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 25856 26911 gene locus_tag LOCUS_34170 25856 26911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 26930 27733 gene locus_tag LOCUS_34180 26930 27733 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805157.1 protein_id gnl|my_center|LOCUS_34180 >Feature sequence070 <1 987 gene locus_tag LOCUS_34190 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775809.1:Gfo/Idh/MocA family oxidoreductase 1000 2307 gene locus_tag LOCUS_34200 1000 2307 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_34200 2312 3019 gene locus_tag LOCUS_34210 2312 3019 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_34210 3220 6111 gene locus_tag LOCUS_34220 3220 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 6204 6827 gene locus_tag LOCUS_34230 6204 6827 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393557.1 protein_id gnl|my_center|LOCUS_34230 6912 8123 gene locus_tag LOCUS_34240 6912 8123 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_34240 8198 9166 gene locus_tag LOCUS_34250 8198 9166 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_34250 9437 9171 gene locus_tag LOCUS_34260 9437 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 11162 9543 gene locus_tag LOCUS_34270 11162 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 11241 11879 gene locus_tag LOCUS_34280 11241 11879 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940859.1 protein_id gnl|my_center|LOCUS_34280 11918 13990 gene locus_tag LOCUS_34290 11918 13990 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_34290 14014 15282 gene locus_tag LOCUS_34300 14014 15282 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_34300 15365 16510 gene locus_tag LOCUS_34310 15365 16510 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011053155.1 protein_id gnl|my_center|LOCUS_34310 16507 17127 gene locus_tag LOCUS_34320 16507 17127 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_34320 17407 18036 gene locus_tag LOCUS_34330 17407 18036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 18914 19708 gene locus_tag LOCUS_34340 18914 19708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 19938 20291 gene locus_tag LOCUS_34350 19938 20291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 20348 20791 gene locus_tag LOCUS_34360 20348 20791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 20851 21459 gene locus_tag LOCUS_34370 20851 21459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 21543 21905 gene locus_tag LOCUS_34380 21543 21905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 21966 22391 gene locus_tag LOCUS_34390 21966 22391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 22447 22884 gene locus_tag LOCUS_34400 22447 22884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 23007 26336 gene locus_tag LOCUS_34410 23007 26336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 >Feature sequence071 4312 1037 gene locus_tag LOCUS_34420 4312 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 5280 4459 gene locus_tag LOCUS_34430 5280 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 6752 5757 gene locus_tag LOCUS_34440 6752 5757 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_34440 8146 6839 gene locus_tag LOCUS_34450 gene aspS 8146 6839 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249447.1 protein_id gnl|my_center|LOCUS_34450 9099 8335 gene locus_tag LOCUS_34460 9099 8335 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_34460 10657 9077 gene locus_tag LOCUS_34470 gene ggtA 10657 9077 CDS product gamma-glutamyltranspeptidase GgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403933.1 protein_id gnl|my_center|LOCUS_34470 11137 10676 gene locus_tag LOCUS_34480 11137 10676 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143726.1 protein_id gnl|my_center|LOCUS_34480 12331 11534 gene locus_tag LOCUS_34490 12331 11534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 12531 12328 gene locus_tag LOCUS_34500 12531 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 13187 12540 gene locus_tag LOCUS_34510 13187 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 13757 13308 gene locus_tag LOCUS_34520 13757 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 14176 13778 gene locus_tag LOCUS_34530 14176 13778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 14766 14173 gene locus_tag LOCUS_34540 gene sigW 14766 14173 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_34540 16666 14900 gene locus_tag LOCUS_34550 gene ilvB 16666 14900 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_34550 17696 16926 gene locus_tag LOCUS_34560 17696 16926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 17915 19246 gene locus_tag LOCUS_34570 17915 19246 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 protein_id gnl|my_center|LOCUS_34570 19344 22202 gene locus_tag LOCUS_34580 19344 22202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 22256 25117 gene locus_tag LOCUS_34590 22256 25117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 26370 25180 gene locus_tag LOCUS_34600 26370 25180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 28070 26385 gene locus_tag LOCUS_34610 gene pheT 28070 26385 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957104.1 protein_id gnl|my_center|LOCUS_34610 >Feature sequence072 1263 2363 gene locus_tag LOCUS_34620 1263 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 2378 3445 gene locus_tag LOCUS_34630 2378 3445 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_34630 5576 3429 gene locus_tag LOCUS_34640 5576 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 5686 6747 gene locus_tag LOCUS_34650 5686 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 8722 6761 gene locus_tag LOCUS_34660 8722 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 10007 8739 gene locus_tag LOCUS_34670 10007 8739 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_34670 10828 10019 gene locus_tag LOCUS_34680 10828 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 11990 10953 gene locus_tag LOCUS_34690 11990 10953 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525324.1 protein_id gnl|my_center|LOCUS_34690 12827 12051 gene locus_tag LOCUS_34700 12827 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 15104 12834 gene locus_tag LOCUS_34710 15104 12834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 15225 16475 gene locus_tag LOCUS_34720 15225 16475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 16486 17304 gene locus_tag LOCUS_34730 16486 17304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 19064 17301 gene locus_tag LOCUS_34740 19064 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 19199 20101 gene locus_tag LOCUS_34750 19199 20101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 21396 20104 gene locus_tag LOCUS_34760 21396 20104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 23198 21465 gene locus_tag LOCUS_34770 23198 21465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 24370 23354 gene locus_tag LOCUS_34780 24370 23354 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975103.1 protein_id gnl|my_center|LOCUS_34780 25136 24477 gene locus_tag LOCUS_34790 25136 24477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 26610 25162 gene locus_tag LOCUS_34800 26610 25162 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_34800 27320 26610 gene locus_tag LOCUS_34810 27320 26610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 >Feature sequence073 473 667 gene locus_tag LOCUS_34820 gene rpmI 473 667 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_34820 703 1056 gene locus_tag LOCUS_34830 gene rplT 703 1056 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405508.1 protein_id gnl|my_center|LOCUS_34830 1213 1704 gene locus_tag LOCUS_34840 1213 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 1704 1997 gene locus_tag LOCUS_34850 gene zapA 1704 1997 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082701.1 protein_id gnl|my_center|LOCUS_34850 2135 3697 gene locus_tag LOCUS_34860 gene rny 2135 3697 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221010.1 protein_id gnl|my_center|LOCUS_34860 3708 4499 gene locus_tag LOCUS_34870 3708 4499 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_34870 4501 5691 gene locus_tag LOCUS_34880 gene xseA 4501 5691 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393024.1 protein_id gnl|my_center|LOCUS_34880 5698 5958 gene locus_tag LOCUS_34890 5698 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 5955 6815 gene locus_tag LOCUS_34900 5955 6815 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_34900 6828 8531 gene locus_tag LOCUS_34910 gene recN 6828 8531 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933282.1 protein_id gnl|my_center|LOCUS_34910 8553 9701 gene locus_tag LOCUS_34920 gene mqnE 8553 9701 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_34920 9728 10828 gene locus_tag LOCUS_34930 9728 10828 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851090.1 protein_id gnl|my_center|LOCUS_34930 10840 11637 gene locus_tag LOCUS_34940 10840 11637 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_34940 11698 12957 gene locus_tag LOCUS_34950 11698 12957 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_34950 12968 13360 gene locus_tag LOCUS_34960 12968 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 13966 13592 gene locus_tag LOCUS_34970 13966 13592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 15604 14273 gene locus_tag LOCUS_34980 15604 14273 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_34980 15734 17917 gene locus_tag LOCUS_34990 15734 17917 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 protein_id gnl|my_center|LOCUS_34990 18156 17926 gene locus_tag LOCUS_35000 18156 17926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 18398 18153 gene locus_tag LOCUS_35010 18398 18153 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014628886.1 protein_id gnl|my_center|LOCUS_35010 18586 19557 gene locus_tag LOCUS_35020 18586 19557 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967753.1 protein_id gnl|my_center|LOCUS_35020 20411 19650 gene locus_tag LOCUS_35030 20411 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 21449 20427 gene locus_tag LOCUS_35040 21449 20427 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_35040 21641 22615 gene locus_tag LOCUS_35050 21641 22615 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969225.1 protein_id gnl|my_center|LOCUS_35050 22707 24212 gene locus_tag LOCUS_35060 gene betC 22707 24212 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_35060 24229 25146 gene locus_tag LOCUS_35070 24229 25146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 25180 26499 gene locus_tag LOCUS_35080 25180 26499 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_35080 >Feature sequence074 1449 796 gene locus_tag LOCUS_35090 1449 796 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_35090 3834 1567 gene locus_tag LOCUS_35100 3834 1567 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037676.1 protein_id gnl|my_center|LOCUS_35100 4929 3910 gene locus_tag LOCUS_35110 4929 3910 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_35110 6497 5091 gene locus_tag LOCUS_35120 6497 5091 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_35120 8009 6513 gene locus_tag LOCUS_35130 8009 6513 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_35130 8122 8988 gene locus_tag LOCUS_35140 8122 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 9064 9501 gene locus_tag LOCUS_35150 9064 9501 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_35150 9517 11502 gene locus_tag LOCUS_35160 9517 11502 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_35160 11499 11957 gene locus_tag LOCUS_35170 11499 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 11957 12334 gene locus_tag LOCUS_35180 11957 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 12786 12481 gene locus_tag LOCUS_35190 12786 12481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 13146 12886 gene locus_tag LOCUS_35200 13146 12886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 13432 13121 gene locus_tag LOCUS_35210 13432 13121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 13877 14797 gene locus_tag LOCUS_35220 13877 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 14790 15854 gene locus_tag LOCUS_35230 14790 15854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 15854 16564 gene locus_tag LOCUS_35240 15854 16564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_35240 16567 17238 gene locus_tag LOCUS_35250 16567 17238 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_35250 17241 17918 gene locus_tag LOCUS_35260 17241 17918 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065117.1 protein_id gnl|my_center|LOCUS_35260 17938 18087 gene locus_tag LOCUS_35270 17938 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 18091 18861 gene locus_tag LOCUS_35280 18091 18861 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808211.1 protein_id gnl|my_center|LOCUS_35280 19952 18915 gene locus_tag LOCUS_35290 19952 18915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 20194 20015 gene locus_tag LOCUS_35300 20194 20015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 21104 20346 gene locus_tag LOCUS_35310 21104 20346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 21463 21119 gene locus_tag LOCUS_35320 21463 21119 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_35320 21728 21477 gene locus_tag LOCUS_35330 21728 21477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 22080 21706 gene locus_tag LOCUS_35340 22080 21706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 22376 23890 gene locus_tag LOCUS_35350 22376 23890 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037250650.1 protein_id gnl|my_center|LOCUS_35350 23895 24836 gene locus_tag LOCUS_35360 23895 24836 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_35360 25806 24841 gene locus_tag LOCUS_35370 gene rsgA 25806 24841 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_35370 25964 26713 gene locus_tag LOCUS_35380 25964 26713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 >Feature sequence075 925 170 gene locus_tag LOCUS_35390 925 170 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003873.1 protein_id gnl|my_center|LOCUS_35390 1104 2201 gene locus_tag LOCUS_35400 1104 2201 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_35400 2231 3097 gene locus_tag LOCUS_35410 2231 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 3172 4512 gene locus_tag LOCUS_35420 3172 4512 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_35420 4525 6024 gene locus_tag LOCUS_35430 4525 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 6051 7079 gene locus_tag LOCUS_35440 6051 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 7224 8453 gene locus_tag LOCUS_35450 7224 8453 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804457.1 protein_id gnl|my_center|LOCUS_35450 9905 8508 gene locus_tag LOCUS_35460 9905 8508 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_35460 10825 10013 gene locus_tag LOCUS_35470 10825 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 11013 11777 gene locus_tag LOCUS_35480 11013 11777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 11764 11976 gene locus_tag LOCUS_35490 11764 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 12046 12591 gene locus_tag LOCUS_35500 12046 12591 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627261.1 protein_id gnl|my_center|LOCUS_35500 12682 12606 gene locus_tag LOCUS_t00420 12682 12606 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13053 13307 gene locus_tag LOCUS_35510 13053 13307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 13433 14896 gene locus_tag LOCUS_35520 13433 14896 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_35520 15171 15959 gene locus_tag LOCUS_35530 15171 15959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159350744.1 protein_id gnl|my_center|LOCUS_35530 16029 17759 gene locus_tag LOCUS_35540 16029 17759 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_35540 17865 18830 gene locus_tag LOCUS_35550 gene pdhA 17865 18830 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_35550 18846 19805 gene locus_tag LOCUS_35560 18846 19805 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_35560 19903 20907 gene locus_tag LOCUS_35570 19903 20907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 20946 25745 gene locus_tag LOCUS_35580 20946 25745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 26046 26240 gene locus_tag LOCUS_35590 26046 26240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 >Feature sequence076 757 1476 gene locus_tag LOCUS_35600 gene mqnB 757 1476 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941120.1 protein_id gnl|my_center|LOCUS_35600 1490 2320 gene locus_tag LOCUS_35610 1490 2320 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_35610 2335 3258 gene locus_tag LOCUS_35620 2335 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 3334 4233 gene locus_tag LOCUS_35630 gene garR 3334 4233 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 protein_id gnl|my_center|LOCUS_35630 4817 4341 gene locus_tag LOCUS_35640 4817 4341 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_35640 5076 4810 gene locus_tag LOCUS_35650 5076 4810 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_35650 5438 5115 gene locus_tag LOCUS_35660 5438 5115 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_35660 6636 5428 gene locus_tag LOCUS_35670 6636 5428 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_35670 7981 6647 gene locus_tag LOCUS_35680 7981 6647 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393135.1 protein_id gnl|my_center|LOCUS_35680 8858 8022 gene locus_tag LOCUS_35690 gene dsrM 8858 8022 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544992.1 protein_id gnl|my_center|LOCUS_35690 9415 8846 gene locus_tag LOCUS_35700 9415 8846 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243940.1 protein_id gnl|my_center|LOCUS_35700 10415 9567 gene locus_tag LOCUS_35710 10415 9567 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_35710 12619 10529 gene locus_tag LOCUS_35720 12619 10529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 14188 12749 gene locus_tag LOCUS_35730 14188 12749 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_35730 15879 14203 gene locus_tag LOCUS_35740 15879 14203 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_35740 18224 15903 gene locus_tag LOCUS_35750 18224 15903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 22145 18237 gene locus_tag LOCUS_35760 gene purL 22145 18237 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544968.1 protein_id gnl|my_center|LOCUS_35760 22707 22153 gene locus_tag LOCUS_35770 gene rfbC 22707 22153 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_35770 24126 22768 gene locus_tag LOCUS_35780 gene purB 24126 22768 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423756.1 protein_id gnl|my_center|LOCUS_35780 24125 24334 gene locus_tag LOCUS_35790 24125 24334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 >Feature sequence077 1107 10 gene locus_tag LOCUS_35800 1107 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 1135 1335 gene locus_tag LOCUS_35810 1135 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 4644 1450 gene locus_tag LOCUS_35820 4644 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 8231 5022 gene locus_tag LOCUS_35830 8231 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 9507 8689 gene locus_tag LOCUS_35840 9507 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 10701 9517 gene locus_tag LOCUS_35850 10701 9517 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660225.1 protein_id gnl|my_center|LOCUS_35850 10803 11606 gene locus_tag LOCUS_35860 10803 11606 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358274.1 protein_id gnl|my_center|LOCUS_35860 12415 11669 gene locus_tag LOCUS_35870 12415 11669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 13270 12467 gene locus_tag LOCUS_35880 13270 12467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 13403 14665 gene locus_tag LOCUS_35890 13403 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 14734 15420 gene locus_tag LOCUS_35900 14734 15420 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_35900 16883 15471 gene locus_tag LOCUS_35910 16883 15471 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338202.1 protein_id gnl|my_center|LOCUS_35910 17809 16919 gene locus_tag LOCUS_35920 17809 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 18252 17839 gene locus_tag LOCUS_35930 18252 17839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 20835 18256 gene locus_tag LOCUS_35940 20835 18256 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403224.1 protein_id gnl|my_center|LOCUS_35940 21008 21202 gene locus_tag LOCUS_35950 21008 21202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 21294 22964 gene locus_tag LOCUS_35960 gene nadB 21294 22964 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_35960 22975 24789 gene locus_tag LOCUS_35970 gene guaA 22975 24789 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234667.1 protein_id gnl|my_center|LOCUS_35970 25105 26379 gene locus_tag LOCUS_35980 25105 26379 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972423.1 protein_id gnl|my_center|LOCUS_35980 >Feature sequence078 <1 1171 gene locus_tag LOCUS_35990 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005080518.1:signal peptide peptidase SppA 1186 1938 gene locus_tag LOCUS_36000 1186 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 2191 3135 gene locus_tag LOCUS_36010 2191 3135 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_36010 3128 3841 gene locus_tag LOCUS_36020 3128 3841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_36020 3844 5352 gene locus_tag LOCUS_36030 3844 5352 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_36030 5345 5914 gene locus_tag LOCUS_36040 5345 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 9007 5954 gene locus_tag LOCUS_36050 9007 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 9770 9009 gene locus_tag LOCUS_36060 9770 9009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_36060 10506 9784 gene locus_tag LOCUS_36070 10506 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 10703 11662 gene locus_tag LOCUS_36080 10703 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 14385 11719 gene locus_tag LOCUS_36090 14385 11719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 17521 14780 gene locus_tag LOCUS_36100 17521 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 17816 17977 gene locus_tag LOCUS_36110 17816 17977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 18061 18621 gene locus_tag LOCUS_36120 18061 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 18715 19017 gene locus_tag LOCUS_36130 18715 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 19036 20388 gene locus_tag LOCUS_36140 19036 20388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 20385 21164 gene locus_tag LOCUS_36150 20385 21164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 21182 22864 gene locus_tag LOCUS_36160 21182 22864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 22867 23865 gene locus_tag LOCUS_36170 gene arsS 22867 23865 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_36170 <26175 23925 gene locus_tag LOCUS_36180 <26175 23925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023630.1:thioredoxin domain-containing protein >Feature sequence079 943 260 gene locus_tag LOCUS_36190 gene queC 943 260 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_36190 1922 954 gene locus_tag LOCUS_36200 1922 954 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222033.1 protein_id gnl|my_center|LOCUS_36200 2038 3135 gene locus_tag LOCUS_36210 2038 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 4084 3137 gene locus_tag LOCUS_36220 4084 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 5545 4112 gene locus_tag LOCUS_36230 5545 4112 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332236.1 protein_id gnl|my_center|LOCUS_36230 5782 7527 gene locus_tag LOCUS_36240 5782 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 7722 9467 gene locus_tag LOCUS_36250 7722 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 9639 10616 gene locus_tag LOCUS_36260 9639 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 10695 11360 gene locus_tag LOCUS_36270 gene lepB 10695 11360 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_36270 11543 14350 gene locus_tag LOCUS_36280 11543 14350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 14395 15003 gene locus_tag LOCUS_36290 14395 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 16174 15074 gene locus_tag LOCUS_36300 16174 15074 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921634.1 protein_id gnl|my_center|LOCUS_36300 16365 17393 gene locus_tag LOCUS_36310 gene uxuA 16365 17393 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082566.1 protein_id gnl|my_center|LOCUS_36310 17432 18445 gene locus_tag LOCUS_36320 17432 18445 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966893.1 protein_id gnl|my_center|LOCUS_36320 18447 19703 gene locus_tag LOCUS_36330 18447 19703 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922251.1 protein_id gnl|my_center|LOCUS_36330 19725 20699 gene locus_tag LOCUS_36340 19725 20699 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532261.1 protein_id gnl|my_center|LOCUS_36340 20713 21426 gene locus_tag LOCUS_36350 20713 21426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 21447 22172 gene locus_tag LOCUS_36360 21447 22172 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_36360 22169 23314 gene locus_tag LOCUS_36370 22169 23314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 24089 23331 gene locus_tag LOCUS_36380 24089 23331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 25092 24091 gene locus_tag LOCUS_36390 25092 24091 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966893.1 protein_id gnl|my_center|LOCUS_36390 >Feature sequence080 2650 11 gene locus_tag LOCUS_36400 2650 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 3510 2698 gene locus_tag LOCUS_36410 3510 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 4287 3526 gene locus_tag LOCUS_36420 4287 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 5272 4868 gene locus_tag LOCUS_36430 5272 4868 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_36430 6662 5277 gene locus_tag LOCUS_36440 gene atpD 6662 5277 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_36440 7513 6677 gene locus_tag LOCUS_36450 gene atpG 7513 6677 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_36450 9049 7532 gene locus_tag LOCUS_36460 gene atpA 9049 7532 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545369.1 protein_id gnl|my_center|LOCUS_36460 9698 9159 gene locus_tag LOCUS_36470 gene atpH 9698 9159 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403676.1 protein_id gnl|my_center|LOCUS_36470 10207 9713 gene locus_tag LOCUS_36480 10207 9713 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931713.1 protein_id gnl|my_center|LOCUS_36480 10482 10246 gene locus_tag LOCUS_36490 10482 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 11307 10510 gene locus_tag LOCUS_36500 11307 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 11700 11311 gene locus_tag LOCUS_36510 11700 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 11951 11697 gene locus_tag LOCUS_36520 11951 11697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 13943 11958 gene locus_tag LOCUS_36530 13943 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 15365 13968 gene locus_tag LOCUS_36540 15365 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 16569 15388 gene locus_tag LOCUS_36550 16569 15388 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_36550 17540 16758 gene locus_tag LOCUS_36560 17540 16758 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770085.1 protein_id gnl|my_center|LOCUS_36560 18757 17630 gene locus_tag LOCUS_36570 18757 17630 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229000.1 protein_id gnl|my_center|LOCUS_36570 18854 19612 gene locus_tag LOCUS_36580 18854 19612 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231034.1 protein_id gnl|my_center|LOCUS_36580 20887 19616 gene locus_tag LOCUS_36590 20887 19616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 21897 20899 gene locus_tag LOCUS_36600 21897 20899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 25038 21946 gene locus_tag LOCUS_36610 25038 21946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 >Feature sequence081 <1 538 gene locus_tag LOCUS_36620 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120149.1:sulfatase 556 2547 gene locus_tag LOCUS_36630 556 2547 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528247.1 protein_id gnl|my_center|LOCUS_36630 3785 2589 gene locus_tag LOCUS_36640 3785 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 4838 3795 gene locus_tag LOCUS_36650 4838 3795 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_36650 4943 6067 gene locus_tag LOCUS_36660 4943 6067 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 protein_id gnl|my_center|LOCUS_36660 7073 6084 gene locus_tag LOCUS_36670 7073 6084 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083301.1 protein_id gnl|my_center|LOCUS_36670 7133 9052 gene locus_tag LOCUS_36680 7133 9052 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_36680 10210 9116 gene locus_tag LOCUS_36690 10210 9116 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_36690 10316 10963 gene locus_tag LOCUS_36700 10316 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 10968 11645 gene locus_tag LOCUS_36710 10968 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 11683 12594 gene locus_tag LOCUS_36720 11683 12594 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_36720 12632 14020 gene locus_tag LOCUS_36730 12632 14020 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_36730 14020 16122 gene locus_tag LOCUS_36740 14020 16122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 16061 17503 gene locus_tag LOCUS_36750 gene atoC 16061 17503 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125283.1 protein_id gnl|my_center|LOCUS_36750 17751 18398 gene locus_tag LOCUS_36760 17751 18398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 18423 19427 gene locus_tag LOCUS_36770 18423 19427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 19464 19991 gene locus_tag LOCUS_36780 19464 19991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 20087 20482 gene locus_tag LOCUS_36790 20087 20482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 21255 20485 gene locus_tag LOCUS_36800 gene modA 21255 20485 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206718.1 protein_id gnl|my_center|LOCUS_36800 21274 21921 gene locus_tag LOCUS_36810 21274 21921 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_36810 21963 23048 gene locus_tag LOCUS_36820 21963 23048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 24354 23056 gene locus_tag LOCUS_36830 24354 23056 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_36830 >Feature sequence082 89 970 gene locus_tag LOCUS_36840 89 970 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_36840 975 1367 gene locus_tag LOCUS_36850 975 1367 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_36850 2685 1480 gene locus_tag LOCUS_36860 2685 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 3965 2685 gene locus_tag LOCUS_36870 3965 2685 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_36870 4315 4061 gene locus_tag LOCUS_36880 4315 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 4512 5324 gene locus_tag LOCUS_36890 4512 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 5326 6399 gene locus_tag LOCUS_36900 5326 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 6412 7272 gene locus_tag LOCUS_36910 6412 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 8706 7279 gene locus_tag LOCUS_36920 8706 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 9446 8703 gene locus_tag LOCUS_36930 gene yfaU 9446 8703 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992954.1 protein_id gnl|my_center|LOCUS_36930 10362 9481 gene locus_tag LOCUS_36940 10362 9481 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_36940 12145 10391 gene locus_tag LOCUS_36950 12145 10391 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_36950 13923 12145 gene locus_tag LOCUS_36960 13923 12145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257958.1 protein_id gnl|my_center|LOCUS_36960 17772 13927 gene locus_tag LOCUS_36970 gene hrpA 17772 13927 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483469.1 protein_id gnl|my_center|LOCUS_36970 18602 17865 gene locus_tag LOCUS_36980 18602 17865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 18964 19797 gene locus_tag LOCUS_36990 18964 19797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 19858 20598 gene locus_tag LOCUS_37000 19858 20598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 20621 21277 gene locus_tag LOCUS_37010 gene rpe 20621 21277 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 protein_id gnl|my_center|LOCUS_37010 21364 22689 gene locus_tag LOCUS_37020 gene ffh 21364 22689 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 protein_id gnl|my_center|LOCUS_37020 22706 23008 gene locus_tag LOCUS_37030 22706 23008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 23012 23545 gene locus_tag LOCUS_37040 gene rimM 23012 23545 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_37040 23557 24225 gene locus_tag LOCUS_37050 gene trmD 23557 24225 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_37050 >Feature sequence083 64 2424 gene locus_tag LOCUS_37060 64 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 2584 3270 gene locus_tag LOCUS_37070 2584 3270 CDS product YesU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233822.1 protein_id gnl|my_center|LOCUS_37070 3321 5837 gene locus_tag LOCUS_37080 3321 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 5996 7222 gene locus_tag LOCUS_37090 5996 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 7229 8026 gene locus_tag LOCUS_37100 7229 8026 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446742.1 protein_id gnl|my_center|LOCUS_37100 8884 8033 gene locus_tag LOCUS_37110 8884 8033 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973114.1 protein_id gnl|my_center|LOCUS_37110 9994 8906 gene locus_tag LOCUS_37120 9994 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 11002 10148 gene locus_tag LOCUS_37130 11002 10148 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103020948.1 protein_id gnl|my_center|LOCUS_37130 13253 11019 gene locus_tag LOCUS_37140 13253 11019 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403520.1 protein_id gnl|my_center|LOCUS_37140 13594 13268 gene locus_tag LOCUS_37150 13594 13268 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 protein_id gnl|my_center|LOCUS_37150 14144 13575 gene locus_tag LOCUS_37160 14144 13575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 15518 14268 gene locus_tag LOCUS_37170 15518 14268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 17110 15515 gene locus_tag LOCUS_37180 17110 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 17773 17459 gene locus_tag LOCUS_37190 17773 17459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 18509 17733 gene locus_tag LOCUS_37200 18509 17733 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931393.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37200 19497 18523 gene locus_tag LOCUS_37210 19497 18523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 19661 19786 gene locus_tag LOCUS_37220 19661 19786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 20863 19835 gene locus_tag LOCUS_37230 20863 19835 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_37230 20925 22106 gene locus_tag LOCUS_37240 20925 22106 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191983.1 protein_id gnl|my_center|LOCUS_37240 22103 22855 gene locus_tag LOCUS_37250 22103 22855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence084 138 353 gene locus_tag LOCUS_37260 138 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 2205 862 gene locus_tag LOCUS_37270 2205 862 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_37270 3628 2195 gene locus_tag LOCUS_37280 3628 2195 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_37280 4766 3672 gene locus_tag LOCUS_37290 4766 3672 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817270.1 protein_id gnl|my_center|LOCUS_37290 4942 6336 gene locus_tag LOCUS_37300 4942 6336 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_37300 6359 7204 gene locus_tag LOCUS_37310 6359 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 7220 7978 gene locus_tag LOCUS_37320 7220 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 7994 8659 gene locus_tag LOCUS_37330 7994 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 8661 9626 gene locus_tag LOCUS_37340 8661 9626 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_37340 10524 9628 gene locus_tag LOCUS_37350 10524 9628 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921881.1 protein_id gnl|my_center|LOCUS_37350 10822 11598 gene locus_tag LOCUS_37360 10822 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 11788 13239 gene locus_tag LOCUS_37370 11788 13239 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_37370 13332 14051 gene locus_tag LOCUS_37380 13332 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 14014 14778 gene locus_tag LOCUS_37390 14014 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 14797 14991 gene locus_tag LOCUS_37400 14797 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 15184 16071 gene locus_tag LOCUS_37410 15184 16071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146827.1 protein_id gnl|my_center|LOCUS_37410 16073 16822 gene locus_tag LOCUS_37420 16073 16822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 17020 18279 gene locus_tag LOCUS_37430 17020 18279 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958546.1 protein_id gnl|my_center|LOCUS_37430 18413 18790 gene locus_tag LOCUS_37440 18413 18790 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_37440 18787 19698 gene locus_tag LOCUS_37450 18787 19698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 20589 19759 gene locus_tag LOCUS_37460 20589 19759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 23057 20604 gene locus_tag LOCUS_37470 23057 20604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 >Feature sequence085 3043 1241 gene locus_tag LOCUS_37480 3043 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 3404 5095 gene locus_tag LOCUS_37490 3404 5095 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074344.1 protein_id gnl|my_center|LOCUS_37490 6100 5072 gene locus_tag LOCUS_37500 6100 5072 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074343.1 protein_id gnl|my_center|LOCUS_37500 7222 6113 gene locus_tag LOCUS_37510 7222 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 8128 7238 gene locus_tag LOCUS_37520 8128 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 8996 8142 gene locus_tag LOCUS_37530 8996 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 10107 9079 gene locus_tag LOCUS_37540 10107 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 10217 11926 gene locus_tag LOCUS_37550 gene polX 10217 11926 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615613.1 protein_id gnl|my_center|LOCUS_37550 12050 12490 gene locus_tag LOCUS_37560 gene dksA 12050 12490 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920436.1 protein_id gnl|my_center|LOCUS_37560 12569 13867 gene locus_tag LOCUS_37570 12569 13867 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682315.1 protein_id gnl|my_center|LOCUS_37570 13869 17900 gene locus_tag LOCUS_37580 13869 17900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 17992 19521 gene locus_tag LOCUS_37590 17992 19521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 19775 20359 gene locus_tag LOCUS_37600 19775 20359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 20356 20676 gene locus_tag LOCUS_37610 20356 20676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 20704 21048 gene locus_tag LOCUS_37620 20704 21048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 21062 21412 gene locus_tag LOCUS_37630 21062 21412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 22422 21661 gene locus_tag LOCUS_37640 22422 21661 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235568.1 protein_id gnl|my_center|LOCUS_37640 23303 22602 gene locus_tag LOCUS_37650 23303 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 >Feature sequence086 1107 283 gene locus_tag LOCUS_37660 1107 283 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_37660 3226 1121 gene locus_tag LOCUS_37670 3226 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 3462 3223 gene locus_tag LOCUS_37680 3462 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 6731 3597 gene locus_tag LOCUS_37690 6731 3597 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_37690 7927 6728 gene locus_tag LOCUS_37700 7927 6728 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_37700 9136 7943 gene locus_tag LOCUS_37710 9136 7943 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_37710 10288 9446 gene locus_tag LOCUS_37720 10288 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 10474 12297 gene locus_tag LOCUS_37730 10474 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 13697 12543 gene locus_tag LOCUS_37740 13697 12543 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_37740 14775 13837 gene locus_tag LOCUS_37750 14775 13837 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559357.1 protein_id gnl|my_center|LOCUS_37750 16453 14882 gene locus_tag LOCUS_37760 16453 14882 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_37760 18116 16482 gene locus_tag LOCUS_37770 18116 16482 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114996.1 protein_id gnl|my_center|LOCUS_37770 18979 18131 gene locus_tag LOCUS_37780 18979 18131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 19812 19066 gene locus_tag LOCUS_37790 19812 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37790 20374 19736 gene locus_tag LOCUS_37800 20374 19736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37800 21222 20380 gene locus_tag LOCUS_37810 21222 20380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 22351 21266 gene locus_tag LOCUS_37820 22351 21266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 >Feature sequence087 962 180 gene locus_tag LOCUS_37830 962 180 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066342893.1 protein_id gnl|my_center|LOCUS_37830 1098 1988 gene locus_tag LOCUS_37840 1098 1988 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_37840 2014 2802 gene locus_tag LOCUS_37850 2014 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 3217 3543 gene locus_tag LOCUS_37860 3217 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 3771 4193 gene locus_tag LOCUS_37870 3771 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 5318 4410 gene locus_tag LOCUS_37880 5318 4410 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_37880 5917 5630 gene locus_tag LOCUS_37890 5917 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37890 6194 6343 gene locus_tag LOCUS_37900 6194 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 6312 6509 gene locus_tag LOCUS_37910 6312 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 6870 6676 gene locus_tag LOCUS_37920 6870 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 7338 7985 gene locus_tag LOCUS_37930 7338 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 7989 8162 gene locus_tag LOCUS_37940 7989 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 8470 8616 gene locus_tag LOCUS_37950 8470 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 8761 8579 gene locus_tag LOCUS_37960 8761 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 8889 9182 gene locus_tag LOCUS_37970 8889 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 9182 9640 gene locus_tag LOCUS_37980 9182 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 10523 9771 gene locus_tag LOCUS_37990 10523 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 11883 10525 gene locus_tag LOCUS_38000 11883 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 11987 12460 gene locus_tag LOCUS_38010 11987 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 12461 13126 gene locus_tag LOCUS_38020 12461 13126 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_38020 13126 13917 gene locus_tag LOCUS_38030 13126 13917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 14872 13898 gene locus_tag LOCUS_38040 14872 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 15077 15823 gene locus_tag LOCUS_38050 15077 15823 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_38050 16207 15890 gene locus_tag LOCUS_38060 16207 15890 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110750833.1 protein_id gnl|my_center|LOCUS_38060 16521 16219 gene locus_tag LOCUS_38070 16521 16219 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_38070 16648 17619 gene locus_tag LOCUS_38080 16648 17619 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903551.1 protein_id gnl|my_center|LOCUS_38080 18087 17626 gene locus_tag LOCUS_38090 18087 17626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 19842 18130 gene locus_tag LOCUS_38100 19842 18130 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_38100 20930 19860 gene locus_tag LOCUS_38110 20930 19860 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810317.1 protein_id gnl|my_center|LOCUS_38110 21855 20932 gene locus_tag LOCUS_38120 21855 20932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 <22422 21896 gene locus_tag LOCUS_38130 <22422 21896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108692.1:sulfatase >Feature sequence088 354 827 gene locus_tag LOCUS_38140 354 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 879 2477 gene locus_tag LOCUS_38150 879 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 3277 2471 gene locus_tag LOCUS_38160 3277 2471 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889174.1 protein_id gnl|my_center|LOCUS_38160 3224 3427 gene locus_tag LOCUS_38170 3224 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 4698 3496 gene locus_tag LOCUS_38180 4698 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 6180 4759 gene locus_tag LOCUS_38190 6180 4759 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 protein_id gnl|my_center|LOCUS_38190 7192 6215 gene locus_tag LOCUS_38200 7192 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 8743 7217 gene locus_tag LOCUS_38210 8743 7217 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921988.1 protein_id gnl|my_center|LOCUS_38210 10042 8756 gene locus_tag LOCUS_38220 10042 8756 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_38220 11279 10035 gene locus_tag LOCUS_38230 11279 10035 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_38230 12769 11360 gene locus_tag LOCUS_38240 12769 11360 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 protein_id gnl|my_center|LOCUS_38240 14259 12790 gene locus_tag LOCUS_38250 14259 12790 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_38250 15144 14281 gene locus_tag LOCUS_38260 15144 14281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 16324 15167 gene locus_tag LOCUS_38270 16324 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120328.1 protein_id gnl|my_center|LOCUS_38270 17431 16400 gene locus_tag LOCUS_38280 17431 16400 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_38280 17733 19865 gene locus_tag LOCUS_38290 gene katG 17733 19865 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_38290 19882 20181 gene locus_tag LOCUS_38300 19882 20181 CDS product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528905.1 protein_id gnl|my_center|LOCUS_38300 20257 22017 gene locus_tag LOCUS_38310 20257 22017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 >Feature sequence089 1390 140 gene locus_tag LOCUS_38320 1390 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 3630 1471 gene locus_tag LOCUS_38330 gene rnr 3630 1471 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_38330 3751 4830 gene locus_tag LOCUS_38340 3751 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 4897 5349 gene locus_tag LOCUS_38350 4897 5349 CDS product superoxide dismutase [Ni] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814912.1 protein_id gnl|my_center|LOCUS_38350 5533 5823 gene locus_tag LOCUS_38360 gene groES 5533 5823 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918572.1 protein_id gnl|my_center|LOCUS_38360 5857 7482 gene locus_tag LOCUS_38370 gene groL 5857 7482 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932217.1 protein_id gnl|my_center|LOCUS_38370 8807 7536 gene locus_tag LOCUS_38380 8807 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 9853 8828 gene locus_tag LOCUS_38390 9853 8828 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_38390 10744 9869 gene locus_tag LOCUS_38400 10744 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 10846 11784 gene locus_tag LOCUS_38410 10846 11784 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_38410 11825 12226 gene locus_tag LOCUS_38420 11825 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 13248 12223 gene locus_tag LOCUS_38430 13248 12223 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_38430 13969 13199 gene locus_tag LOCUS_38440 13969 13199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 14835 14038 gene locus_tag LOCUS_38450 14835 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 16223 14832 gene locus_tag LOCUS_38460 gene hemG 16223 14832 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_38460 17164 16220 gene locus_tag LOCUS_38470 gene hemH 17164 16220 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887774.1 protein_id gnl|my_center|LOCUS_38470 18176 17133 gene locus_tag LOCUS_38480 gene hemE 18176 17133 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258456.1 protein_id gnl|my_center|LOCUS_38480 18411 18166 gene locus_tag LOCUS_38490 18411 18166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 19755 18421 gene locus_tag LOCUS_38500 gene glnA 19755 18421 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582594.1 protein_id gnl|my_center|LOCUS_38500 >Feature sequence090 7300 4091 gene locus_tag LOCUS_38510 7300 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 10898 7683 gene locus_tag LOCUS_38520 10898 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 12252 10966 gene locus_tag LOCUS_38530 gene hemL 12252 10966 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_38530 13257 12268 gene locus_tag LOCUS_38540 13257 12268 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_38540 14933 13260 gene locus_tag LOCUS_38550 14933 13260 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144388.1 protein_id gnl|my_center|LOCUS_38550 15567 14971 gene locus_tag LOCUS_38560 15567 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 protein_id gnl|my_center|LOCUS_38560 16799 15579 gene locus_tag LOCUS_38570 16799 15579 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144027.1 protein_id gnl|my_center|LOCUS_38570 17377 16820 gene locus_tag LOCUS_38580 17377 16820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 17607 18230 gene locus_tag LOCUS_38590 17607 18230 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 protein_id gnl|my_center|LOCUS_38590 18243 19244 gene locus_tag LOCUS_38600 18243 19244 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_38600 19466 21400 gene locus_tag LOCUS_38610 gene thrS 19466 21400 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_38610 >Feature sequence091 671 150 gene locus_tag LOCUS_38620 671 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 1127 693 gene locus_tag LOCUS_38630 1127 693 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943765.1 protein_id gnl|my_center|LOCUS_38630 1280 2179 gene locus_tag LOCUS_38640 1280 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 2204 3184 gene locus_tag LOCUS_38650 2204 3184 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_38650 3194 4429 gene locus_tag LOCUS_38660 3194 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 4557 5675 gene locus_tag LOCUS_38670 gene tgt 4557 5675 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_38670 5678 6103 gene locus_tag LOCUS_38680 5678 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 6139 7053 gene locus_tag LOCUS_38690 gene fmt 6139 7053 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404897.1 protein_id gnl|my_center|LOCUS_38690 7069 7755 gene locus_tag LOCUS_38700 7069 7755 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870390.1 protein_id gnl|my_center|LOCUS_38700 7784 8827 gene locus_tag LOCUS_38710 7784 8827 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_38710 8904 9545 gene locus_tag LOCUS_38720 gene eda 8904 9545 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_38720 9542 10480 gene locus_tag LOCUS_38730 9542 10480 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_38730 11261 10509 gene locus_tag LOCUS_38740 11261 10509 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225011.1 protein_id gnl|my_center|LOCUS_38740 11521 12393 gene locus_tag LOCUS_38750 11521 12393 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243735.1 protein_id gnl|my_center|LOCUS_38750 12417 13256 gene locus_tag LOCUS_38760 12417 13256 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_38760 14080 13343 gene locus_tag LOCUS_38770 14080 13343 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_38770 15722 14133 gene locus_tag LOCUS_38780 15722 14133 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 protein_id gnl|my_center|LOCUS_38780 15862 17937 gene locus_tag LOCUS_38790 15862 17937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 17958 18977 gene locus_tag LOCUS_38800 17958 18977 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_38800 18990 20582 gene locus_tag LOCUS_38810 18990 20582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 21331 20591 gene locus_tag LOCUS_38820 21331 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 >Feature sequence092 3756 784 gene locus_tag LOCUS_38830 3756 784 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_38830 5188 3791 gene locus_tag LOCUS_38840 5188 3791 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_38840 5367 5176 gene locus_tag LOCUS_38850 5367 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 5408 6244 gene locus_tag LOCUS_38860 5408 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 6257 7594 gene locus_tag LOCUS_38870 6257 7594 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_38870 7597 7998 gene locus_tag LOCUS_38880 7597 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 7991 9214 gene locus_tag LOCUS_38890 7991 9214 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_38890 9299 10120 gene locus_tag LOCUS_38900 9299 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 10138 10935 gene locus_tag LOCUS_38910 10138 10935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 12632 11022 gene locus_tag LOCUS_38920 gene iorA 12632 11022 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068577330.1 protein_id gnl|my_center|LOCUS_38920 14101 12731 gene locus_tag LOCUS_38930 14101 12731 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099324.1 protein_id gnl|my_center|LOCUS_38930 14240 15409 gene locus_tag LOCUS_38940 gene nagA 14240 15409 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002179749.1 protein_id gnl|my_center|LOCUS_38940 15421 16272 gene locus_tag LOCUS_38950 15421 16272 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889481.1 protein_id gnl|my_center|LOCUS_38950 16394 17518 gene locus_tag LOCUS_38960 gene dgoD 16394 17518 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_38960 17487 18713 gene locus_tag LOCUS_38970 17487 18713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 18713 19471 gene locus_tag LOCUS_38980 18713 19471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 19468 19890 gene locus_tag LOCUS_38990 19468 19890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 20490 19933 gene locus_tag LOCUS_39000 20490 19933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 >Feature sequence093 <1 1251 gene locus_tag LOCUS_39010 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002456470.1:glutamate-1-semialdehyde 2,1-aminomutase 1262 3157 gene locus_tag LOCUS_39020 1262 3157 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945510.1 protein_id gnl|my_center|LOCUS_39020 3159 5123 gene locus_tag LOCUS_39030 3159 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 5136 6146 gene locus_tag LOCUS_39040 5136 6146 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_39040 6159 7163 gene locus_tag LOCUS_39050 6159 7163 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213192.1 protein_id gnl|my_center|LOCUS_39050 7175 7870 gene locus_tag LOCUS_39060 7175 7870 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980655.1 protein_id gnl|my_center|LOCUS_39060 7881 9026 gene locus_tag LOCUS_39070 7881 9026 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_39070 9040 10437 gene locus_tag LOCUS_39080 9040 10437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 10462 11004 gene locus_tag LOCUS_39090 10462 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 11023 11877 gene locus_tag LOCUS_39100 11023 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 11883 13124 gene locus_tag LOCUS_39110 11883 13124 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326489.1 protein_id gnl|my_center|LOCUS_39110 13186 16500 gene locus_tag LOCUS_39120 13186 16500 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_39120 16500 20267 gene locus_tag LOCUS_39130 16500 20267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 >Feature sequence094 1289 330 gene locus_tag LOCUS_39140 1289 330 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_39140 1801 1328 gene locus_tag LOCUS_39150 1801 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 2803 1946 gene locus_tag LOCUS_39160 2803 1946 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926835.1 protein_id gnl|my_center|LOCUS_39160 3486 2821 gene locus_tag LOCUS_39170 gene ftsE 3486 2821 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985455.1 protein_id gnl|my_center|LOCUS_39170 4259 3501 gene locus_tag LOCUS_39180 4259 3501 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_39180 4601 4329 gene locus_tag LOCUS_39190 4601 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 5852 4608 gene locus_tag LOCUS_39200 5852 4608 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_39200 6735 5887 gene locus_tag LOCUS_39210 6735 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 10216 6809 gene locus_tag LOCUS_39220 gene mfd 10216 6809 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_39220 10371 10294 gene locus_tag LOCUS_t00430 10371 10294 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 10519 13911 gene locus_tag LOCUS_39230 10519 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 13921 15135 gene locus_tag LOCUS_39240 13921 15135 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_39240 16941 15148 gene locus_tag LOCUS_39250 16941 15148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 17064 18539 gene locus_tag LOCUS_39260 17064 18539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 20709 18613 gene locus_tag LOCUS_39270 20709 18613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 >Feature sequence095 503 1354 gene locus_tag LOCUS_39280 503 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 1497 2123 gene locus_tag LOCUS_39290 1497 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 2207 2794 gene locus_tag LOCUS_39300 2207 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 2809 3312 gene locus_tag LOCUS_39310 2809 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 3309 4277 gene locus_tag LOCUS_39320 3309 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 4288 5172 gene locus_tag LOCUS_39330 gene era 4288 5172 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404809.1 protein_id gnl|my_center|LOCUS_39330 5169 6164 gene locus_tag LOCUS_39340 5169 6164 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404317.1 protein_id gnl|my_center|LOCUS_39340 8167 6176 gene locus_tag LOCUS_39350 8167 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 8584 8204 gene locus_tag LOCUS_39360 8584 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 11958 8689 gene locus_tag LOCUS_39370 11958 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 12313 12510 gene locus_tag LOCUS_39380 12313 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 13365 12529 gene locus_tag LOCUS_39390 13365 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 13532 14227 gene locus_tag LOCUS_39400 gene rpiA 13532 14227 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049992.1 protein_id gnl|my_center|LOCUS_39400 14321 15208 gene locus_tag LOCUS_39410 gene sucD 14321 15208 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_39410 16128 15265 gene locus_tag LOCUS_39420 16128 15265 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_39420 16382 16822 gene locus_tag LOCUS_39430 16382 16822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 16819 17085 gene locus_tag LOCUS_39440 16819 17085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 17559 17245 gene locus_tag LOCUS_39450 17559 17245 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234794028.1 protein_id gnl|my_center|LOCUS_39450 18001 18309 gene locus_tag LOCUS_39460 18001 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 18412 18233 gene locus_tag LOCUS_39470 18412 18233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 18822 18436 gene locus_tag LOCUS_39480 18822 18436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 20477 19308 gene locus_tag LOCUS_39490 20477 19308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 >Feature sequence096 1230 877 gene locus_tag LOCUS_39500 1230 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 1964 1230 gene locus_tag LOCUS_39510 1964 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 2776 1982 gene locus_tag LOCUS_39520 2776 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 3887 2988 gene locus_tag LOCUS_39530 3887 2988 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 protein_id gnl|my_center|LOCUS_39530 4006 4956 gene locus_tag LOCUS_39540 4006 4956 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786554.1 protein_id gnl|my_center|LOCUS_39540 4969 5925 gene locus_tag LOCUS_39550 4969 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 6333 5956 gene locus_tag LOCUS_39560 6333 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 6596 6429 gene locus_tag LOCUS_39570 6596 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 7126 6593 gene locus_tag LOCUS_39580 7126 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 7500 7234 gene locus_tag LOCUS_39590 7500 7234 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_39590 7787 8119 gene locus_tag LOCUS_39600 7787 8119 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 protein_id gnl|my_center|LOCUS_39600 8112 8384 gene locus_tag LOCUS_39610 8112 8384 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_39610 8585 8334 gene locus_tag LOCUS_39620 8585 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39620 9304 8582 gene locus_tag LOCUS_39630 9304 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39630 11257 9683 gene locus_tag LOCUS_39640 11257 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 12318 11446 gene locus_tag LOCUS_39650 12318 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 13600 12374 gene locus_tag LOCUS_39660 13600 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 15355 13625 gene locus_tag LOCUS_39670 15355 13625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 16592 15390 gene locus_tag LOCUS_39680 16592 15390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 17442 16609 gene locus_tag LOCUS_39690 17442 16609 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532943.1 protein_id gnl|my_center|LOCUS_39690 18637 17522 gene locus_tag LOCUS_39700 18637 17522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 19671 18757 gene locus_tag LOCUS_39710 19671 18757 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226917.1 protein_id gnl|my_center|LOCUS_39710 >Feature sequence097 <1 763 gene locus_tag LOCUS_39720 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000894643.1:mechanosensitive ion channel family protein 849 3185 gene locus_tag LOCUS_39730 849 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39730 3210 4253 gene locus_tag LOCUS_39740 3210 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39740 5444 4353 gene locus_tag LOCUS_39750 5444 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39750 6756 5464 gene locus_tag LOCUS_39760 6756 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 7923 7024 gene locus_tag LOCUS_39770 7923 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 8251 9462 gene locus_tag LOCUS_39780 8251 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39780 9468 10823 gene locus_tag LOCUS_39790 9468 10823 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_39790 11072 11239 gene locus_tag LOCUS_39800 11072 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 11270 11485 gene locus_tag LOCUS_39810 11270 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 11487 12893 gene locus_tag LOCUS_39820 11487 12893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 13543 13043 gene locus_tag LOCUS_39830 13543 13043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 15283 13556 gene locus_tag LOCUS_39840 15283 13556 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545979.1 protein_id gnl|my_center|LOCUS_39840 17119 15296 gene locus_tag LOCUS_39850 17119 15296 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404166.1 protein_id gnl|my_center|LOCUS_39850 17365 19374 gene locus_tag LOCUS_39860 17365 19374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 >Feature sequence098 1171 77 gene locus_tag LOCUS_39870 1171 77 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189457038.1 protein_id gnl|my_center|LOCUS_39870 3629 1266 gene locus_tag LOCUS_39880 3629 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 3826 3912 gene locus_tag LOCUS_t00440 3826 3912 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4032 5318 gene locus_tag LOCUS_39890 4032 5318 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_39890 5329 6468 gene locus_tag LOCUS_39900 5329 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 6481 7896 gene locus_tag LOCUS_39910 6481 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 7908 8948 gene locus_tag LOCUS_39920 7908 8948 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_39920 8977 10128 gene locus_tag LOCUS_39930 8977 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 10242 10658 gene locus_tag LOCUS_39940 10242 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 10786 12228 gene locus_tag LOCUS_39950 10786 12228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 12244 13074 gene locus_tag LOCUS_39960 gene larE 12244 13074 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_39960 13123 13659 gene locus_tag LOCUS_39970 gene def 13123 13659 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_39970 13680 14501 gene locus_tag LOCUS_39980 13680 14501 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_39980 14513 15517 gene locus_tag LOCUS_39990 14513 15517 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393336.1 protein_id gnl|my_center|LOCUS_39990 15542 15787 gene locus_tag LOCUS_40000 15542 15787 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147008.1 protein_id gnl|my_center|LOCUS_40000 15821 16264 gene locus_tag LOCUS_40010 gene moaE 15821 16264 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149946.1 protein_id gnl|my_center|LOCUS_40010 17746 16319 gene locus_tag LOCUS_40020 17746 16319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 19619 17895 gene locus_tag LOCUS_40030 19619 17895 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403891.1 protein_id gnl|my_center|LOCUS_40030 >Feature sequence099 3259 2876 gene locus_tag LOCUS_40040 3259 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 3487 5613 gene locus_tag LOCUS_40050 3487 5613 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 protein_id gnl|my_center|LOCUS_40050 6408 5680 gene locus_tag LOCUS_40060 6408 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 7270 6500 gene locus_tag LOCUS_40070 7270 6500 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405089.1 protein_id gnl|my_center|LOCUS_40070 8193 7270 gene locus_tag LOCUS_40080 8193 7270 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405088.1 protein_id gnl|my_center|LOCUS_40080 9157 8276 gene locus_tag LOCUS_40090 gene cyoE 9157 8276 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_40090 9362 11878 gene locus_tag LOCUS_40100 9362 11878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 13864 11897 gene locus_tag LOCUS_40110 13864 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 15301 13865 gene locus_tag LOCUS_40120 15301 13865 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_40120 16760 15318 gene locus_tag LOCUS_40130 16760 15318 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922306.1 protein_id gnl|my_center|LOCUS_40130 17810 16779 gene locus_tag LOCUS_40140 17810 16779 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 protein_id gnl|my_center|LOCUS_40140 >Feature sequence100 1109 258 gene locus_tag LOCUS_40150 1109 258 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062346.1 protein_id gnl|my_center|LOCUS_40150 1654 1142 gene locus_tag LOCUS_40160 1654 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 1576 1758 gene locus_tag LOCUS_40170 1576 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 3320 1962 gene locus_tag LOCUS_40180 3320 1962 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122716.1 protein_id gnl|my_center|LOCUS_40180 4391 3330 gene locus_tag LOCUS_40190 4391 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 4544 7213 gene locus_tag LOCUS_40200 gene glnD 4544 7213 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_40200 7433 8716 gene locus_tag LOCUS_40210 gene rho 7433 8716 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_40210 8810 9088 gene locus_tag LOCUS_40220 8810 9088 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_40220 9176 10243 gene locus_tag LOCUS_40230 gene prfA 9176 10243 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_40230 10253 11110 gene locus_tag LOCUS_40240 gene prmC 10253 11110 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_40240 11295 12263 gene locus_tag LOCUS_40250 11295 12263 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_40250 12294 14822 gene locus_tag LOCUS_40260 gene secDF 12294 14822 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_40260 14989 17577 gene locus_tag LOCUS_40270 14989 17577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 18124 17705 gene locus_tag LOCUS_40280 18124 17705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 18879 18631 gene locus_tag LOCUS_40290 18879 18631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 19275 18970 gene locus_tag LOCUS_40300 19275 18970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 >Feature sequence101 471 1208 gene locus_tag LOCUS_40310 471 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 1234 3330 gene locus_tag LOCUS_40320 1234 3330 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582700.1 protein_id gnl|my_center|LOCUS_40320 3364 3630 gene locus_tag LOCUS_40330 3364 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 3632 4210 gene locus_tag LOCUS_40340 3632 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40340 4276 5271 gene locus_tag LOCUS_40350 4276 5271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970413.1 protein_id gnl|my_center|LOCUS_40350 5272 6408 gene locus_tag LOCUS_40360 5272 6408 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584053.1 protein_id gnl|my_center|LOCUS_40360 6421 7173 gene locus_tag LOCUS_40370 gene yfaU 6421 7173 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992954.1 protein_id gnl|my_center|LOCUS_40370 7175 8182 gene locus_tag LOCUS_40380 7175 8182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584052.1 protein_id gnl|my_center|LOCUS_40380 8175 9188 gene locus_tag LOCUS_40390 8175 9188 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_40390 9235 9621 gene locus_tag LOCUS_40400 9235 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 9707 10753 gene locus_tag LOCUS_40410 9707 10753 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_40410 10764 11582 gene locus_tag LOCUS_40420 10764 11582 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_40420 11586 13193 gene locus_tag LOCUS_40430 11586 13193 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_40430 13200 13940 gene locus_tag LOCUS_40440 13200 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 13928 14926 gene locus_tag LOCUS_40450 13928 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 15432 15061 gene locus_tag LOCUS_40460 15432 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 16338 15445 gene locus_tag LOCUS_40470 16338 15445 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071010.1 protein_id gnl|my_center|LOCUS_40470 16435 16659 gene locus_tag LOCUS_40480 16435 16659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 16656 17447 gene locus_tag LOCUS_40490 16656 17447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 18331 17477 gene locus_tag LOCUS_40500 18331 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 <19422 18336 gene locus_tag LOCUS_40510 <19422 18336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250499.1:alanine--glyoxylate aminotransferase family protein >Feature sequence102 396 232 gene locus_tag LOCUS_40520 396 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 1254 442 gene locus_tag LOCUS_40530 1254 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 2885 1266 gene locus_tag LOCUS_40540 2885 1266 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_40540 3989 2901 gene locus_tag LOCUS_40550 3989 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 4170 5009 gene locus_tag LOCUS_40560 4170 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 5019 5801 gene locus_tag LOCUS_40570 gene hpaI 5019 5801 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027999571.1 protein_id gnl|my_center|LOCUS_40570 5798 6661 gene locus_tag LOCUS_40580 5798 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 6709 7581 gene locus_tag LOCUS_40590 6709 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 8111 7599 gene locus_tag LOCUS_40600 8111 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 8241 8381 gene locus_tag LOCUS_40610 8241 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 8424 8759 gene locus_tag LOCUS_40620 8424 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 9660 8806 gene locus_tag LOCUS_40630 9660 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 11127 9661 gene locus_tag LOCUS_40640 11127 9661 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_40640 11442 12338 gene locus_tag LOCUS_40650 11442 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 13177 12359 gene locus_tag LOCUS_40660 13177 12359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 13356 14384 gene locus_tag LOCUS_40670 13356 14384 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_40670 14460 15347 gene locus_tag LOCUS_40680 14460 15347 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815464.1 protein_id gnl|my_center|LOCUS_40680 15344 17062 gene locus_tag LOCUS_40690 15344 17062 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_40690 17071 18453 gene locus_tag LOCUS_40700 17071 18453 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_40700 19286 18459 gene locus_tag LOCUS_40710 19286 18459 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_40710 >Feature sequence103 1438 134 gene locus_tag LOCUS_40720 1438 134 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972423.1 protein_id gnl|my_center|LOCUS_40720 1679 1371 gene locus_tag LOCUS_40730 1679 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 2165 1710 gene locus_tag LOCUS_40740 2165 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 2629 3600 gene locus_tag LOCUS_40750 2629 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 3617 4888 gene locus_tag LOCUS_40760 3617 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 5461 5048 gene locus_tag LOCUS_40770 5461 5048 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911313.1 protein_id gnl|my_center|LOCUS_40770 5703 5452 gene locus_tag LOCUS_40780 5703 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 5829 6815 gene locus_tag LOCUS_40790 5829 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 10024 6938 gene locus_tag LOCUS_40800 gene glnE 10024 6938 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_40800 10376 10038 gene locus_tag LOCUS_40810 10376 10038 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225869.1 protein_id gnl|my_center|LOCUS_40810 10472 10825 gene locus_tag LOCUS_40820 10472 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 10833 11402 gene locus_tag LOCUS_40830 10833 11402 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463348.1 protein_id gnl|my_center|LOCUS_40830 12573 11377 gene locus_tag LOCUS_40840 12573 11377 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_40840 13150 12587 gene locus_tag LOCUS_40850 13150 12587 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944374.1 protein_id gnl|my_center|LOCUS_40850 13319 14317 gene locus_tag LOCUS_40860 13319 14317 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_40860 14318 16198 gene locus_tag LOCUS_40870 gene glgB 14318 16198 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324338.1 protein_id gnl|my_center|LOCUS_40870 16400 16576 gene locus_tag LOCUS_40880 16400 16576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 16638 16814 gene locus_tag LOCUS_40890 16638 16814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40890 16815 17102 gene locus_tag LOCUS_40900 16815 17102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40900 17661 17371 gene locus_tag LOCUS_40910 17661 17371 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_40910 17890 17645 gene locus_tag LOCUS_40920 17890 17645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 18379 17897 gene locus_tag LOCUS_40930 18379 17897 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582524.1 protein_id gnl|my_center|LOCUS_40930 18632 18381 gene locus_tag LOCUS_40940 18632 18381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 >Feature sequence104 1382 813 gene locus_tag LOCUS_40950 1382 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 3682 1406 gene locus_tag LOCUS_40960 3682 1406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_40960 5914 3689 gene locus_tag LOCUS_40970 5914 3689 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_40970 6682 5951 gene locus_tag LOCUS_40980 6682 5951 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_40980 7918 6707 gene locus_tag LOCUS_40990 7918 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 8066 9766 gene locus_tag LOCUS_41000 8066 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 10136 9840 gene locus_tag LOCUS_41010 10136 9840 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_41010 10427 10146 gene locus_tag LOCUS_41020 10427 10146 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_41020 14290 10484 gene locus_tag LOCUS_41030 14290 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 16227 14455 gene locus_tag LOCUS_41040 16227 14455 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972438.1 protein_id gnl|my_center|LOCUS_41040 17645 16233 gene locus_tag LOCUS_41050 gene pyk 17645 16233 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_41050 17830 17678 gene locus_tag LOCUS_41060 17830 17678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 18596 17988 gene locus_tag LOCUS_41070 18596 17988 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020205.1 protein_id gnl|my_center|LOCUS_41070 18700 19023 gene locus_tag LOCUS_41080 18700 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 >Feature sequence105 25 1731 gene locus_tag LOCUS_41090 gene frdA 25 1731 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898925.1 protein_id gnl|my_center|LOCUS_41090 1742 2494 gene locus_tag LOCUS_41100 gene sdhB 1742 2494 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407767.1 protein_id gnl|my_center|LOCUS_41100 2491 2925 gene locus_tag LOCUS_41110 2491 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 2941 3303 gene locus_tag LOCUS_41120 gene frdD 2941 3303 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456924.1 protein_id gnl|my_center|LOCUS_41120 4458 3385 gene locus_tag LOCUS_41130 4458 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 5996 4473 gene locus_tag LOCUS_41140 5996 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 7975 6017 gene locus_tag LOCUS_41150 7975 6017 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109364.1 protein_id gnl|my_center|LOCUS_41150 10140 8014 gene locus_tag LOCUS_41160 10140 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 10316 10654 gene locus_tag LOCUS_41170 gene glnK 10316 10654 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_41170 10681 12009 gene locus_tag LOCUS_41180 gene amt 10681 12009 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109815.1 protein_id gnl|my_center|LOCUS_41180 12158 12496 gene locus_tag LOCUS_41190 gene glnK 12158 12496 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_41190 12533 13858 gene locus_tag LOCUS_41200 gene amt 12533 13858 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109815.1 protein_id gnl|my_center|LOCUS_41200 13992 14951 gene locus_tag LOCUS_41210 13992 14951 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_41210 14948 16546 gene locus_tag LOCUS_41220 14948 16546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 17596 16550 gene locus_tag LOCUS_41230 17596 16550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 17621 18385 gene locus_tag LOCUS_41240 17621 18385 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_41240 18684 18388 gene locus_tag LOCUS_41250 18684 18388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 >Feature sequence106 1002 58 gene locus_tag LOCUS_41260 gene uxuA 1002 58 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426045.1 protein_id gnl|my_center|LOCUS_41260 2030 1020 gene locus_tag LOCUS_41270 2030 1020 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705009.1 protein_id gnl|my_center|LOCUS_41270 3690 2032 gene locus_tag LOCUS_41280 3690 2032 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_41280 4563 3778 gene locus_tag LOCUS_41290 4563 3778 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259154.1 protein_id gnl|my_center|LOCUS_41290 5333 4575 gene locus_tag LOCUS_41300 5333 4575 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259153.1 protein_id gnl|my_center|LOCUS_41300 6349 5375 gene locus_tag LOCUS_41310 6349 5375 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259152.1 protein_id gnl|my_center|LOCUS_41310 7667 6381 gene locus_tag LOCUS_41320 7667 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 7891 9561 gene locus_tag LOCUS_41330 7891 9561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929086.1 protein_id gnl|my_center|LOCUS_41330 9558 11306 gene locus_tag LOCUS_41340 9558 11306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142714.1 protein_id gnl|my_center|LOCUS_41340 11357 11776 gene locus_tag LOCUS_41350 11357 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 11796 12563 gene locus_tag LOCUS_41360 11796 12563 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121332.1 protein_id gnl|my_center|LOCUS_41360 12627 13922 gene locus_tag LOCUS_41370 12627 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 13952 14830 gene locus_tag LOCUS_41380 13952 14830 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_41380 14830 15780 gene locus_tag LOCUS_41390 14830 15780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 15859 17040 gene locus_tag LOCUS_41400 15859 17040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 17203 17511 gene locus_tag LOCUS_41410 17203 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 >Feature sequence107 1234 47 gene locus_tag LOCUS_41420 1234 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 2135 1803 gene locus_tag LOCUS_41430 2135 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 3043 2585 gene locus_tag LOCUS_41440 3043 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 3423 3223 gene locus_tag LOCUS_41450 3423 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 4015 3500 gene locus_tag LOCUS_41460 4015 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 4272 4048 gene locus_tag LOCUS_41470 4272 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 6549 4525 gene locus_tag LOCUS_41480 6549 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 7451 7803 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acatctgagatgctattgtc 9883 11706 gene locus_tag LOCUS_41490 9883 11706 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404200.1 protein_id gnl|my_center|LOCUS_41490 11874 11677 gene locus_tag LOCUS_41500 11874 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 12053 11919 gene locus_tag LOCUS_41510 12053 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 12210 12449 gene locus_tag LOCUS_41520 12210 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 12460 12645 gene locus_tag LOCUS_41530 12460 12645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 12649 13002 gene locus_tag LOCUS_41540 12649 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 13013 13228 gene locus_tag LOCUS_41550 13013 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 13669 13869 gene locus_tag LOCUS_41560 13669 13869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 14161 14616 gene locus_tag LOCUS_41570 14161 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 14683 15126 gene locus_tag LOCUS_41580 14683 15126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 15183 15326 gene locus_tag LOCUS_41590 15183 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 15374 15604 gene locus_tag LOCUS_41600 15374 15604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 15729 16232 gene locus_tag LOCUS_41610 15729 16232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 16292 16549 gene locus_tag LOCUS_41620 16292 16549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 16833 16660 gene locus_tag LOCUS_41630 16833 16660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 >Feature sequence108 268 936 gene locus_tag LOCUS_41640 268 936 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243047.1 protein_id gnl|my_center|LOCUS_41640 939 1127 gene locus_tag LOCUS_41650 939 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 1274 3253 gene locus_tag LOCUS_41660 1274 3253 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_41660 3250 4140 gene locus_tag LOCUS_41670 3250 4140 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_41670 4150 6345 gene locus_tag LOCUS_41680 4150 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 6369 7631 gene locus_tag LOCUS_41690 6369 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 7996 11109 gene locus_tag LOCUS_41700 gene ileS 7996 11109 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_41700 11421 11179 gene locus_tag LOCUS_41710 11421 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 12582 11440 gene locus_tag LOCUS_41720 12582 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 13184 12618 gene locus_tag LOCUS_41730 13184 12618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 13708 13193 gene locus_tag LOCUS_41740 13708 13193 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730372.1 protein_id gnl|my_center|LOCUS_41740 14675 13713 gene locus_tag LOCUS_41750 14675 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 15306 14686 gene locus_tag LOCUS_41760 15306 14686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 16694 15303 gene locus_tag LOCUS_41770 gene argH 16694 15303 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_41770 >Feature sequence109 339 70 gene locus_tag LOCUS_41780 339 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 2273 336 gene locus_tag LOCUS_41790 2273 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 2613 2296 gene locus_tag LOCUS_41800 2613 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 3762 3382 gene locus_tag LOCUS_41810 3762 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 5897 4182 gene locus_tag LOCUS_41820 5897 4182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 protein_id gnl|my_center|LOCUS_41820 7107 5929 gene locus_tag LOCUS_41830 7107 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 7986 7180 gene locus_tag LOCUS_41840 7986 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 9612 8494 gene locus_tag LOCUS_41850 9612 8494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086353.1 protein_id gnl|my_center|LOCUS_41850 10670 9609 gene locus_tag LOCUS_41860 gene ugpC 10670 9609 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972369.1 protein_id gnl|my_center|LOCUS_41860 11533 10670 gene locus_tag LOCUS_41870 11533 10670 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034858202.1 protein_id gnl|my_center|LOCUS_41870 12408 11530 gene locus_tag LOCUS_41880 12408 11530 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970661.1 protein_id gnl|my_center|LOCUS_41880 12742 12458 gene locus_tag LOCUS_41890 12742 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 13875 12835 gene locus_tag LOCUS_41900 gene ychF 13875 12835 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393954.1 protein_id gnl|my_center|LOCUS_41900 13996 14760 gene locus_tag LOCUS_41910 13996 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 15444 14797 gene locus_tag LOCUS_41920 15444 14797 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366622.1 protein_id gnl|my_center|LOCUS_41920 15552 16373 gene locus_tag LOCUS_41930 15552 16373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 >Feature sequence110 <1 1319 gene locus_tag LOCUS_41940 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_195899535.1:arylsulfatase 1337 2092 gene locus_tag LOCUS_41950 1337 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 2096 3520 gene locus_tag LOCUS_41960 2096 3520 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120134.1 protein_id gnl|my_center|LOCUS_41960 3530 4768 gene locus_tag LOCUS_41970 3530 4768 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_41970 4787 5512 gene locus_tag LOCUS_41980 4787 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 5512 6549 gene locus_tag LOCUS_41990 5512 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 6559 7740 gene locus_tag LOCUS_42000 gene purT 6559 7740 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 protein_id gnl|my_center|LOCUS_42000 9005 7803 gene locus_tag LOCUS_42010 9005 7803 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529507.1 protein_id gnl|my_center|LOCUS_42010 9103 10464 gene locus_tag LOCUS_42020 9103 10464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 10479 11531 gene locus_tag LOCUS_42030 gene mnmA 10479 11531 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657419.1 protein_id gnl|my_center|LOCUS_42030 11546 12295 gene locus_tag LOCUS_42040 11546 12295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 12324 13268 gene locus_tag LOCUS_42050 12324 13268 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968890.1 protein_id gnl|my_center|LOCUS_42050 13261 14148 gene locus_tag LOCUS_42060 gene pheA 13261 14148 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404690.1 protein_id gnl|my_center|LOCUS_42060 14160 16286 gene locus_tag LOCUS_42070 14160 16286 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904206.1 protein_id gnl|my_center|LOCUS_42070 >Feature sequence111 82 1170 gene locus_tag LOCUS_42080 gene hemL 82 1170 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_42080 1180 1902 gene locus_tag LOCUS_42090 1180 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 1904 2704 gene locus_tag LOCUS_42100 1904 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 2715 3149 gene locus_tag LOCUS_42110 gene hemJ 2715 3149 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067412.1 protein_id gnl|my_center|LOCUS_42110 3174 3923 gene locus_tag LOCUS_42120 3174 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 4374 7157 gene locus_tag LOCUS_42130 4374 7157 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081615318.1 protein_id gnl|my_center|LOCUS_42130 11085 7198 gene locus_tag LOCUS_42140 11085 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 12485 11355 gene locus_tag LOCUS_42150 12485 11355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 12957 12573 gene locus_tag LOCUS_tm00010 12957 12573 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13946 13011 gene locus_tag LOCUS_42160 13946 13011 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_42160 15401 14055 gene locus_tag LOCUS_42170 15401 14055 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_42170 16126 15401 gene locus_tag LOCUS_42180 16126 15401 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004530.1 protein_id gnl|my_center|LOCUS_42180 >Feature sequence112 631 933 gene locus_tag LOCUS_42190 631 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42190 946 1953 gene locus_tag LOCUS_42200 946 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42200 1967 2959 gene locus_tag LOCUS_42210 1967 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 3010 3570 gene locus_tag LOCUS_42220 3010 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 3790 4911 gene locus_tag LOCUS_42230 3790 4911 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 protein_id gnl|my_center|LOCUS_42230 5132 5278 gene locus_tag LOCUS_42240 5132 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 6312 5428 gene locus_tag LOCUS_42250 6312 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 7092 6346 gene locus_tag LOCUS_42260 7092 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 7462 7229 gene locus_tag LOCUS_42270 7462 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 7688 8185 gene locus_tag LOCUS_42280 gene rraA 7688 8185 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191744.1 protein_id gnl|my_center|LOCUS_42280 8220 9587 gene locus_tag LOCUS_42290 8220 9587 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_42290 9597 10580 gene locus_tag LOCUS_42300 9597 10580 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_42300 10744 11091 gene locus_tag LOCUS_42310 10744 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 12091 11117 gene locus_tag LOCUS_42320 12091 11117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42320 13082 12096 gene locus_tag LOCUS_42330 13082 12096 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_42330 13828 13100 gene locus_tag LOCUS_42340 13828 13100 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_42340 15272 13836 gene locus_tag LOCUS_42350 15272 13836 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064158.1 protein_id gnl|my_center|LOCUS_42350 16021 15281 gene locus_tag LOCUS_42360 16021 15281 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_42360 >Feature sequence113 1008 2438 gene locus_tag LOCUS_42370 1008 2438 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_42370 2466 3632 gene locus_tag LOCUS_42380 2466 3632 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_42380 3646 4392 gene locus_tag LOCUS_42390 3646 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 4419 5903 gene locus_tag LOCUS_42400 4419 5903 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228174.1 protein_id gnl|my_center|LOCUS_42400 5851 6048 gene locus_tag LOCUS_42410 5851 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 8439 6115 gene locus_tag LOCUS_42420 gene recQ 8439 6115 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681287.1 protein_id gnl|my_center|LOCUS_42420 9391 8441 gene locus_tag LOCUS_42430 9391 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 11271 9910 gene locus_tag LOCUS_42440 11271 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 13862 11268 gene locus_tag LOCUS_42450 13862 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 14524 13985 gene locus_tag LOCUS_42460 14524 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 14848 14537 gene locus_tag LOCUS_42470 14848 14537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 15485 14886 gene locus_tag LOCUS_42480 15485 14886 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_42480 >Feature sequence114 680 321 gene locus_tag LOCUS_42490 680 321 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190909147.1 protein_id gnl|my_center|LOCUS_42490 964 677 gene locus_tag LOCUS_42500 964 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 1168 2238 gene locus_tag LOCUS_42510 gene murG 1168 2238 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724779.1 protein_id gnl|my_center|LOCUS_42510 2244 4214 gene locus_tag LOCUS_42520 2244 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 4237 5133 gene locus_tag LOCUS_42530 4237 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 5605 10137 gene locus_tag LOCUS_42540 5605 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 10609 12045 gene locus_tag LOCUS_42550 10609 12045 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_42550 >Feature sequence115 405 52 gene locus_tag LOCUS_42560 405 52 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_42560 1439 630 gene locus_tag LOCUS_42570 1439 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42570 1702 1451 gene locus_tag LOCUS_42580 1702 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 2571 1774 gene locus_tag LOCUS_42590 2571 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 6541 2603 gene locus_tag LOCUS_42600 6541 2603 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990725.1 protein_id gnl|my_center|LOCUS_42600 6940 6596 gene locus_tag LOCUS_42610 6940 6596 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788017.1 protein_id gnl|my_center|LOCUS_42610 7516 6953 gene locus_tag LOCUS_42620 7516 6953 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020402.1 protein_id gnl|my_center|LOCUS_42620 8699 7539 gene locus_tag LOCUS_42630 8699 7539 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_42630 9510 8725 gene locus_tag LOCUS_42640 9510 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 9748 9503 gene locus_tag LOCUS_42650 9748 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 10400 9831 gene locus_tag LOCUS_42660 10400 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256223.1 protein_id gnl|my_center|LOCUS_42660 12800 10422 gene locus_tag LOCUS_42670 12800 10422 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926859.1 protein_id gnl|my_center|LOCUS_42670 14200 12980 gene locus_tag LOCUS_42680 gene zigA 14200 12980 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_42680 14592 14215 gene locus_tag LOCUS_42690 14592 14215 CDS product SaoD/DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058111.1 protein_id gnl|my_center|LOCUS_42690 >Feature sequence116 393 1715 gene locus_tag LOCUS_42700 393 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 3266 1719 gene locus_tag LOCUS_42710 gene xylB 3266 1719 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762617.1 protein_id gnl|my_center|LOCUS_42710 3944 3333 gene locus_tag LOCUS_42720 3944 3333 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 protein_id gnl|my_center|LOCUS_42720 4080 4709 gene locus_tag LOCUS_42730 4080 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 4796 6175 gene locus_tag LOCUS_42740 4796 6175 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_42740 6187 6804 gene locus_tag LOCUS_42750 6187 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 7097 7999 gene locus_tag LOCUS_42760 gene htpX 7097 7999 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402892.1 protein_id gnl|my_center|LOCUS_42760 8144 8329 gene locus_tag LOCUS_42770 8144 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 8360 11497 gene locus_tag LOCUS_42780 8360 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 11487 13040 gene locus_tag LOCUS_42790 11487 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 13054 13812 gene locus_tag LOCUS_42800 13054 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 14832 13894 gene locus_tag LOCUS_42810 14832 13894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 >Feature sequence117 1714 848 gene locus_tag LOCUS_42820 1714 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 2108 1740 gene locus_tag LOCUS_42830 2108 1740 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_42830 2394 2098 gene locus_tag LOCUS_42840 2394 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 3457 2483 gene locus_tag LOCUS_42850 3457 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 4283 3471 gene locus_tag LOCUS_42860 4283 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 5952 4411 gene locus_tag LOCUS_42870 5952 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 7857 5965 gene locus_tag LOCUS_42880 7857 5965 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_42880 8343 7876 gene locus_tag LOCUS_42890 8343 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 8635 9810 gene locus_tag LOCUS_42900 8635 9810 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_42900 10040 13201 gene locus_tag LOCUS_42910 10040 13201 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_42910 14548 13202 gene locus_tag LOCUS_42920 14548 13202 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_42920 >Feature sequence118 828 115 gene locus_tag LOCUS_42930 828 115 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_42930 1592 825 gene locus_tag LOCUS_42940 1592 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 2299 1589 gene locus_tag LOCUS_42950 gene truC 2299 1589 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705086.1 protein_id gnl|my_center|LOCUS_42950 3004 2306 gene locus_tag LOCUS_42960 3004 2306 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_42960 4738 3218 gene locus_tag LOCUS_42970 4738 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 5508 4735 gene locus_tag LOCUS_42980 5508 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 6853 5531 gene locus_tag LOCUS_42990 6853 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 7688 6861 gene locus_tag LOCUS_43000 7688 6861 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455010.1 protein_id gnl|my_center|LOCUS_43000 8904 7690 gene locus_tag LOCUS_43010 8904 7690 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_43010 10036 8930 gene locus_tag LOCUS_43020 10036 8930 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669547.1 protein_id gnl|my_center|LOCUS_43020 11195 10092 gene locus_tag LOCUS_43030 11195 10092 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669547.1 protein_id gnl|my_center|LOCUS_43030 12301 11192 gene locus_tag LOCUS_43040 12301 11192 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722797.1 protein_id gnl|my_center|LOCUS_43040 12479 13243 gene locus_tag LOCUS_43050 gene pyrH 12479 13243 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248055.1 protein_id gnl|my_center|LOCUS_43050 13240 14514 gene locus_tag LOCUS_43060 gene purD 13240 14514 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_43060 >Feature sequence119 <1 893 gene locus_tag LOCUS_43070 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870027.1:ABC transporter ATP-binding protein 994 2376 gene locus_tag LOCUS_43080 994 2376 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095714.1 protein_id gnl|my_center|LOCUS_43080 2376 3152 gene locus_tag LOCUS_43090 2376 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 4081 3230 gene locus_tag LOCUS_43100 4081 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 4566 4099 gene locus_tag LOCUS_43110 4566 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 4773 4698 gene locus_tag LOCUS_t00450 4773 4698 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5905 4823 gene locus_tag LOCUS_43120 gene ddlA 5905 4823 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095807.1 protein_id gnl|my_center|LOCUS_43120 6594 5902 gene locus_tag LOCUS_43130 6594 5902 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421523.1 protein_id gnl|my_center|LOCUS_43130 7822 6656 gene locus_tag LOCUS_43140 gene ispD 7822 6656 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 protein_id gnl|my_center|LOCUS_43140 9027 7846 gene locus_tag LOCUS_43150 9027 7846 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_43150 10082 9045 gene locus_tag LOCUS_43160 gene queA 10082 9045 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_43160 10907 10128 gene locus_tag LOCUS_43170 10907 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 11130 12170 gene locus_tag LOCUS_43180 11130 12170 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539819.1 protein_id gnl|my_center|LOCUS_43180 13057 12248 gene locus_tag LOCUS_43190 13057 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 13878 13078 gene locus_tag LOCUS_43200 13878 13078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 >Feature sequence120 223 1599 gene locus_tag LOCUS_43210 223 1599 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_43210 1610 2725 gene locus_tag LOCUS_43220 1610 2725 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541251.1 protein_id gnl|my_center|LOCUS_43220 2743 4389 gene locus_tag LOCUS_43230 2743 4389 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262062.1 protein_id gnl|my_center|LOCUS_43230 4667 5365 gene locus_tag LOCUS_43240 4667 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 5378 8599 gene locus_tag LOCUS_43250 5378 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 8623 10932 gene locus_tag LOCUS_43260 8623 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 10949 11890 gene locus_tag LOCUS_43270 10949 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 11899 13269 gene locus_tag LOCUS_43280 11899 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 >Feature sequence121 <1 970 gene locus_tag LOCUS_43290 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121745.1:Ig-like domain-containing protein 967 1911 gene locus_tag LOCUS_43300 967 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 1928 2665 gene locus_tag LOCUS_43310 1928 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 2677 3732 gene locus_tag LOCUS_43320 2677 3732 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013798.1 protein_id gnl|my_center|LOCUS_43320 3758 4411 gene locus_tag LOCUS_43330 3758 4411 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004438834.1 protein_id gnl|my_center|LOCUS_43330 4477 4550 gene locus_tag LOCUS_t00460 4477 4550 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4680 5585 gene locus_tag LOCUS_43340 4680 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 5650 5736 gene locus_tag LOCUS_t00470 5650 5736 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6778 5792 gene locus_tag LOCUS_43350 6778 5792 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_43350 7727 6765 gene locus_tag LOCUS_43360 gene pdhA 7727 6765 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_43360 8903 7740 gene locus_tag LOCUS_43370 8903 7740 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943072.1 protein_id gnl|my_center|LOCUS_43370 10342 8921 gene locus_tag LOCUS_43380 10342 8921 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828465.1 protein_id gnl|my_center|LOCUS_43380 11195 10362 gene locus_tag LOCUS_43390 11195 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 12856 11270 gene locus_tag LOCUS_43400 12856 11270 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 protein_id gnl|my_center|LOCUS_43400 13633 12929 gene locus_tag LOCUS_43410 13633 12929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 >Feature sequence122 1244 423 gene locus_tag LOCUS_43420 1244 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 2791 1358 gene locus_tag LOCUS_43430 2791 1358 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_43430 3598 2807 gene locus_tag LOCUS_43440 3598 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 4431 3613 gene locus_tag LOCUS_43450 4431 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 5774 4446 gene locus_tag LOCUS_43460 5774 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 7600 5804 gene locus_tag LOCUS_43470 7600 5804 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_43470 7815 10265 gene locus_tag LOCUS_43480 7815 10265 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_43480 12185 10332 gene locus_tag LOCUS_43490 12185 10332 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_43490 >Feature sequence123 <1 850 gene locus_tag LOCUS_43500 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097377.1:PIN domain-containing protein 1050 904 gene locus_tag LOCUS_43510 1050 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 1181 1819 gene locus_tag LOCUS_43520 1181 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 2005 4512 gene locus_tag LOCUS_43530 2005 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 7547 4575 gene locus_tag LOCUS_43540 7547 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 8249 7992 gene locus_tag LOCUS_43550 8249 7992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 8624 8815 gene locus_tag LOCUS_43560 8624 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 8885 9151 gene locus_tag LOCUS_43570 8885 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 9156 10889 gene locus_tag LOCUS_43580 9156 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 11247 12965 gene locus_tag LOCUS_43590 11247 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 >Feature sequence124 1491 913 gene locus_tag LOCUS_43600 1491 913 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921887.1 protein_id gnl|my_center|LOCUS_43600 2451 1504 gene locus_tag LOCUS_43610 2451 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 3447 2476 gene locus_tag LOCUS_43620 3447 2476 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760615.1 protein_id gnl|my_center|LOCUS_43620 4502 3477 gene locus_tag LOCUS_43630 4502 3477 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_43630 5941 4520 gene locus_tag LOCUS_43640 5941 4520 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_43640 6052 7353 gene locus_tag LOCUS_43650 6052 7353 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_43650 8124 7447 gene locus_tag LOCUS_43660 8124 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 8589 8152 gene locus_tag LOCUS_43670 8589 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 8753 9163 gene locus_tag LOCUS_43680 8753 9163 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477591.1 protein_id gnl|my_center|LOCUS_43680 9184 10011 gene locus_tag LOCUS_43690 9184 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 11366 10101 gene locus_tag LOCUS_43700 11366 10101 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_43700 11466 12269 gene locus_tag LOCUS_43710 11466 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 >Feature sequence125 2 841 gene locus_tag LOCUS_43720 gene thyA 2 841 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948554.1 protein_id gnl|my_center|LOCUS_43720 848 1561 gene locus_tag LOCUS_43730 848 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 1608 2498 gene locus_tag LOCUS_43740 1608 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 3311 2508 gene locus_tag LOCUS_43750 3311 2508 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036011.1 protein_id gnl|my_center|LOCUS_43750 4155 3325 gene locus_tag LOCUS_43760 4155 3325 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_43760 5036 4167 gene locus_tag LOCUS_43770 5036 4167 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062346.1 protein_id gnl|my_center|LOCUS_43770 5515 5033 gene locus_tag LOCUS_43780 5515 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 6854 5679 gene locus_tag LOCUS_43790 6854 5679 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965740.1 protein_id gnl|my_center|LOCUS_43790 8243 7023 gene locus_tag LOCUS_43800 8243 7023 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256710.1 protein_id gnl|my_center|LOCUS_43800 8306 9037 gene locus_tag LOCUS_43810 8306 9037 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957897.1 protein_id gnl|my_center|LOCUS_43810 9034 9780 gene locus_tag LOCUS_43820 9034 9780 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846442.1 protein_id gnl|my_center|LOCUS_43820 10509 9799 gene locus_tag LOCUS_43830 10509 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 10809 10591 gene locus_tag LOCUS_43840 10809 10591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 <12275 10866 gene locus_tag LOCUS_43850 <12275 10866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392612.1:cobyric acid synthase >Feature sequence126 <1 1575 gene locus_tag LOCUS_43860 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948187.1:Na+/H+ antiporter NhaC family protein 1671 2612 gene locus_tag LOCUS_43870 gene uxuA 1671 2612 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426045.1 protein_id gnl|my_center|LOCUS_43870 2645 3637 gene locus_tag LOCUS_43880 2645 3637 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259737.1 protein_id gnl|my_center|LOCUS_43880 4263 3706 gene locus_tag LOCUS_43890 4263 3706 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_43890 4878 4279 gene locus_tag LOCUS_43900 4878 4279 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_43900 5782 4883 gene locus_tag LOCUS_43910 5782 4883 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_43910 6027 6896 gene locus_tag LOCUS_43920 gene accD 6027 6896 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_43920 6893 7333 gene locus_tag LOCUS_43930 gene aroQ 6893 7333 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194379.1 protein_id gnl|my_center|LOCUS_43930 8188 7463 gene locus_tag LOCUS_43940 gene nadD 8188 7463 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994703.1 protein_id gnl|my_center|LOCUS_43940 8252 9004 gene locus_tag LOCUS_43950 8252 9004 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_43950 9007 10215 gene locus_tag LOCUS_43960 9007 10215 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_43960 10221 11450 gene locus_tag LOCUS_43970 10221 11450 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_43970 >Feature sequence127 <1 944 gene locus_tag LOCUS_43980 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108631.1:sulfatase-like hydrolase/transferase 2227 929 gene locus_tag LOCUS_43990 gene rsmB 2227 929 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_43990 3571 2255 gene locus_tag LOCUS_44000 3571 2255 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_44000 5002 3572 gene locus_tag LOCUS_44010 5002 3572 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_44010 5792 5028 gene locus_tag LOCUS_44020 5792 5028 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349517.1 protein_id gnl|my_center|LOCUS_44020 5915 6532 gene locus_tag LOCUS_44030 5915 6532 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140946.1 protein_id gnl|my_center|LOCUS_44030 7391 6513 gene locus_tag LOCUS_44040 gene metF 7391 6513 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615859.1 protein_id gnl|my_center|LOCUS_44040 8867 7416 gene locus_tag LOCUS_44050 gene ahcY 8867 7416 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781763.1 protein_id gnl|my_center|LOCUS_44050 9084 9557 gene locus_tag LOCUS_44060 9084 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 10497 9616 gene locus_tag LOCUS_44070 10497 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 >Feature sequence128 464 1618 gene locus_tag LOCUS_44080 gene dgoD 464 1618 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_44080 1649 3055 gene locus_tag LOCUS_44090 1649 3055 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 protein_id gnl|my_center|LOCUS_44090 3175 4422 gene locus_tag LOCUS_44100 3175 4422 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810317.1 protein_id gnl|my_center|LOCUS_44100 4464 5390 gene locus_tag LOCUS_44110 4464 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 6450 5398 gene locus_tag LOCUS_44120 6450 5398 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_44120 7659 6532 gene locus_tag LOCUS_44130 7659 6532 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229000.1 protein_id gnl|my_center|LOCUS_44130 8581 7730 gene locus_tag LOCUS_44140 8581 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 9465 8620 gene locus_tag LOCUS_44150 9465 8620 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965351.1 protein_id gnl|my_center|LOCUS_44150 10319 9492 gene locus_tag LOCUS_44160 10319 9492 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919445.1 protein_id gnl|my_center|LOCUS_44160 11078 10368 gene locus_tag LOCUS_44170 11078 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 >Feature sequence129 67 2022 gene locus_tag LOCUS_44180 67 2022 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141615.1 protein_id gnl|my_center|LOCUS_44180 2038 4260 gene locus_tag LOCUS_44190 2038 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 4330 5022 gene locus_tag LOCUS_44200 4330 5022 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_44200 5024 6847 gene locus_tag LOCUS_44210 gene phoR 5024 6847 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_44210 9039 6898 gene locus_tag LOCUS_44220 9039 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 11259 9103 gene locus_tag LOCUS_44230 11259 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 >Feature sequence130 848 3316 gene locus_tag LOCUS_44240 848 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 4327 3386 gene locus_tag LOCUS_44250 4327 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 6887 4383 gene locus_tag LOCUS_44260 6887 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 10052 6957 gene locus_tag LOCUS_44270 10052 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 10773 10075 gene locus_tag LOCUS_44280 10773 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 >Feature sequence131 1440 3359 gene locus_tag LOCUS_44290 1440 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 3568 5700 gene locus_tag LOCUS_44300 3568 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 6101 5796 gene locus_tag LOCUS_44310 6101 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 6660 6091 gene locus_tag LOCUS_44320 6660 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 7586 7185 gene locus_tag LOCUS_44330 7586 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 8178 7606 gene locus_tag LOCUS_44340 8178 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 8576 8391 gene locus_tag LOCUS_44350 8576 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 8780 9583 gene locus_tag LOCUS_44360 8780 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 9715 10830 gene locus_tag LOCUS_44370 9715 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 10867 11034 gene locus_tag LOCUS_44380 10867 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 >Feature sequence132 800 1966 gene locus_tag LOCUS_44390 gene rnd 800 1966 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_44390 3945 1969 gene locus_tag LOCUS_44400 3945 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 4619 6049 gene locus_tag LOCUS_44410 4619 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 6046 6318 gene locus_tag LOCUS_44420 6046 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 6340 6555 gene locus_tag LOCUS_44430 6340 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 6574 6981 gene locus_tag LOCUS_44440 gene msrB 6574 6981 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_44440 8531 8205 gene locus_tag LOCUS_44450 8531 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 8808 8419 gene locus_tag LOCUS_44460 8808 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 >Feature sequence133 531 109 gene locus_tag LOCUS_44470 531 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 981 565 gene locus_tag LOCUS_44480 gene gloA 981 565 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480812.1 protein_id gnl|my_center|LOCUS_44480 1112 2302 gene locus_tag LOCUS_44490 1112 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 2321 2740 gene locus_tag LOCUS_44500 2321 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 2838 3683 gene locus_tag LOCUS_44510 2838 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 3745 4692 gene locus_tag LOCUS_44520 3745 4692 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_44520 4759 6231 gene locus_tag LOCUS_44530 4759 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198142920.1 protein_id gnl|my_center|LOCUS_44530 6683 7681 gene locus_tag LOCUS_44540 gene trpS 6683 7681 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393419.1 protein_id gnl|my_center|LOCUS_44540 8256 7687 gene locus_tag LOCUS_44550 8256 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 <10875 8271 gene locus_tag LOCUS_44560 <10875 8271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962462.1:DNA polymerase I >Feature sequence134 397 1440 gene locus_tag LOCUS_44570 397 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 1630 3882 gene locus_tag LOCUS_44580 1630 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 3892 5193 gene locus_tag LOCUS_44590 3892 5193 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392273.1 protein_id gnl|my_center|LOCUS_44590 5172 7358 gene locus_tag LOCUS_44600 5172 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 7387 8205 gene locus_tag LOCUS_44610 7387 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 8243 9703 gene locus_tag LOCUS_44620 gene betC 8243 9703 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776263.1 protein_id gnl|my_center|LOCUS_44620 >Feature sequence135 189 1454 gene locus_tag LOCUS_44630 189 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 2695 1463 gene locus_tag LOCUS_44640 2695 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 4202 2742 gene locus_tag LOCUS_44650 4202 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 5419 4250 gene locus_tag LOCUS_44660 5419 4250 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245414.1 protein_id gnl|my_center|LOCUS_44660 6671 5517 gene locus_tag LOCUS_44670 6671 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 7768 6668 gene locus_tag LOCUS_44680 7768 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 8378 7875 gene locus_tag LOCUS_44690 8378 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 8922 8395 gene locus_tag LOCUS_44700 8922 8395 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_44700 9630 9034 gene locus_tag LOCUS_44710 9630 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 10162 9749 gene locus_tag LOCUS_44720 10162 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 >Feature sequence136 <1 596 gene locus_tag LOCUS_44730 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922609.1:sulfatase-like hydrolase/transferase 613 1404 gene locus_tag LOCUS_44740 613 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 1426 3120 gene locus_tag LOCUS_44750 1426 3120 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118507.1 protein_id gnl|my_center|LOCUS_44750 3203 4597 gene locus_tag LOCUS_44760 3203 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 4656 5843 gene locus_tag LOCUS_44770 4656 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 5964 7325 gene locus_tag LOCUS_44780 5964 7325 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_44780 7315 8730 gene locus_tag LOCUS_44790 7315 8730 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_44790 8753 10087 gene locus_tag LOCUS_44800 8753 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 >Feature sequence137 <1 1341 gene locus_tag LOCUS_44810 <1 1341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729326.1:D-aminoacylase 1338 2090 gene locus_tag LOCUS_44820 gene nagB 1338 2090 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118913.1 protein_id gnl|my_center|LOCUS_44820 2117 3211 gene locus_tag LOCUS_44830 gene leuB 2117 3211 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081326.1 protein_id gnl|my_center|LOCUS_44830 3224 4294 gene locus_tag LOCUS_44840 3224 4294 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782642.1 protein_id gnl|my_center|LOCUS_44840 4310 5818 gene locus_tag LOCUS_44850 4310 5818 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_44850 7806 5860 gene locus_tag LOCUS_44860 7806 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 7986 8624 gene locus_tag LOCUS_44870 7986 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 8708 9508 gene locus_tag LOCUS_44880 gene iolE 8708 9508 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968520.1 protein_id gnl|my_center|LOCUS_44880 9795 9526 gene locus_tag LOCUS_44890 9795 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 >Feature sequence138 386 195 gene locus_tag LOCUS_44900 386 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 459 1430 gene locus_tag LOCUS_44910 459 1430 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704826.1 protein_id gnl|my_center|LOCUS_44910 1528 3951 gene locus_tag LOCUS_44920 1528 3951 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615806.1 protein_id gnl|my_center|LOCUS_44920 3951 4805 gene locus_tag LOCUS_44930 3951 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 4823 5851 gene locus_tag LOCUS_44940 4823 5851 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 protein_id gnl|my_center|LOCUS_44940 5863 6792 gene locus_tag LOCUS_44950 5863 6792 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_44950 6792 8708 gene locus_tag LOCUS_44960 6792 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 >Feature sequence139 212 1204 gene locus_tag LOCUS_44970 212 1204 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048295.1 protein_id gnl|my_center|LOCUS_44970 1206 2084 gene locus_tag LOCUS_44980 1206 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 2093 2380 gene locus_tag LOCUS_44990 2093 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 3170 2358 gene locus_tag LOCUS_45000 3170 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 4199 3180 gene locus_tag LOCUS_45010 4199 3180 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_45010 5197 4211 gene locus_tag LOCUS_45020 5197 4211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_45020 6343 5201 gene locus_tag LOCUS_45030 6343 5201 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080422.1 protein_id gnl|my_center|LOCUS_45030 7334 6336 gene locus_tag LOCUS_45040 7334 6336 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082548.1 protein_id gnl|my_center|LOCUS_45040 9245 7338 gene locus_tag LOCUS_45050 9245 7338 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_45050 >Feature sequence140 598 389 gene locus_tag LOCUS_45060 598 389 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022120.1 protein_id gnl|my_center|LOCUS_45060 2046 649 gene locus_tag LOCUS_45070 2046 649 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_45070 2305 2135 gene locus_tag LOCUS_45080 2305 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 2440 3219 gene locus_tag LOCUS_45090 2440 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 3264 4796 gene locus_tag LOCUS_45100 3264 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 5914 4865 gene locus_tag LOCUS_45110 5914 4865 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_45110 6865 5936 gene locus_tag LOCUS_45120 6865 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 6860 7075 gene locus_tag LOCUS_45130 6860 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 7423 7959 gene locus_tag LOCUS_45140 gene resA 7423 7959 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742200.1 protein_id gnl|my_center|LOCUS_45140 7946 9481 gene locus_tag LOCUS_45150 7946 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 >Feature sequence141 <1 539 gene locus_tag LOCUS_45160 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836208.1:M81 family metallopeptidase 621 2351 gene locus_tag LOCUS_45170 621 2351 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870477.1 protein_id gnl|my_center|LOCUS_45170 2382 4463 gene locus_tag LOCUS_45180 2382 4463 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_45180 4510 6414 gene locus_tag LOCUS_45190 4510 6414 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_45190 6435 7736 gene locus_tag LOCUS_45200 6435 7736 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_45200 9239 7815 gene locus_tag LOCUS_45210 9239 7815 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376432.1 protein_id gnl|my_center|LOCUS_45210 >Feature sequence142 121 867 gene locus_tag LOCUS_45220 121 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 967 1938 gene locus_tag LOCUS_45230 967 1938 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085601.1 protein_id gnl|my_center|LOCUS_45230 1966 2181 gene locus_tag LOCUS_45240 1966 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 2178 3623 gene locus_tag LOCUS_45250 2178 3623 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_45250 3636 4040 gene locus_tag LOCUS_45260 3636 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 4579 4271 gene locus_tag LOCUS_45270 4579 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 5905 4700 gene locus_tag LOCUS_45280 5905 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 6311 6024 gene locus_tag LOCUS_45290 6311 6024 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_45290 7702 6479 gene locus_tag LOCUS_45300 7702 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 7885 8679 gene locus_tag LOCUS_45310 7885 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 >Feature sequence143 446 2908 gene locus_tag LOCUS_45320 446 2908 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_45320 2920 5895 gene locus_tag LOCUS_45330 2920 5895 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839231.1 protein_id gnl|my_center|LOCUS_45330 5892 9101 gene locus_tag LOCUS_45340 5892 9101 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839229.1 protein_id gnl|my_center|LOCUS_45340 >Feature sequence144 741 34 gene locus_tag LOCUS_45350 741 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 1014 2168 gene locus_tag LOCUS_45360 gene solA 1014 2168 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_45360 2161 3603 gene locus_tag LOCUS_45370 2161 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 3904 4356 gene locus_tag LOCUS_45380 3904 4356 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815275.1 protein_id gnl|my_center|LOCUS_45380 4373 4690 gene locus_tag LOCUS_45390 4373 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 4790 4656 gene locus_tag LOCUS_45400 4790 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 4892 5749 gene locus_tag LOCUS_45410 4892 5749 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_45410 5953 6621 gene locus_tag LOCUS_45420 5953 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 6649 9012 gene locus_tag LOCUS_45430 6649 9012 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927134.1 protein_id gnl|my_center|LOCUS_45430 >Feature sequence145 299 24 gene locus_tag LOCUS_45440 299 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 3060 547 gene locus_tag LOCUS_45450 3060 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 5416 3125 gene locus_tag LOCUS_45460 5416 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 6178 5504 gene locus_tag LOCUS_45470 6178 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 6572 6294 gene locus_tag LOCUS_45480 6572 6294 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_45480 7324 6617 gene locus_tag LOCUS_45490 7324 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 >Feature sequence146 113 361 gene locus_tag LOCUS_45500 113 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 1575 424 gene locus_tag LOCUS_45510 gene larC 1575 424 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_45510 2943 1651 gene locus_tag LOCUS_45520 2943 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 3296 4351 gene locus_tag LOCUS_45530 gene rlmN 3296 4351 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_45530 4573 5862 gene locus_tag LOCUS_45540 gene murA 4573 5862 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669886.1 protein_id gnl|my_center|LOCUS_45540 5882 7207 gene locus_tag LOCUS_45550 5882 7207 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_45550 7304 7870 gene locus_tag LOCUS_45560 7304 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 >Feature sequence147 339 157 gene locus_tag LOCUS_45570 339 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 5464 653 gene locus_tag LOCUS_45580 5464 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 7182 5719 gene locus_tag LOCUS_45590 7182 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 8072 7182 gene locus_tag LOCUS_45600 8072 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 8457 8062 gene locus_tag LOCUS_45610 8457 8062 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121968.1 protein_id gnl|my_center|LOCUS_45610 >Feature sequence148 1385 15 gene locus_tag LOCUS_45620 1385 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 2431 1382 gene locus_tag LOCUS_45630 2431 1382 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_45630 3672 2428 gene locus_tag LOCUS_45640 3672 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 4655 3858 gene locus_tag LOCUS_45650 gene folP 4655 3858 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_45650 6902 4776 gene locus_tag LOCUS_45660 gene ftsH 6902 4776 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_45660 <8273 6899 gene locus_tag LOCUS_45670 <8273 6899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966480.1:tRNA lysidine(34) synthetase TilS >Feature sequence149 184 108 gene locus_tag LOCUS_t00480 184 108 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 280 2358 gene locus_tag LOCUS_45680 280 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45680 2355 4049 gene locus_tag LOCUS_45690 2355 4049 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399319.1 protein_id gnl|my_center|LOCUS_45690 4050 5840 gene locus_tag LOCUS_45700 4050 5840 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_45700 7380 5833 gene locus_tag LOCUS_45710 gene xylB 7380 5833 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_45710 >Feature sequence150 <1 1460 gene locus_tag LOCUS_45720 <1 1460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113453.1:heme/hemoglobin uptake receptor PhuR 1476 4589 gene locus_tag LOCUS_45730 1476 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 4622 5677 gene locus_tag LOCUS_45740 4622 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 6765 5752 gene locus_tag LOCUS_45750 6765 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 >Feature sequence151 3058 1790 gene locus_tag LOCUS_45760 3058 1790 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_45760 4869 3079 gene locus_tag LOCUS_45770 4869 3079 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_45770 6300 4978 gene locus_tag LOCUS_45780 6300 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 7366 6359 gene locus_tag LOCUS_45790 7366 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 >Feature sequence152 73 1773 gene locus_tag LOCUS_45800 73 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 2272 1781 gene locus_tag LOCUS_45810 gene coaD 2272 1781 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218149.1 protein_id gnl|my_center|LOCUS_45810 2985 2281 gene locus_tag LOCUS_45820 2985 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 4294 2990 gene locus_tag LOCUS_45830 4294 2990 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_45830 6695 4323 gene locus_tag LOCUS_45840 6695 4323 CDS product DUF4962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927915.1 protein_id gnl|my_center|LOCUS_45840 6855 7154 gene locus_tag LOCUS_45850 6855 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 >Feature sequence153 464 171 gene locus_tag LOCUS_45860 464 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 608 477 gene locus_tag LOCUS_45870 608 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45870 788 1501 gene locus_tag LOCUS_45880 788 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 1513 2088 gene locus_tag LOCUS_45890 1513 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 2134 2709 gene locus_tag LOCUS_45900 2134 2709 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761998.1 protein_id gnl|my_center|LOCUS_45900 2706 2936 gene locus_tag LOCUS_45910 2706 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 2946 4211 gene locus_tag LOCUS_45920 2946 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 4250 5449 gene locus_tag LOCUS_45930 4250 5449 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 protein_id gnl|my_center|LOCUS_45930 5549 5704 gene locus_tag LOCUS_45940 5549 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 5914 7215 gene locus_tag LOCUS_45950 5914 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 >Feature sequence154 2541 340 gene locus_tag LOCUS_45960 2541 340 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265515.1 protein_id gnl|my_center|LOCUS_45960 3091 2606 gene locus_tag LOCUS_45970 3091 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 3374 3508 gene locus_tag LOCUS_45980 3374 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 4020 3556 gene locus_tag LOCUS_45990 4020 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 4447 4049 gene locus_tag LOCUS_46000 4447 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 5013 4483 gene locus_tag LOCUS_46010 5013 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 6287 5013 gene locus_tag LOCUS_46020 6287 5013 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 protein_id gnl|my_center|LOCUS_46020 6937 6284 gene locus_tag LOCUS_46030 6937 6284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_46030 >Feature sequence155 1716 616 gene locus_tag LOCUS_46040 1716 616 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_46040 2296 1709 gene locus_tag LOCUS_46050 gene yihA 2296 1709 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640795.1 protein_id gnl|my_center|LOCUS_46050 3620 2373 gene locus_tag LOCUS_46060 gene clpX 3620 2373 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_46060 4263 3634 gene locus_tag LOCUS_46070 gene clpP 4263 3634 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_46070 5621 4293 gene locus_tag LOCUS_46080 gene tig 5621 4293 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830810.1 protein_id gnl|my_center|LOCUS_46080 6452 5730 gene locus_tag LOCUS_46090 6452 5730 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 protein_id gnl|my_center|LOCUS_46090 7016 6465 gene locus_tag LOCUS_46100 gene pdxH 7016 6465 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_46100 >Feature sequence156 176 505 gene locus_tag LOCUS_46110 gene folB 176 505 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358062.1 protein_id gnl|my_center|LOCUS_46110 502 1005 gene locus_tag LOCUS_46120 gene folK 502 1005 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391686.1 protein_id gnl|my_center|LOCUS_46120 1023 1676 gene locus_tag LOCUS_46130 1023 1676 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_46130 1680 2513 gene locus_tag LOCUS_46140 gene panB 1680 2513 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258071.1 protein_id gnl|my_center|LOCUS_46140 2634 3488 gene locus_tag LOCUS_46150 gene panC 2634 3488 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_46150 3637 4248 gene locus_tag LOCUS_46160 gene sodA 3637 4248 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_46160 4270 4749 gene locus_tag LOCUS_46170 4270 4749 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_46170 4761 5087 gene locus_tag LOCUS_46180 gene iscA 4761 5087 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301571.1 protein_id gnl|my_center|LOCUS_46180 >Feature sequence157 265 1362 gene locus_tag LOCUS_46190 265 1362 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533028.1 protein_id gnl|my_center|LOCUS_46190 2305 1376 gene locus_tag LOCUS_46200 2305 1376 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 protein_id gnl|my_center|LOCUS_46200 3714 2329 gene locus_tag LOCUS_46210 3714 2329 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_46210 3904 4911 gene locus_tag LOCUS_46220 3904 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 >Feature sequence158 411 214 gene locus_tag LOCUS_46230 411 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 706 2067 gene locus_tag LOCUS_46240 706 2067 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_46240 2071 4608 gene locus_tag LOCUS_46250 2071 4608 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 protein_id gnl|my_center|LOCUS_46250 4627 5787 gene locus_tag LOCUS_46260 4627 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 >Feature sequence159 <1 1004 gene locus_tag LOCUS_46270 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776786.1:sulfatase-like hydrolase/transferase 3664 1001 gene locus_tag LOCUS_46280 3664 1001 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_46280 3879 4388 gene locus_tag LOCUS_46290 3879 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 4385 5521 gene locus_tag LOCUS_46300 4385 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 5533 6309 gene locus_tag LOCUS_46310 5533 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 >Feature sequence160 1133 54 gene locus_tag LOCUS_46320 1133 54 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339517.1 protein_id gnl|my_center|LOCUS_46320 1501 1097 gene locus_tag LOCUS_46330 1501 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 3995 1515 gene locus_tag LOCUS_46340 3995 1515 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393063.1 protein_id gnl|my_center|LOCUS_46340 4525 4304 gene locus_tag LOCUS_46350 4525 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 5310 4522 gene locus_tag LOCUS_46360 5310 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 6200 5310 gene locus_tag LOCUS_46370 6200 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 >Feature sequence161 1103 1330 gene locus_tag LOCUS_46380 1103 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 1414 2823 gene locus_tag LOCUS_46390 1414 2823 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_46390 3774 2848 gene locus_tag LOCUS_46400 3774 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 4630 3803 gene locus_tag LOCUS_46410 4630 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 4911 5957 gene locus_tag LOCUS_46420 4911 5957 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_46420 >Feature sequence162 1976 972 gene locus_tag LOCUS_46430 1976 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 2812 2039 gene locus_tag LOCUS_46440 2812 2039 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044973.1 protein_id gnl|my_center|LOCUS_46440 3844 2834 gene locus_tag LOCUS_46450 3844 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 4791 3856 gene locus_tag LOCUS_46460 4791 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 <5840 4821 gene locus_tag LOCUS_46470 <5840 4821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000089239.1:ankyrin repeat domain-containing protein >Feature sequence163 383 5140 gene locus_tag LOCUS_46480 383 5140 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950644.1 protein_id gnl|my_center|LOCUS_46480 >Feature sequence164 3 293 gene locus_tag LOCUS_46490 3 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 2584 365 gene locus_tag LOCUS_46500 2584 365 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 protein_id gnl|my_center|LOCUS_46500 2724 3392 gene locus_tag LOCUS_46510 2724 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 3553 4239 gene locus_tag LOCUS_46520 3553 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 >Feature sequence165 2080 713 gene locus_tag LOCUS_46530 2080 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 2315 2061 gene locus_tag LOCUS_46540 2315 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 2490 3536 gene locus_tag LOCUS_46550 2490 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 3556 3744 gene locus_tag LOCUS_46560 3556 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 4856 3825 gene locus_tag LOCUS_46570 4856 3825 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_46570 >Feature sequence166 1579 2898 gene locus_tag LOCUS_46580 1579 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 <5027 2904 gene locus_tag LOCUS_46590 <5027 2904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392141.1:glycine--tRNA ligase subunit beta >Feature sequence167 2861 1302 gene locus_tag LOCUS_46600 2861 1302 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727746.1 protein_id gnl|my_center|LOCUS_46600 3888 2911 gene locus_tag LOCUS_46610 3888 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 <4883 4141 gene locus_tag LOCUS_46620 <4883 4141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680484.1:ATP-binding protein >Feature sequence168 2 2899 gene locus_tag LOCUS_46630 2 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 3212 3403 gene locus_tag LOCUS_46640 3212 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 >Feature sequence169 553 777 gene locus_tag LOCUS_46650 553 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 1016 1345 gene locus_tag LOCUS_46660 1016 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 2382 3182 gene locus_tag LOCUS_46670 2382 3182 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175234.1 protein_id gnl|my_center|LOCUS_46670 3283 4146 gene locus_tag LOCUS_46680 3283 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 >Feature sequence170 >Feature sequence171 1646 783 gene locus_tag LOCUS_46690 1646 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 3149 1695 gene locus_tag LOCUS_46700 3149 1695 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_46700 3942 3142 gene locus_tag LOCUS_46710 3942 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 >Feature sequence172 39 302 gene locus_tag LOCUS_46720 39 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 334 1419 gene locus_tag LOCUS_46730 334 1419 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700809.1 protein_id gnl|my_center|LOCUS_46730 2222 1404 gene locus_tag LOCUS_46740 2222 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812972.1 protein_id gnl|my_center|LOCUS_46740 3365 2247 gene locus_tag LOCUS_46750 3365 2247 CDS product agarase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731459.1 protein_id gnl|my_center|LOCUS_46750 <4337 3387 gene locus_tag LOCUS_46760 <4337 3387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048116.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence173 <1 743 gene locus_tag LOCUS_46770 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680484.1:ATP-binding protein <4126 868 gene locus_tag LOCUS_46780 <4126 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098476.1:formate hydrogenlyase transcriptional activator FlhA >Feature sequence174 437 1072 gene locus_tag LOCUS_46790 437 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 1082 2137 gene locus_tag LOCUS_46800 1082 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 2245 3507 gene locus_tag LOCUS_46810 gene sat 2245 3507 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_46810 >Feature sequence175 >Feature sequence176 930 1409 gene locus_tag LOCUS_46820 930 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 1979 3604 gene locus_tag LOCUS_46830 1979 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 >Feature sequence177 581 1732 gene locus_tag LOCUS_46840 gene istA 581 1732 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_46840 1732 2160 gene locus_tag LOCUS_46850 1732 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46850 2194 2490 gene locus_tag LOCUS_46860 2194 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46860 3607 3329 gene locus_tag LOCUS_46870 3607 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 >Feature sequence178 2683 593 gene locus_tag LOCUS_46880 2683 593 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_46880 3455 3111 gene locus_tag LOCUS_46890 3455 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 >Feature sequence179 1575 250 gene locus_tag LOCUS_46900 1575 250 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969043.1 protein_id gnl|my_center|LOCUS_46900 2780 1572 gene locus_tag LOCUS_46910 2780 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 2913 3194 gene locus_tag LOCUS_46920 2913 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 >Feature sequence180 343 924 gene locus_tag LOCUS_46930 343 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 928 2097 gene locus_tag LOCUS_46940 928 2097 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787705.1 protein_id gnl|my_center|LOCUS_46940 2279 2737 gene locus_tag LOCUS_46950 2279 2737 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091014.1 protein_id gnl|my_center|LOCUS_46950 >Feature sequence181 1271 492 gene locus_tag LOCUS_46960 1271 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 2182 1415 gene locus_tag LOCUS_46970 2182 1415 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067370.1 protein_id gnl|my_center|LOCUS_46970 >Feature sequence182 1259 2800 gene locus_tag LOCUS_46980 1259 2800 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680967.1 protein_id gnl|my_center|LOCUS_46980 >Feature sequence183 <1 748 gene locus_tag LOCUS_46990 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048084.1:thioether cross-link-forming SCIFF peptide maturase 960 1853 gene locus_tag LOCUS_47000 960 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 >Feature sequence184 1514 663 gene locus_tag LOCUS_47010 1514 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 >Feature sequence185 1161 2027 gene locus_tag LOCUS_47020 1161 2027 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_47020 >Feature sequence186 675 1505 gene locus_tag LOCUS_47030 675 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 1513 2079 gene locus_tag LOCUS_47040 1513 2079 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888775.1 protein_id gnl|my_center|LOCUS_47040 >Feature sequence187 390 1379 gene locus_tag LOCUS_47050 390 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 1437 1805 gene locus_tag LOCUS_47060 1437 1805 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_47060 1810 2136 gene locus_tag LOCUS_47070 1810 2136 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_47070 >Feature sequence188 784 1224 gene locus_tag LOCUS_47080 784 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 >Feature sequence189 1459 1965 gene locus_tag LOCUS_47090 1459 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 >Feature sequence190 1103 2029 gene locus_tag LOCUS_47100 gene pyrB 1103 2029 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871106.1 protein_id gnl|my_center|LOCUS_47100