>Feature sequence001 664 512 gene locus_tag LOCUS_00010 664 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2128 1091 gene locus_tag LOCUS_00020 2128 1091 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_00020 3075 5429 gene locus_tag LOCUS_00030 3075 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 7308 7937 gene locus_tag LOCUS_00040 7308 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8582 7905 gene locus_tag LOCUS_00050 8582 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 10690 11622 gene locus_tag LOCUS_00060 10690 11622 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_00060 11861 11619 gene locus_tag LOCUS_00070 11861 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 12230 13033 gene locus_tag LOCUS_00080 12230 13033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 13203 13646 gene locus_tag LOCUS_00090 13203 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13643 15076 gene locus_tag LOCUS_00100 13643 15076 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 protein_id gnl|my_center|LOCUS_00100 15864 15073 gene locus_tag LOCUS_00110 15864 15073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15929 16351 gene locus_tag LOCUS_00120 15929 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16530 16976 gene locus_tag LOCUS_00130 gene mraZ 16530 16976 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480800.1 protein_id gnl|my_center|LOCUS_00130 17031 17903 gene locus_tag LOCUS_00140 gene rsmH 17031 17903 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142921.1 protein_id gnl|my_center|LOCUS_00140 17903 18367 gene locus_tag LOCUS_00150 17903 18367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18426 20132 gene locus_tag LOCUS_00160 18426 20132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20129 21271 gene locus_tag LOCUS_00170 gene spoVE 20129 21271 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_00170 21268 22386 gene locus_tag LOCUS_00180 gene murG 21268 22386 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403336.1 protein_id gnl|my_center|LOCUS_00180 22383 23771 gene locus_tag LOCUS_00190 gene murC 22383 23771 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976211.1 protein_id gnl|my_center|LOCUS_00190 23768 24691 gene locus_tag LOCUS_00200 gene murB 23768 24691 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142314.1 protein_id gnl|my_center|LOCUS_00200 24688 25458 gene locus_tag LOCUS_00210 24688 25458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25514 26761 gene locus_tag LOCUS_00220 gene ftsA 25514 26761 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094115.1 protein_id gnl|my_center|LOCUS_00220 26866 28059 gene locus_tag LOCUS_00230 gene ftsZ 26866 28059 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_00230 28077 28787 gene locus_tag LOCUS_00240 28077 28787 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_00240 28794 29054 gene locus_tag LOCUS_00250 28794 29054 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392380.1 protein_id gnl|my_center|LOCUS_00250 29359 30627 gene locus_tag LOCUS_00260 gene hisS 29359 30627 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_00260 30624 31253 gene locus_tag LOCUS_00270 gene hisH 30624 31253 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256250.1 protein_id gnl|my_center|LOCUS_00270 31257 31982 gene locus_tag LOCUS_00280 gene hisA 31257 31982 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337342.1 protein_id gnl|my_center|LOCUS_00280 31985 32764 gene locus_tag LOCUS_00290 gene hisF 31985 32764 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_00290 34532 33198 gene locus_tag LOCUS_00300 34532 33198 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174149.1 protein_id gnl|my_center|LOCUS_00300 34779 35888 gene locus_tag LOCUS_00310 34779 35888 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456192.1 protein_id gnl|my_center|LOCUS_00310 36280 35912 gene locus_tag LOCUS_00320 36280 35912 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480299.1 protein_id gnl|my_center|LOCUS_00320 37170 36340 gene locus_tag LOCUS_00330 37170 36340 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922725.1 protein_id gnl|my_center|LOCUS_00330 37173 37979 gene locus_tag LOCUS_00340 37173 37979 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_00340 38002 38088 gene locus_tag LOCUS_t00010 38002 38088 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38325 39419 gene locus_tag LOCUS_00350 38325 39419 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228747.1 protein_id gnl|my_center|LOCUS_00350 39519 40046 gene locus_tag LOCUS_00360 39519 40046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 40273 40599 gene locus_tag LOCUS_00370 40273 40599 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_00370 41388 41687 gene locus_tag LOCUS_00380 41388 41687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00380 41709 42044 gene locus_tag LOCUS_00390 41709 42044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00390 42068 44935 gene locus_tag LOCUS_00400 42068 44935 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00400 44932 47814 gene locus_tag LOCUS_00410 44932 47814 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_00410 47829 48146 gene locus_tag LOCUS_00420 47829 48146 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_00420 48293 48679 gene locus_tag LOCUS_00430 48293 48679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48693 49481 gene locus_tag LOCUS_00440 48693 49481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 49727 53068 gene locus_tag LOCUS_00450 49727 53068 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_00450 53177 53449 gene locus_tag LOCUS_00460 53177 53449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54677 55102 gene locus_tag LOCUS_00470 54677 55102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 55099 55872 gene locus_tag LOCUS_00480 55099 55872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 56761 56375 gene locus_tag LOCUS_00490 56761 56375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 57381 56932 gene locus_tag LOCUS_00500 57381 56932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 58557 57385 gene locus_tag LOCUS_00510 58557 57385 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459849.1 protein_id gnl|my_center|LOCUS_00510 58876 58532 gene locus_tag LOCUS_00520 58876 58532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 59648 59223 gene locus_tag LOCUS_00530 59648 59223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 60377 59652 gene locus_tag LOCUS_00540 60377 59652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 61038 60364 gene locus_tag LOCUS_00550 61038 60364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 62307 61987 gene locus_tag LOCUS_00560 62307 61987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 82709 62709 gene locus_tag LOCUS_00570 82709 62709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00570 84289 84606 gene locus_tag LOCUS_00580 84289 84606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 84724 84966 gene locus_tag LOCUS_00590 84724 84966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 86098 86439 gene locus_tag LOCUS_00600 86098 86439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 87549 88214 gene locus_tag LOCUS_00610 87549 88214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 88780 89073 gene locus_tag LOCUS_00620 88780 89073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 89982 92369 gene locus_tag LOCUS_00630 89982 92369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 92420 93271 gene locus_tag LOCUS_00640 92420 93271 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_00640 94252 93554 gene locus_tag LOCUS_00650 94252 93554 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_00650 95210 94254 gene locus_tag LOCUS_00660 95210 94254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 98703 108908 gene locus_tag LOCUS_00670 98703 108908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00670 109226 109471 gene locus_tag LOCUS_00680 109226 109471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 109541 110272 gene locus_tag LOCUS_00690 109541 110272 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527401.1 protein_id gnl|my_center|LOCUS_00690 110381 111310 gene locus_tag LOCUS_00700 110381 111310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 113046 111307 gene locus_tag LOCUS_00710 113046 111307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 114124 115038 gene locus_tag LOCUS_00720 114124 115038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 115222 116538 gene locus_tag LOCUS_00730 115222 116538 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 protein_id gnl|my_center|LOCUS_00730 117439 116663 gene locus_tag LOCUS_00740 gene aacC 117439 116663 CDS product BA2930 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879231.1 protein_id gnl|my_center|LOCUS_00740 117782 117525 gene locus_tag LOCUS_00750 117782 117525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 120309 118288 gene locus_tag LOCUS_00760 120309 118288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00760 122392 120380 gene locus_tag LOCUS_00770 122392 120380 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_00770 125254 122462 gene locus_tag LOCUS_00780 125254 122462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 128285 125325 gene locus_tag LOCUS_00790 128285 125325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 130498 128504 gene locus_tag LOCUS_00800 130498 128504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 132779 130773 gene locus_tag LOCUS_00810 132779 130773 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_00810 >Feature sequence002 1242 454 gene locus_tag LOCUS_00820 1242 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 2047 1274 gene locus_tag LOCUS_00830 2047 1274 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083333.1 protein_id gnl|my_center|LOCUS_00830 3140 2115 gene locus_tag LOCUS_00840 3140 2115 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_00840 3360 3269 gene locus_tag LOCUS_t00020 3360 3269 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4010 3819 gene locus_tag LOCUS_00850 4010 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 4758 4516 gene locus_tag LOCUS_00860 4758 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 7860 8168 gene locus_tag LOCUS_00870 7860 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00870 8354 8539 gene locus_tag LOCUS_00880 8354 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 10650 9349 gene locus_tag LOCUS_00890 10650 9349 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880823.1 protein_id gnl|my_center|LOCUS_00890 11448 10777 gene locus_tag LOCUS_00900 gene tmk 11448 10777 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_00900 13440 12232 gene locus_tag LOCUS_00910 13440 12232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 14332 13949 gene locus_tag LOCUS_00920 14332 13949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 16074 15952 gene locus_tag LOCUS_00930 16074 15952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 18860 17634 gene locus_tag LOCUS_00940 18860 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 21540 19747 gene locus_tag LOCUS_00950 21540 19747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161599.1 protein_id gnl|my_center|LOCUS_00950 23285 21537 gene locus_tag LOCUS_00960 23285 21537 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_00960 23704 24849 gene locus_tag LOCUS_00970 23704 24849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 24819 25007 gene locus_tag LOCUS_00980 24819 25007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 27564 26707 gene locus_tag LOCUS_00990 27564 26707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 28920 31100 gene locus_tag LOCUS_01000 28920 31100 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_01000 31216 31851 gene locus_tag LOCUS_01010 gene cas5c 31216 31851 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_01010 31853 33562 gene locus_tag LOCUS_01020 gene cas8c 31853 33562 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392033.1 protein_id gnl|my_center|LOCUS_01020 33564 34484 gene locus_tag LOCUS_01030 gene cas7c 33564 34484 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392032.1 protein_id gnl|my_center|LOCUS_01030 34514 35143 gene locus_tag LOCUS_01040 gene cas4 34514 35143 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_01040 35281 36312 gene locus_tag LOCUS_01050 gene cas1c 35281 36312 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_01050 36327 36617 gene locus_tag LOCUS_01060 gene cas2 36327 36617 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_01060 36790 38044 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcacccggtctagagaccgggtgaggattgaaac 38203 38129 gene locus_tag LOCUS_t00030 38203 38129 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 38625 38194 gene locus_tag LOCUS_01070 38625 38194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 38800 39636 gene locus_tag LOCUS_01080 38800 39636 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890440.1 protein_id gnl|my_center|LOCUS_01080 39693 40508 gene locus_tag LOCUS_01090 39693 40508 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013747453.1 protein_id gnl|my_center|LOCUS_01090 41949 41371 gene locus_tag LOCUS_01100 41949 41371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01100 42865 42497 gene locus_tag LOCUS_01110 42865 42497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 43121 42903 gene locus_tag LOCUS_01120 43121 42903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 45033 43990 gene locus_tag LOCUS_01130 45033 43990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 46309 45479 gene locus_tag LOCUS_01140 46309 45479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 46800 46279 gene locus_tag LOCUS_01150 46800 46279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 47934 48224 gene locus_tag LOCUS_01160 47934 48224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 48777 48490 gene locus_tag LOCUS_01170 48777 48490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 48838 49509 gene locus_tag LOCUS_01180 48838 49509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01180 56284 50186 gene locus_tag LOCUS_01190 56284 50186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 56949 56281 gene locus_tag LOCUS_01200 56949 56281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 58421 56946 gene locus_tag LOCUS_01210 58421 56946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 61132 58430 gene locus_tag LOCUS_01220 61132 58430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 61730 61218 gene locus_tag LOCUS_01230 61730 61218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 62788 62312 gene locus_tag LOCUS_01240 62788 62312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 63561 63337 gene locus_tag LOCUS_01250 63561 63337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 63999 64256 gene locus_tag LOCUS_01260 63999 64256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 64270 65121 gene locus_tag LOCUS_01270 64270 65121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 66181 65606 gene locus_tag LOCUS_01280 66181 65606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 66273 66464 gene locus_tag LOCUS_01290 66273 66464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 66576 67280 gene locus_tag LOCUS_01300 66576 67280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 67810 67487 gene locus_tag LOCUS_01310 67810 67487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 68256 67879 gene locus_tag LOCUS_01320 68256 67879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 68646 68362 gene locus_tag LOCUS_01330 68646 68362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 68837 68643 gene locus_tag LOCUS_01340 68837 68643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 70067 71665 gene locus_tag LOCUS_01350 70067 71665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 73077 72379 gene locus_tag LOCUS_01360 73077 72379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 77310 73198 gene locus_tag LOCUS_01370 77310 73198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 77838 78506 gene locus_tag LOCUS_01380 77838 78506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 78513 80828 gene locus_tag LOCUS_01390 78513 80828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 81582 82475 gene locus_tag LOCUS_01400 81582 82475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 84243 83719 gene locus_tag LOCUS_01410 84243 83719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 84815 85345 gene locus_tag LOCUS_01420 84815 85345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 86235 86741 gene locus_tag LOCUS_01430 86235 86741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 87509 87763 gene locus_tag LOCUS_01440 87509 87763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 87767 88867 gene locus_tag LOCUS_01450 87767 88867 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_01450 91364 89664 gene locus_tag LOCUS_01460 91364 89664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 93871 91913 gene locus_tag LOCUS_01470 93871 91913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 94282 94007 gene locus_tag LOCUS_01480 94282 94007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 95887 95402 gene locus_tag LOCUS_01490 95887 95402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 96745 96044 gene locus_tag LOCUS_01500 96745 96044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 97916 97104 gene locus_tag LOCUS_01510 97916 97104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 99865 98243 gene locus_tag LOCUS_01520 99865 98243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 101265 100165 gene locus_tag LOCUS_01530 101265 100165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 103172 101262 gene locus_tag LOCUS_01540 103172 101262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 103422 103165 gene locus_tag LOCUS_01550 103422 103165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 103648 103412 gene locus_tag LOCUS_01560 103648 103412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 104409 103582 gene locus_tag LOCUS_01570 104409 103582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01570 104877 104419 gene locus_tag LOCUS_01580 104877 104419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01580 105014 104939 gene locus_tag LOCUS_t00040 105014 104939 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 105105 105836 gene locus_tag LOCUS_01590 105105 105836 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228695.1 protein_id gnl|my_center|LOCUS_01590 106871 105945 gene locus_tag LOCUS_01600 106871 105945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 107065 108693 gene locus_tag LOCUS_01610 107065 108693 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_01610 109244 108747 gene locus_tag LOCUS_01620 109244 108747 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_01620 110488 109256 gene locus_tag LOCUS_01630 gene metK 110488 109256 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258872.1 protein_id gnl|my_center|LOCUS_01630 111812 110541 gene locus_tag LOCUS_01640 gene ahcY 111812 110541 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_01640 112771 111842 gene locus_tag LOCUS_01650 112771 111842 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_01650 114406 113051 gene locus_tag LOCUS_01660 114406 113051 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_01660 116106 114403 gene locus_tag LOCUS_01670 116106 114403 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023977.1 protein_id gnl|my_center|LOCUS_01670 118283 116103 gene locus_tag LOCUS_01680 118283 116103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 118539 118333 gene locus_tag LOCUS_01690 118539 118333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 118451 119944 gene locus_tag LOCUS_01700 118451 119944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 120360 119941 gene locus_tag LOCUS_01710 120360 119941 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879542.1 protein_id gnl|my_center|LOCUS_01710 121394 120651 gene locus_tag LOCUS_01720 gene yjjG 121394 120651 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263181.1 protein_id gnl|my_center|LOCUS_01720 123992 121530 gene locus_tag LOCUS_01730 123992 121530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 125637 124162 gene locus_tag LOCUS_01740 125637 124162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 128591 126003 gene locus_tag LOCUS_01750 128591 126003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 >Feature sequence003 980 66 gene locus_tag LOCUS_01760 gene thrB 980 66 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889016.1 protein_id gnl|my_center|LOCUS_01760 2140 977 gene locus_tag LOCUS_01770 gene mrdB 2140 977 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097590.1 protein_id gnl|my_center|LOCUS_01770 4062 2140 gene locus_tag LOCUS_01780 gene mrdA 4062 2140 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_01780 4644 4078 gene locus_tag LOCUS_01790 4644 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 5480 4656 gene locus_tag LOCUS_01800 gene mreC 5480 4656 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_01800 6547 5492 gene locus_tag LOCUS_01810 6547 5492 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_01810 9061 6647 gene locus_tag LOCUS_01820 gene lon 9061 6647 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255996.1 protein_id gnl|my_center|LOCUS_01820 9744 9061 gene locus_tag LOCUS_01830 9744 9061 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065077.1 protein_id gnl|my_center|LOCUS_01830 9964 10446 gene locus_tag LOCUS_01840 9964 10446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 10539 13373 gene locus_tag LOCUS_01850 10539 13373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 13474 16371 gene locus_tag LOCUS_01860 13474 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 17059 16721 gene locus_tag LOCUS_01870 17059 16721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 17034 17345 gene locus_tag LOCUS_01880 17034 17345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 19379 17382 gene locus_tag LOCUS_01890 gene acs 19379 17382 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_01890 21703 19523 gene locus_tag LOCUS_01900 21703 19523 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 protein_id gnl|my_center|LOCUS_01900 24730 21839 gene locus_tag LOCUS_01910 24730 21839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 27988 25034 gene locus_tag LOCUS_01920 27988 25034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 28292 28089 gene locus_tag LOCUS_01930 28292 28089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 30899 28323 gene locus_tag LOCUS_01940 30899 28323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 31088 31162 gene locus_tag LOCUS_t00050 31088 31162 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31446 31252 gene locus_tag LOCUS_01950 31446 31252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 31372 32397 gene locus_tag LOCUS_01960 31372 32397 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_01960 35332 32498 gene locus_tag LOCUS_01970 35332 32498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 38140 35363 gene locus_tag LOCUS_01980 38140 35363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 41247 38377 gene locus_tag LOCUS_01990 41247 38377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 42092 41316 gene locus_tag LOCUS_02000 42092 41316 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029015.1 protein_id gnl|my_center|LOCUS_02000 42243 42713 gene locus_tag LOCUS_02010 gene bcp 42243 42713 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_02010 42816 42891 gene locus_tag LOCUS_t00060 42816 42891 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 43024 44004 gene locus_tag LOCUS_02020 43024 44004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 44953 45252 gene locus_tag LOCUS_02030 44953 45252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 45986 45723 gene locus_tag LOCUS_02040 45986 45723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 46771 47148 gene locus_tag LOCUS_02050 46771 47148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 50242 47855 gene locus_tag LOCUS_02060 50242 47855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 50840 52099 gene locus_tag LOCUS_02070 50840 52099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 52822 52319 gene locus_tag LOCUS_02080 52822 52319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 53181 52819 gene locus_tag LOCUS_02090 53181 52819 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223693.1 protein_id gnl|my_center|LOCUS_02090 53380 54009 gene locus_tag LOCUS_02100 53380 54009 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862544.1 protein_id gnl|my_center|LOCUS_02100 54301 55692 gene locus_tag LOCUS_02110 54301 55692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 55689 56021 gene locus_tag LOCUS_02120 55689 56021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 56422 56081 gene locus_tag LOCUS_02130 56422 56081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 56493 58970 gene locus_tag LOCUS_02140 56493 58970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 58979 60238 gene locus_tag LOCUS_02150 58979 60238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 60253 60963 gene locus_tag LOCUS_02160 60253 60963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 61633 61409 gene locus_tag LOCUS_02170 61633 61409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 62721 62158 gene locus_tag LOCUS_02180 62721 62158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 64346 65983 gene locus_tag LOCUS_02190 64346 65983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 66607 67059 gene locus_tag LOCUS_02200 66607 67059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 68142 68609 gene locus_tag LOCUS_02210 68142 68609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 68750 69025 gene locus_tag LOCUS_02220 68750 69025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 70204 71727 gene locus_tag LOCUS_02230 70204 71727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 72379 73170 gene locus_tag LOCUS_02240 72379 73170 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639024.1 protein_id gnl|my_center|LOCUS_02240 73593 73261 gene locus_tag LOCUS_02250 73593 73261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 74080 73721 gene locus_tag LOCUS_02260 74080 73721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 74438 74908 gene locus_tag LOCUS_02270 74438 74908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 75113 75397 gene locus_tag LOCUS_02280 75113 75397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 76563 76904 gene locus_tag LOCUS_02290 76563 76904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 78056 78724 gene locus_tag LOCUS_02300 78056 78724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 78993 79346 gene locus_tag LOCUS_02310 78993 79346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 81066 80764 gene locus_tag LOCUS_02320 81066 80764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 81337 82290 gene locus_tag LOCUS_02330 81337 82290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 82296 83750 gene locus_tag LOCUS_02340 82296 83750 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909313.1 protein_id gnl|my_center|LOCUS_02340 84641 84282 gene locus_tag LOCUS_02350 84641 84282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 85727 84693 gene locus_tag LOCUS_02360 85727 84693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 86265 85951 gene locus_tag LOCUS_02370 86265 85951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 87494 87255 gene locus_tag LOCUS_02380 87494 87255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 87554 88102 gene locus_tag LOCUS_02390 87554 88102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 88099 88653 gene locus_tag LOCUS_02400 88099 88653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 88715 89335 gene locus_tag LOCUS_02410 88715 89335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 89628 89233 gene locus_tag LOCUS_02420 89628 89233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 89595 89777 gene locus_tag LOCUS_02430 89595 89777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 90040 90453 gene locus_tag LOCUS_02440 90040 90453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 91226 90963 gene locus_tag LOCUS_02450 91226 90963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 91928 91623 gene locus_tag LOCUS_02460 91928 91623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 92163 91990 gene locus_tag LOCUS_02470 92163 91990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 92559 92164 gene locus_tag LOCUS_02480 92559 92164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 93076 92705 gene locus_tag LOCUS_02490 93076 92705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 94920 94690 gene locus_tag LOCUS_02500 94920 94690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 95019 95771 gene locus_tag LOCUS_02510 95019 95771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 95764 97179 gene locus_tag LOCUS_02520 95764 97179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02520 97388 98272 gene locus_tag LOCUS_02530 97388 98272 CDS product replication-relaxation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224005.1 protein_id gnl|my_center|LOCUS_02530 98413 98604 gene locus_tag LOCUS_02540 98413 98604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 98617 99042 gene locus_tag LOCUS_02550 98617 99042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 99039 99542 gene locus_tag LOCUS_02560 99039 99542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 99547 100461 gene locus_tag LOCUS_02570 99547 100461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 100474 102078 gene locus_tag LOCUS_02580 100474 102078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 102075 102797 gene locus_tag LOCUS_02590 102075 102797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 102794 104149 gene locus_tag LOCUS_02600 102794 104149 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086278.1 protein_id gnl|my_center|LOCUS_02600 104146 105012 gene locus_tag LOCUS_02610 104146 105012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 105009 105926 gene locus_tag LOCUS_02620 105009 105926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 105919 106368 gene locus_tag LOCUS_02630 105919 106368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 107062 107790 gene locus_tag LOCUS_02640 107062 107790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 108938 109639 gene locus_tag LOCUS_02650 108938 109639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 110228 110500 gene locus_tag LOCUS_02660 110228 110500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 111813 113027 gene locus_tag LOCUS_02670 111813 113027 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_02670 114027 114677 gene locus_tag LOCUS_02680 114027 114677 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_02680 114674 115594 gene locus_tag LOCUS_02690 114674 115594 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_02690 >Feature sequence004 539 2110 gene locus_tag LOCUS_02700 539 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 2305 3261 gene locus_tag LOCUS_02710 2305 3261 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_02710 4104 3412 gene locus_tag LOCUS_02720 4104 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 4694 4146 gene locus_tag LOCUS_02730 4694 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 6352 4856 gene locus_tag LOCUS_02740 6352 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 7349 6474 gene locus_tag LOCUS_02750 7349 6474 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_02750 8306 7350 gene locus_tag LOCUS_02760 8306 7350 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_02760 10141 8429 gene locus_tag LOCUS_02770 10141 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 10165 11310 gene locus_tag LOCUS_02780 10165 11310 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_02780 11427 12992 gene locus_tag LOCUS_02790 11427 12992 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_02790 13716 13012 gene locus_tag LOCUS_02800 gene fabG 13716 13012 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_02800 14067 13831 gene locus_tag LOCUS_02810 14067 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 15784 14168 gene locus_tag LOCUS_02820 gene ilvB 15784 14168 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146975.1 protein_id gnl|my_center|LOCUS_02820 17426 15846 gene locus_tag LOCUS_02830 gene murJ 17426 15846 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256387.1 protein_id gnl|my_center|LOCUS_02830 17893 17423 gene locus_tag LOCUS_02840 17893 17423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02840 18932 17907 gene locus_tag LOCUS_02850 18932 17907 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142635.1 protein_id gnl|my_center|LOCUS_02850 19703 18936 gene locus_tag LOCUS_02860 19703 18936 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420918.1 protein_id gnl|my_center|LOCUS_02860 19969 21258 gene locus_tag LOCUS_02870 19969 21258 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258489.1 protein_id gnl|my_center|LOCUS_02870 21260 22690 gene locus_tag LOCUS_02880 21260 22690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 22690 23034 gene locus_tag LOCUS_02890 22690 23034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 23063 23518 gene locus_tag LOCUS_02900 gene ndk 23063 23518 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256592.1 protein_id gnl|my_center|LOCUS_02900 23564 24694 gene locus_tag LOCUS_02910 gene sucC 23564 24694 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_02910 24691 25572 gene locus_tag LOCUS_02920 gene sucD 24691 25572 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256597.1 protein_id gnl|my_center|LOCUS_02920 25680 27539 gene locus_tag LOCUS_02930 25680 27539 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229043.1 protein_id gnl|my_center|LOCUS_02930 27557 28504 gene locus_tag LOCUS_02940 27557 28504 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980518.1 protein_id gnl|my_center|LOCUS_02940 28608 28683 gene locus_tag LOCUS_t00070 28608 28683 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 28884 29843 gene locus_tag LOCUS_02950 28884 29843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 30956 30774 gene locus_tag LOCUS_02960 30956 30774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 31307 31014 gene locus_tag LOCUS_02970 31307 31014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 31272 31697 gene locus_tag LOCUS_02980 31272 31697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 32627 31716 gene locus_tag LOCUS_02990 32627 31716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 32550 32771 gene locus_tag LOCUS_03000 32550 32771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 32887 33117 gene locus_tag LOCUS_03010 32887 33117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 33426 33289 gene locus_tag LOCUS_03020 33426 33289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 34429 38049 gene locus_tag LOCUS_03030 34429 38049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 38239 38057 gene locus_tag LOCUS_03040 38239 38057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 38204 40660 gene locus_tag LOCUS_03050 38204 40660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 41459 42295 gene locus_tag LOCUS_03060 41459 42295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 42456 42647 gene locus_tag LOCUS_03070 42456 42647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 42902 43360 gene locus_tag LOCUS_03080 42902 43360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 43785 44189 gene locus_tag LOCUS_03090 43785 44189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 44183 44827 gene locus_tag LOCUS_03100 44183 44827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 45086 44814 gene locus_tag LOCUS_03110 45086 44814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 45500 46294 gene locus_tag LOCUS_03120 45500 46294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 48315 47419 gene locus_tag LOCUS_03130 48315 47419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 48494 48946 gene locus_tag LOCUS_03140 48494 48946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 50113 49067 gene locus_tag LOCUS_03150 50113 49067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 51163 51543 gene locus_tag LOCUS_03160 51163 51543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 52063 51728 gene locus_tag LOCUS_03170 52063 51728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 53335 52211 gene locus_tag LOCUS_03180 53335 52211 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919629.1 protein_id gnl|my_center|LOCUS_03180 53842 54078 gene locus_tag LOCUS_03190 53842 54078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 54112 54621 gene locus_tag LOCUS_03200 54112 54621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 54640 54849 gene locus_tag LOCUS_03210 54640 54849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 55031 55708 gene locus_tag LOCUS_03220 55031 55708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 55882 56676 gene locus_tag LOCUS_03230 55882 56676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 56802 57356 gene locus_tag LOCUS_03240 56802 57356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 58137 57943 gene locus_tag LOCUS_03250 58137 57943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 58592 58134 gene locus_tag LOCUS_03260 58592 58134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 59286 58816 gene locus_tag LOCUS_03270 59286 58816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 59403 59585 gene locus_tag LOCUS_03280 59403 59585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 59641 59889 gene locus_tag LOCUS_03290 59641 59889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 59929 60303 gene locus_tag LOCUS_03300 59929 60303 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975148.1 protein_id gnl|my_center|LOCUS_03300 60563 61192 gene locus_tag LOCUS_03310 60563 61192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 61404 62558 gene locus_tag LOCUS_03320 61404 62558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 62619 63200 gene locus_tag LOCUS_03330 62619 63200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03330 63204 63377 gene locus_tag LOCUS_03340 63204 63377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 63646 63401 gene locus_tag LOCUS_03350 63646 63401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 64067 63810 gene locus_tag LOCUS_03360 64067 63810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 63991 64377 gene locus_tag LOCUS_03370 63991 64377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 66261 64666 gene locus_tag LOCUS_03380 66261 64666 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403783.1 protein_id gnl|my_center|LOCUS_03380 67525 66461 gene locus_tag LOCUS_03390 67525 66461 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_03390 68841 67777 gene locus_tag LOCUS_03400 68841 67777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082591.1 protein_id gnl|my_center|LOCUS_03400 69812 68838 gene locus_tag LOCUS_03410 69812 68838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_03410 70122 69871 gene locus_tag LOCUS_03420 70122 69871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 72317 70296 gene locus_tag LOCUS_03430 72317 70296 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080060.1 protein_id gnl|my_center|LOCUS_03430 72075 72164 gene locus_tag LOCUS_t00080 72075 72164 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 72613 73614 gene locus_tag LOCUS_03440 72613 73614 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_03440 73601 74509 gene locus_tag LOCUS_03450 73601 74509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082483.1 protein_id gnl|my_center|LOCUS_03450 75582 74569 gene locus_tag LOCUS_03460 75582 74569 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_03460 76894 75644 gene locus_tag LOCUS_03470 gene dgoD 76894 75644 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_03470 77502 76927 gene locus_tag LOCUS_03480 77502 76927 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366428.1 protein_id gnl|my_center|LOCUS_03480 79538 77547 gene locus_tag LOCUS_03490 79538 77547 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_03490 82009 80831 gene locus_tag LOCUS_03500 82009 80831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 83247 82996 gene locus_tag LOCUS_03510 83247 82996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 85374 83404 gene locus_tag LOCUS_03520 85374 83404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 86515 85730 gene locus_tag LOCUS_03530 86515 85730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03530 88003 86600 gene locus_tag LOCUS_03540 88003 86600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 88073 89068 gene locus_tag LOCUS_03550 gene trxB 88073 89068 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_03550 89075 89806 gene locus_tag LOCUS_03560 89075 89806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 91952 89859 gene locus_tag LOCUS_03570 91952 89859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence005 454 275 gene locus_tag LOCUS_03580 454 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 1115 507 gene locus_tag LOCUS_03590 1115 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 1050 1418 gene locus_tag LOCUS_03600 1050 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 1420 2439 gene locus_tag LOCUS_03610 1420 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 2471 3559 gene locus_tag LOCUS_03620 gene trxB 2471 3559 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002926539.1 protein_id gnl|my_center|LOCUS_03620 5017 3587 gene locus_tag LOCUS_03630 5017 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5454 6416 gene locus_tag LOCUS_03640 5454 6416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_03640 6420 7682 gene locus_tag LOCUS_03650 6420 7682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143462.1 protein_id gnl|my_center|LOCUS_03650 8337 7762 gene locus_tag LOCUS_03660 8337 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 9070 9558 gene locus_tag LOCUS_03670 9070 9558 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259748.1 protein_id gnl|my_center|LOCUS_03670 9882 11141 gene locus_tag LOCUS_03680 9882 11141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 11145 12368 gene locus_tag LOCUS_03690 11145 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 13311 12439 gene locus_tag LOCUS_03700 13311 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 13524 14348 gene locus_tag LOCUS_03710 13524 14348 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728307.1 protein_id gnl|my_center|LOCUS_03710 15461 14361 gene locus_tag LOCUS_03720 15461 14361 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525264.1 protein_id gnl|my_center|LOCUS_03720 15653 16684 gene locus_tag LOCUS_03730 15653 16684 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 protein_id gnl|my_center|LOCUS_03730 18024 16732 gene locus_tag LOCUS_03740 18024 16732 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_03740 18171 19457 gene locus_tag LOCUS_03750 gene rifK 18171 19457 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_03750 20545 19523 gene locus_tag LOCUS_03760 20545 19523 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112888.1 protein_id gnl|my_center|LOCUS_03760 21509 20595 gene locus_tag LOCUS_03770 21509 20595 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582765.1 protein_id gnl|my_center|LOCUS_03770 22400 21513 gene locus_tag LOCUS_03780 22400 21513 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_03780 24088 22499 gene locus_tag LOCUS_03790 24088 22499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 25551 24382 gene locus_tag LOCUS_03800 25551 24382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 26829 25660 gene locus_tag LOCUS_03810 26829 25660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 28110 26938 gene locus_tag LOCUS_03820 28110 26938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 28501 29607 gene locus_tag LOCUS_03830 28501 29607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 29747 30706 gene locus_tag LOCUS_03840 29747 30706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 30740 31807 gene locus_tag LOCUS_03850 30740 31807 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_03850 31876 32271 gene locus_tag LOCUS_03860 31876 32271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 32343 33485 gene locus_tag LOCUS_03870 gene solA 32343 33485 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_03870 34523 33504 gene locus_tag LOCUS_03880 34523 33504 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114445.1 protein_id gnl|my_center|LOCUS_03880 34908 37502 gene locus_tag LOCUS_03890 gene clpB 34908 37502 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_03890 37686 38711 gene locus_tag LOCUS_03900 37686 38711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 40348 38771 gene locus_tag LOCUS_03910 40348 38771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 40640 40377 gene locus_tag LOCUS_03920 40640 40377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 41976 40852 gene locus_tag LOCUS_03930 41976 40852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 42713 41973 gene locus_tag LOCUS_03940 42713 41973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 42951 44654 gene locus_tag LOCUS_03950 42951 44654 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_03950 44654 46456 gene locus_tag LOCUS_03960 44654 46456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257581.1 protein_id gnl|my_center|LOCUS_03960 46557 49190 gene locus_tag LOCUS_03970 46557 49190 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_03970 50178 49204 gene locus_tag LOCUS_03980 50178 49204 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643103.1 protein_id gnl|my_center|LOCUS_03980 50694 50263 gene locus_tag LOCUS_03990 50694 50263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 50831 52441 gene locus_tag LOCUS_04000 50831 52441 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_04000 53055 52438 gene locus_tag LOCUS_04010 gene thpR 53055 52438 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_04010 53144 54415 gene locus_tag LOCUS_04020 53144 54415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 54442 55383 gene locus_tag LOCUS_04030 54442 55383 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090280.1 protein_id gnl|my_center|LOCUS_04030 56255 55380 gene locus_tag LOCUS_04040 56255 55380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 56423 57022 gene locus_tag LOCUS_04050 gene rdgB 56423 57022 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256394.1 protein_id gnl|my_center|LOCUS_04050 57121 57894 gene locus_tag LOCUS_04060 gene fabG 57121 57894 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051065148.1 protein_id gnl|my_center|LOCUS_04060 57894 58655 gene locus_tag LOCUS_04070 57894 58655 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525160.1 protein_id gnl|my_center|LOCUS_04070 58715 59569 gene locus_tag LOCUS_04080 gene rsmA 58715 59569 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265733.1 protein_id gnl|my_center|LOCUS_04080 59566 60204 gene locus_tag LOCUS_04090 gene pth 59566 60204 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405251.1 protein_id gnl|my_center|LOCUS_04090 60182 63691 gene locus_tag LOCUS_04100 gene mfd 60182 63691 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_04100 64752 63724 gene locus_tag LOCUS_04110 64752 63724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 64862 65767 gene locus_tag LOCUS_04120 64862 65767 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_04120 65971 68619 gene locus_tag LOCUS_04130 gene topA 65971 68619 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742226.1 protein_id gnl|my_center|LOCUS_04130 68781 69848 gene locus_tag LOCUS_04140 68781 69848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 69854 70345 gene locus_tag LOCUS_04150 gene tsf 69854 70345 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259403.1 protein_id gnl|my_center|LOCUS_04150 70380 71096 gene locus_tag LOCUS_04160 gene pyrH 70380 71096 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_04160 71104 71661 gene locus_tag LOCUS_04170 gene frr 71104 71661 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_04170 71679 72392 gene locus_tag LOCUS_04180 gene uppS 71679 72392 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938168.1 protein_id gnl|my_center|LOCUS_04180 72485 73186 gene locus_tag LOCUS_04190 72485 73186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 73192 74361 gene locus_tag LOCUS_04200 73192 74361 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_04200 74358 75776 gene locus_tag LOCUS_04210 74358 75776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 >Feature sequence006 209 1066 gene locus_tag LOCUS_04220 gene pyrF 209 1066 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_04220 2144 1077 gene locus_tag LOCUS_04230 gene pheA 2144 1077 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_04230 3379 2213 gene locus_tag LOCUS_04240 3379 2213 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_04240 3513 3953 gene locus_tag LOCUS_04250 3513 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3956 4792 gene locus_tag LOCUS_04260 3956 4792 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037421.1 protein_id gnl|my_center|LOCUS_04260 5273 4872 gene locus_tag LOCUS_04270 5273 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 6575 5547 gene locus_tag LOCUS_04280 6575 5547 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729463.1 protein_id gnl|my_center|LOCUS_04280 6664 7515 gene locus_tag LOCUS_04290 6664 7515 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246382.1 protein_id gnl|my_center|LOCUS_04290 7512 8207 gene locus_tag LOCUS_04300 7512 8207 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811192.1 protein_id gnl|my_center|LOCUS_04300 9484 8204 gene locus_tag LOCUS_04310 9484 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 9863 12325 gene locus_tag LOCUS_04320 9863 12325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 12368 15208 gene locus_tag LOCUS_04330 12368 15208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 15205 16356 gene locus_tag LOCUS_04340 15205 16356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 16349 17131 gene locus_tag LOCUS_04350 16349 17131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_04350 18385 17144 gene locus_tag LOCUS_04360 18385 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 19001 18531 gene locus_tag LOCUS_04370 gene sufU 19001 18531 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 protein_id gnl|my_center|LOCUS_04370 20245 18998 gene locus_tag LOCUS_04380 20245 18998 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989988.1 protein_id gnl|my_center|LOCUS_04380 20571 20251 gene locus_tag LOCUS_04390 20571 20251 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259323.1 protein_id gnl|my_center|LOCUS_04390 21863 20571 gene locus_tag LOCUS_04400 gene sufD 21863 20571 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_04400 23342 21936 gene locus_tag LOCUS_04410 gene sufB 23342 21936 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_04410 24118 23345 gene locus_tag LOCUS_04420 gene sufC 24118 23345 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929160.1 protein_id gnl|my_center|LOCUS_04420 24383 25513 gene locus_tag LOCUS_04430 24383 25513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 25718 27664 gene locus_tag LOCUS_04440 25718 27664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 27763 28608 gene locus_tag LOCUS_04450 gene rsmI 27763 28608 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530019.1 protein_id gnl|my_center|LOCUS_04450 28648 30171 gene locus_tag LOCUS_04460 gene metG 28648 30171 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_04460 30279 30947 gene locus_tag LOCUS_04470 30279 30947 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_04470 30929 31939 gene locus_tag LOCUS_04480 30929 31939 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392766.1 protein_id gnl|my_center|LOCUS_04480 31958 32665 gene locus_tag LOCUS_04490 gene ubiE 31958 32665 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_04490 32668 33705 gene locus_tag LOCUS_04500 32668 33705 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_04500 33717 35216 gene locus_tag LOCUS_04510 33717 35216 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_04510 35754 35230 gene locus_tag LOCUS_04520 35754 35230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 35877 36872 gene locus_tag LOCUS_04530 35877 36872 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_04530 37635 37856 gene locus_tag LOCUS_04540 37635 37856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 37921 39033 gene locus_tag LOCUS_04550 37921 39033 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930220.1 protein_id gnl|my_center|LOCUS_04550 39108 39902 gene locus_tag LOCUS_04560 gene garL 39108 39902 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931129.1 protein_id gnl|my_center|LOCUS_04560 40210 41304 gene locus_tag LOCUS_04570 gene thiO 40210 41304 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928950.1 protein_id gnl|my_center|LOCUS_04570 42835 41567 gene locus_tag LOCUS_04580 42835 41567 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974705.1 protein_id gnl|my_center|LOCUS_04580 43917 43639 gene locus_tag LOCUS_04590 43917 43639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 43916 45895 gene locus_tag LOCUS_04600 43916 45895 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_04600 45911 46576 gene locus_tag LOCUS_04610 45911 46576 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887197.1 protein_id gnl|my_center|LOCUS_04610 46811 47116 gene locus_tag LOCUS_04620 46811 47116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 47113 47889 gene locus_tag LOCUS_04630 47113 47889 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057157.1 protein_id gnl|my_center|LOCUS_04630 47886 48878 gene locus_tag LOCUS_04640 47886 48878 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256331.1 protein_id gnl|my_center|LOCUS_04640 48885 49661 gene locus_tag LOCUS_04650 48885 49661 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 protein_id gnl|my_center|LOCUS_04650 49677 50171 gene locus_tag LOCUS_04660 49677 50171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 50197 51603 gene locus_tag LOCUS_04670 50197 51603 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_04670 51693 52592 gene locus_tag LOCUS_04680 gene pdxS 51693 52592 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258093.1 protein_id gnl|my_center|LOCUS_04680 52608 53186 gene locus_tag LOCUS_04690 gene pdxT 52608 53186 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_04690 53183 54166 gene locus_tag LOCUS_04700 53183 54166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 54173 55666 gene locus_tag LOCUS_04710 54173 55666 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258096.1 protein_id gnl|my_center|LOCUS_04710 55663 56376 gene locus_tag LOCUS_04720 gene tmk 55663 56376 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_04720 56440 56748 gene locus_tag LOCUS_04730 56440 56748 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781979.1 protein_id gnl|my_center|LOCUS_04730 57953 56766 gene locus_tag LOCUS_04740 57953 56766 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_04740 58034 58951 gene locus_tag LOCUS_04750 58034 58951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 59731 58955 gene locus_tag LOCUS_04760 59731 58955 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_04760 60487 59732 gene locus_tag LOCUS_04770 60487 59732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 63474 60487 gene locus_tag LOCUS_04780 63474 60487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 64490 63471 gene locus_tag LOCUS_04790 64490 63471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 65260 64703 gene locus_tag LOCUS_04800 65260 64703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 66577 65324 gene locus_tag LOCUS_04810 gene dinB 66577 65324 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731284.1 protein_id gnl|my_center|LOCUS_04810 67437 66730 gene locus_tag LOCUS_04820 67437 66730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 68050 67451 gene locus_tag LOCUS_04830 gene lexA 68050 67451 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_04830 68580 68203 gene locus_tag LOCUS_04840 68580 68203 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_04840 70675 68708 gene locus_tag LOCUS_04850 70675 68708 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_04850 71134 71643 gene locus_tag LOCUS_04860 71134 71643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 72088 71834 gene locus_tag LOCUS_04870 72088 71834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 72472 72089 gene locus_tag LOCUS_04880 72472 72089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04880 73724 72897 gene locus_tag LOCUS_04890 73724 72897 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_04890 74581 75177 gene locus_tag LOCUS_04900 74581 75177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence007 <1 806 gene locus_tag LOCUS_04910 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085701.1:malate/lactate/ureidoglycolate dehydrogenase 815 2836 gene locus_tag LOCUS_04920 815 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 4171 3023 gene locus_tag LOCUS_04930 4171 3023 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972134.1 protein_id gnl|my_center|LOCUS_04930 6277 4319 gene locus_tag LOCUS_04940 6277 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 7612 6374 gene locus_tag LOCUS_04950 7612 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 8472 7609 gene locus_tag LOCUS_04960 gene rihA 8472 7609 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705366.1 protein_id gnl|my_center|LOCUS_04960 10296 8575 gene locus_tag LOCUS_04970 10296 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 12131 10293 gene locus_tag LOCUS_04980 12131 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 12630 12163 gene locus_tag LOCUS_04990 12630 12163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 12776 12851 gene locus_tag LOCUS_t00090 12776 12851 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13239 12868 gene locus_tag LOCUS_05000 13239 12868 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081748.1 protein_id gnl|my_center|LOCUS_05000 13346 13945 gene locus_tag LOCUS_05010 13346 13945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 14039 14338 gene locus_tag LOCUS_05020 14039 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 14363 14701 gene locus_tag LOCUS_05030 14363 14701 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292340.1 protein_id gnl|my_center|LOCUS_05030 15548 14712 gene locus_tag LOCUS_05040 15548 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 15745 17427 gene locus_tag LOCUS_05050 15745 17427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 17891 19528 gene locus_tag LOCUS_05060 17891 19528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 19732 20829 gene locus_tag LOCUS_05070 19732 20829 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_05070 21046 22182 gene locus_tag LOCUS_05080 21046 22182 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_05080 22452 23588 gene locus_tag LOCUS_05090 22452 23588 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_05090 23659 24825 gene locus_tag LOCUS_05100 23659 24825 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_05100 24825 26270 gene locus_tag LOCUS_05110 24825 26270 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_05110 26309 26806 gene locus_tag LOCUS_05120 26309 26806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 27861 26821 gene locus_tag LOCUS_05130 27861 26821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 27928 29070 gene locus_tag LOCUS_05140 27928 29070 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229000.1 protein_id gnl|my_center|LOCUS_05140 29282 29521 gene locus_tag LOCUS_05150 29282 29521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 30498 29566 gene locus_tag LOCUS_05160 30498 29566 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243041.1 protein_id gnl|my_center|LOCUS_05160 31537 30503 gene locus_tag LOCUS_05170 31537 30503 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_05170 31733 32281 gene locus_tag LOCUS_05180 31733 32281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 32483 32644 gene locus_tag LOCUS_05190 32483 32644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 32663 32905 gene locus_tag LOCUS_05200 32663 32905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 32963 33733 gene locus_tag LOCUS_05210 32963 33733 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083016.1 protein_id gnl|my_center|LOCUS_05210 34912 33749 gene locus_tag LOCUS_05220 34912 33749 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_05220 36167 35343 gene locus_tag LOCUS_05230 36167 35343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 37253 36234 gene locus_tag LOCUS_05240 gene asd 37253 36234 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_05240 38044 37250 gene locus_tag LOCUS_05250 gene dapB 38044 37250 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_05250 40306 38054 gene locus_tag LOCUS_05260 gene pnp 40306 38054 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_05260 40806 40534 gene locus_tag LOCUS_05270 gene rpsO 40806 40534 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583506.1 protein_id gnl|my_center|LOCUS_05270 41037 41672 gene locus_tag LOCUS_05280 41037 41672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 41645 41983 gene locus_tag LOCUS_05290 41645 41983 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174185.1 protein_id gnl|my_center|LOCUS_05290 43869 42064 gene locus_tag LOCUS_05300 43869 42064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 44007 44678 gene locus_tag LOCUS_05310 44007 44678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 48175 44675 gene locus_tag LOCUS_05320 48175 44675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 49659 48511 gene locus_tag LOCUS_05330 49659 48511 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040240.1 protein_id gnl|my_center|LOCUS_05330 50960 49893 gene locus_tag LOCUS_05340 50960 49893 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709247.1 protein_id gnl|my_center|LOCUS_05340 52279 50963 gene locus_tag LOCUS_05350 52279 50963 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172728.1 protein_id gnl|my_center|LOCUS_05350 52805 52416 gene locus_tag LOCUS_05360 52805 52416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 52830 53333 gene locus_tag LOCUS_05370 52830 53333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 53485 54144 gene locus_tag LOCUS_05380 53485 54144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 54197 54664 gene locus_tag LOCUS_05390 54197 54664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 54880 56931 gene locus_tag LOCUS_05400 54880 56931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 56931 58046 gene locus_tag LOCUS_05410 gene holB 56931 58046 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_05410 57928 59043 gene locus_tag LOCUS_05420 57928 59043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 60539 59097 gene locus_tag LOCUS_05430 gene glnA 60539 59097 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_05430 60806 61297 gene locus_tag LOCUS_05440 60806 61297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence008 1842 751 gene locus_tag LOCUS_05450 1842 751 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705009.1 protein_id gnl|my_center|LOCUS_05450 2222 1902 gene locus_tag LOCUS_05460 2222 1902 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087569.1 protein_id gnl|my_center|LOCUS_05460 3183 2227 gene locus_tag LOCUS_05470 3183 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 3281 4387 gene locus_tag LOCUS_05480 3281 4387 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_05480 5316 4411 gene locus_tag LOCUS_05490 5316 4411 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776854.1 protein_id gnl|my_center|LOCUS_05490 6564 5425 gene locus_tag LOCUS_05500 6564 5425 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_05500 7891 6710 gene locus_tag LOCUS_05510 7891 6710 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_05510 8051 8129 gene locus_tag LOCUS_t00100 8051 8129 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8721 8275 gene locus_tag LOCUS_05520 8721 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 10274 8775 gene locus_tag LOCUS_05530 10274 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 11110 14571 gene locus_tag LOCUS_05540 11110 14571 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256763.1 protein_id gnl|my_center|LOCUS_05540 14586 19181 gene locus_tag LOCUS_05550 14586 19181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 19254 19667 gene locus_tag LOCUS_05560 gene rpsL 19254 19667 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_05560 19739 20209 gene locus_tag LOCUS_05570 gene rpsG 19739 20209 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258227.1 protein_id gnl|my_center|LOCUS_05570 20241 22313 gene locus_tag LOCUS_05580 gene fusA 20241 22313 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_05580 22343 23545 gene locus_tag LOCUS_05590 gene tuf 22343 23545 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258047.1 protein_id gnl|my_center|LOCUS_05590 23549 23941 gene locus_tag LOCUS_05600 gene rpsJ 23549 23941 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_05600 23944 24585 gene locus_tag LOCUS_05610 gene rplC 23944 24585 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_05610 24585 25196 gene locus_tag LOCUS_05620 gene rplD 24585 25196 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258232.1 protein_id gnl|my_center|LOCUS_05620 25193 25477 gene locus_tag LOCUS_05630 gene rplW 25193 25477 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_05630 25481 26311 gene locus_tag LOCUS_05640 gene rplB 25481 26311 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081830.1 protein_id gnl|my_center|LOCUS_05640 26318 26602 gene locus_tag LOCUS_05650 gene rpsS 26318 26602 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_05650 26606 26944 gene locus_tag LOCUS_05660 gene rplV 26606 26944 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704314.1 protein_id gnl|my_center|LOCUS_05660 26947 27696 gene locus_tag LOCUS_05670 gene rpsC 26947 27696 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810152.1 protein_id gnl|my_center|LOCUS_05670 27699 28124 gene locus_tag LOCUS_05680 gene rplP 27699 28124 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_05680 28117 28332 gene locus_tag LOCUS_05690 gene rpmC 28117 28332 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644429.1 protein_id gnl|my_center|LOCUS_05690 28336 28674 gene locus_tag LOCUS_05700 28336 28674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 28680 29045 gene locus_tag LOCUS_05710 gene rplN 28680 29045 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323021.1 protein_id gnl|my_center|LOCUS_05710 29048 29377 gene locus_tag LOCUS_05720 gene rplX 29048 29377 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938609.1 protein_id gnl|my_center|LOCUS_05720 29377 29931 gene locus_tag LOCUS_05730 gene rplE 29377 29931 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258243.1 protein_id gnl|my_center|LOCUS_05730 29941 30180 gene locus_tag LOCUS_05740 29941 30180 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_05740 30188 30577 gene locus_tag LOCUS_05750 gene rpsH 30188 30577 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 protein_id gnl|my_center|LOCUS_05750 30582 31133 gene locus_tag LOCUS_05760 gene rplF 30582 31133 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357306.1 protein_id gnl|my_center|LOCUS_05760 31212 31505 gene locus_tag LOCUS_05770 gene rplR 31212 31505 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258247.1 protein_id gnl|my_center|LOCUS_05770 31502 32035 gene locus_tag LOCUS_05780 gene rpsE 31502 32035 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_05780 32225 32671 gene locus_tag LOCUS_05790 gene rplO 32225 32671 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356221.1 protein_id gnl|my_center|LOCUS_05790 32668 33948 gene locus_tag LOCUS_05800 gene secY 32668 33948 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_05800 33953 34525 gene locus_tag LOCUS_05810 33953 34525 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222620.1 protein_id gnl|my_center|LOCUS_05810 34522 35304 gene locus_tag LOCUS_05820 gene map 34522 35304 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357322.1 protein_id gnl|my_center|LOCUS_05820 35313 35657 gene locus_tag LOCUS_05830 gene infA 35313 35657 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966389.1 protein_id gnl|my_center|LOCUS_05830 35790 36170 gene locus_tag LOCUS_05840 gene rpsM 35790 36170 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258255.1 protein_id gnl|my_center|LOCUS_05840 36220 36564 gene locus_tag LOCUS_05850 gene rpsK 36220 36564 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900064.1 protein_id gnl|my_center|LOCUS_05850 36595 37227 gene locus_tag LOCUS_05860 gene rpsD 36595 37227 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869903.1 protein_id gnl|my_center|LOCUS_05860 37276 38253 gene locus_tag LOCUS_05870 37276 38253 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549048.1 protein_id gnl|my_center|LOCUS_05870 38259 38609 gene locus_tag LOCUS_05880 gene rplQ 38259 38609 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536492.1 protein_id gnl|my_center|LOCUS_05880 38606 39397 gene locus_tag LOCUS_05890 gene truA 38606 39397 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258260.1 protein_id gnl|my_center|LOCUS_05890 39394 39810 gene locus_tag LOCUS_05900 gene rplM 39394 39810 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173515.1 protein_id gnl|my_center|LOCUS_05900 39807 40202 gene locus_tag LOCUS_05910 gene rpsI 39807 40202 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258262.1 protein_id gnl|my_center|LOCUS_05910 40804 40199 gene locus_tag LOCUS_05920 gene scpB 40804 40199 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869525.1 protein_id gnl|my_center|LOCUS_05920 41546 40791 gene locus_tag LOCUS_05930 41546 40791 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_05930 42031 41543 gene locus_tag LOCUS_05940 42031 41543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 42650 42021 gene locus_tag LOCUS_05950 42650 42021 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723611.1 protein_id gnl|my_center|LOCUS_05950 43531 42767 gene locus_tag LOCUS_05960 43531 42767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 44433 43528 gene locus_tag LOCUS_05970 44433 43528 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 protein_id gnl|my_center|LOCUS_05970 44552 45784 gene locus_tag LOCUS_05980 44552 45784 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095059.1 protein_id gnl|my_center|LOCUS_05980 47055 45841 gene locus_tag LOCUS_05990 47055 45841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 47140 47526 gene locus_tag LOCUS_06000 gene gcvH 47140 47526 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_06000 47510 48865 gene locus_tag LOCUS_06010 gene gcvPA 47510 48865 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230207.1 protein_id gnl|my_center|LOCUS_06010 48862 50313 gene locus_tag LOCUS_06020 gene gcvPB 48862 50313 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259338.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence009 3 1004 gene locus_tag LOCUS_06030 3 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 2234 1005 gene locus_tag LOCUS_06040 2234 1005 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941297.1 protein_id gnl|my_center|LOCUS_06040 5157 2239 gene locus_tag LOCUS_06050 5157 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 5744 5178 gene locus_tag LOCUS_06060 5744 5178 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583472.1 protein_id gnl|my_center|LOCUS_06060 5978 7132 gene locus_tag LOCUS_06070 gene dnaN 5978 7132 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_06070 7249 8790 gene locus_tag LOCUS_06080 gene ggt 7249 8790 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 protein_id gnl|my_center|LOCUS_06080 8863 10434 gene locus_tag LOCUS_06090 8863 10434 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_06090 10503 11345 gene locus_tag LOCUS_06100 10503 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 12240 11722 gene locus_tag LOCUS_06110 12240 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 12215 13063 gene locus_tag LOCUS_06120 12215 13063 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_06120 13109 14107 gene locus_tag LOCUS_06130 13109 14107 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030183075.1 protein_id gnl|my_center|LOCUS_06130 14129 15712 gene locus_tag LOCUS_06140 14129 15712 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868685.1 protein_id gnl|my_center|LOCUS_06140 16015 15788 gene locus_tag LOCUS_06150 16015 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 15902 16690 gene locus_tag LOCUS_06160 15902 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 16966 16712 gene locus_tag LOCUS_06170 16966 16712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 17201 19978 gene locus_tag LOCUS_06180 17201 19978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 20114 20037 gene locus_tag LOCUS_t00110 20114 20037 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 20411 20202 gene locus_tag LOCUS_06190 20411 20202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 20759 22282 gene locus_tag LOCUS_06200 gene guaB 20759 22282 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_06200 22598 23356 gene locus_tag LOCUS_06210 22598 23356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 23356 23991 gene locus_tag LOCUS_06220 23356 23991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 23991 24902 gene locus_tag LOCUS_06230 23991 24902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 25307 25065 gene locus_tag LOCUS_06240 25307 25065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 25470 27599 gene locus_tag LOCUS_06250 25470 27599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 27596 28507 gene locus_tag LOCUS_06260 gene cas1 27596 28507 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_06260 28518 28844 gene locus_tag LOCUS_06270 gene cas2 28518 28844 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_06270 29356 29676 gene locus_tag LOCUS_06280 29356 29676 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243014.1 protein_id gnl|my_center|LOCUS_06280 29771 30049 gene locus_tag LOCUS_06290 29771 30049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 30046 30471 gene locus_tag LOCUS_06300 30046 30471 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406304.1 protein_id gnl|my_center|LOCUS_06300 30609 31325 gene locus_tag LOCUS_06310 30609 31325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 31860 31537 gene locus_tag LOCUS_06320 31860 31537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 33099 35096 gene locus_tag LOCUS_06330 33099 35096 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271940.1 protein_id gnl|my_center|LOCUS_06330 35190 35645 gene locus_tag LOCUS_06340 gene greA 35190 35645 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_06340 35792 37132 gene locus_tag LOCUS_06350 gene lysS 35792 37132 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257111.1 protein_id gnl|my_center|LOCUS_06350 37193 38473 gene locus_tag LOCUS_06360 gene serS 37193 38473 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_06360 38464 39381 gene locus_tag LOCUS_06370 gene cysM 38464 39381 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930733.1 protein_id gnl|my_center|LOCUS_06370 39464 40309 gene locus_tag LOCUS_06380 39464 40309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 41411 40323 gene locus_tag LOCUS_06390 41411 40323 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_06390 42322 41408 gene locus_tag LOCUS_06400 42322 41408 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_06400 44370 42397 gene locus_tag LOCUS_06410 44370 42397 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421608.1 protein_id gnl|my_center|LOCUS_06410 44614 45180 gene locus_tag LOCUS_06420 44614 45180 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_06420 45303 45665 gene locus_tag LOCUS_06430 gene ndhC 45303 45665 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258748.1 protein_id gnl|my_center|LOCUS_06430 45669 46244 gene locus_tag LOCUS_06440 45669 46244 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337546.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence010 3 749 gene locus_tag LOCUS_06450 3 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2402 759 gene locus_tag LOCUS_06460 2402 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 4276 2399 gene locus_tag LOCUS_06470 4276 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 5417 4320 gene locus_tag LOCUS_06480 5417 4320 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_06480 6409 5414 gene locus_tag LOCUS_06490 6409 5414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_06490 8466 6406 gene locus_tag LOCUS_06500 8466 6406 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_06500 10514 8463 gene locus_tag LOCUS_06510 10514 8463 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_06510 10651 11898 gene locus_tag LOCUS_06520 10651 11898 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_06520 13082 11895 gene locus_tag LOCUS_06530 13082 11895 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_06530 13243 14724 gene locus_tag LOCUS_06540 13243 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 14721 15644 gene locus_tag LOCUS_06550 14721 15644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 16430 15660 gene locus_tag LOCUS_06560 16430 15660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 17316 16471 gene locus_tag LOCUS_06570 17316 16471 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_06570 17397 18437 gene locus_tag LOCUS_06580 17397 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 19208 20671 gene locus_tag LOCUS_06590 19208 20671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 20767 21969 gene locus_tag LOCUS_06600 20767 21969 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_06600 21978 23027 gene locus_tag LOCUS_06610 21978 23027 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393095.1 protein_id gnl|my_center|LOCUS_06610 23271 24143 gene locus_tag LOCUS_06620 23271 24143 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_06620 25568 24189 gene locus_tag LOCUS_06630 25568 24189 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458983.1 protein_id gnl|my_center|LOCUS_06630 25686 26066 gene locus_tag LOCUS_06640 25686 26066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 27078 26092 gene locus_tag LOCUS_06650 27078 26092 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017237.1 protein_id gnl|my_center|LOCUS_06650 27457 27083 gene locus_tag LOCUS_06660 27457 27083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 28107 27457 gene locus_tag LOCUS_06670 28107 27457 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403695.1 protein_id gnl|my_center|LOCUS_06670 29424 28108 gene locus_tag LOCUS_06680 29424 28108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 30562 29543 gene locus_tag LOCUS_06690 gene serA 30562 29543 CDS product D-3-phosphoglycerate dehydrogenase SerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403698.1 protein_id gnl|my_center|LOCUS_06690 31471 30590 gene locus_tag LOCUS_06700 31471 30590 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030936.1 protein_id gnl|my_center|LOCUS_06700 31800 31468 gene locus_tag LOCUS_06710 31800 31468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 33235 31871 gene locus_tag LOCUS_06720 gene selA 33235 31871 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_06720 34433 33228 gene locus_tag LOCUS_06730 34433 33228 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_06730 34627 35709 gene locus_tag LOCUS_06740 gene mnmA 34627 35709 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_06740 35706 36029 gene locus_tag LOCUS_06750 35706 36029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 36678 35998 gene locus_tag LOCUS_06760 36678 35998 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_06760 37334 36654 gene locus_tag LOCUS_06770 37334 36654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 37502 38329 gene locus_tag LOCUS_06780 37502 38329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 38721 40226 gene locus_tag LOCUS_06790 gene trpE 38721 40226 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_06790 40207 40791 gene locus_tag LOCUS_06800 40207 40791 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_06800 40788 41813 gene locus_tag LOCUS_06810 gene trpD 40788 41813 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_06810 41817 42596 gene locus_tag LOCUS_06820 gene trpC 41817 42596 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_06820 42604 43221 gene locus_tag LOCUS_06830 42604 43221 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392851.1 protein_id gnl|my_center|LOCUS_06830 43218 44207 gene locus_tag LOCUS_06840 43218 44207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 44210 45412 gene locus_tag LOCUS_06850 gene trpB 44210 45412 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728904.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence011 369 1496 gene locus_tag LOCUS_06860 369 1496 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_06860 2481 1522 gene locus_tag LOCUS_06870 2481 1522 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_06870 2725 3303 gene locus_tag LOCUS_06880 2725 3303 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531326.1 protein_id gnl|my_center|LOCUS_06880 4338 3523 gene locus_tag LOCUS_06890 4338 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 5298 4474 gene locus_tag LOCUS_06900 5298 4474 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_06900 5382 6752 gene locus_tag LOCUS_06910 5382 6752 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_06910 6974 9604 gene locus_tag LOCUS_06920 6974 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 9607 10311 gene locus_tag LOCUS_06930 9607 10311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_06930 10308 11609 gene locus_tag LOCUS_06940 10308 11609 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173094.1 protein_id gnl|my_center|LOCUS_06940 11814 11626 gene locus_tag LOCUS_06950 11814 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 11937 12419 gene locus_tag LOCUS_06960 11937 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 12502 13392 gene locus_tag LOCUS_06970 12502 13392 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008032.1 protein_id gnl|my_center|LOCUS_06970 14156 13482 gene locus_tag LOCUS_06980 14156 13482 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391460.1 protein_id gnl|my_center|LOCUS_06980 17025 35894 gene locus_tag LOCUS_06990 17025 35894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 36448 36642 gene locus_tag LOCUS_07000 36448 36642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 37404 37811 gene locus_tag LOCUS_07010 37404 37811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 38824 37985 gene locus_tag LOCUS_07020 38824 37985 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_07020 39420 38821 gene locus_tag LOCUS_07030 39420 38821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 39715 39401 gene locus_tag LOCUS_07040 39715 39401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 39859 40059 gene locus_tag LOCUS_07050 39859 40059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 41053 40979 gene locus_tag LOCUS_t00120 41053 40979 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 41570 41082 gene locus_tag LOCUS_07060 41570 41082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 <42543 42031 gene locus_tag LOCUS_07070 <42543 42031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113700.1:4-hydroxythreonine-4-phosphate dehydrogenase PdxA >Feature sequence012 475 1767 gene locus_tag LOCUS_07080 475 1767 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036521.1 protein_id gnl|my_center|LOCUS_07080 1949 2887 gene locus_tag LOCUS_07090 1949 2887 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_07090 2904 3809 gene locus_tag LOCUS_07100 2904 3809 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_07100 3855 6299 gene locus_tag LOCUS_07110 3855 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 6340 7521 gene locus_tag LOCUS_07120 6340 7521 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012165757.1 protein_id gnl|my_center|LOCUS_07120 7993 9639 gene locus_tag LOCUS_07130 7993 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 9643 9939 gene locus_tag LOCUS_07140 9643 9939 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256425.1 protein_id gnl|my_center|LOCUS_07140 9943 10545 gene locus_tag LOCUS_07150 gene recR 9943 10545 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_07150 10535 11245 gene locus_tag LOCUS_07160 10535 11245 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392252.1 protein_id gnl|my_center|LOCUS_07160 11802 11248 gene locus_tag LOCUS_07170 11802 11248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 11960 13015 gene locus_tag LOCUS_07180 gene chrA 11960 13015 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_07180 13201 14484 gene locus_tag LOCUS_07190 13201 14484 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259028.1 protein_id gnl|my_center|LOCUS_07190 14492 16909 gene locus_tag LOCUS_07200 14492 16909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 16913 17197 gene locus_tag LOCUS_07210 16913 17197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 17446 17760 gene locus_tag LOCUS_07220 17446 17760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 18334 17786 gene locus_tag LOCUS_07230 gene mug 18334 17786 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230901.1 protein_id gnl|my_center|LOCUS_07230 18553 19191 gene locus_tag LOCUS_07240 18553 19191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 19282 20268 gene locus_tag LOCUS_07250 19282 20268 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_07250 20265 21362 gene locus_tag LOCUS_07260 20265 21362 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_07260 22639 21368 gene locus_tag LOCUS_07270 22639 21368 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868853.1 protein_id gnl|my_center|LOCUS_07270 23521 22685 gene locus_tag LOCUS_07280 23521 22685 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392476.1 protein_id gnl|my_center|LOCUS_07280 24279 23518 gene locus_tag LOCUS_07290 24279 23518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392475.1 protein_id gnl|my_center|LOCUS_07290 25274 24426 gene locus_tag LOCUS_07300 25274 24426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 27016 25271 gene locus_tag LOCUS_07310 27016 25271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 28736 27018 gene locus_tag LOCUS_07320 28736 27018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 29526 28789 gene locus_tag LOCUS_07330 29526 28789 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887903.1 protein_id gnl|my_center|LOCUS_07330 29716 29913 gene locus_tag LOCUS_07340 29716 29913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 30081 30782 gene locus_tag LOCUS_07350 30081 30782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 30877 32115 gene locus_tag LOCUS_07360 30877 32115 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_07360 32149 33315 gene locus_tag LOCUS_07370 32149 33315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 33350 34540 gene locus_tag LOCUS_07380 33350 34540 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618904.1 protein_id gnl|my_center|LOCUS_07380 34533 35501 gene locus_tag LOCUS_07390 34533 35501 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_07390 37028 35451 gene locus_tag LOCUS_07400 37028 35451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 37168 38010 gene locus_tag LOCUS_07410 37168 38010 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838531.1 protein_id gnl|my_center|LOCUS_07410 39636 38035 gene locus_tag LOCUS_07420 39636 38035 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705871.1 protein_id gnl|my_center|LOCUS_07420 41254 39641 gene locus_tag LOCUS_07430 41254 39641 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_07430 41732 41247 gene locus_tag LOCUS_07440 41732 41247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence013 <1 880 gene locus_tag LOCUS_07450 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388509.1:peptide chain release factor N(5)-glutamine methyltransferase 929 1573 gene locus_tag LOCUS_07460 gene gmk 929 1573 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_07460 1578 4016 gene locus_tag LOCUS_07470 gene priA 1578 4016 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259672.1 protein_id gnl|my_center|LOCUS_07470 4022 4522 gene locus_tag LOCUS_07480 gene def 4022 4522 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392416.1 protein_id gnl|my_center|LOCUS_07480 4527 5480 gene locus_tag LOCUS_07490 gene fmt 4527 5480 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_07490 5578 6303 gene locus_tag LOCUS_07500 5578 6303 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_07500 6319 7398 gene locus_tag LOCUS_07510 gene rlmN 6319 7398 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229030.1 protein_id gnl|my_center|LOCUS_07510 7609 7409 gene locus_tag LOCUS_07520 7609 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 7508 8170 gene locus_tag LOCUS_07530 gene rpe 7508 8170 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_07530 8373 8167 gene locus_tag LOCUS_07540 8373 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 8460 10100 gene locus_tag LOCUS_07550 8460 10100 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 protein_id gnl|my_center|LOCUS_07550 10116 12419 gene locus_tag LOCUS_07560 gene recG 10116 12419 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_07560 12427 13023 gene locus_tag LOCUS_07570 gene rsmD 12427 13023 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_07570 13034 13543 gene locus_tag LOCUS_07580 gene coaD 13034 13543 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 protein_id gnl|my_center|LOCUS_07580 13607 14029 gene locus_tag LOCUS_07590 13607 14029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 14071 14592 gene locus_tag LOCUS_07600 14071 14592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 14827 15825 gene locus_tag LOCUS_07610 gene fabD 14827 15825 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258269.1 protein_id gnl|my_center|LOCUS_07610 15818 16576 gene locus_tag LOCUS_07620 gene fabG 15818 16576 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_07620 16580 17938 gene locus_tag LOCUS_07630 gene accC 16580 17938 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124229.1 protein_id gnl|my_center|LOCUS_07630 17994 18389 gene locus_tag LOCUS_07640 gene nusB 17994 18389 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_07640 18394 19218 gene locus_tag LOCUS_07650 gene tatC 18394 19218 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259255.1 protein_id gnl|my_center|LOCUS_07650 20162 19215 gene locus_tag LOCUS_07660 20162 19215 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943100.1 protein_id gnl|my_center|LOCUS_07660 21159 20299 gene locus_tag LOCUS_07670 21159 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 21496 22086 gene locus_tag LOCUS_07680 gene lepB 21496 22086 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257166.1 protein_id gnl|my_center|LOCUS_07680 22574 22083 gene locus_tag LOCUS_07690 22574 22083 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_07690 23022 25031 gene locus_tag LOCUS_07700 23022 25031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 25396 25097 gene locus_tag LOCUS_07710 25396 25097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 25514 26725 gene locus_tag LOCUS_07720 25514 26725 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_07720 27282 26956 gene locus_tag LOCUS_07730 27282 26956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 27592 27314 gene locus_tag LOCUS_07740 27592 27314 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_07740 28985 27792 gene locus_tag LOCUS_07750 28985 27792 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_07750 29167 29763 gene locus_tag LOCUS_07760 29167 29763 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_07760 29760 30602 gene locus_tag LOCUS_07770 29760 30602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 31550 30675 gene locus_tag LOCUS_07780 31550 30675 CDS product DUF1479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_07780 31742 32710 gene locus_tag LOCUS_07790 31742 32710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 34105 32816 gene locus_tag LOCUS_07800 34105 32816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 35878 34268 gene locus_tag LOCUS_07810 gene ggt 35878 34268 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868894.1 protein_id gnl|my_center|LOCUS_07810 36953 36081 gene locus_tag LOCUS_07820 36953 36081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 37366 37040 gene locus_tag LOCUS_07830 37366 37040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 38492 37380 gene locus_tag LOCUS_07840 38492 37380 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_07840 39424 38489 gene locus_tag LOCUS_07850 39424 38489 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_07850 41116 39485 gene locus_tag LOCUS_07860 41116 39485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence014 2374 1253 gene locus_tag LOCUS_07870 2374 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 4060 3368 gene locus_tag LOCUS_07880 4060 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 5672 6922 gene locus_tag LOCUS_07890 5672 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 8214 6991 gene locus_tag LOCUS_07900 8214 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 8652 8350 gene locus_tag LOCUS_07910 8652 8350 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256893.1 protein_id gnl|my_center|LOCUS_07910 9634 10641 gene locus_tag LOCUS_07920 gene xerC 9634 10641 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_07920 10646 11002 gene locus_tag LOCUS_07930 10646 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 12315 10999 gene locus_tag LOCUS_07940 12315 10999 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_07940 13643 12312 gene locus_tag LOCUS_07950 gene hflX 13643 12312 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_07950 14790 13624 gene locus_tag LOCUS_07960 14790 13624 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_07960 16090 14792 gene locus_tag LOCUS_07970 16090 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 16432 17004 gene locus_tag LOCUS_07980 16432 17004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 17008 17598 gene locus_tag LOCUS_07990 17008 17598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 18264 19766 gene locus_tag LOCUS_08000 18264 19766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 19739 20644 gene locus_tag LOCUS_08010 19739 20644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 20619 25643 gene locus_tag LOCUS_08020 20619 25643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 26975 25830 gene locus_tag LOCUS_08030 26975 25830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 31743 27145 gene locus_tag LOCUS_08040 31743 27145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 33278 32478 gene locus_tag LOCUS_08050 33278 32478 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226033.1 protein_id gnl|my_center|LOCUS_08050 33954 33460 gene locus_tag LOCUS_08060 33954 33460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 34077 34352 gene locus_tag LOCUS_08070 34077 34352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 34349 34777 gene locus_tag LOCUS_08080 34349 34777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 35043 36047 gene locus_tag LOCUS_08090 35043 36047 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_08090 36050 36682 gene locus_tag LOCUS_08100 36050 36682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 36679 37533 gene locus_tag LOCUS_08110 gene folD 36679 37533 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207454.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence015 1646 336 gene locus_tag LOCUS_08120 1646 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 1860 1621 gene locus_tag LOCUS_08130 1860 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1972 2340 gene locus_tag LOCUS_08140 1972 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 2589 3746 gene locus_tag LOCUS_08150 2589 3746 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_08150 3746 4489 gene locus_tag LOCUS_08160 3746 4489 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_08160 4556 5965 gene locus_tag LOCUS_08170 gene lpdA 4556 5965 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230317.1 protein_id gnl|my_center|LOCUS_08170 6141 5983 gene locus_tag LOCUS_08180 6141 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 6094 6795 gene locus_tag LOCUS_08190 6094 6795 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870429.1 protein_id gnl|my_center|LOCUS_08190 7601 6822 gene locus_tag LOCUS_08200 7601 6822 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227838.1 protein_id gnl|my_center|LOCUS_08200 7712 7984 gene locus_tag LOCUS_08210 7712 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 8014 8283 gene locus_tag LOCUS_08220 gene vapB30 8014 8283 CDS product type II toxin-antitoxin system antitoxin VapB30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403235.1 protein_id gnl|my_center|LOCUS_08220 8304 8666 gene locus_tag LOCUS_08230 8304 8666 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533691.1 protein_id gnl|my_center|LOCUS_08230 8739 9851 gene locus_tag LOCUS_08240 8739 9851 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_08240 9844 10206 gene locus_tag LOCUS_08250 9844 10206 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090630.1 protein_id gnl|my_center|LOCUS_08250 10508 11644 gene locus_tag LOCUS_08260 10508 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 11717 12880 gene locus_tag LOCUS_08270 11717 12880 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255920.1 protein_id gnl|my_center|LOCUS_08270 13008 14309 gene locus_tag LOCUS_08280 13008 14309 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_08280 14306 15373 gene locus_tag LOCUS_08290 gene thrC 14306 15373 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392819.1 protein_id gnl|my_center|LOCUS_08290 16277 15405 gene locus_tag LOCUS_08300 gene panC 16277 15405 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258070.1 protein_id gnl|my_center|LOCUS_08300 16455 16946 gene locus_tag LOCUS_08310 16455 16946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 16939 18735 gene locus_tag LOCUS_08320 16939 18735 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_08320 18747 20570 gene locus_tag LOCUS_08330 18747 20570 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360293.1 protein_id gnl|my_center|LOCUS_08330 21300 20614 gene locus_tag LOCUS_08340 21300 20614 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 protein_id gnl|my_center|LOCUS_08340 21470 22378 gene locus_tag LOCUS_08350 21470 22378 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_08350 23146 22424 gene locus_tag LOCUS_08360 gene tpiA 23146 22424 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_08360 24299 23238 gene locus_tag LOCUS_08370 24299 23238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 24672 24478 gene locus_tag LOCUS_08380 24672 24478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 25474 24725 gene locus_tag LOCUS_08390 25474 24725 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632942.1 protein_id gnl|my_center|LOCUS_08390 26811 25471 gene locus_tag LOCUS_08400 26811 25471 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_08400 27389 28264 gene locus_tag LOCUS_08410 27389 28264 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255173.1 protein_id gnl|my_center|LOCUS_08410 28261 29079 gene locus_tag LOCUS_08420 28261 29079 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925131.1 protein_id gnl|my_center|LOCUS_08420 29557 29057 gene locus_tag LOCUS_08430 29557 29057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 29453 29728 gene locus_tag LOCUS_08440 29453 29728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 29852 30856 gene locus_tag LOCUS_08450 29852 30856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 31143 31913 gene locus_tag LOCUS_08460 31143 31913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 32473 33540 gene locus_tag LOCUS_08470 32473 33540 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729463.1 protein_id gnl|my_center|LOCUS_08470 33548 35014 gene locus_tag LOCUS_08480 33548 35014 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_08480 35514 35059 gene locus_tag LOCUS_08490 35514 35059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 35814 35533 gene locus_tag LOCUS_08500 35814 35533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 36758 35814 gene locus_tag LOCUS_08510 36758 35814 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861113.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence016 3 470 gene locus_tag LOCUS_08520 3 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 766 467 gene locus_tag LOCUS_08530 766 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 749 2989 gene locus_tag LOCUS_08540 749 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2986 3642 gene locus_tag LOCUS_08550 2986 3642 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_08550 4611 3568 gene locus_tag LOCUS_08560 4611 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 4912 5979 gene locus_tag LOCUS_08570 4912 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 6776 5976 gene locus_tag LOCUS_08580 6776 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 6876 7682 gene locus_tag LOCUS_08590 6876 7682 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240366.1 protein_id gnl|my_center|LOCUS_08590 7697 9706 gene locus_tag LOCUS_08600 7697 9706 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_08600 10321 9728 gene locus_tag LOCUS_08610 10321 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 10486 11379 gene locus_tag LOCUS_08620 gene galU 10486 11379 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937189.1 protein_id gnl|my_center|LOCUS_08620 11424 12488 gene locus_tag LOCUS_08630 11424 12488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 12485 14005 gene locus_tag LOCUS_08640 gene xylB 12485 14005 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_08640 14080 14988 gene locus_tag LOCUS_08650 14080 14988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 15102 15848 gene locus_tag LOCUS_08660 15102 15848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 15891 17072 gene locus_tag LOCUS_08670 gene ugpC 15891 17072 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222655.1 protein_id gnl|my_center|LOCUS_08670 17289 18479 gene locus_tag LOCUS_08680 gene nusA 17289 18479 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_08680 18476 18775 gene locus_tag LOCUS_08690 gene rulR 18476 18775 CDS product glucose-induced regulator RulR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967250.1 protein_id gnl|my_center|LOCUS_08690 18897 20660 gene locus_tag LOCUS_08700 18897 20660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08700 20788 21066 gene locus_tag LOCUS_08710 20788 21066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 21056 22012 gene locus_tag LOCUS_08720 gene truB 21056 22012 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_08720 22012 23004 gene locus_tag LOCUS_08730 22012 23004 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_08730 23208 23870 gene locus_tag LOCUS_08740 23208 23870 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 protein_id gnl|my_center|LOCUS_08740 23971 25572 gene locus_tag LOCUS_08750 gene ggt 23971 25572 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808651.1 protein_id gnl|my_center|LOCUS_08750 25687 26949 gene locus_tag LOCUS_08760 25687 26949 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065381.1 protein_id gnl|my_center|LOCUS_08760 26946 29918 gene locus_tag LOCUS_08770 26946 29918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 31026 29968 gene locus_tag LOCUS_08780 31026 29968 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_08780 33132 31054 gene locus_tag LOCUS_08790 gene fusA 33132 31054 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_08790 33258 34376 gene locus_tag LOCUS_08800 gene proB 33258 34376 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909083.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence017 <1 533 gene locus_tag LOCUS_08810 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921844.1:DNA polymerase I 866 1816 gene locus_tag LOCUS_08820 866 1816 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949052.1 protein_id gnl|my_center|LOCUS_08820 1785 2363 gene locus_tag LOCUS_08830 1785 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 2363 3112 gene locus_tag LOCUS_08840 2363 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3541 4524 gene locus_tag LOCUS_08850 3541 4524 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_08850 4599 5411 gene locus_tag LOCUS_08860 4599 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 5412 6284 gene locus_tag LOCUS_08870 5412 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 6281 7438 gene locus_tag LOCUS_08880 6281 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 7458 10658 gene locus_tag LOCUS_08890 7458 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08890 10864 11088 gene locus_tag LOCUS_08900 10864 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 11866 12063 gene locus_tag LOCUS_08910 11866 12063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 12987 12751 gene locus_tag LOCUS_08920 12987 12751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 13220 12984 gene locus_tag LOCUS_08930 13220 12984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 15738 15523 gene locus_tag LOCUS_08940 15738 15523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 16673 16419 gene locus_tag LOCUS_08950 16673 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 16569 17408 gene locus_tag LOCUS_08960 16569 17408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 17419 18588 gene locus_tag LOCUS_08970 17419 18588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 19341 20495 gene locus_tag LOCUS_08980 19341 20495 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256151.1 protein_id gnl|my_center|LOCUS_08980 21058 22689 gene locus_tag LOCUS_08990 21058 22689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 22772 23311 gene locus_tag LOCUS_09000 22772 23311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 23315 24328 gene locus_tag LOCUS_09010 23315 24328 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227854.1 protein_id gnl|my_center|LOCUS_09010 24325 24651 gene locus_tag LOCUS_09020 24325 24651 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_09020 25045 24824 gene locus_tag LOCUS_09030 25045 24824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 24953 25882 gene locus_tag LOCUS_09040 24953 25882 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09040 29315 26067 gene locus_tag LOCUS_09050 29315 26067 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804172.1 protein_id gnl|my_center|LOCUS_09050 31061 29373 gene locus_tag LOCUS_09060 31061 29373 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804171.1 protein_id gnl|my_center|LOCUS_09060 32271 31048 gene locus_tag LOCUS_09070 32271 31048 CDS product DUF6361 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804170.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence018 263 604 gene locus_tag LOCUS_09080 263 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1075 665 gene locus_tag LOCUS_09090 1075 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1698 1075 gene locus_tag LOCUS_09100 1698 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2208 2552 gene locus_tag LOCUS_09110 2208 2552 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809935.1 protein_id gnl|my_center|LOCUS_09110 2668 3012 gene locus_tag LOCUS_09120 2668 3012 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_09120 3080 4030 gene locus_tag LOCUS_09130 3080 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4040 5209 gene locus_tag LOCUS_09140 4040 5209 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_09140 5209 5628 gene locus_tag LOCUS_09150 5209 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 5625 6908 gene locus_tag LOCUS_09160 5625 6908 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_09160 6911 9097 gene locus_tag LOCUS_09170 6911 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 9944 9126 gene locus_tag LOCUS_09180 9944 9126 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_09180 10090 11412 gene locus_tag LOCUS_09190 10090 11412 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144150.1 protein_id gnl|my_center|LOCUS_09190 12392 11448 gene locus_tag LOCUS_09200 12392 11448 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257726.1 protein_id gnl|my_center|LOCUS_09200 14322 12505 gene locus_tag LOCUS_09210 gene dxs 14322 12505 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_09210 14696 14478 gene locus_tag LOCUS_09220 14696 14478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 14601 15239 gene locus_tag LOCUS_09230 14601 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 16259 15249 gene locus_tag LOCUS_09240 gene hpnH 16259 15249 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_09240 17034 16744 gene locus_tag LOCUS_09250 17034 16744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 17363 17031 gene locus_tag LOCUS_09260 17363 17031 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497212.1 protein_id gnl|my_center|LOCUS_09260 19389 17494 gene locus_tag LOCUS_09270 gene shc 19389 17494 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_09270 20738 19386 gene locus_tag LOCUS_09280 gene hpnE 20738 19386 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_09280 21571 20735 gene locus_tag LOCUS_09290 gene hpnD 21571 20735 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_09290 22435 21575 gene locus_tag LOCUS_09300 gene hpnC 22435 21575 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_09300 24003 22687 gene locus_tag LOCUS_09310 24003 22687 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_09310 25286 24000 gene locus_tag LOCUS_09320 25286 24000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09320 25320 25742 gene locus_tag LOCUS_09330 25320 25742 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_09330 25743 26819 gene locus_tag LOCUS_09340 25743 26819 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_09340 27591 26977 gene locus_tag LOCUS_09350 27591 26977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 27738 28472 gene locus_tag LOCUS_09360 27738 28472 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227838.1 protein_id gnl|my_center|LOCUS_09360 28469 29203 gene locus_tag LOCUS_09370 28469 29203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 30252 29236 gene locus_tag LOCUS_09380 30252 29236 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120607.1 protein_id gnl|my_center|LOCUS_09380 30828 30421 gene locus_tag LOCUS_09390 30828 30421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence019 928 113 gene locus_tag LOCUS_09400 928 113 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_09400 1249 1061 gene locus_tag LOCUS_09410 1249 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1907 1719 gene locus_tag LOCUS_09420 1907 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3017 2037 gene locus_tag LOCUS_09430 3017 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 3691 3041 gene locus_tag LOCUS_09440 3691 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09440 4568 3738 gene locus_tag LOCUS_09450 4568 3738 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_09450 5960 4755 gene locus_tag LOCUS_09460 5960 4755 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_09460 6650 6048 gene locus_tag LOCUS_09470 6650 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 8212 6671 gene locus_tag LOCUS_09480 8212 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 9977 8220 gene locus_tag LOCUS_09490 9977 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 10831 10028 gene locus_tag LOCUS_09500 10831 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 11879 11187 gene locus_tag LOCUS_09510 11879 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 13870 12044 gene locus_tag LOCUS_09520 13870 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 14465 13857 gene locus_tag LOCUS_09530 14465 13857 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643206.1 protein_id gnl|my_center|LOCUS_09530 15764 14616 gene locus_tag LOCUS_09540 15764 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 16906 15761 gene locus_tag LOCUS_09550 16906 15761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 18141 17077 gene locus_tag LOCUS_09560 18141 17077 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257504.1 protein_id gnl|my_center|LOCUS_09560 19367 18141 gene locus_tag LOCUS_09570 gene wcaI 19367 18141 CDS product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699753.1 protein_id gnl|my_center|LOCUS_09570 20125 19379 gene locus_tag LOCUS_09580 20125 19379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 20334 22103 gene locus_tag LOCUS_09590 gene asnB 20334 22103 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533108.1 protein_id gnl|my_center|LOCUS_09590 22922 22092 gene locus_tag LOCUS_09600 22922 22092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 23771 22923 gene locus_tag LOCUS_09610 23771 22923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 24944 24114 gene locus_tag LOCUS_09620 24944 24114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 25661 24945 gene locus_tag LOCUS_09630 25661 24945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 26817 25780 gene locus_tag LOCUS_09640 26817 25780 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_09640 28040 26862 gene locus_tag LOCUS_09650 28040 26862 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909061.1 protein_id gnl|my_center|LOCUS_09650 27972 28247 gene locus_tag LOCUS_09660 27972 28247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 29426 28308 gene locus_tag LOCUS_09670 29426 28308 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142380.1 protein_id gnl|my_center|LOCUS_09670 29909 29565 gene locus_tag LOCUS_09680 29909 29565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence020 1917 79 gene locus_tag LOCUS_09690 1917 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2051 3043 gene locus_tag LOCUS_09700 2051 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 3344 3108 gene locus_tag LOCUS_09710 3344 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3733 3563 gene locus_tag LOCUS_09720 3733 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4140 3781 gene locus_tag LOCUS_09730 4140 3781 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_09730 4383 5120 gene locus_tag LOCUS_09740 4383 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 7003 5195 gene locus_tag LOCUS_09750 7003 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 7545 7180 gene locus_tag LOCUS_09760 7545 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 8143 7430 gene locus_tag LOCUS_09770 8143 7430 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_09770 8971 8144 gene locus_tag LOCUS_09780 8971 8144 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528737.1 protein_id gnl|my_center|LOCUS_09780 10729 9485 gene locus_tag LOCUS_09790 gene dnaA 10729 9485 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229057.1 protein_id gnl|my_center|LOCUS_09790 11311 11466 gene locus_tag LOCUS_09800 11311 11466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 12039 11470 gene locus_tag LOCUS_09810 12039 11470 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259510.1 protein_id gnl|my_center|LOCUS_09810 12119 14983 gene locus_tag LOCUS_09820 12119 14983 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_09820 15167 16171 gene locus_tag LOCUS_09830 15167 16171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 17263 16229 gene locus_tag LOCUS_09840 17263 16229 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_09840 18015 17263 gene locus_tag LOCUS_09850 18015 17263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 18126 18806 gene locus_tag LOCUS_09860 18126 18806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 19801 18866 gene locus_tag LOCUS_09870 19801 18866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 20028 19798 gene locus_tag LOCUS_09880 20028 19798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 20670 20038 gene locus_tag LOCUS_09890 20670 20038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 21742 20816 gene locus_tag LOCUS_09900 21742 20816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 22160 22864 gene locus_tag LOCUS_09910 22160 22864 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_09910 23603 22827 gene locus_tag LOCUS_09920 23603 22827 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972011.1 protein_id gnl|my_center|LOCUS_09920 23719 24687 gene locus_tag LOCUS_09930 23719 24687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 25384 24731 gene locus_tag LOCUS_09940 25384 24731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 26515 25391 gene locus_tag LOCUS_09950 26515 25391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence021 438 1421 gene locus_tag LOCUS_09960 438 1421 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_09960 1424 2203 gene locus_tag LOCUS_09970 1424 2203 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_09970 2240 3373 gene locus_tag LOCUS_09980 2240 3373 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256104.1 protein_id gnl|my_center|LOCUS_09980 3370 4479 gene locus_tag LOCUS_09990 3370 4479 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_09990 5532 4684 gene locus_tag LOCUS_10000 5532 4684 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 protein_id gnl|my_center|LOCUS_10000 6590 5667 gene locus_tag LOCUS_10010 6590 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 7648 6683 gene locus_tag LOCUS_10020 7648 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 10623 7687 gene locus_tag LOCUS_10030 gene uvrA 10623 7687 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_10030 10764 12116 gene locus_tag LOCUS_10040 10764 12116 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173806.1 protein_id gnl|my_center|LOCUS_10040 12559 12173 gene locus_tag LOCUS_10050 12559 12173 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922062.1 protein_id gnl|my_center|LOCUS_10050 13210 12647 gene locus_tag LOCUS_10060 13210 12647 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_10060 13743 13207 gene locus_tag LOCUS_10070 13743 13207 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223648.1 protein_id gnl|my_center|LOCUS_10070 14282 13740 gene locus_tag LOCUS_10080 14282 13740 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065210.1 protein_id gnl|my_center|LOCUS_10080 15367 14306 gene locus_tag LOCUS_10090 15367 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 15640 16242 gene locus_tag LOCUS_10100 15640 16242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 16335 17147 gene locus_tag LOCUS_10110 16335 17147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 18761 17202 gene locus_tag LOCUS_10120 18761 17202 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_10120 18886 19653 gene locus_tag LOCUS_10130 18886 19653 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_10130 19704 21341 gene locus_tag LOCUS_10140 19704 21341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 21450 21695 gene locus_tag LOCUS_10150 21450 21695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 21696 22133 gene locus_tag LOCUS_10160 21696 22133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 23643 22174 gene locus_tag LOCUS_10170 23643 22174 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389097.1 protein_id gnl|my_center|LOCUS_10170 24528 23707 gene locus_tag LOCUS_10180 24528 23707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 25644 24562 gene locus_tag LOCUS_10190 25644 24562 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393322.1 protein_id gnl|my_center|LOCUS_10190 26375 25641 gene locus_tag LOCUS_10200 26375 25641 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_10200 27408 26503 gene locus_tag LOCUS_10210 gene modA 27408 26503 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_10210 27858 27547 gene locus_tag LOCUS_10220 27858 27547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 28130 28450 gene locus_tag LOCUS_10230 28130 28450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence022 1153 395 gene locus_tag LOCUS_10240 1153 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1927 1163 gene locus_tag LOCUS_10250 1927 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2427 2041 gene locus_tag LOCUS_10260 2427 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3142 2522 gene locus_tag LOCUS_10270 3142 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3226 4662 gene locus_tag LOCUS_10280 gene gndA 3226 4662 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141117.1 protein_id gnl|my_center|LOCUS_10280 5158 4673 gene locus_tag LOCUS_10290 5158 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 6034 5429 gene locus_tag LOCUS_10300 6034 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 6316 6101 gene locus_tag LOCUS_10310 6316 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 6495 7247 gene locus_tag LOCUS_10320 6495 7247 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393206.1 protein_id gnl|my_center|LOCUS_10320 7341 7841 gene locus_tag LOCUS_10330 gene ruvC 7341 7841 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_10330 7838 8428 gene locus_tag LOCUS_10340 gene ruvA 7838 8428 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223336.1 protein_id gnl|my_center|LOCUS_10340 8425 9459 gene locus_tag LOCUS_10350 gene ruvB 8425 9459 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258937.1 protein_id gnl|my_center|LOCUS_10350 9461 9757 gene locus_tag LOCUS_10360 9461 9757 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631905.1 protein_id gnl|my_center|LOCUS_10360 9768 11009 gene locus_tag LOCUS_10370 9768 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 11343 10996 gene locus_tag LOCUS_10380 11343 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 11394 13001 gene locus_tag LOCUS_10390 11394 13001 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_10390 13468 12983 gene locus_tag LOCUS_10400 13468 12983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 14149 13481 gene locus_tag LOCUS_10410 gene plsY 14149 13481 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228511.1 protein_id gnl|my_center|LOCUS_10410 15583 14228 gene locus_tag LOCUS_10420 gene der 15583 14228 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_10420 16247 15576 gene locus_tag LOCUS_10430 16247 15576 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_10430 16953 16240 gene locus_tag LOCUS_10440 gene cmk 16953 16240 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554563.1 protein_id gnl|my_center|LOCUS_10440 17252 17488 gene locus_tag LOCUS_10450 17252 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 17684 18067 gene locus_tag LOCUS_10460 17684 18067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 18289 18636 gene locus_tag LOCUS_10470 18289 18636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 18940 20568 gene locus_tag LOCUS_10480 18940 20568 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142798.1 protein_id gnl|my_center|LOCUS_10480 20598 22499 gene locus_tag LOCUS_10490 20598 22499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 22744 23706 gene locus_tag LOCUS_10500 gene thyX 22744 23706 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_10500 24576 23908 gene locus_tag LOCUS_10510 24576 23908 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289175.1 protein_id gnl|my_center|LOCUS_10510 24727 25623 gene locus_tag LOCUS_10520 24727 25623 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256486.1 protein_id gnl|my_center|LOCUS_10520 25623 26105 gene locus_tag LOCUS_10530 25623 26105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 <28020 26102 gene locus_tag LOCUS_10540 <28020 26102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975790.1:c-type cytochrome >Feature sequence023 1137 1799 gene locus_tag LOCUS_10550 1137 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2861 1815 gene locus_tag LOCUS_10560 2861 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 4788 2851 gene locus_tag LOCUS_10570 4788 2851 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582880.1 protein_id gnl|my_center|LOCUS_10570 5100 4855 gene locus_tag LOCUS_10580 5100 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 5996 5139 gene locus_tag LOCUS_10590 5996 5139 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_10590 6256 7356 gene locus_tag LOCUS_10600 6256 7356 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_10600 7456 8547 gene locus_tag LOCUS_10610 gene mtnA 7456 8547 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_10610 8567 9439 gene locus_tag LOCUS_10620 gene mtnP 8567 9439 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_10620 9503 10753 gene locus_tag LOCUS_10630 9503 10753 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640554.1 protein_id gnl|my_center|LOCUS_10630 11392 10781 gene locus_tag LOCUS_10640 11392 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040508.1 protein_id gnl|my_center|LOCUS_10640 11654 11385 gene locus_tag LOCUS_10650 11654 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 16234 11651 gene locus_tag LOCUS_10660 gene gltB 16234 11651 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_10660 16621 16959 gene locus_tag LOCUS_10670 16621 16959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 16981 17214 gene locus_tag LOCUS_10680 16981 17214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 17227 18006 gene locus_tag LOCUS_10690 17227 18006 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729455.1 protein_id gnl|my_center|LOCUS_10690 19010 18054 gene locus_tag LOCUS_10700 19010 18054 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728382.1 protein_id gnl|my_center|LOCUS_10700 19116 21539 gene locus_tag LOCUS_10710 19116 21539 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_10710 21576 21893 gene locus_tag LOCUS_10720 21576 21893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 21909 22469 gene locus_tag LOCUS_10730 21909 22469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 22476 22829 gene locus_tag LOCUS_10740 22476 22829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 24305 23061 gene locus_tag LOCUS_10750 24305 23061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 24447 26327 gene locus_tag LOCUS_10760 24447 26327 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259019.1 protein_id gnl|my_center|LOCUS_10760 26880 26389 gene locus_tag LOCUS_10770 26880 26389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence024 3 836 gene locus_tag LOCUS_10780 3 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 892 1857 gene locus_tag LOCUS_10790 892 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1871 2689 gene locus_tag LOCUS_10800 1871 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2748 3575 gene locus_tag LOCUS_10810 2748 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 4151 3588 gene locus_tag LOCUS_10820 4151 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4905 4129 gene locus_tag LOCUS_10830 4905 4129 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_10830 4941 5014 gene locus_tag LOCUS_t00130 4941 5014 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5069 7516 gene locus_tag LOCUS_10840 5069 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 7509 8003 gene locus_tag LOCUS_10850 7509 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 8544 8035 gene locus_tag LOCUS_10860 gene lspA 8544 8035 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_10860 9482 8541 gene locus_tag LOCUS_10870 9482 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 10115 9486 gene locus_tag LOCUS_10880 10115 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 11504 10161 gene locus_tag LOCUS_10890 11504 10161 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_10890 15105 11578 gene locus_tag LOCUS_10900 15105 11578 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153439724.1 protein_id gnl|my_center|LOCUS_10900 15273 16409 gene locus_tag LOCUS_10910 15273 16409 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099371.1 protein_id gnl|my_center|LOCUS_10910 17453 16416 gene locus_tag LOCUS_10920 17453 16416 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 protein_id gnl|my_center|LOCUS_10920 17605 18648 gene locus_tag LOCUS_10930 gene recA 17605 18648 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_10930 18664 19098 gene locus_tag LOCUS_10940 18664 19098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 19102 20085 gene locus_tag LOCUS_10950 19102 20085 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259441.1 protein_id gnl|my_center|LOCUS_10950 20085 21773 gene locus_tag LOCUS_10960 gene ggt 20085 21773 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929162.1 protein_id gnl|my_center|LOCUS_10960 21878 23344 gene locus_tag LOCUS_10970 21878 23344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 23353 24666 gene locus_tag LOCUS_10980 23353 24666 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_10980 24726 26582 gene locus_tag LOCUS_10990 24726 26582 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence025 2802 562 gene locus_tag LOCUS_11000 2802 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 6385 2981 gene locus_tag LOCUS_11010 6385 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 7147 6488 gene locus_tag LOCUS_11020 7147 6488 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_11020 8832 7264 gene locus_tag LOCUS_11030 8832 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 10685 8838 gene locus_tag LOCUS_11040 10685 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 11064 11750 gene locus_tag LOCUS_11050 11064 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 11824 12345 gene locus_tag LOCUS_11060 11824 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 12369 13499 gene locus_tag LOCUS_11070 12369 13499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 14233 13565 gene locus_tag LOCUS_11080 14233 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 14499 14245 gene locus_tag LOCUS_11090 14499 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 14437 16191 gene locus_tag LOCUS_11100 14437 16191 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_11100 17107 16244 gene locus_tag LOCUS_11110 17107 16244 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_11110 17613 17395 gene locus_tag LOCUS_11120 17613 17395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 17524 18573 gene locus_tag LOCUS_11130 17524 18573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 18605 19054 gene locus_tag LOCUS_11140 18605 19054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 19070 19543 gene locus_tag LOCUS_11150 19070 19543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 19679 20542 gene locus_tag LOCUS_11160 19679 20542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 20683 21747 gene locus_tag LOCUS_11170 20683 21747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 21883 23013 gene locus_tag LOCUS_11180 21883 23013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 23010 24464 gene locus_tag LOCUS_11190 23010 24464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 24526 24789 gene locus_tag LOCUS_11200 24526 24789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 24776 25195 gene locus_tag LOCUS_11210 24776 25195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 25415 25789 gene locus_tag LOCUS_11220 25415 25789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 26320 26000 gene locus_tag LOCUS_11230 26320 26000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence026 498 1202 gene locus_tag LOCUS_11240 gene kdpE 498 1202 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405305.1 protein_id gnl|my_center|LOCUS_11240 1195 2613 gene locus_tag LOCUS_11250 1195 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2635 3744 gene locus_tag LOCUS_11260 2635 3744 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_11260 4105 4488 gene locus_tag LOCUS_11270 4105 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 4619 5614 gene locus_tag LOCUS_11280 4619 5614 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_11280 5614 6405 gene locus_tag LOCUS_11290 5614 6405 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_11290 6464 7576 gene locus_tag LOCUS_11300 6464 7576 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_11300 7647 8000 gene locus_tag LOCUS_11310 7647 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 8093 8629 gene locus_tag LOCUS_11320 8093 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 9154 11526 gene locus_tag LOCUS_11330 9154 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 12694 11585 gene locus_tag LOCUS_11340 12694 11585 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728652.1 protein_id gnl|my_center|LOCUS_11340 14457 12718 gene locus_tag LOCUS_11350 14457 12718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 14675 14896 gene locus_tag LOCUS_11360 14675 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 15234 15452 gene locus_tag LOCUS_11370 15234 15452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 15469 16140 gene locus_tag LOCUS_11380 gene nusG 15469 16140 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_11380 16159 16584 gene locus_tag LOCUS_11390 gene rplK 16159 16584 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548197.1 protein_id gnl|my_center|LOCUS_11390 16629 17303 gene locus_tag LOCUS_11400 gene rplA 16629 17303 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_11400 17472 18014 gene locus_tag LOCUS_11410 gene rplJ 17472 18014 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 protein_id gnl|my_center|LOCUS_11410 18014 18394 gene locus_tag LOCUS_11420 gene rplL 18014 18394 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356427.1 protein_id gnl|my_center|LOCUS_11420 18460 19326 gene locus_tag LOCUS_11430 18460 19326 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258568.1 protein_id gnl|my_center|LOCUS_11430 19332 20096 gene locus_tag LOCUS_11440 19332 20096 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258938.1 protein_id gnl|my_center|LOCUS_11440 20093 21034 gene locus_tag LOCUS_11450 20093 21034 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259392.1 protein_id gnl|my_center|LOCUS_11450 21013 22197 gene locus_tag LOCUS_11460 21013 22197 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257466.1 protein_id gnl|my_center|LOCUS_11460 22181 24235 gene locus_tag LOCUS_11470 22181 24235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 25752 24232 gene locus_tag LOCUS_11480 25752 24232 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259564.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence027 2481 685 gene locus_tag LOCUS_11490 2481 685 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256503.1 protein_id gnl|my_center|LOCUS_11490 3456 2503 gene locus_tag LOCUS_11500 3456 2503 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_11500 3548 4096 gene locus_tag LOCUS_11510 gene pyrE 3548 4096 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023240.1 protein_id gnl|my_center|LOCUS_11510 4096 5190 gene locus_tag LOCUS_11520 4096 5190 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_11520 5318 6433 gene locus_tag LOCUS_11530 5318 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681099.1 protein_id gnl|my_center|LOCUS_11530 8845 6440 gene locus_tag LOCUS_11540 8845 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 9405 8842 gene locus_tag LOCUS_11550 9405 8842 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222410.1 protein_id gnl|my_center|LOCUS_11550 10419 9487 gene locus_tag LOCUS_11560 10419 9487 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_11560 11375 10416 gene locus_tag LOCUS_11570 11375 10416 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_11570 11504 11788 gene locus_tag LOCUS_11580 11504 11788 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074197.1 protein_id gnl|my_center|LOCUS_11580 12001 12225 gene locus_tag LOCUS_11590 12001 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 12983 12261 gene locus_tag LOCUS_11600 12983 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 13971 12949 gene locus_tag LOCUS_11610 13971 12949 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529382.1 protein_id gnl|my_center|LOCUS_11610 15025 13973 gene locus_tag LOCUS_11620 gene ltaE 15025 13973 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_11620 16086 15070 gene locus_tag LOCUS_11630 16086 15070 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_11630 16159 17643 gene locus_tag LOCUS_11640 gene pabB 16159 17643 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819891.1 protein_id gnl|my_center|LOCUS_11640 18188 17640 gene locus_tag LOCUS_11650 18188 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 18951 18226 gene locus_tag LOCUS_11660 18951 18226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 19089 19667 gene locus_tag LOCUS_11670 19089 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 19738 20148 gene locus_tag LOCUS_11680 19738 20148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 20825 20145 gene locus_tag LOCUS_11690 20825 20145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 21643 20894 gene locus_tag LOCUS_11700 21643 20894 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_11700 21934 21725 gene locus_tag LOCUS_11710 21934 21725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 21858 23804 gene locus_tag LOCUS_11720 21858 23804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 23864 24604 gene locus_tag LOCUS_11730 23864 24604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence028 1189 23 gene locus_tag LOCUS_11740 1189 23 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719837.1 protein_id gnl|my_center|LOCUS_11740 2756 1224 gene locus_tag LOCUS_11750 2756 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3880 2819 gene locus_tag LOCUS_11760 3880 2819 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582497.1 protein_id gnl|my_center|LOCUS_11760 4091 5047 gene locus_tag LOCUS_11770 4091 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 5149 6498 gene locus_tag LOCUS_11780 5149 6498 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 protein_id gnl|my_center|LOCUS_11780 6502 7806 gene locus_tag LOCUS_11790 6502 7806 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_11790 7823 8698 gene locus_tag LOCUS_11800 7823 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 10236 8857 gene locus_tag LOCUS_11810 gene mnmE 10236 8857 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_11810 10371 11969 gene locus_tag LOCUS_11820 10371 11969 CDS product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895690.1 protein_id gnl|my_center|LOCUS_11820 12047 12892 gene locus_tag LOCUS_11830 12047 12892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 13122 12931 gene locus_tag LOCUS_11840 13122 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 13027 13230 gene locus_tag LOCUS_11850 13027 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 15045 13249 gene locus_tag LOCUS_11860 15045 13249 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460899.1 protein_id gnl|my_center|LOCUS_11860 15321 16532 gene locus_tag LOCUS_11870 15321 16532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 16529 17557 gene locus_tag LOCUS_11880 16529 17557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 17633 17893 gene locus_tag LOCUS_11890 17633 17893 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_11890 17880 18194 gene locus_tag LOCUS_11900 17880 18194 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525420.1 protein_id gnl|my_center|LOCUS_11900 19323 18229 gene locus_tag LOCUS_11910 19323 18229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 20423 19335 gene locus_tag LOCUS_11920 20423 19335 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_11920 21562 20420 gene locus_tag LOCUS_11930 21562 20420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 22995 23192 gene locus_tag LOCUS_11940 22995 23192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence029 407 1480 gene locus_tag LOCUS_11950 407 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2244 1489 gene locus_tag LOCUS_11960 2244 1489 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530480.1 protein_id gnl|my_center|LOCUS_11960 3008 2241 gene locus_tag LOCUS_11970 3008 2241 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970020.1 protein_id gnl|my_center|LOCUS_11970 3975 3067 gene locus_tag LOCUS_11980 gene rbsK 3975 3067 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526901.1 protein_id gnl|my_center|LOCUS_11980 4757 3972 gene locus_tag LOCUS_11990 4757 3972 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258224.1 protein_id gnl|my_center|LOCUS_11990 5921 4809 gene locus_tag LOCUS_12000 5921 4809 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185786.1 protein_id gnl|my_center|LOCUS_12000 5347 5429 gene locus_tag LOCUS_t00140 5347 5429 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6433 5918 gene locus_tag LOCUS_12010 6433 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 7791 6436 gene locus_tag LOCUS_12020 7791 6436 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256342.1 protein_id gnl|my_center|LOCUS_12020 8365 7799 gene locus_tag LOCUS_12030 8365 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 8511 10373 gene locus_tag LOCUS_12040 8511 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 10370 11395 gene locus_tag LOCUS_12050 10370 11395 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259095.1 protein_id gnl|my_center|LOCUS_12050 11398 12552 gene locus_tag LOCUS_12060 11398 12552 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_12060 12710 13369 gene locus_tag LOCUS_12070 12710 13369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 13374 14150 gene locus_tag LOCUS_12080 13374 14150 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259013.1 protein_id gnl|my_center|LOCUS_12080 14211 15035 gene locus_tag LOCUS_12090 14211 15035 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459931.1 protein_id gnl|my_center|LOCUS_12090 15057 16322 gene locus_tag LOCUS_12100 gene larA 15057 16322 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283069.1 protein_id gnl|my_center|LOCUS_12100 16323 17555 gene locus_tag LOCUS_12110 16323 17555 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040096.1 protein_id gnl|my_center|LOCUS_12110 17575 18630 gene locus_tag LOCUS_12120 17575 18630 CDS product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448742.1 protein_id gnl|my_center|LOCUS_12120 18635 18856 gene locus_tag LOCUS_12130 18635 18856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 19765 18809 gene locus_tag LOCUS_12140 19765 18809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 19786 20832 gene locus_tag LOCUS_12150 19786 20832 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 protein_id gnl|my_center|LOCUS_12150 20847 20923 gene locus_tag LOCUS_t00150 20847 20923 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22189 20999 gene locus_tag LOCUS_12160 22189 20999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence030 2499 3662 gene locus_tag LOCUS_12170 2499 3662 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_12170 5216 3702 gene locus_tag LOCUS_12180 gene putP 5216 3702 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_12180 6501 5251 gene locus_tag LOCUS_12190 6501 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 8263 6527 gene locus_tag LOCUS_12200 8263 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 8494 8979 gene locus_tag LOCUS_12210 8494 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 9121 9468 gene locus_tag LOCUS_12220 9121 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 11250 9523 gene locus_tag LOCUS_12230 11250 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 11810 11421 gene locus_tag LOCUS_12240 11810 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 11834 12976 gene locus_tag LOCUS_12250 11834 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 13104 13367 gene locus_tag LOCUS_12260 13104 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 13358 13762 gene locus_tag LOCUS_12270 13358 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 14210 13944 gene locus_tag LOCUS_12280 14210 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 14441 15277 gene locus_tag LOCUS_12290 14441 15277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 15347 15988 gene locus_tag LOCUS_12300 15347 15988 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086779.1 protein_id gnl|my_center|LOCUS_12300 16032 16400 gene locus_tag LOCUS_12310 16032 16400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 16984 16397 gene locus_tag LOCUS_12320 16984 16397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 18434 17028 gene locus_tag LOCUS_12330 18434 17028 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986686.1 protein_id gnl|my_center|LOCUS_12330 18999 18541 gene locus_tag LOCUS_12340 18999 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 19802 22279 gene locus_tag LOCUS_12350 19802 22279 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence031 1261 1010 gene locus_tag LOCUS_12360 1261 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 2250 1666 gene locus_tag LOCUS_12370 2250 1666 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_12370 3252 2527 gene locus_tag LOCUS_12380 3252 2527 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088254.1 protein_id gnl|my_center|LOCUS_12380 3397 3696 gene locus_tag LOCUS_12390 3397 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 4009 5028 gene locus_tag LOCUS_12400 4009 5028 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190976.1 protein_id gnl|my_center|LOCUS_12400 5487 5080 gene locus_tag LOCUS_12410 5487 5080 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383881.1 protein_id gnl|my_center|LOCUS_12410 6029 5541 gene locus_tag LOCUS_12420 6029 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6870 6244 gene locus_tag LOCUS_12430 6870 6244 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_12430 7794 7024 gene locus_tag LOCUS_12440 7794 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 8207 7794 gene locus_tag LOCUS_12450 gene mce 8207 7794 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789532.1 protein_id gnl|my_center|LOCUS_12450 9405 8281 gene locus_tag LOCUS_12460 9405 8281 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_12460 10274 9528 gene locus_tag LOCUS_12470 gene nth 10274 9528 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_12470 10385 10654 gene locus_tag LOCUS_12480 10385 10654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 10663 10932 gene locus_tag LOCUS_12490 10663 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 11099 11305 gene locus_tag LOCUS_12500 11099 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 12979 11468 gene locus_tag LOCUS_12510 12979 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 13325 13603 gene locus_tag LOCUS_12520 13325 13603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 13753 15627 gene locus_tag LOCUS_12530 13753 15627 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256369.1 protein_id gnl|my_center|LOCUS_12530 15743 15818 gene locus_tag LOCUS_t00160 15743 15818 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17449 15902 gene locus_tag LOCUS_12540 17449 15902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 17586 17834 gene locus_tag LOCUS_12550 17586 17834 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_12550 17797 18225 gene locus_tag LOCUS_12560 17797 18225 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_12560 19144 18284 gene locus_tag LOCUS_12570 19144 18284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 19291 19593 gene locus_tag LOCUS_12580 19291 19593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 19583 20359 gene locus_tag LOCUS_12590 19583 20359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 21218 20367 gene locus_tag LOCUS_12600 21218 20367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 21455 21532 gene locus_tag LOCUS_t00170 21455 21532 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21804 21613 gene locus_tag LOCUS_12610 21804 21613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence032 1505 477 gene locus_tag LOCUS_12620 1505 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3806 1611 gene locus_tag LOCUS_12630 3806 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 5083 3803 gene locus_tag LOCUS_12640 5083 3803 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392273.1 protein_id gnl|my_center|LOCUS_12640 5666 5169 gene locus_tag LOCUS_12650 gene purE 5666 5169 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_12650 7124 5682 gene locus_tag LOCUS_12660 7124 5682 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_12660 7881 7438 gene locus_tag LOCUS_12670 7881 7438 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_12670 8833 8261 gene locus_tag LOCUS_12680 8833 8261 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_12680 9807 8914 gene locus_tag LOCUS_12690 9807 8914 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_12690 10791 9874 gene locus_tag LOCUS_12700 10791 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 11992 10862 gene locus_tag LOCUS_12710 11992 10862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 12995 12183 gene locus_tag LOCUS_12720 12995 12183 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027810.1 protein_id gnl|my_center|LOCUS_12720 13875 13009 gene locus_tag LOCUS_12730 13875 13009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 15979 13934 gene locus_tag LOCUS_12740 gene katG 15979 13934 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_12740 17179 17406 gene locus_tag LOCUS_12750 17179 17406 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412749.1 protein_id gnl|my_center|LOCUS_12750 17403 17837 gene locus_tag LOCUS_12760 17403 17837 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412970.1 protein_id gnl|my_center|LOCUS_12760 18176 18607 gene locus_tag LOCUS_12770 18176 18607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 18753 19598 gene locus_tag LOCUS_12780 18753 19598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 19846 20328 gene locus_tag LOCUS_12790 19846 20328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 21516 20488 gene locus_tag LOCUS_12800 21516 20488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence033 1289 600 gene locus_tag LOCUS_12810 gene lipB 1289 600 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_12810 2700 1297 gene locus_tag LOCUS_12820 2700 1297 CDS product CUAEP/CCAEP-tail radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257877.1 protein_id gnl|my_center|LOCUS_12820 3958 2735 gene locus_tag LOCUS_12830 3958 2735 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_12830 4009 4674 gene locus_tag LOCUS_12840 4009 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 4741 5448 gene locus_tag LOCUS_12850 4741 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 5484 5726 gene locus_tag LOCUS_12860 5484 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 5800 6294 gene locus_tag LOCUS_12870 5800 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 7413 6322 gene locus_tag LOCUS_12880 7413 6322 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965454.1 protein_id gnl|my_center|LOCUS_12880 8576 7539 gene locus_tag LOCUS_12890 8576 7539 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_12890 9964 8771 gene locus_tag LOCUS_12900 9964 8771 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888593.1 protein_id gnl|my_center|LOCUS_12900 11933 9957 gene locus_tag LOCUS_12910 11933 9957 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391442.1 protein_id gnl|my_center|LOCUS_12910 12474 12611 gene locus_tag LOCUS_12920 12474 12611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 13895 12849 gene locus_tag LOCUS_12930 gene moaA 13895 12849 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243488.1 protein_id gnl|my_center|LOCUS_12930 14438 14187 gene locus_tag LOCUS_12940 14438 14187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 14325 14906 gene locus_tag LOCUS_12950 14325 14906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 18122 15168 gene locus_tag LOCUS_12960 18122 15168 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387994.1 protein_id gnl|my_center|LOCUS_12960 21126 18124 gene locus_tag LOCUS_12970 21126 18124 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036267.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence034 <1 851 gene locus_tag LOCUS_12980 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257763.1:carboxypeptidase M32 888 1994 gene locus_tag LOCUS_12990 888 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 2076 2396 gene locus_tag LOCUS_13000 2076 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3201 2431 gene locus_tag LOCUS_13010 3201 2431 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256065.1 protein_id gnl|my_center|LOCUS_13010 6670 3563 gene locus_tag LOCUS_13020 6670 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6846 6682 gene locus_tag LOCUS_13030 6846 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 6988 8091 gene locus_tag LOCUS_13040 6988 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 8862 10643 gene locus_tag LOCUS_13050 8862 10643 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_13050 10968 11681 gene locus_tag LOCUS_13060 10968 11681 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232103.1 protein_id gnl|my_center|LOCUS_13060 11684 12286 gene locus_tag LOCUS_13070 gene cysC 11684 12286 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256588.1 protein_id gnl|my_center|LOCUS_13070 12286 13371 gene locus_tag LOCUS_13080 gene sat 12286 13371 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_13080 13427 14323 gene locus_tag LOCUS_13090 gene hemC 13427 14323 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459122.1 protein_id gnl|my_center|LOCUS_13090 14320 15069 gene locus_tag LOCUS_13100 14320 15069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13100 15066 15851 gene locus_tag LOCUS_13110 15066 15851 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141649149.1 protein_id gnl|my_center|LOCUS_13110 18548 15990 gene locus_tag LOCUS_13120 18548 15990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 18441 18689 gene locus_tag LOCUS_13130 18441 18689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 18810 19832 gene locus_tag LOCUS_13140 gene hemB 18810 19832 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_13140 20016 19777 gene locus_tag LOCUS_13150 20016 19777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 19937 20713 gene locus_tag LOCUS_13160 19937 20713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence035 1558 362 gene locus_tag LOCUS_13170 gene phnA 1558 362 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975822.1 protein_id gnl|my_center|LOCUS_13170 1733 1551 gene locus_tag LOCUS_13180 1733 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2174 3193 gene locus_tag LOCUS_13190 2174 3193 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975361.1 protein_id gnl|my_center|LOCUS_13190 3753 3190 gene locus_tag LOCUS_13200 3753 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 4354 3746 gene locus_tag LOCUS_13210 4354 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 5019 4351 gene locus_tag LOCUS_13220 5019 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 6161 5019 gene locus_tag LOCUS_13230 6161 5019 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256015.1 protein_id gnl|my_center|LOCUS_13230 7549 6158 gene locus_tag LOCUS_13240 7549 6158 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_13240 8799 7657 gene locus_tag LOCUS_13250 8799 7657 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_13250 11067 8956 gene locus_tag LOCUS_13260 11067 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 13615 11405 gene locus_tag LOCUS_13270 13615 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 14983 13880 gene locus_tag LOCUS_13280 14983 13880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_13280 16228 15308 gene locus_tag LOCUS_13290 16228 15308 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099364.1 protein_id gnl|my_center|LOCUS_13290 17999 16308 gene locus_tag LOCUS_13300 17999 16308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 17992 19776 gene locus_tag LOCUS_13310 17992 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 19846 20112 gene locus_tag LOCUS_13320 19846 20112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 20172 20588 gene locus_tag LOCUS_13330 20172 20588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence036 2024 1302 gene locus_tag LOCUS_13340 gene alaXM 2024 1302 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 protein_id gnl|my_center|LOCUS_13340 3283 2381 gene locus_tag LOCUS_13350 3283 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 4194 3280 gene locus_tag LOCUS_13360 4194 3280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_13360 4617 5070 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcggccggaatcgcgccgctca 6594 7304 gene locus_tag LOCUS_13370 6594 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 8356 7541 gene locus_tag LOCUS_13380 8356 7541 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258778.1 protein_id gnl|my_center|LOCUS_13380 9246 8353 gene locus_tag LOCUS_13390 9246 8353 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258346.1 protein_id gnl|my_center|LOCUS_13390 9430 10683 gene locus_tag LOCUS_13400 gene larA 9430 10683 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224947.1 protein_id gnl|my_center|LOCUS_13400 10775 10987 gene locus_tag LOCUS_13410 10775 10987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 11568 12935 gene locus_tag LOCUS_13420 11568 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 13871 12909 gene locus_tag LOCUS_13430 13871 12909 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929692.1 protein_id gnl|my_center|LOCUS_13430 13945 14883 gene locus_tag LOCUS_13440 13945 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 14922 17702 gene locus_tag LOCUS_13450 14922 17702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259641.1 protein_id gnl|my_center|LOCUS_13450 17735 18619 gene locus_tag LOCUS_13460 17735 18619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 19367 20473 gene locus_tag LOCUS_13470 gene thiO 19367 20473 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921239.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence037 808 1032 gene locus_tag LOCUS_13480 808 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1124 1354 gene locus_tag LOCUS_13490 1124 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1510 1950 gene locus_tag LOCUS_13500 1510 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2696 1947 gene locus_tag LOCUS_13510 gene ctaG 2696 1947 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069017.1 protein_id gnl|my_center|LOCUS_13510 3178 2828 gene locus_tag LOCUS_13520 3178 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 3774 3178 gene locus_tag LOCUS_13530 gene ctaE 3774 3178 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232244.1 protein_id gnl|my_center|LOCUS_13530 5603 3771 gene locus_tag LOCUS_13540 gene ctaD 5603 3771 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232245.1 protein_id gnl|my_center|LOCUS_13540 6665 5652 gene locus_tag LOCUS_13550 gene coxB 6665 5652 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971124.1 protein_id gnl|my_center|LOCUS_13550 7653 6826 gene locus_tag LOCUS_13560 7653 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 8556 7714 gene locus_tag LOCUS_13570 8556 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 10841 8622 gene locus_tag LOCUS_13580 gene recQ 10841 8622 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_13580 11107 12270 gene locus_tag LOCUS_13590 11107 12270 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_13590 12267 12899 gene locus_tag LOCUS_13600 12267 12899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 12896 14062 gene locus_tag LOCUS_13610 12896 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 14128 15141 gene locus_tag LOCUS_13620 14128 15141 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975394.1 protein_id gnl|my_center|LOCUS_13620 15163 16701 gene locus_tag LOCUS_13630 15163 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 17624 16686 gene locus_tag LOCUS_13640 17624 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 18838 17645 gene locus_tag LOCUS_13650 18838 17645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 20213 18831 gene locus_tag LOCUS_13660 20213 18831 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence038 300 103 gene locus_tag LOCUS_13670 300 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1841 525 gene locus_tag LOCUS_13680 1841 525 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_13680 3417 1834 gene locus_tag LOCUS_13690 3417 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 4627 3386 gene locus_tag LOCUS_13700 4627 3386 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257931.1 protein_id gnl|my_center|LOCUS_13700 5888 4917 gene locus_tag LOCUS_13710 5888 4917 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_13710 6536 5907 gene locus_tag LOCUS_13720 6536 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 6501 6812 gene locus_tag LOCUS_13730 6501 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 7182 7538 gene locus_tag LOCUS_13740 7182 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 7547 8389 gene locus_tag LOCUS_13750 gene nadC 7547 8389 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_13750 9035 8424 gene locus_tag LOCUS_13760 9035 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 9986 9039 gene locus_tag LOCUS_13770 9986 9039 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_13770 10143 10218 gene locus_tag LOCUS_t00180 10143 10218 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12712 10289 gene locus_tag LOCUS_13780 12712 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 12989 13402 gene locus_tag LOCUS_13790 12989 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 13432 14058 gene locus_tag LOCUS_13800 13432 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 14128 15924 gene locus_tag LOCUS_13810 gene aspS 14128 15924 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_13810 16600 15911 gene locus_tag LOCUS_13820 16600 15911 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_13820 16996 16643 gene locus_tag LOCUS_13830 16996 16643 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409778.1 protein_id gnl|my_center|LOCUS_13830 17220 16981 gene locus_tag LOCUS_13840 17220 16981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 17612 17316 gene locus_tag LOCUS_13850 17612 17316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 17987 17712 gene locus_tag LOCUS_13860 17987 17712 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_13860 18271 17984 gene locus_tag LOCUS_13870 18271 17984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 18626 18435 gene locus_tag LOCUS_13880 18626 18435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence039 605 246 gene locus_tag LOCUS_13890 605 246 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931752.1 protein_id gnl|my_center|LOCUS_13890 1546 602 gene locus_tag LOCUS_13900 1546 602 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_13900 2649 1543 gene locus_tag LOCUS_13910 gene dnaJ 2649 1543 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_13910 3329 2646 gene locus_tag LOCUS_13920 3329 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 6205 3425 gene locus_tag LOCUS_13930 6205 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 7607 6195 gene locus_tag LOCUS_13940 7607 6195 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_13940 8497 7604 gene locus_tag LOCUS_13950 8497 7604 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_13950 9435 8494 gene locus_tag LOCUS_13960 9435 8494 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257470.1 protein_id gnl|my_center|LOCUS_13960 10646 9432 gene locus_tag LOCUS_13970 10646 9432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 11710 10643 gene locus_tag LOCUS_13980 11710 10643 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_13980 13092 11707 gene locus_tag LOCUS_13990 13092 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 13497 13123 gene locus_tag LOCUS_14000 13497 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 14481 13516 gene locus_tag LOCUS_14010 14481 13516 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256314.1 protein_id gnl|my_center|LOCUS_14010 15327 14482 gene locus_tag LOCUS_14020 gene rfbD 15327 14482 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_14020 15607 15329 gene locus_tag LOCUS_14030 15607 15329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 15703 16983 gene locus_tag LOCUS_14040 gene miaB 15703 16983 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258276.1 protein_id gnl|my_center|LOCUS_14040 16991 18799 gene locus_tag LOCUS_14050 16991 18799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 19545 18796 gene locus_tag LOCUS_14060 19545 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence040 2804 570 gene locus_tag LOCUS_14070 2804 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 3549 4937 gene locus_tag LOCUS_14080 gene noeA 3549 4937 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127582344.1 protein_id gnl|my_center|LOCUS_14080 5153 7324 gene locus_tag LOCUS_14090 5153 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 7490 8236 gene locus_tag LOCUS_14100 7490 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 8529 8233 gene locus_tag LOCUS_14110 8529 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 8653 9705 gene locus_tag LOCUS_14120 8653 9705 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_14120 10605 9718 gene locus_tag LOCUS_14130 10605 9718 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246170.1 protein_id gnl|my_center|LOCUS_14130 12704 10671 gene locus_tag LOCUS_14140 12704 10671 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_14140 13621 12803 gene locus_tag LOCUS_14150 13621 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 15252 13777 gene locus_tag LOCUS_14160 15252 13777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 16506 15964 gene locus_tag LOCUS_14170 16506 15964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014412.1 protein_id gnl|my_center|LOCUS_14170 16954 17442 gene locus_tag LOCUS_14180 16954 17442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 17905 17774 gene locus_tag LOCUS_14190 17905 17774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 18014 18217 gene locus_tag LOCUS_14200 18014 18217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 18650 18225 gene locus_tag LOCUS_14210 18650 18225 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061563.1 protein_id gnl|my_center|LOCUS_14210 18778 19566 gene locus_tag LOCUS_14220 18778 19566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence041 1214 492 gene locus_tag LOCUS_14230 1214 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1942 1211 gene locus_tag LOCUS_14240 1942 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2096 2626 gene locus_tag LOCUS_14250 2096 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 2940 2623 gene locus_tag LOCUS_14260 2940 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 3506 5785 gene locus_tag LOCUS_14270 3506 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 7327 5873 gene locus_tag LOCUS_14280 7327 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 8177 7854 gene locus_tag LOCUS_14290 8177 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 9779 9546 gene locus_tag LOCUS_14300 9779 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 10146 11012 gene locus_tag LOCUS_14310 10146 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 10900 12585 gene locus_tag LOCUS_14320 10900 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 12660 15950 gene locus_tag LOCUS_14330 12660 15950 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284781.1 protein_id gnl|my_center|LOCUS_14330 16233 16057 gene locus_tag LOCUS_14340 16233 16057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 18274 16556 gene locus_tag LOCUS_14350 18274 16556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence042 2380 1703 gene locus_tag LOCUS_14360 2380 1703 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892481.1 protein_id gnl|my_center|LOCUS_14360 2714 2469 gene locus_tag LOCUS_14370 2714 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 3041 3562 gene locus_tag LOCUS_14380 3041 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3680 4219 gene locus_tag LOCUS_14390 3680 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 4247 4729 gene locus_tag LOCUS_14400 4247 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 5535 5053 gene locus_tag LOCUS_14410 5535 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 6621 5590 gene locus_tag LOCUS_14420 6621 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 6759 7358 gene locus_tag LOCUS_14430 6759 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 7380 7688 gene locus_tag LOCUS_14440 7380 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 7771 8823 gene locus_tag LOCUS_14450 7771 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 8917 9390 gene locus_tag LOCUS_14460 8917 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 9630 11045 gene locus_tag LOCUS_14470 gene betC 9630 11045 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338340.1 protein_id gnl|my_center|LOCUS_14470 11173 11823 gene locus_tag LOCUS_14480 11173 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 13099 12257 gene locus_tag LOCUS_14490 13099 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 13817 14368 gene locus_tag LOCUS_14500 13817 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 14679 15692 gene locus_tag LOCUS_14510 14679 15692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 15990 15829 gene locus_tag LOCUS_14520 15990 15829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 16238 15996 gene locus_tag LOCUS_14530 16238 15996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 16652 16434 gene locus_tag LOCUS_14540 16652 16434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 17801 17478 gene locus_tag LOCUS_14550 17801 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence043 882 1571 gene locus_tag LOCUS_14560 882 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2639 1608 gene locus_tag LOCUS_14570 2639 1608 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039574.1 protein_id gnl|my_center|LOCUS_14570 3276 2650 gene locus_tag LOCUS_14580 3276 2650 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293710.1 protein_id gnl|my_center|LOCUS_14580 3896 3408 gene locus_tag LOCUS_14590 3896 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 5048 3903 gene locus_tag LOCUS_14600 gene tyrS 5048 3903 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_14600 4950 5138 gene locus_tag LOCUS_14610 4950 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 6669 5341 gene locus_tag LOCUS_14620 6669 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 6832 7824 gene locus_tag LOCUS_14630 gene selD 6832 7824 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_14630 7817 9034 gene locus_tag LOCUS_14640 7817 9034 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256376.1 protein_id gnl|my_center|LOCUS_14640 9361 9642 gene locus_tag LOCUS_14650 9361 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 9679 11019 gene locus_tag LOCUS_14660 9679 11019 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_14660 11037 11450 gene locus_tag LOCUS_14670 11037 11450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 11642 12130 gene locus_tag LOCUS_14680 11642 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 12199 12435 gene locus_tag LOCUS_14690 12199 12435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 12640 14172 gene locus_tag LOCUS_14700 12640 14172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 14922 15368 gene locus_tag LOCUS_14710 14922 15368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 16186 15365 gene locus_tag LOCUS_14720 16186 15365 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 protein_id gnl|my_center|LOCUS_14720 16646 16251 gene locus_tag LOCUS_14730 16646 16251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 17137 16643 gene locus_tag LOCUS_14740 17137 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence044 462 163 gene locus_tag LOCUS_14750 462 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1574 459 gene locus_tag LOCUS_14760 1574 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3431 2247 gene locus_tag LOCUS_14770 3431 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 3493 3726 gene locus_tag LOCUS_14780 3493 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 3750 4139 gene locus_tag LOCUS_14790 3750 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4294 5127 gene locus_tag LOCUS_14800 4294 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 6296 5151 gene locus_tag LOCUS_14810 6296 5151 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_14810 7282 6563 gene locus_tag LOCUS_14820 7282 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 7374 9134 gene locus_tag LOCUS_14830 7374 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 9124 10218 gene locus_tag LOCUS_14840 9124 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 11875 10226 gene locus_tag LOCUS_14850 gene argS 11875 10226 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_14850 12206 12646 gene locus_tag LOCUS_14860 12206 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 13456 12599 gene locus_tag LOCUS_14870 13456 12599 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967714.1 protein_id gnl|my_center|LOCUS_14870 14317 13460 gene locus_tag LOCUS_14880 14317 13460 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_14880 15176 14307 gene locus_tag LOCUS_14890 15176 14307 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_14890 15358 16479 gene locus_tag LOCUS_14900 15358 16479 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence045 2596 1112 gene locus_tag LOCUS_14910 2596 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2858 4363 gene locus_tag LOCUS_14920 2858 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 7325 4422 gene locus_tag LOCUS_14930 7325 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 10245 7432 gene locus_tag LOCUS_14940 10245 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 13179 10357 gene locus_tag LOCUS_14950 13179 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 16066 13277 gene locus_tag LOCUS_14960 16066 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence046 1032 1928 gene locus_tag LOCUS_14970 1032 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 6998 2133 gene locus_tag LOCUS_14980 6998 2133 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950644.1 protein_id gnl|my_center|LOCUS_14980 7410 7541 gene locus_tag LOCUS_14990 7410 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 7554 8282 gene locus_tag LOCUS_15000 7554 8282 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203813331.1 protein_id gnl|my_center|LOCUS_15000 8285 9148 gene locus_tag LOCUS_15010 8285 9148 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970571.1 protein_id gnl|my_center|LOCUS_15010 10202 9639 gene locus_tag LOCUS_15020 10202 9639 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_15020 10338 10544 gene locus_tag LOCUS_15030 10338 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 10658 11083 gene locus_tag LOCUS_15040 10658 11083 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085641.1 protein_id gnl|my_center|LOCUS_15040 12354 11080 gene locus_tag LOCUS_15050 12354 11080 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401544.1 protein_id gnl|my_center|LOCUS_15050 12455 12757 gene locus_tag LOCUS_15060 12455 12757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 12785 13825 gene locus_tag LOCUS_15070 12785 13825 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_15070 15288 13822 gene locus_tag LOCUS_15080 15288 13822 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814808.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence047 <1 1277 gene locus_tag LOCUS_15090 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927834.1:DNA repair protein RadA 1274 2101 gene locus_tag LOCUS_15100 gene ispD 1274 2101 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056453.1 protein_id gnl|my_center|LOCUS_15100 2158 3147 gene locus_tag LOCUS_15110 2158 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 4915 3311 gene locus_tag LOCUS_15120 4915 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 5551 6402 gene locus_tag LOCUS_15130 5551 6402 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065078.1 protein_id gnl|my_center|LOCUS_15130 6440 6931 gene locus_tag LOCUS_15140 gene ispF 6440 6931 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813893.1 protein_id gnl|my_center|LOCUS_15140 6980 8374 gene locus_tag LOCUS_15150 gene cysS 6980 8374 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_15150 8434 9141 gene locus_tag LOCUS_15160 gene rlmB 8434 9141 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_15160 9131 9520 gene locus_tag LOCUS_15170 gene folB 9131 9520 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242949.1 protein_id gnl|my_center|LOCUS_15170 9719 10309 gene locus_tag LOCUS_15180 9719 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 11141 10425 gene locus_tag LOCUS_15190 gene tmk 11141 10425 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762936.1 protein_id gnl|my_center|LOCUS_15190 11899 11138 gene locus_tag LOCUS_15200 gene tmk 11899 11138 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_15200 12192 12656 gene locus_tag LOCUS_15210 12192 12656 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 protein_id gnl|my_center|LOCUS_15210 12691 13341 gene locus_tag LOCUS_15220 gene folE 12691 13341 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075743291.1 protein_id gnl|my_center|LOCUS_15220 13349 14068 gene locus_tag LOCUS_15230 13349 14068 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_15230 15410 14439 gene locus_tag LOCUS_15240 15410 14439 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_15240 <16248 15434 gene locus_tag LOCUS_15250 <16248 15434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258891.1:rod shape-determining protein >Feature sequence048 445 41 gene locus_tag LOCUS_15260 445 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1506 442 gene locus_tag LOCUS_15270 1506 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2495 1506 gene locus_tag LOCUS_15280 2495 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4995 2581 gene locus_tag LOCUS_15290 4995 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 7468 5039 gene locus_tag LOCUS_15300 7468 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 7716 9947 gene locus_tag LOCUS_15310 7716 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 13013 9978 gene locus_tag LOCUS_15320 13013 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 15466 13022 gene locus_tag LOCUS_15330 15466 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence049 2153 1023 gene locus_tag LOCUS_15340 2153 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3562 2189 gene locus_tag LOCUS_15350 3562 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 7218 3793 gene locus_tag LOCUS_15360 7218 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 8193 7462 gene locus_tag LOCUS_15370 8193 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 8680 8258 gene locus_tag LOCUS_15380 8680 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 10055 8961 gene locus_tag LOCUS_15390 10055 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 11737 10646 gene locus_tag LOCUS_15400 11737 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 13484 12321 gene locus_tag LOCUS_15410 13484 12321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence050 108 974 gene locus_tag LOCUS_15420 108 974 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804646.1 protein_id gnl|my_center|LOCUS_15420 1148 2128 gene locus_tag LOCUS_15430 1148 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 2233 3120 gene locus_tag LOCUS_15440 2233 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 3140 3970 gene locus_tag LOCUS_15450 3140 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 3982 4923 gene locus_tag LOCUS_15460 3982 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 5894 4950 gene locus_tag LOCUS_15470 5894 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 7250 5925 gene locus_tag LOCUS_15480 7250 5925 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533446.1 protein_id gnl|my_center|LOCUS_15480 7380 8429 gene locus_tag LOCUS_15490 7380 8429 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_15490 8441 9253 gene locus_tag LOCUS_15500 8441 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846484.1 protein_id gnl|my_center|LOCUS_15500 9318 10289 gene locus_tag LOCUS_15510 9318 10289 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_15510 10385 12376 gene locus_tag LOCUS_15520 10385 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 12463 13440 gene locus_tag LOCUS_15530 12463 13440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_15530 13483 14424 gene locus_tag LOCUS_15540 13483 14424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence051 173 649 gene locus_tag LOCUS_15550 173 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 655 1638 gene locus_tag LOCUS_15560 655 1638 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257671.1 protein_id gnl|my_center|LOCUS_15560 1635 2441 gene locus_tag LOCUS_15570 1635 2441 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256865.1 protein_id gnl|my_center|LOCUS_15570 2444 3229 gene locus_tag LOCUS_15580 2444 3229 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256343.1 protein_id gnl|my_center|LOCUS_15580 3907 3221 gene locus_tag LOCUS_15590 3907 3221 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730268.1 protein_id gnl|my_center|LOCUS_15590 4833 3904 gene locus_tag LOCUS_15600 4833 3904 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_15600 4949 5281 gene locus_tag LOCUS_15610 gene rpsF 4949 5281 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777139.1 protein_id gnl|my_center|LOCUS_15610 5278 5760 gene locus_tag LOCUS_15620 5278 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 5787 6173 gene locus_tag LOCUS_15630 5787 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 6189 7295 gene locus_tag LOCUS_15640 6189 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 8526 7330 gene locus_tag LOCUS_15650 8526 7330 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938041.1 protein_id gnl|my_center|LOCUS_15650 8807 8592 gene locus_tag LOCUS_15660 8807 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 8937 12821 gene locus_tag LOCUS_15670 8937 12821 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_15670 13769 12834 gene locus_tag LOCUS_15680 13769 12834 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762562.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence052 <1 617 gene locus_tag LOCUS_15690 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007331388.1:phytanoyl-CoA dioxygenase family protein 1741 725 gene locus_tag LOCUS_15700 1741 725 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259275.1 protein_id gnl|my_center|LOCUS_15700 2116 4188 gene locus_tag LOCUS_15710 2116 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5371 4349 gene locus_tag LOCUS_15720 5371 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 6079 5882 gene locus_tag LOCUS_15730 6079 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 6078 6977 gene locus_tag LOCUS_15740 6078 6977 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082702.1 protein_id gnl|my_center|LOCUS_15740 6984 7169 gene locus_tag LOCUS_15750 6984 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 7207 8052 gene locus_tag LOCUS_15760 gene hpaI 7207 8052 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392271.1 protein_id gnl|my_center|LOCUS_15760 8470 9771 gene locus_tag LOCUS_15770 8470 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 9872 11023 gene locus_tag LOCUS_15780 9872 11023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 11036 11842 gene locus_tag LOCUS_15790 11036 11842 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868130.1 protein_id gnl|my_center|LOCUS_15790 11980 13182 gene locus_tag LOCUS_15800 11980 13182 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_15800 13847 13572 gene locus_tag LOCUS_15810 13847 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence053 194 1387 gene locus_tag LOCUS_15820 194 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2176 1358 gene locus_tag LOCUS_15830 2176 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3268 2309 gene locus_tag LOCUS_15840 3268 2309 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228903.1 protein_id gnl|my_center|LOCUS_15840 4165 3284 gene locus_tag LOCUS_15850 gene accD 4165 3284 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_15850 5010 4249 gene locus_tag LOCUS_15860 5010 4249 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402142.1 protein_id gnl|my_center|LOCUS_15860 7578 5071 gene locus_tag LOCUS_15870 7578 5071 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870144.1 protein_id gnl|my_center|LOCUS_15870 7797 7594 gene locus_tag LOCUS_15880 7797 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 8495 8079 gene locus_tag LOCUS_15890 8495 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 8724 8642 gene locus_tag LOCUS_t00190 8724 8642 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9576 9016 gene locus_tag LOCUS_15900 9576 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 9743 10597 gene locus_tag LOCUS_15910 9743 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 10652 11743 gene locus_tag LOCUS_15920 10652 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 12544 11789 gene locus_tag LOCUS_15930 12544 11789 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_15930 13512 12541 gene locus_tag LOCUS_15940 gene ftsY 13512 12541 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007656.1 protein_id gnl|my_center|LOCUS_15940 14451 13711 gene locus_tag LOCUS_15950 14451 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence054 370 29 gene locus_tag LOCUS_15960 370 29 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_15960 901 1692 gene locus_tag LOCUS_15970 901 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2667 1789 gene locus_tag LOCUS_15980 2667 1789 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966538.1 protein_id gnl|my_center|LOCUS_15980 3034 4428 gene locus_tag LOCUS_15990 3034 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 4545 6419 gene locus_tag LOCUS_16000 4545 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 7729 8658 gene locus_tag LOCUS_16010 7729 8658 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027134.1 protein_id gnl|my_center|LOCUS_16010 9729 8767 gene locus_tag LOCUS_16020 9729 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 10138 10548 gene locus_tag LOCUS_16030 10138 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 10853 10674 gene locus_tag LOCUS_16040 10853 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 12040 11066 gene locus_tag LOCUS_16050 12040 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 12488 13492 gene locus_tag LOCUS_16060 12488 13492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 14182 13577 gene locus_tag LOCUS_16070 14182 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence055 3329 837 gene locus_tag LOCUS_16080 3329 837 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_16080 5184 3739 gene locus_tag LOCUS_16090 5184 3739 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039375.1 protein_id gnl|my_center|LOCUS_16090 6487 5324 gene locus_tag LOCUS_16100 6487 5324 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986854.1 protein_id gnl|my_center|LOCUS_16100 6834 7952 gene locus_tag LOCUS_16110 6834 7952 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_16110 8371 8084 gene locus_tag LOCUS_16120 8371 8084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 8252 9421 gene locus_tag LOCUS_16130 8252 9421 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869241.1 protein_id gnl|my_center|LOCUS_16130 9563 9904 gene locus_tag LOCUS_16140 9563 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 9906 10520 gene locus_tag LOCUS_16150 9906 10520 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_16150 10577 11554 gene locus_tag LOCUS_16160 10577 11554 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_16160 11657 12775 gene locus_tag LOCUS_16170 11657 12775 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_16170 13978 12839 gene locus_tag LOCUS_16180 13978 12839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence056 1238 633 gene locus_tag LOCUS_16190 1238 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2374 1235 gene locus_tag LOCUS_16200 2374 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3483 2371 gene locus_tag LOCUS_16210 3483 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 4661 3498 gene locus_tag LOCUS_16220 4661 3498 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249842.1 protein_id gnl|my_center|LOCUS_16220 5870 4749 gene locus_tag LOCUS_16230 5870 4749 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390553.1 protein_id gnl|my_center|LOCUS_16230 6097 5867 gene locus_tag LOCUS_16240 6097 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 8373 6127 gene locus_tag LOCUS_16250 8373 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 9978 8386 gene locus_tag LOCUS_16260 9978 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 11336 9975 gene locus_tag LOCUS_16270 11336 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 13039 11333 gene locus_tag LOCUS_16280 13039 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 13130 13591 gene locus_tag LOCUS_16290 13130 13591 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014359.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence057 2108 3490 gene locus_tag LOCUS_16300 2108 3490 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190374.1 protein_id gnl|my_center|LOCUS_16300 3487 4227 gene locus_tag LOCUS_16310 3487 4227 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246488.1 protein_id gnl|my_center|LOCUS_16310 4273 5559 gene locus_tag LOCUS_16320 4273 5559 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095329.1 protein_id gnl|my_center|LOCUS_16320 7109 5694 gene locus_tag LOCUS_16330 7109 5694 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257378.1 protein_id gnl|my_center|LOCUS_16330 8298 7111 gene locus_tag LOCUS_16340 8298 7111 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_16340 9245 8271 gene locus_tag LOCUS_16350 9245 8271 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_16350 10451 9315 gene locus_tag LOCUS_16360 10451 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 11668 10448 gene locus_tag LOCUS_16370 11668 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 12771 11701 gene locus_tag LOCUS_16380 12771 11701 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_16380 13586 12768 gene locus_tag LOCUS_16390 13586 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence058 198 416 gene locus_tag LOCUS_16400 198 416 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312031.1 protein_id gnl|my_center|LOCUS_16400 3230 1173 gene locus_tag LOCUS_16410 3230 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 3895 4230 gene locus_tag LOCUS_16420 3895 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 4472 4284 gene locus_tag LOCUS_16430 4472 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 4832 5032 gene locus_tag LOCUS_16440 4832 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 5073 5489 gene locus_tag LOCUS_16450 5073 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5904 5476 gene locus_tag LOCUS_16460 gene hicB 5904 5476 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209405.1 protein_id gnl|my_center|LOCUS_16460 6371 7330 gene locus_tag LOCUS_16470 6371 7330 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209809385.1 protein_id gnl|my_center|LOCUS_16470 7350 8309 gene locus_tag LOCUS_16480 7350 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 8510 10609 gene locus_tag LOCUS_16490 8510 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 10945 11352 gene locus_tag LOCUS_16500 10945 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 12208 11729 gene locus_tag LOCUS_16510 12208 11729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 12256 13146 gene locus_tag LOCUS_16520 gene folP 12256 13146 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence059 3075 967 gene locus_tag LOCUS_16530 3075 967 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_16530 4170 3289 gene locus_tag LOCUS_16540 4170 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 4200 7457 gene locus_tag LOCUS_16550 4200 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 7748 10024 gene locus_tag LOCUS_16560 7748 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 10234 12006 gene locus_tag LOCUS_16570 10234 12006 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926968.1 protein_id gnl|my_center|LOCUS_16570 12198 12767 gene locus_tag LOCUS_16580 12198 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 13611 12814 gene locus_tag LOCUS_16590 13611 12814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence060 1022 90 gene locus_tag LOCUS_16600 1022 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1230 1024 gene locus_tag LOCUS_16610 1230 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1454 1822 gene locus_tag LOCUS_16620 1454 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 1830 2579 gene locus_tag LOCUS_16630 1830 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 2743 3261 gene locus_tag LOCUS_16640 2743 3261 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941010.1 protein_id gnl|my_center|LOCUS_16640 3261 4556 gene locus_tag LOCUS_16650 3261 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 5380 4619 gene locus_tag LOCUS_16660 5380 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16660 6382 5393 gene locus_tag LOCUS_16670 6382 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 6898 6554 gene locus_tag LOCUS_16680 6898 6554 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258652.1 protein_id gnl|my_center|LOCUS_16680 7715 6990 gene locus_tag LOCUS_16690 7715 6990 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258710.1 protein_id gnl|my_center|LOCUS_16690 8284 7919 gene locus_tag LOCUS_16700 8284 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 8475 8672 gene locus_tag LOCUS_16710 8475 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 8682 9035 gene locus_tag LOCUS_16720 gene rplT 8682 9035 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256290.1 protein_id gnl|my_center|LOCUS_16720 9069 9848 gene locus_tag LOCUS_16730 9069 9848 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_16730 9856 10878 gene locus_tag LOCUS_16740 gene pheS 9856 10878 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_16740 10882 13404 gene locus_tag LOCUS_16750 gene pheT 10882 13404 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence061 132 1439 gene locus_tag LOCUS_16760 gene secD 132 1439 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902477.1 protein_id gnl|my_center|LOCUS_16760 1439 2377 gene locus_tag LOCUS_16770 gene secF 1439 2377 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_16770 2823 2374 gene locus_tag LOCUS_16780 gene accB 2823 2374 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_16780 3399 2842 gene locus_tag LOCUS_16790 gene efp 3399 2842 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_16790 4481 3456 gene locus_tag LOCUS_16800 gene pepQ 4481 3456 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_16800 5566 4514 gene locus_tag LOCUS_16810 gene mltG 5566 4514 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_16810 5904 5560 gene locus_tag LOCUS_16820 5904 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 7381 5981 gene locus_tag LOCUS_16830 7381 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 9999 7378 gene locus_tag LOCUS_16840 gene alaS 9999 7378 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_16840 10591 10325 gene locus_tag LOCUS_16850 10591 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 11772 10594 gene locus_tag LOCUS_16860 gene nifS 11772 10594 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_16860 12124 11939 gene locus_tag LOCUS_16870 12124 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence062 1683 148 gene locus_tag LOCUS_16880 1683 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 2614 2294 gene locus_tag LOCUS_16890 2614 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2945 3490 gene locus_tag LOCUS_16900 2945 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3541 5049 gene locus_tag LOCUS_16910 3541 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257117.1 protein_id gnl|my_center|LOCUS_16910 5346 5272 gene locus_tag LOCUS_t00200 5346 5272 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5444 5370 gene locus_tag LOCUS_t00210 5444 5370 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6529 5648 gene locus_tag LOCUS_16920 6529 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 6628 8010 gene locus_tag LOCUS_16930 6628 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 8310 8071 gene locus_tag LOCUS_16940 8310 8071 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_16940 11011 8429 gene locus_tag LOCUS_16950 11011 8429 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_16950 11736 11056 gene locus_tag LOCUS_16960 11736 11056 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257014.1 protein_id gnl|my_center|LOCUS_16960 12798 11770 gene locus_tag LOCUS_16970 12798 11770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228819.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence063 3 824 gene locus_tag LOCUS_16980 3 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1078 2097 gene locus_tag LOCUS_16990 gene gap 1078 2097 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_16990 2204 3397 gene locus_tag LOCUS_17000 2204 3397 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_17000 5304 3394 gene locus_tag LOCUS_17010 gene selB 5304 3394 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_17010 6023 5301 gene locus_tag LOCUS_17020 6023 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 6464 6096 gene locus_tag LOCUS_17030 6464 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 10767 6502 gene locus_tag LOCUS_17040 10767 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 11573 10764 gene locus_tag LOCUS_17050 11573 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 11748 12020 gene locus_tag LOCUS_17060 11748 12020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 12472 11966 gene locus_tag LOCUS_17070 12472 11966 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925236.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence064 473 997 gene locus_tag LOCUS_17080 473 997 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_17080 1041 1889 gene locus_tag LOCUS_17090 1041 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2585 1914 gene locus_tag LOCUS_17100 2585 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 3118 2582 gene locus_tag LOCUS_17110 3118 2582 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_17110 5021 3144 gene locus_tag LOCUS_17120 5021 3144 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_17120 5287 6351 gene locus_tag LOCUS_17130 5287 6351 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976168.1 protein_id gnl|my_center|LOCUS_17130 7413 6577 gene locus_tag LOCUS_17140 7413 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 7591 8994 gene locus_tag LOCUS_17150 7591 8994 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_17150 9009 9734 gene locus_tag LOCUS_17160 9009 9734 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392510.1 protein_id gnl|my_center|LOCUS_17160 9689 10252 gene locus_tag LOCUS_17170 9689 10252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 10287 10769 gene locus_tag LOCUS_17180 10287 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 <12129 10766 gene locus_tag LOCUS_17190 <12129 10766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392877.1:diaminopimelate decarboxylase >Feature sequence065 619 2 gene locus_tag LOCUS_17200 619 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 3054 616 gene locus_tag LOCUS_17210 3054 616 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_17210 4784 3075 gene locus_tag LOCUS_17220 gene recJ 4784 3075 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_17220 4859 5731 gene locus_tag LOCUS_17230 4859 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 5928 5728 gene locus_tag LOCUS_17240 5928 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 6150 7310 gene locus_tag LOCUS_17250 6150 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 8642 7614 gene locus_tag LOCUS_17260 8642 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 9895 8699 gene locus_tag LOCUS_17270 gene coaBC 9895 8699 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259488.1 protein_id gnl|my_center|LOCUS_17270 10650 9892 gene locus_tag LOCUS_17280 10650 9892 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389445.1 protein_id gnl|my_center|LOCUS_17280 10715 11548 gene locus_tag LOCUS_17290 10715 11548 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530431.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence066 418 765 gene locus_tag LOCUS_17300 418 765 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694481.1 protein_id gnl|my_center|LOCUS_17300 810 1061 gene locus_tag LOCUS_17310 810 1061 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379963.1 protein_id gnl|my_center|LOCUS_17310 1138 1440 gene locus_tag LOCUS_17320 1138 1440 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994045.1 protein_id gnl|my_center|LOCUS_17320 1783 1472 gene locus_tag LOCUS_17330 1783 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1830 2522 gene locus_tag LOCUS_17340 1830 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2568 2783 gene locus_tag LOCUS_17350 2568 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3088 2702 gene locus_tag LOCUS_17360 3088 2702 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533691.1 protein_id gnl|my_center|LOCUS_17360 3342 3085 gene locus_tag LOCUS_17370 3342 3085 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892665.1 protein_id gnl|my_center|LOCUS_17370 6567 3763 gene locus_tag LOCUS_17380 6567 3763 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055983.1 protein_id gnl|my_center|LOCUS_17380 7864 6569 gene locus_tag LOCUS_17390 7864 6569 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942369.1 protein_id gnl|my_center|LOCUS_17390 7969 8751 gene locus_tag LOCUS_17400 7969 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 9143 10939 gene locus_tag LOCUS_17410 9143 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 <11946 11033 gene locus_tag LOCUS_17420 <11946 11033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029104378.1:alpha/beta hydrolase >Feature sequence067 466 969 gene locus_tag LOCUS_17430 466 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 2095 980 gene locus_tag LOCUS_17440 2095 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3569 2100 gene locus_tag LOCUS_17450 gene gltX 3569 2100 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 protein_id gnl|my_center|LOCUS_17450 4461 3619 gene locus_tag LOCUS_17460 4461 3619 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_17460 5358 4537 gene locus_tag LOCUS_17470 5358 4537 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777022.1 protein_id gnl|my_center|LOCUS_17470 6514 5489 gene locus_tag LOCUS_17480 6514 5489 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_17480 7311 6511 gene locus_tag LOCUS_17490 7311 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 7853 7308 gene locus_tag LOCUS_17500 7853 7308 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_17500 8650 7892 gene locus_tag LOCUS_17510 8650 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 8748 8821 gene locus_tag LOCUS_t00220 8748 8821 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8905 9486 gene locus_tag LOCUS_17520 gene pncA 8905 9486 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942927.1 protein_id gnl|my_center|LOCUS_17520 9483 10844 gene locus_tag LOCUS_17530 9483 10844 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403127.1 protein_id gnl|my_center|LOCUS_17530 <11783 10891 gene locus_tag LOCUS_17540 <11783 10891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966917.1:heavy metal translocating P-type ATPase >Feature sequence068 1513 761 gene locus_tag LOCUS_17550 1513 761 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942965.1 protein_id gnl|my_center|LOCUS_17550 2751 1510 gene locus_tag LOCUS_17560 2751 1510 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_17560 3787 2762 gene locus_tag LOCUS_17570 3787 2762 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_17570 4571 3780 gene locus_tag LOCUS_17580 4571 3780 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_17580 5021 4629 gene locus_tag LOCUS_17590 5021 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 5139 5519 gene locus_tag LOCUS_17600 5139 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 5606 6211 gene locus_tag LOCUS_17610 5606 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 6416 7366 gene locus_tag LOCUS_17620 6416 7366 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_17620 7431 8453 gene locus_tag LOCUS_17630 7431 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 8471 9580 gene locus_tag LOCUS_17640 8471 9580 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_17640 9596 10627 gene locus_tag LOCUS_17650 9596 10627 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288131.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence069 1715 210 gene locus_tag LOCUS_17660 1715 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2624 1716 gene locus_tag LOCUS_17670 2624 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3348 2650 gene locus_tag LOCUS_17680 3348 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 4103 3348 gene locus_tag LOCUS_17690 4103 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 4207 6186 gene locus_tag LOCUS_17700 4207 6186 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259298.1 protein_id gnl|my_center|LOCUS_17700 8078 6270 gene locus_tag LOCUS_17710 8078 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 9906 8371 gene locus_tag LOCUS_17720 9906 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 9794 10132 gene locus_tag LOCUS_17730 9794 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence070 527 814 gene locus_tag LOCUS_17740 527 814 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_17740 1102 2067 gene locus_tag LOCUS_17750 1102 2067 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194438.1 protein_id gnl|my_center|LOCUS_17750 2329 2775 gene locus_tag LOCUS_17760 2329 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 4017 3019 gene locus_tag LOCUS_17770 4017 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 4335 4547 gene locus_tag LOCUS_17780 4335 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 5479 5000 gene locus_tag LOCUS_17790 5479 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 6298 5819 gene locus_tag LOCUS_17800 6298 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 7989 6295 gene locus_tag LOCUS_17810 7989 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 7945 8223 gene locus_tag LOCUS_17820 7945 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 9367 9092 gene locus_tag LOCUS_17830 9367 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 9251 9484 gene locus_tag LOCUS_17840 9251 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence071 365 2284 gene locus_tag LOCUS_17850 365 2284 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250346.1 protein_id gnl|my_center|LOCUS_17850 2556 2353 gene locus_tag LOCUS_17860 2556 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3007 2693 gene locus_tag LOCUS_17870 3007 2693 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_17870 3224 2988 gene locus_tag LOCUS_17880 3224 2988 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_17880 3679 3323 gene locus_tag LOCUS_17890 3679 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 4034 3663 gene locus_tag LOCUS_17900 4034 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 4532 4134 gene locus_tag LOCUS_17910 4532 4134 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075890604.1 protein_id gnl|my_center|LOCUS_17910 4810 4532 gene locus_tag LOCUS_17920 4810 4532 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143788.1 protein_id gnl|my_center|LOCUS_17920 5386 6372 gene locus_tag LOCUS_17930 5386 6372 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256068.1 protein_id gnl|my_center|LOCUS_17930 6776 7255 gene locus_tag LOCUS_17940 6776 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 7267 7773 gene locus_tag LOCUS_17950 7267 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 7803 7997 gene locus_tag LOCUS_17960 7803 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 7997 8455 gene locus_tag LOCUS_17970 7997 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 9395 8832 gene locus_tag LOCUS_17980 9395 8832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 9583 9807 gene locus_tag LOCUS_17990 9583 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence072 1835 411 gene locus_tag LOCUS_18000 1835 411 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_18000 2533 1832 gene locus_tag LOCUS_18010 2533 1832 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878347.1 protein_id gnl|my_center|LOCUS_18010 2583 3107 gene locus_tag LOCUS_18020 2583 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 4020 3160 gene locus_tag LOCUS_18030 4020 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 5027 4017 gene locus_tag LOCUS_18040 5027 4017 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_18040 5127 6128 gene locus_tag LOCUS_18050 5127 6128 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_18050 6167 6742 gene locus_tag LOCUS_18060 6167 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 6765 8171 gene locus_tag LOCUS_18070 6765 8171 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229612.1 protein_id gnl|my_center|LOCUS_18070 9612 8590 gene locus_tag LOCUS_18080 9612 8590 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence073 532 1758 gene locus_tag LOCUS_18090 532 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1755 3449 gene locus_tag LOCUS_18100 1755 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 3442 6450 gene locus_tag LOCUS_18110 3442 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 6447 7358 gene locus_tag LOCUS_18120 6447 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 7351 8991 gene locus_tag LOCUS_18130 gene cas1 7351 8991 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_18130 8996 9292 gene locus_tag LOCUS_18140 8996 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence074 221 568 gene locus_tag LOCUS_18150 221 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1072 602 gene locus_tag LOCUS_18160 1072 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1642 2370 gene locus_tag LOCUS_18170 1642 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2372 3304 gene locus_tag LOCUS_18180 2372 3304 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393491.1 protein_id gnl|my_center|LOCUS_18180 3578 3363 gene locus_tag LOCUS_18190 3578 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3787 4473 gene locus_tag LOCUS_18200 3787 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 4951 4460 gene locus_tag LOCUS_18210 gene soxR 4951 4460 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977128.1 protein_id gnl|my_center|LOCUS_18210 5052 5726 gene locus_tag LOCUS_18220 5052 5726 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030391327.1 protein_id gnl|my_center|LOCUS_18220 5974 6870 gene locus_tag LOCUS_18230 5974 6870 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 protein_id gnl|my_center|LOCUS_18230 7603 6929 gene locus_tag LOCUS_18240 7603 6929 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774859.1 protein_id gnl|my_center|LOCUS_18240 8047 7610 gene locus_tag LOCUS_18250 8047 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 8122 8481 gene locus_tag LOCUS_18260 8122 8481 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528065.1 protein_id gnl|my_center|LOCUS_18260 8693 9157 gene locus_tag LOCUS_18270 8693 9157 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388616.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence075 503 156 gene locus_tag LOCUS_18280 503 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 797 549 gene locus_tag LOCUS_18290 797 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929158.1 protein_id gnl|my_center|LOCUS_18290 1028 942 gene locus_tag LOCUS_t00230 1028 942 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1475 1101 gene locus_tag LOCUS_18300 1475 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2414 1983 gene locus_tag LOCUS_18310 2414 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2707 2414 gene locus_tag LOCUS_18320 2707 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2972 2709 gene locus_tag LOCUS_18330 2972 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 3301 5409 gene locus_tag LOCUS_18340 3301 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 5505 6638 gene locus_tag LOCUS_18350 5505 6638 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_18350 6647 7270 gene locus_tag LOCUS_18360 6647 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 7474 7674 gene locus_tag LOCUS_18370 7474 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 7795 9000 gene locus_tag LOCUS_18380 7795 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence076 <1 950 gene locus_tag LOCUS_18390 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404080.1:lipocalin-like domain-containing protein 1024 2094 gene locus_tag LOCUS_18400 1024 2094 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120607.1 protein_id gnl|my_center|LOCUS_18400 2069 2413 gene locus_tag LOCUS_18410 2069 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 3000 2410 gene locus_tag LOCUS_18420 3000 2410 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228871.1 protein_id gnl|my_center|LOCUS_18420 3166 3792 gene locus_tag LOCUS_18430 3166 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 3805 4650 gene locus_tag LOCUS_18440 3805 4650 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904947.1 protein_id gnl|my_center|LOCUS_18440 5200 4718 gene locus_tag LOCUS_18450 5200 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 5775 5197 gene locus_tag LOCUS_18460 5775 5197 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390927.1 protein_id gnl|my_center|LOCUS_18460 5861 6394 gene locus_tag LOCUS_18470 gene def 5861 6394 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528469.1 protein_id gnl|my_center|LOCUS_18470 6941 6405 gene locus_tag LOCUS_18480 6941 6405 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256302.1 protein_id gnl|my_center|LOCUS_18480 7015 7317 gene locus_tag LOCUS_18490 gene moaD 7015 7317 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257741.1 protein_id gnl|my_center|LOCUS_18490 7314 7745 gene locus_tag LOCUS_18500 7314 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18500 7995 7771 gene locus_tag LOCUS_18510 7995 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 8390 7992 gene locus_tag LOCUS_18520 8390 7992 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402858.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence077 716 480 gene locus_tag LOCUS_18530 716 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1238 783 gene locus_tag LOCUS_18540 1238 783 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112905282.1 protein_id gnl|my_center|LOCUS_18540 2495 1425 gene locus_tag LOCUS_18550 2495 1425 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395785.1 protein_id gnl|my_center|LOCUS_18550 3556 2492 gene locus_tag LOCUS_18560 3556 2492 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395785.1 protein_id gnl|my_center|LOCUS_18560 4749 3553 gene locus_tag LOCUS_18570 4749 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 6460 4775 gene locus_tag LOCUS_18580 gene groL 6460 4775 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 protein_id gnl|my_center|LOCUS_18580 6772 6470 gene locus_tag LOCUS_18590 gene groES 6772 6470 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_18590 7003 8238 gene locus_tag LOCUS_18600 7003 8238 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence078 1545 349 gene locus_tag LOCUS_18610 1545 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2780 1542 gene locus_tag LOCUS_18620 2780 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3262 2777 gene locus_tag LOCUS_18630 3262 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 5259 3259 gene locus_tag LOCUS_18640 5259 3259 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_18640 5477 5307 gene locus_tag LOCUS_18650 5477 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 6220 5474 gene locus_tag LOCUS_18660 gene ccsA 6220 5474 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_18660 7573 6233 gene locus_tag LOCUS_18670 7573 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 8130 7657 gene locus_tag LOCUS_18680 8130 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence079 444 91 gene locus_tag LOCUS_18690 444 91 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200901620.1 protein_id gnl|my_center|LOCUS_18690 681 454 gene locus_tag LOCUS_18700 681 454 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928916.1 protein_id gnl|my_center|LOCUS_18700 899 2137 gene locus_tag LOCUS_18710 899 2137 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326489.1 protein_id gnl|my_center|LOCUS_18710 2472 4316 gene locus_tag LOCUS_18720 2472 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 4367 4948 gene locus_tag LOCUS_18730 4367 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 5763 4945 gene locus_tag LOCUS_18740 5763 4945 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817305.1 protein_id gnl|my_center|LOCUS_18740 6701 5766 gene locus_tag LOCUS_18750 6701 5766 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141892.1 protein_id gnl|my_center|LOCUS_18750 7486 6701 gene locus_tag LOCUS_18760 7486 6701 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532495.1 protein_id gnl|my_center|LOCUS_18760 <8145 7596 gene locus_tag LOCUS_18770 <8145 7596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393825.1:uroporphyrinogen decarboxylase family protein >Feature sequence080 1261 827 gene locus_tag LOCUS_18780 1261 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1896 2573 gene locus_tag LOCUS_18790 gene aqpS 1896 2573 CDS product aquaglyceroporin AqpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969025.1 protein_id gnl|my_center|LOCUS_18790 3570 3848 gene locus_tag LOCUS_18800 3570 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3994 4623 gene locus_tag LOCUS_18810 3994 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 5223 5840 gene locus_tag LOCUS_18820 5223 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 7243 6002 gene locus_tag LOCUS_18830 7243 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence081 382 83 gene locus_tag LOCUS_18840 382 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 3479 423 gene locus_tag LOCUS_18850 3479 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 4045 3626 gene locus_tag LOCUS_18860 4045 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 4225 5775 gene locus_tag LOCUS_18870 4225 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 6337 5735 gene locus_tag LOCUS_18880 6337 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence082 207 1205 gene locus_tag LOCUS_18890 gene holA 207 1205 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258281.1 protein_id gnl|my_center|LOCUS_18890 1441 1202 gene locus_tag LOCUS_18900 1441 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 3284 1680 gene locus_tag LOCUS_18910 3284 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 3434 4480 gene locus_tag LOCUS_18920 gene ychF 3434 4480 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898732.1 protein_id gnl|my_center|LOCUS_18920 5423 4470 gene locus_tag LOCUS_18930 5423 4470 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_18930 5592 6368 gene locus_tag LOCUS_18940 5592 6368 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921580.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence083 <1 572 gene locus_tag LOCUS_18950 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065185.1:FAD-dependent tricarballylate dehydrogenase TcuA 1834 569 gene locus_tag LOCUS_18960 1834 569 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230328.1 protein_id gnl|my_center|LOCUS_18960 4384 1874 gene locus_tag LOCUS_18970 4384 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 5472 4459 gene locus_tag LOCUS_18980 5472 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence084 372 160 gene locus_tag LOCUS_18990 372 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 480 1190 gene locus_tag LOCUS_19000 480 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2003 2194 gene locus_tag LOCUS_19010 2003 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3043 2303 gene locus_tag LOCUS_19020 3043 2303 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122046.1 protein_id gnl|my_center|LOCUS_19020 3119 4171 gene locus_tag LOCUS_19030 3119 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 4158 4490 gene locus_tag LOCUS_19040 4158 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4704 4531 gene locus_tag LOCUS_19050 4704 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 4627 4929 gene locus_tag LOCUS_19060 4627 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 <6196 4974 gene locus_tag LOCUS_19070 <6196 4974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258550.1:isoleucine--tRNA ligase >Feature sequence085 464 1489 gene locus_tag LOCUS_19080 464 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2031 1510 gene locus_tag LOCUS_19090 2031 1510 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614581.1 protein_id gnl|my_center|LOCUS_19090 4430 2049 gene locus_tag LOCUS_19100 4430 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 4539 5507 gene locus_tag LOCUS_19110 4539 5507 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616239.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence086 370 2 gene locus_tag LOCUS_19120 370 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 654 358 gene locus_tag LOCUS_19130 654 358 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390829.1 protein_id gnl|my_center|LOCUS_19130 653 955 gene locus_tag LOCUS_19140 653 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 1081 1848 gene locus_tag LOCUS_19150 1081 1848 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251678.1 protein_id gnl|my_center|LOCUS_19150 2585 1845 gene locus_tag LOCUS_19160 gene yfaU 2585 1845 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992981.1 protein_id gnl|my_center|LOCUS_19160 4360 3380 gene locus_tag LOCUS_19170 4360 3380 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_19170 4468 4396 gene locus_tag LOCUS_t00240 4468 4396 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence087 1073 132 gene locus_tag LOCUS_19180 1073 132 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095835446.1 protein_id gnl|my_center|LOCUS_19180 3555 1480 gene locus_tag LOCUS_19190 3555 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 4140 3970 gene locus_tag LOCUS_19200 4140 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 4646 4233 gene locus_tag LOCUS_19210 4646 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence088 385 1242 gene locus_tag LOCUS_19220 385 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2259 1264 gene locus_tag LOCUS_19230 2259 1264 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030183075.1 protein_id gnl|my_center|LOCUS_19230 2580 4946 gene locus_tag LOCUS_19240 2580 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence089 1017 1292 gene locus_tag LOCUS_19250 gene rpsP 1017 1292 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_19250 1302 1538 gene locus_tag LOCUS_19260 1302 1538 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_19260 1571 2038 gene locus_tag LOCUS_19270 gene rimM 1571 2038 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_19270 2035 2778 gene locus_tag LOCUS_19280 gene trmD 2035 2778 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_19280 4170 2839 gene locus_tag LOCUS_19290 4170 2839 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence090 2474 246 gene locus_tag LOCUS_19300 2474 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 4884 2680 gene locus_tag LOCUS_19310 4884 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 5150 4881 gene locus_tag LOCUS_19320 5150 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence091 1727 129 gene locus_tag LOCUS_19330 1727 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2591 1824 gene locus_tag LOCUS_19340 2591 1824 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_19340 4103 2652 gene locus_tag LOCUS_19350 gene argH 4103 2652 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529410.1 protein_id gnl|my_center|LOCUS_19350 <5192 4144 gene locus_tag LOCUS_19360 <5192 4144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928539.1:acetylornithine transaminase >Feature sequence092 <1 914 gene locus_tag LOCUS_19370 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000804038.1:leucine-rich repeat domain-containing protein 1070 4834 gene locus_tag LOCUS_19380 1070 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence093 103 1344 gene locus_tag LOCUS_19390 103 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1341 2135 gene locus_tag LOCUS_19400 1341 2135 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_19400 2138 2962 gene locus_tag LOCUS_19410 2138 2962 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_19410 3065 4138 gene locus_tag LOCUS_19420 3065 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence094 1336 842 gene locus_tag LOCUS_19430 1336 842 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389584.1 protein_id gnl|my_center|LOCUS_19430 2088 1354 gene locus_tag LOCUS_19440 2088 1354 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122697.1 protein_id gnl|my_center|LOCUS_19440 2190 2870 gene locus_tag LOCUS_19450 gene queC 2190 2870 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038130.1 protein_id gnl|my_center|LOCUS_19450 3739 2942 gene locus_tag LOCUS_19460 3739 2942 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256936.1 protein_id gnl|my_center|LOCUS_19460 4266 3718 gene locus_tag LOCUS_19470 4266 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence095 83 538 gene locus_tag LOCUS_19480 83 538 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582556.1 protein_id gnl|my_center|LOCUS_19480 570 1004 gene locus_tag LOCUS_19490 gene ybeY 570 1004 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259163.1 protein_id gnl|my_center|LOCUS_19490 1007 1870 gene locus_tag LOCUS_19500 gene ispE 1007 1870 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_19500 1903 1976 gene locus_tag LOCUS_t00250 1903 1976 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1977 2753 gene locus_tag LOCUS_19510 1977 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2806 3798 gene locus_tag LOCUS_19520 2806 3798 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258060.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence096 1241 252 gene locus_tag LOCUS_19530 1241 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1438 2094 gene locus_tag LOCUS_19540 1438 2094 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926969.1 protein_id gnl|my_center|LOCUS_19540 2125 3297 gene locus_tag LOCUS_19550 2125 3297 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_19550 3380 3622 gene locus_tag LOCUS_19560 3380 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3734 4174 gene locus_tag LOCUS_19570 3734 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 4536 4282 gene locus_tag LOCUS_19580 4536 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence097 1744 1592 gene locus_tag LOCUS_19590 1744 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2551 1793 gene locus_tag LOCUS_19600 2551 1793 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971974.1 protein_id gnl|my_center|LOCUS_19600 2653 3126 gene locus_tag LOCUS_19610 2653 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 3198 4112 gene locus_tag LOCUS_19620 3198 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence098 1363 137 gene locus_tag LOCUS_19630 1363 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2198 1470 gene locus_tag LOCUS_19640 2198 1470 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_19640 3602 2229 gene locus_tag LOCUS_19650 3602 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 <4407 3668 gene locus_tag LOCUS_19660 <4407 3668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776832.1:phytanoyl-CoA dioxygenase family protein >Feature sequence099 3 455 gene locus_tag LOCUS_19670 3 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 555 1682 gene locus_tag LOCUS_19680 555 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2262 1690 gene locus_tag LOCUS_19690 2262 1690 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545889.1 protein_id gnl|my_center|LOCUS_19690 3494 2307 gene locus_tag LOCUS_19700 3494 2307 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907730.1 protein_id gnl|my_center|LOCUS_19700 4357 3491 gene locus_tag LOCUS_19710 4357 3491 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946112.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence100 1210 335 gene locus_tag LOCUS_19720 1210 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1898 1197 gene locus_tag LOCUS_19730 1898 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3385 1895 gene locus_tag LOCUS_19740 3385 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3869 3420 gene locus_tag LOCUS_19750 3869 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence101 6 1007 gene locus_tag LOCUS_19760 gene gmd 6 1007 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_19760 1022 1960 gene locus_tag LOCUS_19770 1022 1960 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_19770 1962 3416 gene locus_tag LOCUS_19780 1962 3416 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_19780 3413 3787 gene locus_tag LOCUS_19790 3413 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence102 1569 4 gene locus_tag LOCUS_19800 1569 4 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967847.1 protein_id gnl|my_center|LOCUS_19800 2236 1583 gene locus_tag LOCUS_19810 2236 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2977 2342 gene locus_tag LOCUS_19820 2977 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3459 4088 gene locus_tag LOCUS_19830 3459 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence103 <1 960 gene locus_tag LOCUS_19840 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943261.1:ABC transporter ATP-binding protein 957 1940 gene locus_tag LOCUS_19850 957 1940 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087313.1 protein_id gnl|my_center|LOCUS_19850 1940 2875 gene locus_tag LOCUS_19860 1940 2875 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538241.1 protein_id gnl|my_center|LOCUS_19860 2865 3740 gene locus_tag LOCUS_19870 2865 3740 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538240.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence104 <1 605 gene locus_tag LOCUS_19880 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531184.1:DUF1801 domain-containing protein 810 2417 gene locus_tag LOCUS_19890 810 2417 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031209.1 protein_id gnl|my_center|LOCUS_19890 2414 3040 gene locus_tag LOCUS_19900 2414 3040 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729044.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence105 413 1438 gene locus_tag LOCUS_19910 413 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1440 2066 gene locus_tag LOCUS_19920 gene nadD 1440 2066 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258169.1 protein_id gnl|my_center|LOCUS_19920 2047 2442 gene locus_tag LOCUS_19930 gene rsfS 2047 2442 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257176.1 protein_id gnl|my_center|LOCUS_19930 2451 2630 gene locus_tag LOCUS_19940 2451 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 <3837 2672 gene locus_tag LOCUS_19950 <3837 2672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012660626.1:endonuclease MutS2 >Feature sequence106 312 572 gene locus_tag LOCUS_19960 312 572 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413167.1 protein_id gnl|my_center|LOCUS_19960 569 946 gene locus_tag LOCUS_19970 569 946 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413174.1 protein_id gnl|my_center|LOCUS_19970 2206 1169 gene locus_tag LOCUS_19980 2206 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2326 2856 gene locus_tag LOCUS_19990 2326 2856 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028212.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence107 1360 299 gene locus_tag LOCUS_20000 gene tsaD 1360 299 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256815.1 protein_id gnl|my_center|LOCUS_20000 1962 1357 gene locus_tag LOCUS_20010 gene rimI 1962 1357 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258576.1 protein_id gnl|my_center|LOCUS_20010 2694 2044 gene locus_tag LOCUS_20020 2694 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 3179 2691 gene locus_tag LOCUS_20030 3179 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence108 161 412 gene locus_tag LOCUS_20040 161 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 507 1640 gene locus_tag LOCUS_20050 gene recF 507 1640 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_20050 1633 1989 gene locus_tag LOCUS_20060 1633 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence109 1013 246 gene locus_tag LOCUS_20070 gene proC 1013 246 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_20070 <3319 1098 gene locus_tag LOCUS_20080 <3319 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057539.1:ComEC/Rec2 family competence protein >Feature sequence110 <1 1061 gene locus_tag LOCUS_20090 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_163760282.1:DDE-type integrase/transposase/recombinase 1061 1867 gene locus_tag LOCUS_20100 1061 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1864 2805 gene locus_tag LOCUS_20110 1864 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence111 1304 1026 gene locus_tag LOCUS_20120 1304 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1674 1309 gene locus_tag LOCUS_20130 1674 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 1906 3003 gene locus_tag LOCUS_20140 1906 3003 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015478.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence112 1831 143 gene locus_tag LOCUS_20150 1831 143 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192100.1 protein_id gnl|my_center|LOCUS_20150 2700 1828 gene locus_tag LOCUS_20160 2700 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence113 1270 626 gene locus_tag LOCUS_20170 1270 626 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933360.1 protein_id gnl|my_center|LOCUS_20170 2445 1300 gene locus_tag LOCUS_20180 2445 1300 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946655.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence114 1819 359 gene locus_tag LOCUS_20190 1819 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2129 2974 gene locus_tag LOCUS_20200 2129 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence115 2147 1122 gene locus_tag LOCUS_20210 2147 1122 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence116 892 2385 gene locus_tag LOCUS_20220 892 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 <2960 2428 gene locus_tag LOCUS_20230 <2960 2428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804458.1:sialidase family protein >Feature sequence117 297 758 gene locus_tag LOCUS_20240 297 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 966 2423 gene locus_tag LOCUS_20250 966 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence118 251 1480 gene locus_tag LOCUS_20260 gene mfnA 251 1480 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250765.1 protein_id gnl|my_center|LOCUS_20260 2594 1542 gene locus_tag LOCUS_20270 2594 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 >Feature sequence119 <1 1566 gene locus_tag LOCUS_20280 <1 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111860.1:ATP-dependent DNA helicase 1739 1966 gene locus_tag LOCUS_20290 1739 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 1963 2370 gene locus_tag LOCUS_20300 gene vapC1 1963 2370 CDS product type II toxin-antitoxin system ribonuclease VapC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400580.1 protein_id gnl|my_center|LOCUS_20300 2497 2348 gene locus_tag LOCUS_20310 2497 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence120 2022 712 gene locus_tag LOCUS_20320 2022 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence121 1908 1522 gene locus_tag LOCUS_20330 1908 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2431 1955 gene locus_tag LOCUS_20340 2431 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence122 2533 458 gene locus_tag LOCUS_20350 2533 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence123 566 772 gene locus_tag LOCUS_20360 566 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 832 1182 gene locus_tag LOCUS_20370 832 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 1251 1640 gene locus_tag LOCUS_20380 1251 1640 CDS product DUF3224 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071754.1 protein_id gnl|my_center|LOCUS_20380 <2650 1902 gene locus_tag LOCUS_20390 <2650 1902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164736349.1:IS5 family transposase >Feature sequence124 295 1122 gene locus_tag LOCUS_20400 295 1122 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_20400 1129 2361 gene locus_tag LOCUS_20410 1129 2361 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138390504.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence125 1671 94 gene locus_tag LOCUS_20420 gene murJ 1671 94 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391760.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence126 <1 2348 gene locus_tag LOCUS_20430 <1 2348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861551.1:glycine--tRNA ligase subunit beta >Feature sequence127 417 2036 gene locus_tag LOCUS_20440 417 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence128 1471 623 gene locus_tag LOCUS_20450 1471 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence129 <1 1085 gene locus_tag LOCUS_20460 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255932.1:HAMP domain-containing protein 1099 1755 gene locus_tag LOCUS_20470 1099 1755 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_20470 1849 2109 gene locus_tag LOCUS_20480 1849 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence130 >Feature sequence131 836 1393 gene locus_tag LOCUS_20490 836 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence132 1922 1368 gene locus_tag LOCUS_20500 1922 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence133 1128 238 gene locus_tag LOCUS_20510 1128 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1812 1144 gene locus_tag LOCUS_20520 1812 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520