>Feature sequence001 313 322 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1490 1293 gene locus_tag LOCUS_00010 1490 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1585 1848 gene locus_tag LOCUS_00020 1585 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1921 3297 gene locus_tag LOCUS_00030 1921 3297 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_00030 3468 3695 gene locus_tag LOCUS_00040 3468 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00040 3771 5291 gene locus_tag LOCUS_00050 3771 5291 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_00050 5282 5749 gene locus_tag LOCUS_00060 gene tsaE 5282 5749 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 protein_id gnl|my_center|LOCUS_00060 5842 7002 gene locus_tag LOCUS_00070 gene amiB 5842 7002 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_00070 7048 8787 gene locus_tag LOCUS_00080 gene mutL 7048 8787 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_00080 8780 9757 gene locus_tag LOCUS_00090 gene miaA 8780 9757 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768333.1 protein_id gnl|my_center|LOCUS_00090 9773 10015 gene locus_tag LOCUS_00100 gene hfq 9773 10015 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_00100 10664 10140 gene locus_tag LOCUS_00110 10664 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11217 10717 gene locus_tag LOCUS_00120 11217 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12635 11373 gene locus_tag LOCUS_00130 12635 11373 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920509.1 protein_id gnl|my_center|LOCUS_00130 13780 12734 gene locus_tag LOCUS_00140 13780 12734 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 protein_id gnl|my_center|LOCUS_00140 14690 13884 gene locus_tag LOCUS_00150 14690 13884 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040197.1 protein_id gnl|my_center|LOCUS_00150 15354 15022 gene locus_tag LOCUS_00160 15354 15022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15595 16425 gene locus_tag LOCUS_00170 15595 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18785 16506 gene locus_tag LOCUS_00180 gene clpA 18785 16506 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_00180 19111 18785 gene locus_tag LOCUS_00190 gene clpS 19111 18785 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097649.1 protein_id gnl|my_center|LOCUS_00190 19814 19155 gene locus_tag LOCUS_00200 19814 19155 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114076.1 protein_id gnl|my_center|LOCUS_00200 20052 21707 gene locus_tag LOCUS_00210 20052 21707 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_00210 21710 22528 gene locus_tag LOCUS_00220 gene kdsA 21710 22528 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_00220 22528 23856 gene locus_tag LOCUS_00230 gene eno 22528 23856 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_00230 23853 24263 gene locus_tag LOCUS_00240 23853 24263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24260 24961 gene locus_tag LOCUS_00250 gene ispD 24260 24961 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478544.1 protein_id gnl|my_center|LOCUS_00250 24958 25467 gene locus_tag LOCUS_00260 gene ispF 24958 25467 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_00260 25567 25971 gene locus_tag LOCUS_00270 25567 25971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 26211 25999 gene locus_tag LOCUS_00280 26211 25999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26487 27410 gene locus_tag LOCUS_00290 26487 27410 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943634.1 protein_id gnl|my_center|LOCUS_00290 27394 28752 gene locus_tag LOCUS_00300 27394 28752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 28805 30151 gene locus_tag LOCUS_00310 28805 30151 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125657.1 protein_id gnl|my_center|LOCUS_00310 30139 31179 gene locus_tag LOCUS_00320 30139 31179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125658.1 protein_id gnl|my_center|LOCUS_00320 31279 31578 gene locus_tag LOCUS_00330 31279 31578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 31779 33914 gene locus_tag LOCUS_00340 31779 33914 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114020.1 protein_id gnl|my_center|LOCUS_00340 33951 35516 gene locus_tag LOCUS_00350 33951 35516 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926123.1 protein_id gnl|my_center|LOCUS_00350 35533 36774 gene locus_tag LOCUS_00360 gene zigA 35533 36774 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_00360 37104 36889 gene locus_tag LOCUS_00370 37104 36889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 37316 37101 gene locus_tag LOCUS_00380 37316 37101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 >Feature sequence002 224 1192 gene locus_tag LOCUS_00390 gene rluD 224 1192 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957782.1 protein_id gnl|my_center|LOCUS_00390 1233 2006 gene locus_tag LOCUS_00400 gene yfiH 1233 2006 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209471.1 protein_id gnl|my_center|LOCUS_00400 2037 2312 gene locus_tag LOCUS_00410 2037 2312 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_00410 2369 3601 gene locus_tag LOCUS_00420 2369 3601 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_00420 3857 4765 gene locus_tag LOCUS_00430 3857 4765 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693969.1 protein_id gnl|my_center|LOCUS_00430 5670 4762 gene locus_tag LOCUS_00440 5670 4762 CDS product HindIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995236.1 protein_id gnl|my_center|LOCUS_00440 5832 8408 gene locus_tag LOCUS_00450 gene clpB 5832 8408 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038185.1 protein_id gnl|my_center|LOCUS_00450 8689 8456 gene locus_tag LOCUS_00460 8689 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 8573 9364 gene locus_tag LOCUS_00470 8573 9364 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 protein_id gnl|my_center|LOCUS_00470 9361 9960 gene locus_tag LOCUS_00480 gene coaE 9361 9960 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772796.1 protein_id gnl|my_center|LOCUS_00480 10036 10803 gene locus_tag LOCUS_00490 gene zapD 10036 10803 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_00490 11863 10877 gene locus_tag LOCUS_00500 11863 10877 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_00500 13076 11871 gene locus_tag LOCUS_00510 gene argJ 13076 11871 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 protein_id gnl|my_center|LOCUS_00510 15728 13098 gene locus_tag LOCUS_00520 gene secA 15728 13098 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947192.1 protein_id gnl|my_center|LOCUS_00520 16758 15874 gene locus_tag LOCUS_00530 16758 15874 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_00530 16955 17422 gene locus_tag LOCUS_00540 16955 17422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 18369 17452 gene locus_tag LOCUS_00550 gene lpxC 18369 17452 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555040.1 protein_id gnl|my_center|LOCUS_00550 19512 18373 gene locus_tag LOCUS_00560 gene ftsZ 19512 18373 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555041.1 protein_id gnl|my_center|LOCUS_00560 20800 19580 gene locus_tag LOCUS_00570 gene ftsA 20800 19580 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_00570 21570 20797 gene locus_tag LOCUS_00580 21570 20797 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769491.1 protein_id gnl|my_center|LOCUS_00580 22517 21570 gene locus_tag LOCUS_00590 22517 21570 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_00590 23467 22514 gene locus_tag LOCUS_00600 gene murB 23467 22514 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_00600 24906 23470 gene locus_tag LOCUS_00610 gene murC 24906 23470 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_00610 26074 24899 gene locus_tag LOCUS_00620 gene murG 26074 24899 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035962.1 protein_id gnl|my_center|LOCUS_00620 27254 26061 gene locus_tag LOCUS_00630 gene ftsW 27254 26061 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216490.1 protein_id gnl|my_center|LOCUS_00630 28636 27254 gene locus_tag LOCUS_00640 gene murD 28636 27254 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268846.1 protein_id gnl|my_center|LOCUS_00640 29721 28639 gene locus_tag LOCUS_00650 gene mraY 29721 28639 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_00650 31076 29721 gene locus_tag LOCUS_00660 31076 29721 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_00660 32608 31073 gene locus_tag LOCUS_00670 32608 31073 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112751.1 protein_id gnl|my_center|LOCUS_00670 34350 32611 gene locus_tag LOCUS_00680 gene ftsI 34350 32611 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_00680 34613 34347 gene locus_tag LOCUS_00690 34613 34347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 >Feature sequence003 2901 424 gene locus_tag LOCUS_00700 2901 424 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_00700 3578 2901 gene locus_tag LOCUS_00710 3578 2901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_00710 3577 4200 gene locus_tag LOCUS_00720 gene tesA 3577 4200 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114753.1 protein_id gnl|my_center|LOCUS_00720 4227 4772 gene locus_tag LOCUS_00730 4227 4772 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_00730 4879 5214 gene locus_tag LOCUS_00740 4879 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 5222 6403 gene locus_tag LOCUS_00750 gene sat 5222 6403 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_00750 6558 6845 gene locus_tag LOCUS_00760 gene groES 6558 6845 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_00760 6867 8516 gene locus_tag LOCUS_00770 gene groL 6867 8516 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_00770 9875 8616 gene locus_tag LOCUS_00780 gene rho 9875 8616 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378757.1 protein_id gnl|my_center|LOCUS_00780 10386 10060 gene locus_tag LOCUS_00790 gene trxA 10386 10060 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_00790 10589 10747 gene locus_tag LOCUS_00800 10589 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 10728 12053 gene locus_tag LOCUS_00810 gene lysA 10728 12053 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196768.1 protein_id gnl|my_center|LOCUS_00810 12481 13890 gene locus_tag LOCUS_00820 gene glnA 12481 13890 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456818.1 protein_id gnl|my_center|LOCUS_00820 14053 15099 gene locus_tag LOCUS_00830 gene glnL 14053 15099 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_00830 15101 16504 gene locus_tag LOCUS_00840 gene ntrC 15101 16504 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_00840 16655 18205 gene locus_tag LOCUS_00850 16655 18205 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_00850 18761 18312 gene locus_tag LOCUS_00860 18761 18312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487403.1 protein_id gnl|my_center|LOCUS_00860 20155 19034 gene locus_tag LOCUS_00870 20155 19034 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_00870 20490 20218 gene locus_tag LOCUS_00880 20490 20218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 20669 21382 gene locus_tag LOCUS_00890 20669 21382 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_00890 22434 21424 gene locus_tag LOCUS_00900 gene hemB 22434 21424 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 protein_id gnl|my_center|LOCUS_00900 22549 23427 gene locus_tag LOCUS_00910 gene prpB 22549 23427 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244715.1 protein_id gnl|my_center|LOCUS_00910 23563 24717 gene locus_tag LOCUS_00920 gene prpC 23563 24717 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285909.1 protein_id gnl|my_center|LOCUS_00920 25767 24721 gene locus_tag LOCUS_00930 gene purM 25767 24721 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693936.1 protein_id gnl|my_center|LOCUS_00930 25875 26945 gene locus_tag LOCUS_00940 25875 26945 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112582.1 protein_id gnl|my_center|LOCUS_00940 26947 27735 gene locus_tag LOCUS_00950 gene hda 26947 27735 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208566.1 protein_id gnl|my_center|LOCUS_00950 27766 29481 gene locus_tag LOCUS_00960 27766 29481 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707374.1 protein_id gnl|my_center|LOCUS_00960 29481 30074 gene locus_tag LOCUS_00970 gene wrbA 29481 30074 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115189.1 protein_id gnl|my_center|LOCUS_00970 30187 31914 gene locus_tag LOCUS_00980 30187 31914 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_00980 31914 32405 gene locus_tag LOCUS_00990 gene ilvN 31914 32405 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_00990 32530 33546 gene locus_tag LOCUS_01000 gene ilvC 32530 33546 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185539.1 protein_id gnl|my_center|LOCUS_01000 >Feature sequence004 1837 65 gene locus_tag LOCUS_01010 1837 65 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919297.1 protein_id gnl|my_center|LOCUS_01010 2666 1860 gene locus_tag LOCUS_01020 2666 1860 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338914.1 protein_id gnl|my_center|LOCUS_01020 2795 4363 gene locus_tag LOCUS_01030 2795 4363 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_01030 4357 5259 gene locus_tag LOCUS_01040 4357 5259 CDS product CBU_1789 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958443.1 protein_id gnl|my_center|LOCUS_01040 5268 5981 gene locus_tag LOCUS_01050 5268 5981 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918668.1 protein_id gnl|my_center|LOCUS_01050 8253 5998 gene locus_tag LOCUS_01060 8253 5998 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765772.1 protein_id gnl|my_center|LOCUS_01060 8944 8486 gene locus_tag LOCUS_01070 8944 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 12857 8997 gene locus_tag LOCUS_01080 12857 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 14390 12942 gene locus_tag LOCUS_01090 14390 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 15536 15859 gene locus_tag LOCUS_01100 15536 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 15914 16393 gene locus_tag LOCUS_01110 15914 16393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 16561 25053 gene locus_tag LOCUS_01120 16561 25053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 20154 20366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28222 25079 gene locus_tag LOCUS_01130 gene lacZ 28222 25079 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_01130 31401 28261 gene locus_tag LOCUS_01140 31401 28261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 31585 33795 gene locus_tag LOCUS_01150 gene gspD 31585 33795 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533584.1 protein_id gnl|my_center|LOCUS_01150 >Feature sequence005 2026 737 gene locus_tag LOCUS_01160 gene aceA 2026 737 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268275.1 protein_id gnl|my_center|LOCUS_01160 2850 2182 gene locus_tag LOCUS_01170 2850 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 4064 2970 gene locus_tag LOCUS_01180 4064 2970 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_01180 5164 6339 gene locus_tag LOCUS_01190 5164 6339 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_01190 6539 7384 gene locus_tag LOCUS_01200 6539 7384 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098766.1 protein_id gnl|my_center|LOCUS_01200 7397 7699 gene locus_tag LOCUS_01210 7397 7699 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814830.1 protein_id gnl|my_center|LOCUS_01210 7702 8043 gene locus_tag LOCUS_01220 7702 8043 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 protein_id gnl|my_center|LOCUS_01220 8082 9785 gene locus_tag LOCUS_01230 gene ureC 8082 9785 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099392.1 protein_id gnl|my_center|LOCUS_01230 9790 10242 gene locus_tag LOCUS_01240 gene ureE 9790 10242 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261401.1 protein_id gnl|my_center|LOCUS_01240 10223 10900 gene locus_tag LOCUS_01250 10223 10900 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142971.1 protein_id gnl|my_center|LOCUS_01250 10927 11559 gene locus_tag LOCUS_01260 gene ureG 10927 11559 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_01260 11702 14521 gene locus_tag LOCUS_01270 11702 14521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 14685 14945 gene locus_tag LOCUS_01280 14685 14945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 14956 17034 gene locus_tag LOCUS_01290 14956 17034 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_01290 17062 18801 gene locus_tag LOCUS_01300 17062 18801 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_01300 19911 18940 gene locus_tag LOCUS_01310 19911 18940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 20585 19908 gene locus_tag LOCUS_01320 20585 19908 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061919.1 protein_id gnl|my_center|LOCUS_01320 22240 20645 gene locus_tag LOCUS_01330 22240 20645 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462305.1 protein_id gnl|my_center|LOCUS_01330 22613 23011 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25750 24419 gene locus_tag LOCUS_01340 25750 24419 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920685.1 protein_id gnl|my_center|LOCUS_01340 26247 25786 gene locus_tag LOCUS_01350 26247 25786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 26324 28771 gene locus_tag LOCUS_01360 26324 28771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 28764 28961 gene locus_tag LOCUS_01370 28764 28961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 29205 30674 gene locus_tag LOCUS_01380 29205 30674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 30671 32050 gene locus_tag LOCUS_01390 30671 32050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 32705 32148 gene locus_tag LOCUS_01400 32705 32148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 >Feature sequence006 <1 1638 gene locus_tag LOCUS_01410 <1 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085104.1:NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein 1638 4361 gene locus_tag LOCUS_01420 gene fdhF 1638 4361 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_01420 4368 6194 gene locus_tag LOCUS_01430 4368 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 6400 6245 gene locus_tag LOCUS_01440 6400 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 7978 6503 gene locus_tag LOCUS_01450 7978 6503 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691244.1 protein_id gnl|my_center|LOCUS_01450 8400 7975 gene locus_tag LOCUS_01460 8400 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 9935 8412 gene locus_tag LOCUS_01470 9935 8412 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_01470 13237 10004 gene locus_tag LOCUS_01480 13237 10004 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_01480 14484 13249 gene locus_tag LOCUS_01490 14484 13249 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_01490 16068 14689 gene locus_tag LOCUS_01500 gene cysG 16068 14689 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_01500 16706 16095 gene locus_tag LOCUS_01510 gene rsxG 16706 16095 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480816.1 protein_id gnl|my_center|LOCUS_01510 17797 16706 gene locus_tag LOCUS_01520 gene rsxD 17797 16706 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231937.1 protein_id gnl|my_center|LOCUS_01520 19317 17797 gene locus_tag LOCUS_01530 19317 17797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 19858 19310 gene locus_tag LOCUS_01540 19858 19310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 20463 19885 gene locus_tag LOCUS_01550 gene rsxA 20463 19885 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169884.1 protein_id gnl|my_center|LOCUS_01550 22570 20471 gene locus_tag LOCUS_01560 gene metG 22570 20471 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 protein_id gnl|my_center|LOCUS_01560 22792 23883 gene locus_tag LOCUS_01570 gene apbC 22792 23883 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_01570 23884 24450 gene locus_tag LOCUS_01580 gene dcd 23884 24450 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 protein_id gnl|my_center|LOCUS_01580 24447 26903 gene locus_tag LOCUS_01590 gene lptD 24447 26903 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 protein_id gnl|my_center|LOCUS_01590 26900 28174 gene locus_tag LOCUS_01600 26900 28174 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079997984.1 protein_id gnl|my_center|LOCUS_01600 28618 28883 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29329 30087 gene locus_tag LOCUS_01610 gene rsmA 29329 30087 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036027.1 protein_id gnl|my_center|LOCUS_01610 31074 30073 gene locus_tag LOCUS_01620 31074 30073 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266127.1 protein_id gnl|my_center|LOCUS_01620 32124 31099 gene locus_tag LOCUS_01630 32124 31099 CDS product phenylacetaldoxime dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266125.1 protein_id gnl|my_center|LOCUS_01630 >Feature sequence007 214 570 gene locus_tag LOCUS_tm00010 214 570 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1572 643 gene locus_tag LOCUS_01640 1572 643 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068063.1 protein_id gnl|my_center|LOCUS_01640 2119 1532 gene locus_tag LOCUS_01650 2119 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490290.1 protein_id gnl|my_center|LOCUS_01650 2614 2456 gene locus_tag LOCUS_01660 2614 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 2628 2912 gene locus_tag LOCUS_01670 2628 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 2899 3636 gene locus_tag LOCUS_01680 2899 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 3855 4175 gene locus_tag LOCUS_01690 3855 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 4696 4202 gene locus_tag LOCUS_01700 4696 4202 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086185.1 protein_id gnl|my_center|LOCUS_01700 5987 4698 gene locus_tag LOCUS_01710 5987 4698 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965985.1 protein_id gnl|my_center|LOCUS_01710 6306 5962 gene locus_tag LOCUS_01720 gene rplQ 6306 5962 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307999.1 protein_id gnl|my_center|LOCUS_01720 7404 6382 gene locus_tag LOCUS_01730 gene rpoA 7404 6382 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_01730 8047 7427 gene locus_tag LOCUS_01740 gene rpsD 8047 7427 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215455.1 protein_id gnl|my_center|LOCUS_01740 8456 8070 gene locus_tag LOCUS_01750 gene rpsK 8456 8070 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093689.1 protein_id gnl|my_center|LOCUS_01750 8829 8473 gene locus_tag LOCUS_01760 gene rpsM 8829 8473 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555467.1 protein_id gnl|my_center|LOCUS_01760 10355 9006 gene locus_tag LOCUS_01770 gene secY 10355 9006 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_01770 10802 10368 gene locus_tag LOCUS_01780 gene rplO 10802 10368 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_01780 11004 10804 gene locus_tag LOCUS_01790 gene rpmD 11004 10804 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093696.1 protein_id gnl|my_center|LOCUS_01790 11541 11035 gene locus_tag LOCUS_01800 gene rpsE 11541 11035 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141025.1 protein_id gnl|my_center|LOCUS_01800 11922 11614 gene locus_tag LOCUS_01810 gene rplR 11922 11614 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625873.1 protein_id gnl|my_center|LOCUS_01810 12515 11982 gene locus_tag LOCUS_01820 gene rplF 12515 11982 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_01820 12929 12534 gene locus_tag LOCUS_01830 gene rpsH 12929 12534 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704316.1 protein_id gnl|my_center|LOCUS_01830 13275 12970 gene locus_tag LOCUS_01840 gene rpsN 13275 12970 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555476.1 protein_id gnl|my_center|LOCUS_01840 13830 13291 gene locus_tag LOCUS_01850 gene rplE 13830 13291 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946090.1 protein_id gnl|my_center|LOCUS_01850 14150 13830 gene locus_tag LOCUS_01860 gene rplX 14150 13830 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021594.1 protein_id gnl|my_center|LOCUS_01860 14533 14165 gene locus_tag LOCUS_01870 gene rplN 14533 14165 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_01870 14822 14556 gene locus_tag LOCUS_01880 gene rpsQ 14822 14556 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 protein_id gnl|my_center|LOCUS_01880 15012 14815 gene locus_tag LOCUS_01890 gene rpmC 15012 14815 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771530.1 protein_id gnl|my_center|LOCUS_01890 15425 15012 gene locus_tag LOCUS_01900 gene rplP 15425 15012 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307963.1 protein_id gnl|my_center|LOCUS_01900 16101 15430 gene locus_tag LOCUS_01910 gene rpsC 16101 15430 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_01910 16443 16108 gene locus_tag LOCUS_01920 gene rplV 16443 16108 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957457.1 protein_id gnl|my_center|LOCUS_01920 16728 16453 gene locus_tag LOCUS_01930 gene rpsS 16728 16453 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307960.1 protein_id gnl|my_center|LOCUS_01930 17552 16728 gene locus_tag LOCUS_01940 gene rplB 17552 16728 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317104.1 protein_id gnl|my_center|LOCUS_01940 17858 17565 gene locus_tag LOCUS_01950 gene rplW 17858 17565 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 protein_id gnl|my_center|LOCUS_01950 18579 17851 gene locus_tag LOCUS_01960 gene rplD 18579 17851 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218934.1 protein_id gnl|my_center|LOCUS_01960 19270 18596 gene locus_tag LOCUS_01970 gene rplC 19270 18596 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036123.1 protein_id gnl|my_center|LOCUS_01970 19581 19267 gene locus_tag LOCUS_01980 gene rpsJ 19581 19267 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 protein_id gnl|my_center|LOCUS_01980 21714 19609 gene locus_tag LOCUS_01990 gene fusA 21714 19609 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946076.1 protein_id gnl|my_center|LOCUS_01990 22210 21740 gene locus_tag LOCUS_02000 gene rpsG 22210 21740 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397077.1 protein_id gnl|my_center|LOCUS_02000 22605 22231 gene locus_tag LOCUS_02010 gene rpsL 22605 22231 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399892.1 protein_id gnl|my_center|LOCUS_02010 25599 22873 gene locus_tag LOCUS_02020 25599 22873 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933304.1 protein_id gnl|my_center|LOCUS_02020 26726 25755 gene locus_tag LOCUS_02030 26726 25755 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164889853.1 protein_id gnl|my_center|LOCUS_02030 27637 26750 gene locus_tag LOCUS_02040 gene sucD 27637 26750 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329405.1 protein_id gnl|my_center|LOCUS_02040 28824 27637 gene locus_tag LOCUS_02050 28824 27637 CDS product malate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329404.1 protein_id gnl|my_center|LOCUS_02050 29828 28869 gene locus_tag LOCUS_02060 29828 28869 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 protein_id gnl|my_center|LOCUS_02060 30919 29828 gene locus_tag LOCUS_02070 30919 29828 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243814.1 protein_id gnl|my_center|LOCUS_02070 31359 32531 gene locus_tag LOCUS_02080 31359 32531 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_02080 >Feature sequence008 1885 110 gene locus_tag LOCUS_02090 1885 110 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640264.1 protein_id gnl|my_center|LOCUS_02090 3185 1896 gene locus_tag LOCUS_02100 3185 1896 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114884.1 protein_id gnl|my_center|LOCUS_02100 4692 3304 gene locus_tag LOCUS_02110 4692 3304 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479724.1 protein_id gnl|my_center|LOCUS_02110 6077 4689 gene locus_tag LOCUS_02120 6077 4689 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971610.1 protein_id gnl|my_center|LOCUS_02120 8476 6125 gene locus_tag LOCUS_02130 8476 6125 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639902.1 protein_id gnl|my_center|LOCUS_02130 9581 8520 gene locus_tag LOCUS_02140 9581 8520 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 protein_id gnl|my_center|LOCUS_02140 10556 9588 gene locus_tag LOCUS_02150 10556 9588 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533099.1 protein_id gnl|my_center|LOCUS_02150 10672 12273 gene locus_tag LOCUS_02160 10672 12273 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544143.1 protein_id gnl|my_center|LOCUS_02160 12964 12290 gene locus_tag LOCUS_02170 12964 12290 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504795.1 protein_id gnl|my_center|LOCUS_02170 15293 13056 gene locus_tag LOCUS_02180 15293 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 16026 15415 gene locus_tag LOCUS_02190 16026 15415 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815398.1 protein_id gnl|my_center|LOCUS_02190 17384 16077 gene locus_tag LOCUS_02200 17384 16077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 19606 17468 gene locus_tag LOCUS_02210 19606 17468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 22138 19742 gene locus_tag LOCUS_02220 22138 19742 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_02220 23127 22135 gene locus_tag LOCUS_02230 23127 22135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 23918 23130 gene locus_tag LOCUS_02240 23918 23130 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_02240 24958 23918 gene locus_tag LOCUS_02250 gene dmpG 24958 23918 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013510.1 protein_id gnl|my_center|LOCUS_02250 25839 24955 gene locus_tag LOCUS_02260 25839 24955 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419251.1 protein_id gnl|my_center|LOCUS_02260 26623 25832 gene locus_tag LOCUS_02270 26623 25832 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_02270 28124 26634 gene locus_tag LOCUS_02280 28124 26634 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_02280 28955 28167 gene locus_tag LOCUS_02290 28955 28167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 29085 29741 gene locus_tag LOCUS_02300 29085 29741 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402117.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence009 810 118 gene locus_tag LOCUS_02310 810 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 1138 833 gene locus_tag LOCUS_02320 1138 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 2445 1135 gene locus_tag LOCUS_02330 2445 1135 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 protein_id gnl|my_center|LOCUS_02330 2723 2442 gene locus_tag LOCUS_02340 2723 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 3778 2720 gene locus_tag LOCUS_02350 3778 2720 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_02350 5367 3775 gene locus_tag LOCUS_02360 5367 3775 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393174.1 protein_id gnl|my_center|LOCUS_02360 5585 6124 gene locus_tag LOCUS_02370 5585 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 6124 6381 gene locus_tag LOCUS_02380 6124 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 6437 6793 gene locus_tag LOCUS_02390 6437 6793 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_02390 6812 7300 gene locus_tag LOCUS_02400 6812 7300 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944318.1 protein_id gnl|my_center|LOCUS_02400 7327 7983 gene locus_tag LOCUS_02410 7327 7983 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958234.1 protein_id gnl|my_center|LOCUS_02410 7995 9248 gene locus_tag LOCUS_02420 7995 9248 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078068422.1 protein_id gnl|my_center|LOCUS_02420 9286 9798 gene locus_tag LOCUS_02430 gene nuoE 9286 9798 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 protein_id gnl|my_center|LOCUS_02430 9798 11090 gene locus_tag LOCUS_02440 gene nuoF 9798 11090 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_02440 11159 13546 gene locus_tag LOCUS_02450 gene nuoG 11159 13546 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948472.1 protein_id gnl|my_center|LOCUS_02450 13539 14657 gene locus_tag LOCUS_02460 gene nuoH 13539 14657 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_02460 14657 15142 gene locus_tag LOCUS_02470 gene nuoI 14657 15142 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_02470 15159 15761 gene locus_tag LOCUS_02480 15159 15761 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_02480 15765 16070 gene locus_tag LOCUS_02490 gene nuoK 15765 16070 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_02490 16067 18034 gene locus_tag LOCUS_02500 gene nuoL 16067 18034 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930037.1 protein_id gnl|my_center|LOCUS_02500 18039 19568 gene locus_tag LOCUS_02510 18039 19568 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 protein_id gnl|my_center|LOCUS_02510 19568 21016 gene locus_tag LOCUS_02520 gene nuoN 19568 21016 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_02520 21045 21347 gene locus_tag LOCUS_02530 21045 21347 CDS product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526463.1 protein_id gnl|my_center|LOCUS_02530 22221 21385 gene locus_tag LOCUS_02540 22221 21385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 22884 22258 gene locus_tag LOCUS_02550 22884 22258 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105394.1 protein_id gnl|my_center|LOCUS_02550 24291 22891 gene locus_tag LOCUS_02560 gene nhaD 24291 22891 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_02560 <26618 24415 gene locus_tag LOCUS_02570 <26618 24415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:Calx-beta domain-containing protein >Feature sequence010 341 141 gene locus_tag LOCUS_02580 341 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 675 358 gene locus_tag LOCUS_02590 675 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 1019 678 gene locus_tag LOCUS_02600 1019 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 2047 1178 gene locus_tag LOCUS_02610 2047 1178 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035739.1 protein_id gnl|my_center|LOCUS_02610 2650 2099 gene locus_tag LOCUS_02620 gene ampD 2650 2099 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051592.1 protein_id gnl|my_center|LOCUS_02620 2744 3595 gene locus_tag LOCUS_02630 gene nadC 2744 3595 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707567.1 protein_id gnl|my_center|LOCUS_02630 3592 4926 gene locus_tag LOCUS_02640 3592 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 4936 5589 gene locus_tag LOCUS_02650 4936 5589 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_02650 5854 5600 gene locus_tag LOCUS_02660 5854 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 6941 5802 gene locus_tag LOCUS_02670 6941 5802 CDS product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196835716.1 protein_id gnl|my_center|LOCUS_02670 7099 6938 gene locus_tag LOCUS_02680 7099 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 7983 7348 gene locus_tag LOCUS_02690 7983 7348 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932402.1 protein_id gnl|my_center|LOCUS_02690 8187 9044 gene locus_tag LOCUS_02700 8187 9044 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_02700 10035 9046 gene locus_tag LOCUS_02710 10035 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 10232 10032 gene locus_tag LOCUS_02720 10232 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 11687 10248 gene locus_tag LOCUS_02730 11687 10248 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986686.1 protein_id gnl|my_center|LOCUS_02730 12799 11684 gene locus_tag LOCUS_02740 12799 11684 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887889.1 protein_id gnl|my_center|LOCUS_02740 14080 12890 gene locus_tag LOCUS_02750 14080 12890 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819167.1 protein_id gnl|my_center|LOCUS_02750 15423 14074 gene locus_tag LOCUS_02760 15423 14074 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040326.1 protein_id gnl|my_center|LOCUS_02760 16328 15420 gene locus_tag LOCUS_02770 gene dpsA 16328 15420 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460385.1 protein_id gnl|my_center|LOCUS_02770 17585 16494 gene locus_tag LOCUS_02780 17585 16494 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 protein_id gnl|my_center|LOCUS_02780 18739 17582 gene locus_tag LOCUS_02790 18739 17582 CDS product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015092.1 protein_id gnl|my_center|LOCUS_02790 19626 18868 gene locus_tag LOCUS_02800 19626 18868 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_02800 20984 19722 gene locus_tag LOCUS_02810 20984 19722 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013726.1 protein_id gnl|my_center|LOCUS_02810 21126 21401 gene locus_tag LOCUS_02820 21126 21401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 22566 23190 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23706 23533 gene locus_tag LOCUS_02830 23706 23533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 23870 25456 gene locus_tag LOCUS_02840 23870 25456 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 protein_id gnl|my_center|LOCUS_02840 26175 25465 gene locus_tag LOCUS_02850 26175 25465 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532980.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence011 1 141 gene locus_tag LOCUS_02860 1 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 144 644 gene locus_tag LOCUS_02870 144 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 724 2100 gene locus_tag LOCUS_02880 724 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 2119 2646 gene locus_tag LOCUS_02890 2119 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 2718 3179 gene locus_tag LOCUS_02900 2718 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 3181 3615 gene locus_tag LOCUS_02910 3181 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 3621 5195 gene locus_tag LOCUS_02920 3621 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 5256 7040 gene locus_tag LOCUS_02930 gene sctC 5256 7040 CDS product type III secretion system outer membrane ring subunit SctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176690.1 protein_id gnl|my_center|LOCUS_02930 7125 7358 gene locus_tag LOCUS_02940 7125 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 7411 8391 gene locus_tag LOCUS_02950 7411 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 9473 8430 gene locus_tag LOCUS_02960 gene vscU 9473 8430 CDS product SctU family type III secretion system export apparatus subunit VscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477705.1 protein_id gnl|my_center|LOCUS_02960 9652 11349 gene locus_tag LOCUS_02970 9652 11349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 11425 13740 gene locus_tag LOCUS_02980 11425 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 13747 15069 gene locus_tag LOCUS_02990 gene vscN 13747 15069 CDS product SctN family type III secretion system ATPase VscN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477722.1 protein_id gnl|my_center|LOCUS_02990 15095 15556 gene locus_tag LOCUS_03000 15095 15556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 15606 15678 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15918 16235 gene locus_tag LOCUS_03010 15918 16235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 16346 16933 gene locus_tag LOCUS_03020 16346 16933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 17085 18239 gene locus_tag LOCUS_03030 17085 18239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 18232 18891 gene locus_tag LOCUS_03040 gene vscR 18232 18891 CDS product SctR family type III secretion system export apparatus subunit VscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377232.1 protein_id gnl|my_center|LOCUS_03040 18896 19159 gene locus_tag LOCUS_03050 gene bscS 18896 19159 CDS product SctS family type III secretion system export apparatus subunit BscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447679.1 protein_id gnl|my_center|LOCUS_03050 19169 19945 gene locus_tag LOCUS_03060 gene pscT 19169 19945 CDS product SctT family type III secretion system export apparatus subunit PscT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114621.1 protein_id gnl|my_center|LOCUS_03060 21985 20048 gene locus_tag LOCUS_03070 21985 20048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 23792 22032 gene locus_tag LOCUS_03080 23792 22032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence012 185 658 gene locus_tag LOCUS_03090 gene phaR 185 658 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037439.1 protein_id gnl|my_center|LOCUS_03090 1286 723 gene locus_tag LOCUS_03100 1286 723 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243940.1 protein_id gnl|my_center|LOCUS_03100 2931 1414 gene locus_tag LOCUS_03110 gene purF 2931 1414 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381064.1 protein_id gnl|my_center|LOCUS_03110 3514 2954 gene locus_tag LOCUS_03120 3514 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 4043 3552 gene locus_tag LOCUS_03130 4043 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 5369 4053 gene locus_tag LOCUS_03140 gene folC 5369 4053 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039854.1 protein_id gnl|my_center|LOCUS_03140 6229 5369 gene locus_tag LOCUS_03150 gene accD 6229 5369 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706493.1 protein_id gnl|my_center|LOCUS_03150 7071 6226 gene locus_tag LOCUS_03160 gene trpA 7071 6226 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_03160 7893 7261 gene locus_tag LOCUS_03170 7893 7261 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_03170 8670 7909 gene locus_tag LOCUS_03180 gene truA 8670 7909 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368434.1 protein_id gnl|my_center|LOCUS_03180 10516 8762 gene locus_tag LOCUS_03190 10516 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 11659 10619 gene locus_tag LOCUS_03200 11659 10619 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948008.1 protein_id gnl|my_center|LOCUS_03200 12745 11669 gene locus_tag LOCUS_03210 gene leuB 12745 11669 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038427.1 protein_id gnl|my_center|LOCUS_03210 12882 13703 gene locus_tag LOCUS_03220 gene dapD 12882 13703 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186656.1 protein_id gnl|my_center|LOCUS_03220 14293 13751 gene locus_tag LOCUS_03230 gene orn 14293 13751 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_03230 14379 15614 gene locus_tag LOCUS_03240 14379 15614 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039491.1 protein_id gnl|my_center|LOCUS_03240 16337 15711 gene locus_tag LOCUS_03250 gene recR 16337 15711 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087237.1 protein_id gnl|my_center|LOCUS_03250 16717 16394 gene locus_tag LOCUS_03260 16717 16394 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706069.1 protein_id gnl|my_center|LOCUS_03260 18515 16794 gene locus_tag LOCUS_03270 18515 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 18881 19831 gene locus_tag LOCUS_03280 gene paaA 18881 19831 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_03280 19841 20125 gene locus_tag LOCUS_03290 gene paaB 19841 20125 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_03290 20171 20923 gene locus_tag LOCUS_03300 gene paaC 20171 20923 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329397.1 protein_id gnl|my_center|LOCUS_03300 20923 21504 gene locus_tag LOCUS_03310 gene paaJ 20923 21504 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_03310 21495 22580 gene locus_tag LOCUS_03320 gene paaK 21495 22580 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329395.1 protein_id gnl|my_center|LOCUS_03320 22816 23013 gene locus_tag LOCUS_03330 22816 23013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 23010 23927 gene locus_tag LOCUS_03340 gene paaX 23010 23927 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931077.1 protein_id gnl|my_center|LOCUS_03340 24064 24291 gene locus_tag LOCUS_03350 24064 24291 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403888.1 protein_id gnl|my_center|LOCUS_03350 24275 24628 gene locus_tag LOCUS_03360 24275 24628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 >Feature sequence013 <1 710 gene locus_tag LOCUS_03370 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639931.1:amidohydrolase family protein note possible pseudo, frameshifted 626 991 gene locus_tag LOCUS_03380 626 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03380 995 2353 gene locus_tag LOCUS_03390 995 2353 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_03390 2359 3534 gene locus_tag LOCUS_03400 2359 3534 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405167.1 protein_id gnl|my_center|LOCUS_03400 3640 3834 gene locus_tag LOCUS_03410 3640 3834 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971328.1 protein_id gnl|my_center|LOCUS_03410 3831 4220 gene locus_tag LOCUS_03420 3831 4220 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_03420 4217 4429 gene locus_tag LOCUS_03430 4217 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 6627 4717 gene locus_tag LOCUS_03440 6627 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 7781 6624 gene locus_tag LOCUS_03450 7781 6624 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_03450 10479 7774 gene locus_tag LOCUS_03460 10479 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 10907 12376 gene locus_tag LOCUS_03470 10907 12376 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_03470 12366 13055 gene locus_tag LOCUS_03480 12366 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 13058 14839 gene locus_tag LOCUS_03490 13058 14839 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_03490 14836 16041 gene locus_tag LOCUS_03500 14836 16041 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387875.1 protein_id gnl|my_center|LOCUS_03500 16013 17686 gene locus_tag LOCUS_03510 16013 17686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 17676 18290 gene locus_tag LOCUS_03520 17676 18290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 18386 18910 gene locus_tag LOCUS_03530 18386 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 18907 21891 gene locus_tag LOCUS_03540 18907 21891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 19866 19942 gene locus_tag LOCUS_t00010 19866 19942 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21913 22662 gene locus_tag LOCUS_03550 21913 22662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 22737 23426 gene locus_tag LOCUS_03560 22737 23426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 23432 24133 gene locus_tag LOCUS_03570 23432 24133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence014 3 2789 gene locus_tag LOCUS_03580 3 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 2885 5203 gene locus_tag LOCUS_03590 gene bamA 2885 5203 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 protein_id gnl|my_center|LOCUS_03590 5261 5779 gene locus_tag LOCUS_03600 5261 5779 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_03600 5806 6819 gene locus_tag LOCUS_03610 gene lpxD 5806 6819 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036555.1 protein_id gnl|my_center|LOCUS_03610 6888 7337 gene locus_tag LOCUS_03620 gene fabZ 6888 7337 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_03620 7334 8107 gene locus_tag LOCUS_03630 gene lpxA 7334 8107 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690038.1 protein_id gnl|my_center|LOCUS_03630 8104 9234 gene locus_tag LOCUS_03640 gene lpxB 8104 9234 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262425.1 protein_id gnl|my_center|LOCUS_03640 9254 9904 gene locus_tag LOCUS_03650 gene rnhB 9254 9904 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_03650 9886 13380 gene locus_tag LOCUS_03660 gene dnaE 9886 13380 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946697.1 protein_id gnl|my_center|LOCUS_03660 13377 14348 gene locus_tag LOCUS_03670 gene accA 13377 14348 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_03670 14436 15410 gene locus_tag LOCUS_03680 14436 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 16740 15421 gene locus_tag LOCUS_03690 16740 15421 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_03690 16875 17906 gene locus_tag LOCUS_03700 gene argC 16875 17906 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_03700 17938 18660 gene locus_tag LOCUS_03710 17938 18660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 18650 19078 gene locus_tag LOCUS_03720 18650 19078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 19290 19871 gene locus_tag LOCUS_03730 19290 19871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 19868 20866 gene locus_tag LOCUS_03740 19868 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 21217 21570 gene locus_tag LOCUS_03750 gene erpA 21217 21570 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_03750 22667 21567 gene locus_tag LOCUS_03760 22667 21567 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence015 1488 169 gene locus_tag LOCUS_03770 1488 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 2164 1640 gene locus_tag LOCUS_03780 2164 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 2988 2659 gene locus_tag LOCUS_03790 2988 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 3982 3158 gene locus_tag LOCUS_03800 3982 3158 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311402.1 protein_id gnl|my_center|LOCUS_03800 3997 4635 gene locus_tag LOCUS_03810 3997 4635 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_03810 4660 5409 gene locus_tag LOCUS_03820 4660 5409 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_03820 6472 5669 gene locus_tag LOCUS_03830 6472 5669 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257230.1 protein_id gnl|my_center|LOCUS_03830 6636 7400 gene locus_tag LOCUS_03840 6636 7400 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 protein_id gnl|my_center|LOCUS_03840 8659 7457 gene locus_tag LOCUS_03850 8659 7457 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_03850 8788 9822 gene locus_tag LOCUS_03860 8788 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 10365 11048 gene locus_tag LOCUS_03870 10365 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 11793 11152 gene locus_tag LOCUS_03880 11793 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 12076 11837 gene locus_tag LOCUS_03890 12076 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 12330 12761 gene locus_tag LOCUS_03900 12330 12761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 12907 13725 gene locus_tag LOCUS_03910 gene atpB 12907 13725 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114072.1 protein_id gnl|my_center|LOCUS_03910 13753 14052 gene locus_tag LOCUS_03920 gene atpE 13753 14052 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450922.1 protein_id gnl|my_center|LOCUS_03920 14058 14528 gene locus_tag LOCUS_03930 gene atpF 14058 14528 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884340.1 protein_id gnl|my_center|LOCUS_03930 14539 15078 gene locus_tag LOCUS_03940 14539 15078 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_03940 15200 16741 gene locus_tag LOCUS_03950 gene atpA 15200 16741 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_03950 16758 17621 gene locus_tag LOCUS_03960 gene atpG 16758 17621 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_03960 17662 19065 gene locus_tag LOCUS_03970 gene atpD 17662 19065 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 protein_id gnl|my_center|LOCUS_03970 19075 19500 gene locus_tag LOCUS_03980 19075 19500 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035802.1 protein_id gnl|my_center|LOCUS_03980 19580 20911 gene locus_tag LOCUS_03990 gene glmU 19580 20911 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421582.1 protein_id gnl|my_center|LOCUS_03990 20984 21460 gene locus_tag LOCUS_04000 gene rraA 20984 21460 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731282.1 protein_id gnl|my_center|LOCUS_04000 21866 21468 gene locus_tag LOCUS_04010 21866 21468 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969348.1 protein_id gnl|my_center|LOCUS_04010 22095 21853 gene locus_tag LOCUS_04020 22095 21853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 >Feature sequence016 204 1028 gene locus_tag LOCUS_04030 gene mazG 204 1028 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537451.1 protein_id gnl|my_center|LOCUS_04030 1238 1056 gene locus_tag LOCUS_04040 1238 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 2146 1256 gene locus_tag LOCUS_04050 2146 1256 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_04050 2504 2163 gene locus_tag LOCUS_04060 2504 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2626 3045 gene locus_tag LOCUS_04070 2626 3045 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_04070 3178 4521 gene locus_tag LOCUS_04080 3178 4521 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_04080 4600 5196 gene locus_tag LOCUS_04090 4600 5196 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_04090 5265 7151 gene locus_tag LOCUS_04100 gene parE 5265 7151 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_04100 7349 9859 gene locus_tag LOCUS_04110 7349 9859 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038375.1 protein_id gnl|my_center|LOCUS_04110 10090 12354 gene locus_tag LOCUS_04120 10090 12354 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265751.1 protein_id gnl|my_center|LOCUS_04120 12412 14460 gene locus_tag LOCUS_04130 12412 14460 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538146.1 protein_id gnl|my_center|LOCUS_04130 14466 16175 gene locus_tag LOCUS_04140 14466 16175 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_04140 16165 17124 gene locus_tag LOCUS_04150 16165 17124 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_04150 17121 18647 gene locus_tag LOCUS_04160 17121 18647 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919562.1 protein_id gnl|my_center|LOCUS_04160 21749 18633 gene locus_tag LOCUS_04170 gene putA 21749 18633 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_04170 21926 22390 gene locus_tag LOCUS_04180 gene lrp 21926 22390 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162770.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence017 1608 265 gene locus_tag LOCUS_04190 1608 265 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899017.1 protein_id gnl|my_center|LOCUS_04190 4091 1743 gene locus_tag LOCUS_04200 4091 1743 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920256.1 protein_id gnl|my_center|LOCUS_04200 4283 4942 gene locus_tag LOCUS_04210 4283 4942 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_04210 6190 4994 gene locus_tag LOCUS_04220 6190 4994 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_04220 6698 6228 gene locus_tag LOCUS_04230 6698 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 8979 6814 gene locus_tag LOCUS_04240 8979 6814 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532900.1 protein_id gnl|my_center|LOCUS_04240 9458 8979 gene locus_tag LOCUS_04250 9458 8979 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940875.1 protein_id gnl|my_center|LOCUS_04250 10200 9541 gene locus_tag LOCUS_04260 10200 9541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 10454 10717 gene locus_tag LOCUS_04270 10454 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 11536 10760 gene locus_tag LOCUS_04280 11536 10760 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_04280 12455 11526 gene locus_tag LOCUS_04290 12455 11526 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707287.1 protein_id gnl|my_center|LOCUS_04290 12857 12477 gene locus_tag LOCUS_04300 12857 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 13148 13816 gene locus_tag LOCUS_04310 gene lipB 13148 13816 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038550.1 protein_id gnl|my_center|LOCUS_04310 14239 14676 gene locus_tag LOCUS_04320 14239 14676 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970913.1 protein_id gnl|my_center|LOCUS_04320 14743 15210 gene locus_tag LOCUS_04330 14743 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 15322 16287 gene locus_tag LOCUS_04340 gene lipA 15322 16287 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688622.1 protein_id gnl|my_center|LOCUS_04340 16530 16210 gene locus_tag LOCUS_04350 16530 16210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 17212 16955 gene locus_tag LOCUS_04360 17212 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 18777 17422 gene locus_tag LOCUS_04370 gene xseA 18777 17422 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_04370 18872 20332 gene locus_tag LOCUS_04380 gene guaB 18872 20332 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947450.1 protein_id gnl|my_center|LOCUS_04380 >Feature sequence018 801 1802 gene locus_tag LOCUS_04390 801 1802 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_04390 2324 2972 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3025 3513 gene locus_tag LOCUS_04400 3025 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 3538 3762 gene locus_tag LOCUS_04410 gene rpsR 3538 3762 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_04410 3856 4770 gene locus_tag LOCUS_04420 3856 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957858.1 protein_id gnl|my_center|LOCUS_04420 4928 5392 gene locus_tag LOCUS_04430 gene rplI 4928 5392 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421134.1 protein_id gnl|my_center|LOCUS_04430 5701 6013 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6787 7899 gene locus_tag LOCUS_04440 gene alr 6787 7899 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772336.1 protein_id gnl|my_center|LOCUS_04440 8000 9235 gene locus_tag LOCUS_04450 gene radA 8000 9235 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094867.1 protein_id gnl|my_center|LOCUS_04450 10453 9332 gene locus_tag LOCUS_04460 10453 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 10579 12009 gene locus_tag LOCUS_04470 gene leuC 10579 12009 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091399.1 protein_id gnl|my_center|LOCUS_04470 12015 12662 gene locus_tag LOCUS_04480 gene leuD 12015 12662 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_04480 13989 14230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15668 14364 gene locus_tag LOCUS_04490 15668 14364 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_04490 16141 16725 gene locus_tag LOCUS_04500 gene msrA 16141 16725 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_04500 17292 16747 gene locus_tag LOCUS_04510 17292 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 17404 17859 gene locus_tag LOCUS_04520 17404 17859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 19180 17801 gene locus_tag LOCUS_04530 gene mtaB 19180 17801 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_04530 19094 19276 gene locus_tag LOCUS_04540 19094 19276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 20501 19344 gene locus_tag LOCUS_04550 20501 19344 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183845.1 protein_id gnl|my_center|LOCUS_04550 >Feature sequence019 610 534 gene locus_tag LOCUS_t00020 610 534 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1025 669 gene locus_tag LOCUS_04560 1025 669 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_04560 1308 1003 gene locus_tag LOCUS_04570 gene ihfA 1308 1003 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 protein_id gnl|my_center|LOCUS_04570 3421 1331 gene locus_tag LOCUS_04580 gene pheT 3421 1331 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103972.1 protein_id gnl|my_center|LOCUS_04580 4410 3418 gene locus_tag LOCUS_04590 gene pheS 4410 3418 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706167.1 protein_id gnl|my_center|LOCUS_04590 4789 4436 gene locus_tag LOCUS_04600 gene rplT 4789 4436 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_04600 4999 4802 gene locus_tag LOCUS_04610 gene rpmI 4999 4802 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596065.1 protein_id gnl|my_center|LOCUS_04610 5598 5107 gene locus_tag LOCUS_04620 gene infC 5598 5107 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119938.1 protein_id gnl|my_center|LOCUS_04620 7605 5695 gene locus_tag LOCUS_04630 gene thrS 7605 5695 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443963.1 protein_id gnl|my_center|LOCUS_04630 7850 7774 gene locus_tag LOCUS_t00030 7850 7774 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11384 7881 gene locus_tag LOCUS_04640 11384 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 9759 9927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13485 11431 gene locus_tag LOCUS_04650 gene uvrB 13485 11431 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957630.1 protein_id gnl|my_center|LOCUS_04650 13550 14941 gene locus_tag LOCUS_04660 13550 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 16427 14907 gene locus_tag LOCUS_04670 16427 14907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 17805 16411 gene locus_tag LOCUS_04680 gene noeA 17805 16411 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967406.1 protein_id gnl|my_center|LOCUS_04680 18034 17798 gene locus_tag LOCUS_04690 18034 17798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 18590 19318 gene locus_tag LOCUS_04700 18590 19318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 19306 20643 gene locus_tag LOCUS_04710 19306 20643 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061510.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence020 1361 180 gene locus_tag LOCUS_04720 1361 180 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_04720 2871 1447 gene locus_tag LOCUS_04730 gene lpdA 2871 1447 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382001.1 protein_id gnl|my_center|LOCUS_04730 4390 2888 gene locus_tag LOCUS_04740 gene odhB 4390 2888 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521670.1 protein_id gnl|my_center|LOCUS_04740 7382 4422 gene locus_tag LOCUS_04750 7382 4422 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207474.1 protein_id gnl|my_center|LOCUS_04750 7517 8809 gene locus_tag LOCUS_04760 gene gltA 7517 8809 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328205.1 protein_id gnl|my_center|LOCUS_04760 8811 9788 gene locus_tag LOCUS_04770 8811 9788 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_04770 9971 10483 gene locus_tag LOCUS_04780 gene rppH 9971 10483 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071540.1 protein_id gnl|my_center|LOCUS_04780 10877 10512 gene locus_tag LOCUS_04790 10877 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 11373 10897 gene locus_tag LOCUS_04800 11373 10897 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_04800 11667 11473 gene locus_tag LOCUS_04810 11667 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 11804 13153 gene locus_tag LOCUS_04820 gene mpl 11804 13153 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 protein_id gnl|my_center|LOCUS_04820 13153 13758 gene locus_tag LOCUS_04830 13153 13758 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038391.1 protein_id gnl|my_center|LOCUS_04830 13759 14403 gene locus_tag LOCUS_04840 13759 14403 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_04840 14379 15071 gene locus_tag LOCUS_04850 gene nth 14379 15071 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210602.1 protein_id gnl|my_center|LOCUS_04850 15077 19138 gene locus_tag LOCUS_04860 15077 19138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 20031 19450 gene locus_tag LOCUS_04870 20031 19450 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703843.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence021 1253 588 gene locus_tag LOCUS_04880 gene bioD 1253 588 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704797.1 protein_id gnl|my_center|LOCUS_04880 1657 1250 gene locus_tag LOCUS_04890 1657 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 1691 1923 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3312 2131 gene locus_tag LOCUS_04900 gene bioF 3312 2131 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 protein_id gnl|my_center|LOCUS_04900 4376 3312 gene locus_tag LOCUS_04910 gene bioB 4376 3312 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072679.1 protein_id gnl|my_center|LOCUS_04910 4258 4476 gene locus_tag LOCUS_04920 4258 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 4476 5183 gene locus_tag LOCUS_04930 4476 5183 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 protein_id gnl|my_center|LOCUS_04930 5500 5743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8357 7641 gene locus_tag LOCUS_04940 8357 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 9885 8443 gene locus_tag LOCUS_04950 9885 8443 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_04950 9993 11261 gene locus_tag LOCUS_04960 9993 11261 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_04960 11923 11291 gene locus_tag LOCUS_04970 gene dsbA 11923 11291 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_04970 13089 11923 gene locus_tag LOCUS_04980 gene ccsB 13089 11923 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197914.1 protein_id gnl|my_center|LOCUS_04980 13561 13983 gene locus_tag LOCUS_04990 13561 13983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 14120 15331 gene locus_tag LOCUS_05000 14120 15331 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_05000 17350 15350 gene locus_tag LOCUS_05010 17350 15350 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033909628.1 protein_id gnl|my_center|LOCUS_05010 18092 17490 gene locus_tag LOCUS_05020 18092 17490 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 protein_id gnl|my_center|LOCUS_05020 18082 18810 gene locus_tag LOCUS_05030 gene yihA 18082 18810 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945886.1 protein_id gnl|my_center|LOCUS_05030 18122 18193 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence022 1714 50 gene locus_tag LOCUS_05040 1714 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 2958 1711 gene locus_tag LOCUS_05050 2958 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 5636 2958 gene locus_tag LOCUS_05060 5636 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 5739 6083 gene locus_tag LOCUS_05070 5739 6083 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_05070 6080 6373 gene locus_tag LOCUS_05080 6080 6373 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388057.1 protein_id gnl|my_center|LOCUS_05080 9591 6706 gene locus_tag LOCUS_05090 gene uvrA 9591 6706 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_05090 9810 9613 gene locus_tag LOCUS_05100 9810 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 9882 10352 gene locus_tag LOCUS_05110 gene ssb 9882 10352 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_05110 10558 13374 gene locus_tag LOCUS_05120 10558 13374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 13943 13443 gene locus_tag LOCUS_05130 13943 13443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 14271 14612 gene locus_tag LOCUS_05140 14271 14612 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871778.1 protein_id gnl|my_center|LOCUS_05140 15161 14655 gene locus_tag LOCUS_05150 15161 14655 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267699.1 protein_id gnl|my_center|LOCUS_05150 16842 15148 gene locus_tag LOCUS_05160 16842 15148 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396332.1 protein_id gnl|my_center|LOCUS_05160 19008 16963 gene locus_tag LOCUS_05170 gene fusA 19008 16963 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence023 2535 742 gene locus_tag LOCUS_05180 gene sdhA 2535 742 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388959.1 protein_id gnl|my_center|LOCUS_05180 2838 2539 gene locus_tag LOCUS_05190 2838 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3263 2883 gene locus_tag LOCUS_05200 gene sdhC 3263 2883 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597166.1 protein_id gnl|my_center|LOCUS_05200 4388 3348 gene locus_tag LOCUS_05210 4388 3348 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060992239.1 protein_id gnl|my_center|LOCUS_05210 4578 4375 gene locus_tag LOCUS_05220 4578 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 4967 4716 gene locus_tag LOCUS_05230 4967 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 4854 5093 gene locus_tag LOCUS_05240 4854 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 5189 5533 gene locus_tag LOCUS_05250 gene uraH 5189 5533 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087207.1 protein_id gnl|my_center|LOCUS_05250 5553 7058 gene locus_tag LOCUS_05260 gene xdhA 5553 7058 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207271.1 protein_id gnl|my_center|LOCUS_05260 7046 9412 gene locus_tag LOCUS_05270 gene xdhB 7046 9412 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920472.1 protein_id gnl|my_center|LOCUS_05270 9429 10523 gene locus_tag LOCUS_05280 9429 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 9937 9957 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10529 11794 gene locus_tag LOCUS_05290 10529 11794 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083321.1 protein_id gnl|my_center|LOCUS_05290 12136 11885 gene locus_tag LOCUS_05300 12136 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 12149 12343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13905 12439 gene locus_tag LOCUS_05310 gene guaB 13905 12439 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227931.1 protein_id gnl|my_center|LOCUS_05310 16928 13989 gene locus_tag LOCUS_05320 16928 13989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 <18997 16933 gene locus_tag LOCUS_05330 <18997 16933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814910.1:NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit >Feature sequence024 1237 5 gene locus_tag LOCUS_05340 1237 5 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926104.1 protein_id gnl|my_center|LOCUS_05340 1280 2164 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2372 2926 gene locus_tag LOCUS_05350 2372 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2923 4494 gene locus_tag LOCUS_05360 2923 4494 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902740.1 protein_id gnl|my_center|LOCUS_05360 4654 5247 gene locus_tag LOCUS_05370 4654 5247 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 protein_id gnl|my_center|LOCUS_05370 5481 6026 gene locus_tag LOCUS_05380 5481 6026 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073239.1 protein_id gnl|my_center|LOCUS_05380 7424 6045 gene locus_tag LOCUS_05390 7424 6045 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_05390 7846 8937 gene locus_tag LOCUS_05400 gene gcvT 7846 8937 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390799.1 protein_id gnl|my_center|LOCUS_05400 8987 11878 gene locus_tag LOCUS_05410 gene gcvP 8987 11878 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967189.1 protein_id gnl|my_center|LOCUS_05410 12753 11896 gene locus_tag LOCUS_05420 gene rsmI 12753 11896 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_05420 12796 14379 gene locus_tag LOCUS_05430 12796 14379 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_05430 14405 14737 gene locus_tag LOCUS_05440 14405 14737 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024665649.1 protein_id gnl|my_center|LOCUS_05440 14746 15339 gene locus_tag LOCUS_05450 14746 15339 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770434.1 protein_id gnl|my_center|LOCUS_05450 15336 15950 gene locus_tag LOCUS_05460 gene dolP 15336 15950 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818900.1 protein_id gnl|my_center|LOCUS_05460 16707 16069 gene locus_tag LOCUS_05470 gene sspA 16707 16069 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257304.1 protein_id gnl|my_center|LOCUS_05470 17489 16704 gene locus_tag LOCUS_05480 17489 16704 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_05480 18793 17570 gene locus_tag LOCUS_05490 18793 17570 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence025 359 269 gene locus_tag LOCUS_t00040 359 269 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2177 459 gene locus_tag LOCUS_05500 2177 459 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 protein_id gnl|my_center|LOCUS_05500 2327 2653 gene locus_tag LOCUS_05510 2327 2653 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376591.1 protein_id gnl|my_center|LOCUS_05510 2801 3955 gene locus_tag LOCUS_05520 2801 3955 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813554.1 protein_id gnl|my_center|LOCUS_05520 5157 4006 gene locus_tag LOCUS_05530 5157 4006 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113490.1 protein_id gnl|my_center|LOCUS_05530 6901 5162 gene locus_tag LOCUS_05540 6901 5162 CDS product di-heme-cytochrome C peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114647.1 protein_id gnl|my_center|LOCUS_05540 8517 7138 gene locus_tag LOCUS_05550 8517 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 8649 9587 gene locus_tag LOCUS_05560 8649 9587 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_05560 9574 10257 gene locus_tag LOCUS_05570 gene aat 9574 10257 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_05570 10367 10585 gene locus_tag LOCUS_05580 gene infA 10367 10585 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 protein_id gnl|my_center|LOCUS_05580 11292 10570 gene locus_tag LOCUS_05590 gene kdsB 11292 10570 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770642.1 protein_id gnl|my_center|LOCUS_05590 11498 11307 gene locus_tag LOCUS_05600 11498 11307 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221286.1 protein_id gnl|my_center|LOCUS_05600 12486 11491 gene locus_tag LOCUS_05610 gene lpxK 12486 11491 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037270.1 protein_id gnl|my_center|LOCUS_05610 12966 12547 gene locus_tag LOCUS_05620 12966 12547 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931122.1 protein_id gnl|my_center|LOCUS_05620 13571 12963 gene locus_tag LOCUS_05630 13571 12963 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_05630 13719 13489 gene locus_tag LOCUS_05640 13719 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 13678 14223 gene locus_tag LOCUS_05650 13678 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 14345 15079 gene locus_tag LOCUS_05660 14345 15079 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088432.1 protein_id gnl|my_center|LOCUS_05660 15095 15685 gene locus_tag LOCUS_05670 15095 15685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088431.1 protein_id gnl|my_center|LOCUS_05670 15746 16267 gene locus_tag LOCUS_05680 15746 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 17161 16319 gene locus_tag LOCUS_05690 17161 16319 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772043.1 protein_id gnl|my_center|LOCUS_05690 <18837 17291 gene locus_tag LOCUS_05700 <18837 17291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037788.1:TonB-dependent receptor >Feature sequence026 80 1141 gene locus_tag LOCUS_05710 gene nagZ 80 1141 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810348.1 protein_id gnl|my_center|LOCUS_05710 1125 2042 gene locus_tag LOCUS_05720 1125 2042 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528856.1 protein_id gnl|my_center|LOCUS_05720 2053 3162 gene locus_tag LOCUS_05730 2053 3162 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_05730 3166 3993 gene locus_tag LOCUS_05740 gene dapF 3166 3993 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038015413.1 protein_id gnl|my_center|LOCUS_05740 4036 4728 gene locus_tag LOCUS_05750 4036 4728 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_05750 4716 5618 gene locus_tag LOCUS_05760 gene xerC 4716 5618 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704449.1 protein_id gnl|my_center|LOCUS_05760 5909 5631 gene locus_tag LOCUS_05770 5909 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 6472 5999 gene locus_tag LOCUS_05780 gene smpB 6472 5999 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948526.1 protein_id gnl|my_center|LOCUS_05780 6601 7968 gene locus_tag LOCUS_05790 6601 7968 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_05790 7983 8276 gene locus_tag LOCUS_05800 7983 8276 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918351.1 protein_id gnl|my_center|LOCUS_05800 8276 9295 gene locus_tag LOCUS_05810 8276 9295 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_05810 9402 10163 gene locus_tag LOCUS_05820 gene fepC 9402 10163 CDS product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140620.1 protein_id gnl|my_center|LOCUS_05820 10738 10211 gene locus_tag LOCUS_05830 10738 10211 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400155.1 protein_id gnl|my_center|LOCUS_05830 10872 11273 gene locus_tag LOCUS_05840 gene fur 10872 11273 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555142.1 protein_id gnl|my_center|LOCUS_05840 11342 12403 gene locus_tag LOCUS_05850 gene cobT 11342 12403 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 protein_id gnl|my_center|LOCUS_05850 12420 13220 gene locus_tag LOCUS_05860 gene cobS 12420 13220 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_05860 13220 14221 gene locus_tag LOCUS_05870 gene cbiB 13220 14221 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258432.1 protein_id gnl|my_center|LOCUS_05870 14223 15311 gene locus_tag LOCUS_05880 14223 15311 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258420.1 protein_id gnl|my_center|LOCUS_05880 15301 15870 gene locus_tag LOCUS_05890 gene cobU 15301 15870 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258421.1 protein_id gnl|my_center|LOCUS_05890 16721 15882 gene locus_tag LOCUS_05900 16721 15882 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_05900 16939 18381 gene locus_tag LOCUS_05910 16939 18381 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112353.1 protein_id gnl|my_center|LOCUS_05910 >Feature sequence027 682 233 gene locus_tag LOCUS_05920 682 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 1865 1200 gene locus_tag LOCUS_05930 1865 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 2013 2327 gene locus_tag LOCUS_05940 2013 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 3517 2366 gene locus_tag LOCUS_05950 3517 2366 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_05950 3971 3684 gene locus_tag LOCUS_05960 3971 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 4195 7020 gene locus_tag LOCUS_05970 4195 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 8691 7201 gene locus_tag LOCUS_05980 8691 7201 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 protein_id gnl|my_center|LOCUS_05980 9188 8844 gene locus_tag LOCUS_05990 9188 8844 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811313.1 protein_id gnl|my_center|LOCUS_05990 9766 9182 gene locus_tag LOCUS_06000 9766 9182 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729910.1 protein_id gnl|my_center|LOCUS_06000 11219 9768 gene locus_tag LOCUS_06010 11219 9768 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 protein_id gnl|my_center|LOCUS_06010 12630 11257 gene locus_tag LOCUS_06020 gene trkA 12630 11257 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_06020 13982 12627 gene locus_tag LOCUS_06030 13982 12627 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941477.1 protein_id gnl|my_center|LOCUS_06030 16192 13979 gene locus_tag LOCUS_06040 16192 13979 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_06040 16743 16189 gene locus_tag LOCUS_06050 16743 16189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 16911 17192 gene locus_tag LOCUS_06060 16911 17192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 17192 17476 gene locus_tag LOCUS_06070 17192 17476 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173685.1 protein_id gnl|my_center|LOCUS_06070 17473 17835 gene locus_tag LOCUS_06080 17473 17835 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence028 277 1155 gene locus_tag LOCUS_06090 277 1155 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 protein_id gnl|my_center|LOCUS_06090 1152 4544 gene locus_tag LOCUS_06100 1152 4544 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_06100 4541 6067 gene locus_tag LOCUS_06110 4541 6067 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_06110 6064 7200 gene locus_tag LOCUS_06120 6064 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 7660 7247 gene locus_tag LOCUS_06130 7660 7247 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651037.1 protein_id gnl|my_center|LOCUS_06130 8068 7667 gene locus_tag LOCUS_06140 8068 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 9288 8158 gene locus_tag LOCUS_06150 gene dapE 9288 8158 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225058.1 protein_id gnl|my_center|LOCUS_06150 9945 9421 gene locus_tag LOCUS_06160 9945 9421 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261907.1 protein_id gnl|my_center|LOCUS_06160 11320 9947 gene locus_tag LOCUS_06170 gene ccoG 11320 9947 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_06170 11666 11421 gene locus_tag LOCUS_06180 11666 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 12582 11674 gene locus_tag LOCUS_06190 gene ccoP 12582 11674 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930775.1 protein_id gnl|my_center|LOCUS_06190 12730 12575 gene locus_tag LOCUS_06200 12730 12575 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087314.1 protein_id gnl|my_center|LOCUS_06200 13347 12733 gene locus_tag LOCUS_06210 gene ccoO 13347 12733 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_06210 14797 13361 gene locus_tag LOCUS_06220 gene ccoN 14797 13361 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_06220 15385 14837 gene locus_tag LOCUS_06230 15385 14837 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262566.1 protein_id gnl|my_center|LOCUS_06230 15484 17754 gene locus_tag LOCUS_06240 15484 17754 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_06240 17754 17933 gene locus_tag LOCUS_06250 17754 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence029 245 254 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 409 912 gene locus_tag LOCUS_06260 409 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 5172 1009 gene locus_tag LOCUS_06270 gene purL 5172 1009 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211561.1 protein_id gnl|my_center|LOCUS_06270 6592 5204 gene locus_tag LOCUS_06280 gene purB 6592 5204 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705315.1 protein_id gnl|my_center|LOCUS_06280 7677 6592 gene locus_tag LOCUS_06290 7677 6592 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 protein_id gnl|my_center|LOCUS_06290 7676 8716 gene locus_tag LOCUS_06300 gene pyrC 7676 8716 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112889.1 protein_id gnl|my_center|LOCUS_06300 8713 9330 gene locus_tag LOCUS_06310 gene rnt 8713 9330 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_06310 9419 12055 gene locus_tag LOCUS_06320 gene gyrA 9419 12055 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_06320 12015 13148 gene locus_tag LOCUS_06330 gene serC 12015 13148 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393775.1 protein_id gnl|my_center|LOCUS_06330 13218 14303 gene locus_tag LOCUS_06340 gene pheA 13218 14303 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 protein_id gnl|my_center|LOCUS_06340 14360 15481 gene locus_tag LOCUS_06350 gene hisC 14360 15481 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_06350 15494 16372 gene locus_tag LOCUS_06360 15494 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence030 1206 556 gene locus_tag LOCUS_06370 1206 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 1655 1203 gene locus_tag LOCUS_06380 1655 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2102 1659 gene locus_tag LOCUS_06390 2102 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 3161 2127 gene locus_tag LOCUS_06400 3161 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 4770 3145 gene locus_tag LOCUS_06410 4770 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 5571 4774 gene locus_tag LOCUS_06420 5571 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 6745 5573 gene locus_tag LOCUS_06430 6745 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 8304 6742 gene locus_tag LOCUS_06440 8304 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 9253 8282 gene locus_tag LOCUS_06450 9253 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 10629 9301 gene locus_tag LOCUS_06460 10629 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 11483 10635 gene locus_tag LOCUS_06470 11483 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 12210 11470 gene locus_tag LOCUS_06480 12210 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 13195 12215 gene locus_tag LOCUS_06490 13195 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 14043 13195 gene locus_tag LOCUS_06500 14043 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 16553 14040 gene locus_tag LOCUS_06510 16553 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 17320 16763 gene locus_tag LOCUS_06520 17320 16763 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947530.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence031 1126 251 gene locus_tag LOCUS_06530 1126 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 1956 1123 gene locus_tag LOCUS_06540 1956 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3291 1963 gene locus_tag LOCUS_06550 3291 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 3466 3837 gene locus_tag LOCUS_06560 3466 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 4948 3944 gene locus_tag LOCUS_06570 4948 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 6632 5652 gene locus_tag LOCUS_06580 6632 5652 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 protein_id gnl|my_center|LOCUS_06580 8196 6817 gene locus_tag LOCUS_06590 8196 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 9336 8398 gene locus_tag LOCUS_06600 9336 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 10851 9385 gene locus_tag LOCUS_06610 gene mnmE 10851 9385 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981435.1 protein_id gnl|my_center|LOCUS_06610 12503 10854 gene locus_tag LOCUS_06620 gene yidC 12503 10854 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 protein_id gnl|my_center|LOCUS_06620 12762 12535 gene locus_tag LOCUS_06630 gene yidD 12762 12535 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141911.1 protein_id gnl|my_center|LOCUS_06630 12880 13068 gene locus_tag LOCUS_06640 12880 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 13446 14762 gene locus_tag LOCUS_06650 gene dnaA 13446 14762 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769932.1 protein_id gnl|my_center|LOCUS_06650 14819 15529 gene locus_tag LOCUS_06660 gene phoB 14819 15529 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113933.1 protein_id gnl|my_center|LOCUS_06660 15545 16858 gene locus_tag LOCUS_06670 gene phoR 15545 16858 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460158.1 protein_id gnl|my_center|LOCUS_06670 16935 17153 gene locus_tag LOCUS_06680 16935 17153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence032 80 4657 gene locus_tag LOCUS_06690 gene gltB 80 4657 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_06690 4663 6111 gene locus_tag LOCUS_06700 4663 6111 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_06700 6144 7061 gene locus_tag LOCUS_06710 6144 7061 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530631.1 protein_id gnl|my_center|LOCUS_06710 7191 7409 gene locus_tag LOCUS_06720 7191 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 7833 7534 gene locus_tag LOCUS_06730 7833 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 7848 7887 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7971 9488 gene locus_tag LOCUS_06740 7971 9488 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921534.1 protein_id gnl|my_center|LOCUS_06740 10027 9602 gene locus_tag LOCUS_06750 10027 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 10227 11297 gene locus_tag LOCUS_06760 gene hemE 10227 11297 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114569.1 protein_id gnl|my_center|LOCUS_06760 11287 12168 gene locus_tag LOCUS_06770 11287 12168 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 protein_id gnl|my_center|LOCUS_06770 13672 12143 gene locus_tag LOCUS_06780 gene lnt 13672 12143 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089648.1 protein_id gnl|my_center|LOCUS_06780 14495 13635 gene locus_tag LOCUS_06790 14495 13635 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368790.1 protein_id gnl|my_center|LOCUS_06790 15008 14499 gene locus_tag LOCUS_06800 gene ybeY 15008 14499 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399800.1 protein_id gnl|my_center|LOCUS_06800 15957 14980 gene locus_tag LOCUS_06810 15957 14980 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065624607.1 protein_id gnl|my_center|LOCUS_06810 17322 15961 gene locus_tag LOCUS_06820 gene miaB 17322 15961 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649877.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence033 836 48 gene locus_tag LOCUS_06830 836 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 1360 833 gene locus_tag LOCUS_06840 1360 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 2655 1399 gene locus_tag LOCUS_06850 2655 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 3647 2652 gene locus_tag LOCUS_06860 gene gspK 3647 2652 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 protein_id gnl|my_center|LOCUS_06860 4212 3628 gene locus_tag LOCUS_06870 gene gspJ 4212 3628 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038517.1 protein_id gnl|my_center|LOCUS_06870 4514 4242 gene locus_tag LOCUS_06880 4514 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 4886 5689 gene locus_tag LOCUS_06890 4886 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 5702 7732 gene locus_tag LOCUS_06900 gene xcpQ 5702 7732 CDS product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 protein_id gnl|my_center|LOCUS_06900 7729 9282 gene locus_tag LOCUS_06910 gene gspE 7729 9282 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070564.1 protein_id gnl|my_center|LOCUS_06910 9311 10525 gene locus_tag LOCUS_06920 gene xcpS 9311 10525 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_06920 10527 10994 gene locus_tag LOCUS_06930 gene xcpT 10527 10994 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_06930 11015 11512 gene locus_tag LOCUS_06940 11015 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 11568 11909 gene locus_tag LOCUS_06950 11568 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 12307 11948 gene locus_tag LOCUS_06960 12307 11948 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694338.1 protein_id gnl|my_center|LOCUS_06960 12756 15299 gene locus_tag LOCUS_06970 12756 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 15357 17315 gene locus_tag LOCUS_06980 15357 17315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence034 429 1037 gene locus_tag LOCUS_06990 429 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2670 2870 gene locus_tag LOCUS_07000 2670 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2879 4546 gene locus_tag LOCUS_07010 gene ggt 2879 4546 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133817160.1 protein_id gnl|my_center|LOCUS_07010 4616 5896 gene locus_tag LOCUS_07020 gene bioA 4616 5896 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931741.1 protein_id gnl|my_center|LOCUS_07020 9032 5829 gene locus_tag LOCUS_07030 9032 5829 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053708.1 protein_id gnl|my_center|LOCUS_07030 9184 10401 gene locus_tag LOCUS_07040 9184 10401 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 protein_id gnl|my_center|LOCUS_07040 10557 10402 gene locus_tag LOCUS_07050 10557 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 10532 11476 gene locus_tag LOCUS_07060 10532 11476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 11473 14559 gene locus_tag LOCUS_07070 11473 14559 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_07070 14570 15928 gene locus_tag LOCUS_07080 14570 15928 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184355.1 protein_id gnl|my_center|LOCUS_07080 17083 15950 gene locus_tag LOCUS_07090 17083 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence035 318 1517 gene locus_tag LOCUS_07100 318 1517 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877238.1 protein_id gnl|my_center|LOCUS_07100 1550 2500 gene locus_tag LOCUS_07110 1550 2500 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039919.1 protein_id gnl|my_center|LOCUS_07110 6790 2531 gene locus_tag LOCUS_07120 gene rpoC 6790 2531 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_07120 10944 6802 gene locus_tag LOCUS_07130 gene rpoB 10944 6802 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_07130 11490 11110 gene locus_tag LOCUS_07140 gene rplL 11490 11110 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_07140 12040 11516 gene locus_tag LOCUS_07150 gene rplJ 12040 11516 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771616.1 protein_id gnl|my_center|LOCUS_07150 12746 12057 gene locus_tag LOCUS_07160 gene rplA 12746 12057 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096676.1 protein_id gnl|my_center|LOCUS_07160 13194 12748 gene locus_tag LOCUS_07170 gene rplK 13194 12748 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218414.1 protein_id gnl|my_center|LOCUS_07170 13767 13234 gene locus_tag LOCUS_07180 gene nusG 13767 13234 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 protein_id gnl|my_center|LOCUS_07180 14146 13772 gene locus_tag LOCUS_07190 gene secE 14146 13772 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108030.1 protein_id gnl|my_center|LOCUS_07190 14262 14187 gene locus_tag LOCUS_t00050 14262 14187 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 15488 14298 gene locus_tag LOCUS_07200 gene tuf 15488 14298 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946066.1 protein_id gnl|my_center|LOCUS_07200 16493 16332 gene locus_tag LOCUS_07210 16493 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 16658 16509 gene locus_tag LOCUS_07220 16658 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence036 780 7 gene locus_tag LOCUS_07230 780 7 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_07230 2156 777 gene locus_tag LOCUS_07240 gene dacB 2156 777 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 protein_id gnl|my_center|LOCUS_07240 2104 2316 gene locus_tag LOCUS_07250 2104 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 2975 2409 gene locus_tag LOCUS_07260 2975 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 6370 2972 gene locus_tag LOCUS_07270 6370 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 7725 6367 gene locus_tag LOCUS_07280 gene cyp51 7725 6367 CDS product lanosterol 14-alpha demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898577.1 protein_id gnl|my_center|LOCUS_07280 8787 7732 gene locus_tag LOCUS_07290 8787 7732 CDS product delta(24(24(1)))-sterol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958072.1 protein_id gnl|my_center|LOCUS_07290 9940 8798 gene locus_tag LOCUS_07300 9940 8798 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141920.1 protein_id gnl|my_center|LOCUS_07300 11079 9976 gene locus_tag LOCUS_07310 11079 9976 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_07310 11301 12719 gene locus_tag LOCUS_07320 11301 12719 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_07320 12726 13940 gene locus_tag LOCUS_07330 12726 13940 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015670.1 protein_id gnl|my_center|LOCUS_07330 13937 17107 gene locus_tag LOCUS_07340 13937 17107 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence037 58 1143 gene locus_tag LOCUS_07350 58 1143 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234306381.1 protein_id gnl|my_center|LOCUS_07350 1177 2094 gene locus_tag LOCUS_07360 1177 2094 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 protein_id gnl|my_center|LOCUS_07360 2116 3402 gene locus_tag LOCUS_07370 2116 3402 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728152.1 protein_id gnl|my_center|LOCUS_07370 3480 5076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5098 7443 gene locus_tag LOCUS_07380 5098 7443 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455006.1 protein_id gnl|my_center|LOCUS_07380 7433 8494 gene locus_tag LOCUS_07390 gene aroC 7433 8494 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918437.1 protein_id gnl|my_center|LOCUS_07390 10305 8548 gene locus_tag LOCUS_07400 10305 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 11820 10378 gene locus_tag LOCUS_07410 gene tldD 11820 10378 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_07410 12635 11817 gene locus_tag LOCUS_07420 12635 11817 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931197.1 protein_id gnl|my_center|LOCUS_07420 12775 14097 gene locus_tag LOCUS_07430 12775 14097 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_07430 14097 15203 gene locus_tag LOCUS_07440 gene thrC 14097 15203 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048893.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence038 1164 745 gene locus_tag LOCUS_07450 1164 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2404 1238 gene locus_tag LOCUS_07460 2404 1238 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086213.1 protein_id gnl|my_center|LOCUS_07460 4028 2391 gene locus_tag LOCUS_07470 4028 2391 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965984.1 protein_id gnl|my_center|LOCUS_07470 4400 4035 gene locus_tag LOCUS_07480 4400 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4722 4393 gene locus_tag LOCUS_07490 4722 4393 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_07490 5649 4891 gene locus_tag LOCUS_07500 5649 4891 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811759.1 protein_id gnl|my_center|LOCUS_07500 5672 6214 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6743 6444 gene locus_tag LOCUS_07510 6743 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 8770 7163 gene locus_tag LOCUS_07520 gene actP 8770 7163 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175651.1 protein_id gnl|my_center|LOCUS_07520 8978 8763 gene locus_tag LOCUS_07530 8978 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 9589 9092 gene locus_tag LOCUS_07540 9589 9092 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814492.1 protein_id gnl|my_center|LOCUS_07540 10902 9586 gene locus_tag LOCUS_07550 10902 9586 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965985.1 protein_id gnl|my_center|LOCUS_07550 10997 12730 gene locus_tag LOCUS_07560 10997 12730 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902654.1 protein_id gnl|my_center|LOCUS_07560 12867 13976 gene locus_tag LOCUS_07570 12867 13976 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_07570 14474 16870 gene locus_tag LOCUS_07580 14474 16870 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108570.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence039 <1 518 gene locus_tag LOCUS_07590 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481789.1:DNA mismatch repair endonuclease MutH 515 1504 gene locus_tag LOCUS_07600 gene dusA 515 1504 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 protein_id gnl|my_center|LOCUS_07600 1505 2170 gene locus_tag LOCUS_07610 1505 2170 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419060.1 protein_id gnl|my_center|LOCUS_07610 2199 2597 gene locus_tag LOCUS_07620 2199 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2594 4702 gene locus_tag LOCUS_07630 2594 4702 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_07630 5904 4705 gene locus_tag LOCUS_07640 gene hemW 5904 4705 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114885.1 protein_id gnl|my_center|LOCUS_07640 8280 6043 gene locus_tag LOCUS_07650 8280 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 8543 10831 gene locus_tag LOCUS_07660 8543 10831 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_07660 12123 11011 gene locus_tag LOCUS_07670 12123 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 13831 12254 gene locus_tag LOCUS_07680 13831 12254 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091546.1 protein_id gnl|my_center|LOCUS_07680 14235 13828 gene locus_tag LOCUS_07690 14235 13828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 14671 14471 gene locus_tag LOCUS_07700 14671 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 14944 15231 gene locus_tag LOCUS_07710 14944 15231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 15427 15681 gene locus_tag LOCUS_07720 15427 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 15904 16404 gene locus_tag LOCUS_07730 15904 16404 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence040 <1 1656 gene locus_tag LOCUS_07740 <1 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035470.1:site-specific DNA-methyltransferase 1660 4233 gene locus_tag LOCUS_07750 1660 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 5234 4269 gene locus_tag LOCUS_07760 5234 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5675 5457 gene locus_tag LOCUS_07770 5675 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 8769 6007 gene locus_tag LOCUS_07780 8769 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 9001 9450 gene locus_tag LOCUS_07790 gene iscR 9001 9450 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072275.1 protein_id gnl|my_center|LOCUS_07790 9459 9815 gene locus_tag LOCUS_07800 gene iscA 9459 9815 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_07800 9868 11316 gene locus_tag LOCUS_07810 gene sufB 9868 11316 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 protein_id gnl|my_center|LOCUS_07810 11316 12071 gene locus_tag LOCUS_07820 gene sufC 11316 12071 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_07820 12089 12766 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13393 14637 gene locus_tag LOCUS_07830 13393 14637 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_07830 14643 15095 gene locus_tag LOCUS_07840 14643 15095 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_07840 15112 15663 gene locus_tag LOCUS_07850 gene sufT 15112 15663 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_07850 15795 16235 gene locus_tag LOCUS_07860 gene ndk 15795 16235 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence041 165 3338 gene locus_tag LOCUS_07870 165 3338 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_07870 3378 4847 gene locus_tag LOCUS_07880 3378 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275264.1 protein_id gnl|my_center|LOCUS_07880 5257 4817 gene locus_tag LOCUS_07890 5257 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 6612 5455 gene locus_tag LOCUS_07900 6612 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 7460 6711 gene locus_tag LOCUS_07910 7460 6711 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_07910 8293 7457 gene locus_tag LOCUS_07920 gene prmC 8293 7457 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096234.1 protein_id gnl|my_center|LOCUS_07920 9388 8297 gene locus_tag LOCUS_07930 gene prfA 9388 8297 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114692.1 protein_id gnl|my_center|LOCUS_07930 10683 9403 gene locus_tag LOCUS_07940 gene hemA 10683 9403 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490531.1 protein_id gnl|my_center|LOCUS_07940 10808 12514 gene locus_tag LOCUS_07950 10808 12514 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074907579.1 protein_id gnl|my_center|LOCUS_07950 12536 13123 gene locus_tag LOCUS_07960 gene lolB 12536 13123 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095005.1 protein_id gnl|my_center|LOCUS_07960 13120 13977 gene locus_tag LOCUS_07970 gene ispE 13120 13977 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_07970 14133 14156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14262 15506 gene locus_tag LOCUS_07980 14262 15506 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence042 165 1 gene locus_tag LOCUS_07990 165 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1540 158 gene locus_tag LOCUS_08000 1540 158 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_08000 3126 1819 gene locus_tag LOCUS_08010 gene mgtE 3126 1819 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_08010 3952 3128 gene locus_tag LOCUS_08020 3952 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 4780 3953 gene locus_tag LOCUS_08030 4780 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 4867 5826 gene locus_tag LOCUS_08040 gene mhpB 4867 5826 CDS product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543465.1 protein_id gnl|my_center|LOCUS_08040 6855 5842 gene locus_tag LOCUS_08050 6855 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929908.1 protein_id gnl|my_center|LOCUS_08050 7677 6937 gene locus_tag LOCUS_08060 7677 6937 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022442.1 protein_id gnl|my_center|LOCUS_08060 8188 7679 gene locus_tag LOCUS_08070 8188 7679 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_08070 9468 8206 gene locus_tag LOCUS_08080 9468 8206 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338708.1 protein_id gnl|my_center|LOCUS_08080 10100 9468 gene locus_tag LOCUS_08090 10100 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 11274 10111 gene locus_tag LOCUS_08100 11274 10111 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_08100 11411 12715 gene locus_tag LOCUS_08110 11411 12715 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_08110 12712 13536 gene locus_tag LOCUS_08120 12712 13536 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_08120 14703 13564 gene locus_tag LOCUS_08130 14703 13564 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246392.1 protein_id gnl|my_center|LOCUS_08130 14991 15260 gene locus_tag LOCUS_08140 14991 15260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 >Feature sequence043 6 1178 gene locus_tag LOCUS_08150 gene yghO 6 1178 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388786.1 protein_id gnl|my_center|LOCUS_08150 1211 2305 gene locus_tag LOCUS_08160 gene lptF 1211 2305 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779633.1 protein_id gnl|my_center|LOCUS_08160 2430 3494 gene locus_tag LOCUS_08170 gene lptG 2430 3494 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640208.1 protein_id gnl|my_center|LOCUS_08170 3638 4675 gene locus_tag LOCUS_08180 3638 4675 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_08180 4726 5577 gene locus_tag LOCUS_08190 4726 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 5587 6381 gene locus_tag LOCUS_08200 gene nagB 5587 6381 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246480.1 protein_id gnl|my_center|LOCUS_08200 7702 6371 gene locus_tag LOCUS_08210 7702 6371 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073342.1 protein_id gnl|my_center|LOCUS_08210 9030 7747 gene locus_tag LOCUS_08220 gene fucP 9030 7747 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039140.1 protein_id gnl|my_center|LOCUS_08220 9409 11844 gene locus_tag LOCUS_08230 9409 11844 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_08230 11936 13507 gene locus_tag LOCUS_08240 11936 13507 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195202377.1 protein_id gnl|my_center|LOCUS_08240 13726 15231 gene locus_tag LOCUS_08250 13726 15231 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence044 200 1345 gene locus_tag LOCUS_08260 gene hpnH 200 1345 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187762.1 protein_id gnl|my_center|LOCUS_08260 1342 2559 gene locus_tag LOCUS_08270 1342 2559 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530058.1 protein_id gnl|my_center|LOCUS_08270 2559 3236 gene locus_tag LOCUS_08280 2559 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3280 4062 gene locus_tag LOCUS_08290 3280 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4922 4107 gene locus_tag LOCUS_08300 4922 4107 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268829.1 protein_id gnl|my_center|LOCUS_08300 7500 5332 gene locus_tag LOCUS_08310 7500 5332 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968325.1 protein_id gnl|my_center|LOCUS_08310 9412 7490 gene locus_tag LOCUS_08320 gene argS 9412 7490 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266371.1 protein_id gnl|my_center|LOCUS_08320 7512 7616 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9430 10431 gene locus_tag LOCUS_08330 9430 10431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 10489 11538 gene locus_tag LOCUS_08340 10489 11538 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_08340 11578 12333 gene locus_tag LOCUS_08350 11578 12333 CDS product purine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387822.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence045 142 390 gene locus_tag LOCUS_08360 142 390 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_08360 393 770 gene locus_tag LOCUS_08370 393 770 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_08370 4479 859 gene locus_tag LOCUS_08380 4479 859 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871043.1 protein_id gnl|my_center|LOCUS_08380 4690 6240 gene locus_tag LOCUS_08390 4690 6240 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_08390 7000 6272 gene locus_tag LOCUS_08400 7000 6272 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_08400 10130 6990 gene locus_tag LOCUS_08410 10130 6990 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041594898.1 protein_id gnl|my_center|LOCUS_08410 11689 10127 gene locus_tag LOCUS_08420 11689 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 12000 11761 gene locus_tag LOCUS_08430 12000 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 14864 12423 gene locus_tag LOCUS_08440 14864 12423 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985413.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence046 393 1427 gene locus_tag LOCUS_08450 393 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1533 1769 gene locus_tag LOCUS_08460 1533 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1775 2167 gene locus_tag LOCUS_08470 1775 2167 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_08470 2229 3644 gene locus_tag LOCUS_08480 2229 3644 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_08480 3993 3691 gene locus_tag LOCUS_08490 3993 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 4265 5101 gene locus_tag LOCUS_08500 4265 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 5273 6505 gene locus_tag LOCUS_08510 5273 6505 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_08510 7511 6519 gene locus_tag LOCUS_08520 7511 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 6543 6561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7952 7653 gene locus_tag LOCUS_08530 7952 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 9624 7999 gene locus_tag LOCUS_08540 9624 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 11220 9646 gene locus_tag LOCUS_08550 11220 9646 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393791.1 protein_id gnl|my_center|LOCUS_08550 11368 12363 gene locus_tag LOCUS_08560 11368 12363 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816621.1 protein_id gnl|my_center|LOCUS_08560 12360 12875 gene locus_tag LOCUS_08570 12360 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 12872 13342 gene locus_tag LOCUS_08580 12872 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 13335 14681 gene locus_tag LOCUS_08590 13335 14681 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206913.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence047 2532 1228 gene locus_tag LOCUS_08600 2532 1228 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_08600 3171 2536 gene locus_tag LOCUS_08610 gene lolA 3171 2536 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946715.1 protein_id gnl|my_center|LOCUS_08610 5523 3205 gene locus_tag LOCUS_08620 5523 3205 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_08620 5676 8180 gene locus_tag LOCUS_08630 5676 8180 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920256.1 protein_id gnl|my_center|LOCUS_08630 8682 8218 gene locus_tag LOCUS_08640 8682 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 10284 9040 gene locus_tag LOCUS_08650 10284 9040 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 protein_id gnl|my_center|LOCUS_08650 10545 10300 gene locus_tag LOCUS_08660 10545 10300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 10704 10782 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12062 10803 gene locus_tag LOCUS_08670 12062 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 13302 12151 gene locus_tag LOCUS_08680 13302 12151 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_08680 13346 13424 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13902 13438 gene locus_tag LOCUS_08690 13902 13438 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284098.1 protein_id gnl|my_center|LOCUS_08690 <14677 13973 gene locus_tag LOCUS_08700 <14677 13973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023004217.1:VCBS domain-containing protein >Feature sequence048 69 770 gene locus_tag LOCUS_08710 69 770 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_08710 2076 895 gene locus_tag LOCUS_08720 2076 895 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_08720 2204 3385 gene locus_tag LOCUS_08730 2204 3385 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_08730 3755 5764 gene locus_tag LOCUS_08740 3755 5764 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962335.1 protein_id gnl|my_center|LOCUS_08740 5836 6084 gene locus_tag LOCUS_08750 5836 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 8096 6570 gene locus_tag LOCUS_08760 8096 6570 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528581.1 protein_id gnl|my_center|LOCUS_08760 8187 9257 gene locus_tag LOCUS_08770 8187 9257 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_08770 9267 10271 gene locus_tag LOCUS_08780 9267 10271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 10570 10307 gene locus_tag LOCUS_08790 10570 10307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 13037 10722 gene locus_tag LOCUS_08800 13037 10722 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_08800 13516 13034 gene locus_tag LOCUS_08810 13516 13034 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_08810 14393 13506 gene locus_tag LOCUS_08820 14393 13506 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence049 222 860 gene locus_tag LOCUS_08830 222 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 857 1804 gene locus_tag LOCUS_08840 857 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3089 1791 gene locus_tag LOCUS_08850 3089 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 5172 3235 gene locus_tag LOCUS_08860 gene acs 5172 3235 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_08860 5505 5861 gene locus_tag LOCUS_08870 5505 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 7288 6062 gene locus_tag LOCUS_08880 gene ispG 7288 6062 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_08880 7425 7928 gene locus_tag LOCUS_08890 gene fabA 7425 7928 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921547.1 protein_id gnl|my_center|LOCUS_08890 8427 8928 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10459 9275 gene locus_tag LOCUS_08900 10459 9275 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206814.1 protein_id gnl|my_center|LOCUS_08900 12370 10922 gene locus_tag LOCUS_08910 12370 10922 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387751.1 protein_id gnl|my_center|LOCUS_08910 14111 12372 gene locus_tag LOCUS_08920 14111 12372 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387750.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence050 1104 1733 gene locus_tag LOCUS_08930 1104 1733 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104746.1 protein_id gnl|my_center|LOCUS_08930 2306 1977 gene locus_tag LOCUS_08940 2306 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2569 2306 gene locus_tag LOCUS_08950 2569 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 2750 3043 gene locus_tag LOCUS_08960 2750 3043 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_08960 3598 3182 gene locus_tag LOCUS_08970 3598 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3732 4043 gene locus_tag LOCUS_08980 3732 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 5243 4287 gene locus_tag LOCUS_08990 gene sppA 5243 4287 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_08990 7277 5259 gene locus_tag LOCUS_09000 7277 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 7751 8701 gene locus_tag LOCUS_09010 gene rluC 7751 8701 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317474.1 protein_id gnl|my_center|LOCUS_09010 9474 8743 gene locus_tag LOCUS_09020 gene pdxJ 9474 8743 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071560.1 protein_id gnl|my_center|LOCUS_09020 10197 9484 gene locus_tag LOCUS_09030 gene recO 10197 9484 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772032.1 protein_id gnl|my_center|LOCUS_09030 11142 10231 gene locus_tag LOCUS_09040 gene era 11142 10231 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_09040 11824 11132 gene locus_tag LOCUS_09050 gene rnc 11824 11132 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860711.1 protein_id gnl|my_center|LOCUS_09050 12655 11852 gene locus_tag LOCUS_09060 gene lepB 12655 11852 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444404.1 protein_id gnl|my_center|LOCUS_09060 <14427 12652 gene locus_tag LOCUS_09070 <14427 12652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958269.1:translation elongation factor 4 >Feature sequence051 1647 742 gene locus_tag LOCUS_09080 1647 742 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_09080 2917 1640 gene locus_tag LOCUS_09090 2917 1640 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_09090 3897 2917 gene locus_tag LOCUS_09100 3897 2917 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_09100 4403 3894 gene locus_tag LOCUS_09110 gene pyrR 4403 3894 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266430.1 protein_id gnl|my_center|LOCUS_09110 4829 4425 gene locus_tag LOCUS_09120 gene ruvX 4829 4425 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084575.1 protein_id gnl|my_center|LOCUS_09120 5406 4846 gene locus_tag LOCUS_09130 5406 4846 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_09130 5727 7541 gene locus_tag LOCUS_09140 5727 7541 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257769.1 protein_id gnl|my_center|LOCUS_09140 7915 8283 gene locus_tag LOCUS_09150 7915 8283 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739893.1 protein_id gnl|my_center|LOCUS_09150 8526 8329 gene locus_tag LOCUS_09160 8526 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 8763 10982 gene locus_tag LOCUS_09170 8763 10982 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071387.1 protein_id gnl|my_center|LOCUS_09170 10985 11707 gene locus_tag LOCUS_09180 10985 11707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038800.1 protein_id gnl|my_center|LOCUS_09180 11707 13143 gene locus_tag LOCUS_09190 11707 13143 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038799.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence052 1887 1108 gene locus_tag LOCUS_09200 gene tatC 1887 1108 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704121.1 protein_id gnl|my_center|LOCUS_09200 2153 1884 gene locus_tag LOCUS_09210 2153 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 2408 2184 gene locus_tag LOCUS_09220 2408 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 2820 2488 gene locus_tag LOCUS_09230 2820 2488 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943715.1 protein_id gnl|my_center|LOCUS_09230 3296 2886 gene locus_tag LOCUS_09240 gene hisI 3296 2886 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403068.1 protein_id gnl|my_center|LOCUS_09240 4159 3299 gene locus_tag LOCUS_09250 gene hisF 4159 3299 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 protein_id gnl|my_center|LOCUS_09250 4933 4160 gene locus_tag LOCUS_09260 gene hisA 4933 4160 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_09260 7930 5048 gene locus_tag LOCUS_09270 gene polA 7930 5048 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190446.1 protein_id gnl|my_center|LOCUS_09270 10980 8008 gene locus_tag LOCUS_09280 10980 8008 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932591.1 protein_id gnl|my_center|LOCUS_09280 11870 10977 gene locus_tag LOCUS_09290 11870 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 13936 11987 gene locus_tag LOCUS_09300 13936 11987 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555499.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence053 208 2649 gene locus_tag LOCUS_09310 208 2649 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265751.1 protein_id gnl|my_center|LOCUS_09310 2713 3471 gene locus_tag LOCUS_09320 2713 3471 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_09320 3514 4323 gene locus_tag LOCUS_09330 3514 4323 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527980.1 protein_id gnl|my_center|LOCUS_09330 4323 5537 gene locus_tag LOCUS_09340 4323 5537 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040561.1 protein_id gnl|my_center|LOCUS_09340 5661 8045 gene locus_tag LOCUS_09350 5661 8045 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_09350 8269 9477 gene locus_tag LOCUS_09360 8269 9477 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_09360 9480 11042 gene locus_tag LOCUS_09370 9480 11042 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_09370 12274 11087 gene locus_tag LOCUS_09380 12274 11087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 12614 12862 gene locus_tag LOCUS_09390 12614 12862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence054 141 1253 gene locus_tag LOCUS_09400 141 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2346 1210 gene locus_tag LOCUS_09410 2346 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4493 2472 gene locus_tag LOCUS_09420 4493 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4933 4652 gene locus_tag LOCUS_09430 4933 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4993 5061 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6034 5105 gene locus_tag LOCUS_09440 6034 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 8350 6053 gene locus_tag LOCUS_09450 8350 6053 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086860976.1 protein_id gnl|my_center|LOCUS_09450 11274 8371 gene locus_tag LOCUS_09460 11274 8371 CDS product NHLP bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027334.1 protein_id gnl|my_center|LOCUS_09460 13468 11279 gene locus_tag LOCUS_09470 13468 11279 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence055 2284 1421 gene locus_tag LOCUS_09480 2284 1421 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810287.1 protein_id gnl|my_center|LOCUS_09480 3458 2394 gene locus_tag LOCUS_09490 3458 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3533 4060 gene locus_tag LOCUS_09500 3533 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 4053 5315 gene locus_tag LOCUS_09510 4053 5315 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813565.1 protein_id gnl|my_center|LOCUS_09510 5405 6265 gene locus_tag LOCUS_09520 5405 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 7290 6262 gene locus_tag LOCUS_09530 7290 6262 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_09530 8326 7268 gene locus_tag LOCUS_09540 8326 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 9870 8878 gene locus_tag LOCUS_09550 9870 8878 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_09550 12085 9902 gene locus_tag LOCUS_09560 12085 9902 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_09560 13354 12167 gene locus_tag LOCUS_09570 13354 12167 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence056 1677 316 gene locus_tag LOCUS_09580 1677 316 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_09580 3653 1764 gene locus_tag LOCUS_09590 3653 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3991 3851 gene locus_tag LOCUS_09600 3991 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4737 4072 gene locus_tag LOCUS_09610 4737 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09610 5561 4656 gene locus_tag LOCUS_09620 5561 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09620 6460 5753 gene locus_tag LOCUS_09630 6460 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 7030 7611 gene locus_tag LOCUS_09640 7030 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 7703 7921 gene locus_tag LOCUS_09650 7703 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 8526 7969 gene locus_tag LOCUS_09660 8526 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09660 9174 8548 gene locus_tag LOCUS_09670 9174 8548 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929893.1 protein_id gnl|my_center|LOCUS_09670 9441 9244 gene locus_tag LOCUS_09680 9441 9244 CDS product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064480.1 protein_id gnl|my_center|LOCUS_09680 10388 9438 gene locus_tag LOCUS_09690 10388 9438 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 protein_id gnl|my_center|LOCUS_09690 10545 10889 gene locus_tag LOCUS_09700 10545 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 10930 11382 gene locus_tag LOCUS_09710 gene tadA 10930 11382 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050413802.1 protein_id gnl|my_center|LOCUS_09710 12011 12268 gene locus_tag LOCUS_09720 12011 12268 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265886.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence057 244 498 gene locus_tag LOCUS_09730 244 498 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140251.1 protein_id gnl|my_center|LOCUS_09730 528 698 gene locus_tag LOCUS_09740 528 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 756 1034 gene locus_tag LOCUS_09750 756 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2385 1093 gene locus_tag LOCUS_09760 2385 1093 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174384.1 protein_id gnl|my_center|LOCUS_09760 2627 2385 gene locus_tag LOCUS_09770 2627 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 2799 3020 gene locus_tag LOCUS_09780 2799 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2995 3759 gene locus_tag LOCUS_09790 2995 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 3831 4703 gene locus_tag LOCUS_09800 3831 4703 CDS product DUF1838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055925.1 protein_id gnl|my_center|LOCUS_09800 4938 4768 gene locus_tag LOCUS_09810 4938 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 7394 5073 gene locus_tag LOCUS_09820 7394 5073 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_09820 8638 7397 gene locus_tag LOCUS_09830 8638 7397 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086725.1 protein_id gnl|my_center|LOCUS_09830 9885 8704 gene locus_tag LOCUS_09840 9885 8704 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063811.1 protein_id gnl|my_center|LOCUS_09840 10932 9958 gene locus_tag LOCUS_09850 10932 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 11708 11043 gene locus_tag LOCUS_09860 11708 11043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 13148 11790 gene locus_tag LOCUS_09870 13148 11790 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence058 3536 69 gene locus_tag LOCUS_09880 3536 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4819 3536 gene locus_tag LOCUS_09890 4819 3536 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404741.1 protein_id gnl|my_center|LOCUS_09890 6077 4851 gene locus_tag LOCUS_09900 6077 4851 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112805.1 protein_id gnl|my_center|LOCUS_09900 6826 6074 gene locus_tag LOCUS_09910 6826 6074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_09910 8699 6918 gene locus_tag LOCUS_09920 8699 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 9790 8696 gene locus_tag LOCUS_09930 9790 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 10009 10300 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10336 11397 gene locus_tag LOCUS_09940 10336 11397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 12673 11417 gene locus_tag LOCUS_09950 12673 11417 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence059 506 126 gene locus_tag LOCUS_09960 gene gcvH 506 126 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_09960 692 931 gene locus_tag LOCUS_09970 692 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 951 2324 gene locus_tag LOCUS_09980 gene asnS 951 2324 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_09980 4412 2370 gene locus_tag LOCUS_09990 4412 2370 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_09990 8489 4476 gene locus_tag LOCUS_10000 8489 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 4533 4769 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9655 8486 gene locus_tag LOCUS_10010 9655 8486 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_10010 10490 9921 gene locus_tag LOCUS_10020 gene efp 10490 9921 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_10020 12747 10498 gene locus_tag LOCUS_10030 gene parC 12747 10498 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence060 <1 663 gene locus_tag LOCUS_10040 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140499.1:class I SAM-dependent methyltransferase 2548 752 gene locus_tag LOCUS_10050 2548 752 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072992.1 protein_id gnl|my_center|LOCUS_10050 4406 2571 gene locus_tag LOCUS_10060 4406 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 5380 4403 gene locus_tag LOCUS_10070 5380 4403 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 protein_id gnl|my_center|LOCUS_10070 5853 5380 gene locus_tag LOCUS_10080 5853 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 7011 6046 gene locus_tag LOCUS_10090 7011 6046 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 protein_id gnl|my_center|LOCUS_10090 8053 7019 gene locus_tag LOCUS_10100 8053 7019 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091294.1 protein_id gnl|my_center|LOCUS_10100 8692 8267 gene locus_tag LOCUS_10110 8692 8267 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_10110 8840 9202 gene locus_tag LOCUS_10120 8840 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 9221 9910 gene locus_tag LOCUS_10130 9221 9910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943339.1 protein_id gnl|my_center|LOCUS_10130 9943 10650 gene locus_tag LOCUS_10140 9943 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 11903 10710 gene locus_tag LOCUS_10150 11903 10710 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_10150 12360 12115 gene locus_tag LOCUS_10160 12360 12115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence061 579 1682 gene locus_tag LOCUS_10170 579 1682 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_10170 1770 2885 gene locus_tag LOCUS_10180 1770 2885 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_10180 2899 4173 gene locus_tag LOCUS_10190 2899 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 5740 4922 gene locus_tag LOCUS_10200 5740 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 7125 6307 gene locus_tag LOCUS_10210 7125 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 8507 7689 gene locus_tag LOCUS_10220 8507 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 9617 10045 gene locus_tag LOCUS_10230 9617 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 10047 11942 gene locus_tag LOCUS_10240 gene asnB 10047 11942 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064738.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence062 2038 860 gene locus_tag LOCUS_10250 2038 860 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_10250 2877 2035 gene locus_tag LOCUS_10260 2877 2035 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_10260 3862 2882 gene locus_tag LOCUS_10270 gene mltB 3862 2882 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_10270 4955 3864 gene locus_tag LOCUS_10280 gene mrdB 4955 3864 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_10280 6817 4952 gene locus_tag LOCUS_10290 gene mrdA 6817 4952 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_10290 7350 6859 gene locus_tag LOCUS_10300 gene mreD 7350 6859 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094389.1 protein_id gnl|my_center|LOCUS_10300 8159 7347 gene locus_tag LOCUS_10310 8159 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 9268 8219 gene locus_tag LOCUS_10320 9268 8219 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308111.1 protein_id gnl|my_center|LOCUS_10320 9320 9661 gene locus_tag LOCUS_10330 gene gatC 9320 9661 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_10330 9698 11161 gene locus_tag LOCUS_10340 gene gatA 9698 11161 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_10340 11183 12643 gene locus_tag LOCUS_10350 gene gatB 11183 12643 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence063 1146 112 gene locus_tag LOCUS_10360 gene mch 1146 112 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532033.1 protein_id gnl|my_center|LOCUS_10360 2322 1321 gene locus_tag LOCUS_10370 2322 1321 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_10370 2467 2772 gene locus_tag LOCUS_10380 2467 2772 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771072.1 protein_id gnl|my_center|LOCUS_10380 4452 2815 gene locus_tag LOCUS_10390 4452 2815 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035719.1 protein_id gnl|my_center|LOCUS_10390 5323 4541 gene locus_tag LOCUS_10400 5323 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 5787 5320 gene locus_tag LOCUS_10410 5787 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 6287 5784 gene locus_tag LOCUS_10420 6287 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 6463 6284 gene locus_tag LOCUS_10430 6463 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 6924 6460 gene locus_tag LOCUS_10440 6924 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 8719 6989 gene locus_tag LOCUS_10450 8719 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 9086 8733 gene locus_tag LOCUS_10460 9086 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 9502 9083 gene locus_tag LOCUS_10470 9502 9083 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_10470 10141 9716 gene locus_tag LOCUS_10480 10141 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 10601 10161 gene locus_tag LOCUS_10490 10601 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 10773 12152 gene locus_tag LOCUS_10500 10773 12152 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence064 1147 191 gene locus_tag LOCUS_10510 1147 191 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_10510 4341 1171 gene locus_tag LOCUS_10520 4341 1171 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_10520 5439 4354 gene locus_tag LOCUS_10530 5439 4354 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926967.1 protein_id gnl|my_center|LOCUS_10530 6061 5447 gene locus_tag LOCUS_10540 6061 5447 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261211.1 protein_id gnl|my_center|LOCUS_10540 6767 6048 gene locus_tag LOCUS_10550 gene rph 6767 6048 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_10550 6889 7746 gene locus_tag LOCUS_10560 6889 7746 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094887.1 protein_id gnl|my_center|LOCUS_10560 8900 7752 gene locus_tag LOCUS_10570 8900 7752 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958509.1 protein_id gnl|my_center|LOCUS_10570 9209 9018 gene locus_tag LOCUS_10580 9209 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 9340 10992 gene locus_tag LOCUS_10590 9340 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 10970 12421 gene locus_tag LOCUS_10600 10970 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence065 1773 61 gene locus_tag LOCUS_10610 gene atsA 1773 61 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 protein_id gnl|my_center|LOCUS_10610 5211 1903 gene locus_tag LOCUS_10620 5211 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 7605 5293 gene locus_tag LOCUS_10630 7605 5293 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_10630 7881 9860 gene locus_tag LOCUS_10640 7881 9860 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_10640 9930 11663 gene locus_tag LOCUS_10650 9930 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence066 104 2215 gene locus_tag LOCUS_10660 gene spoT 104 2215 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769571.1 protein_id gnl|my_center|LOCUS_10660 2226 4322 gene locus_tag LOCUS_10670 gene recG 2226 4322 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819155.1 protein_id gnl|my_center|LOCUS_10670 4384 5253 gene locus_tag LOCUS_10680 gene ubiA 4384 5253 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455228.1 protein_id gnl|my_center|LOCUS_10680 6571 5279 gene locus_tag LOCUS_10690 6571 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 6906 7157 gene locus_tag LOCUS_10700 6906 7157 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250181.1 protein_id gnl|my_center|LOCUS_10700 7184 7549 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtccttgcaccacttattcccaagtgcaagaat 7950 7612 gene locus_tag LOCUS_10710 gene cas2 7950 7612 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_10710 8585 7950 gene locus_tag LOCUS_10720 8585 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 12245 8886 gene locus_tag LOCUS_10730 12245 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence067 4286 762 gene locus_tag LOCUS_10740 4286 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 5981 4605 gene locus_tag LOCUS_10750 5981 4605 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_10750 5881 6189 gene locus_tag LOCUS_10760 5881 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 8226 6127 gene locus_tag LOCUS_10770 8226 6127 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 protein_id gnl|my_center|LOCUS_10770 8756 8268 gene locus_tag LOCUS_10780 8756 8268 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626636.1 protein_id gnl|my_center|LOCUS_10780 8908 10026 gene locus_tag LOCUS_10790 gene ald 8908 10026 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_10790 10778 10056 gene locus_tag LOCUS_10800 gene phbB 10778 10056 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_10800 10947 12215 gene locus_tag LOCUS_10810 10947 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence068 274 483 gene locus_tag LOCUS_10820 274 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 480 851 gene locus_tag LOCUS_10830 480 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 973 1479 gene locus_tag LOCUS_10840 973 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3145 1517 gene locus_tag LOCUS_10850 3145 1517 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545924.1 protein_id gnl|my_center|LOCUS_10850 3590 3997 gene locus_tag LOCUS_10860 3590 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3994 5637 gene locus_tag LOCUS_10870 3994 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086332.1 protein_id gnl|my_center|LOCUS_10870 5650 7029 gene locus_tag LOCUS_10880 5650 7029 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_10880 7189 9453 gene locus_tag LOCUS_10890 7189 9453 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265751.1 protein_id gnl|my_center|LOCUS_10890 9567 10793 gene locus_tag LOCUS_10900 9567 10793 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216508.1 protein_id gnl|my_center|LOCUS_10900 10783 12225 gene locus_tag LOCUS_10910 10783 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence069 429 1 gene locus_tag LOCUS_10920 gene rplM 429 1 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073682.1 protein_id gnl|my_center|LOCUS_10920 964 551 gene locus_tag LOCUS_10930 964 551 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_10930 1221 961 gene locus_tag LOCUS_10940 1221 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1579 1337 gene locus_tag LOCUS_10950 1579 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1795 2097 gene locus_tag LOCUS_10960 1795 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2087 2629 gene locus_tag LOCUS_10970 2087 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 7237 3425 gene locus_tag LOCUS_10980 7237 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 8592 7234 gene locus_tag LOCUS_10990 8592 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 8654 9190 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10493 9258 gene locus_tag LOCUS_11000 10493 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 11477 10509 gene locus_tag LOCUS_11010 11477 10509 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087474.1 protein_id gnl|my_center|LOCUS_11010 12016 11492 gene locus_tag LOCUS_11020 12016 11492 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087475.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence070 50 1093 gene locus_tag LOCUS_11030 gene recA 50 1093 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_11030 1249 1545 gene locus_tag LOCUS_11040 1249 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1554 4205 gene locus_tag LOCUS_11050 gene alaS 1554 4205 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047160.1 protein_id gnl|my_center|LOCUS_11050 4202 5446 gene locus_tag LOCUS_11060 4202 5446 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369901.1 protein_id gnl|my_center|LOCUS_11060 5532 5810 gene locus_tag LOCUS_11070 5532 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 5876 5966 gene locus_tag LOCUS_t00060 5876 5966 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6205 7881 gene locus_tag LOCUS_11080 6205 7881 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396100.1 protein_id gnl|my_center|LOCUS_11080 7964 8040 gene locus_tag LOCUS_t00070 7964 8040 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8267 9505 gene locus_tag LOCUS_11090 8267 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880001.1 protein_id gnl|my_center|LOCUS_11090 9552 11669 gene locus_tag LOCUS_11100 9552 11669 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000371.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence071 3448 68 gene locus_tag LOCUS_11110 3448 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_11110 4449 3442 gene locus_tag LOCUS_11120 4449 3442 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_11120 4591 5772 gene locus_tag LOCUS_11130 4591 5772 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 protein_id gnl|my_center|LOCUS_11130 5757 6158 gene locus_tag LOCUS_11140 5757 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 6220 6666 gene locus_tag LOCUS_11150 6220 6666 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_11150 8191 6587 gene locus_tag LOCUS_11160 8191 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 6668 6730 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8384 8755 gene locus_tag LOCUS_11170 8384 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 8882 9190 gene locus_tag LOCUS_11180 8882 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 10908 9253 gene locus_tag LOCUS_11190 10908 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 11102 12097 gene locus_tag LOCUS_11200 11102 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence072 3382 686 gene locus_tag LOCUS_11210 3382 686 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_11210 4191 3412 gene locus_tag LOCUS_11220 4191 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4769 4449 gene locus_tag LOCUS_11230 4769 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 4981 5391 gene locus_tag LOCUS_11240 4981 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 5388 6572 gene locus_tag LOCUS_11250 5388 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 6569 8200 gene locus_tag LOCUS_11260 6569 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 8723 8946 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10269 11915 gene locus_tag LOCUS_11270 10269 11915 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139725.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence073 194 104 gene locus_tag LOCUS_t00080 194 104 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 570 388 gene locus_tag LOCUS_11280 570 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 600 1271 gene locus_tag LOCUS_11290 600 1271 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_11290 1506 1724 gene locus_tag LOCUS_11300 1506 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1748 2137 gene locus_tag LOCUS_11310 1748 2137 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_11310 2982 2149 gene locus_tag LOCUS_11320 2982 2149 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391622.1 protein_id gnl|my_center|LOCUS_11320 3968 2985 gene locus_tag LOCUS_11330 3968 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4305 5438 gene locus_tag LOCUS_11340 4305 5438 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_11340 5449 5739 gene locus_tag LOCUS_11350 5449 5739 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_11350 5736 7100 gene locus_tag LOCUS_11360 5736 7100 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325301.1 protein_id gnl|my_center|LOCUS_11360 10900 7277 gene locus_tag LOCUS_11370 10900 7277 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975001.1 protein_id gnl|my_center|LOCUS_11370 11227 11772 gene locus_tag LOCUS_11380 11227 11772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence074 410 123 gene locus_tag LOCUS_11390 410 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 584 5503 gene locus_tag LOCUS_11400 584 5503 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102960.1 protein_id gnl|my_center|LOCUS_11400 5568 6074 gene locus_tag LOCUS_11410 5568 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 6049 6282 gene locus_tag LOCUS_11420 6049 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 6503 6862 gene locus_tag LOCUS_11430 6503 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 7037 7915 gene locus_tag LOCUS_11440 gene glyQ 7037 7915 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070431.1 protein_id gnl|my_center|LOCUS_11440 7915 10053 gene locus_tag LOCUS_11450 gene glyS 7915 10053 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260903.1 protein_id gnl|my_center|LOCUS_11450 10050 10868 gene locus_tag LOCUS_11460 10050 10868 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_11460 11061 10837 gene locus_tag LOCUS_11470 11061 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 11297 11082 gene locus_tag LOCUS_11480 11297 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 11375 11629 gene locus_tag LOCUS_11490 11375 11629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence075 3104 306 gene locus_tag LOCUS_11500 3104 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 4218 3643 gene locus_tag LOCUS_11510 4218 3643 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_11510 4472 5503 gene locus_tag LOCUS_11520 4472 5503 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_11520 6878 5553 gene locus_tag LOCUS_11530 6878 5553 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896880.1 protein_id gnl|my_center|LOCUS_11530 8134 6950 gene locus_tag LOCUS_11540 8134 6950 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524929.1 protein_id gnl|my_center|LOCUS_11540 8391 8137 gene locus_tag LOCUS_11550 8391 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 9462 8566 gene locus_tag LOCUS_11560 9462 8566 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077137.1 protein_id gnl|my_center|LOCUS_11560 11003 9558 gene locus_tag LOCUS_11570 11003 9558 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390306.1 protein_id gnl|my_center|LOCUS_11570 10908 11243 gene locus_tag LOCUS_11580 10908 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence076 <1 540 gene locus_tag LOCUS_11590 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035535025.1:efflux transporter outer membrane subunit 548 1747 gene locus_tag LOCUS_11600 548 1747 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106254.1 protein_id gnl|my_center|LOCUS_11600 1765 4920 gene locus_tag LOCUS_11610 1765 4920 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_11610 5740 4949 gene locus_tag LOCUS_11620 gene trmJ 5740 4949 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771034.1 protein_id gnl|my_center|LOCUS_11620 5795 6574 gene locus_tag LOCUS_11630 5795 6574 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_11630 6798 6571 gene locus_tag LOCUS_11640 6798 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 7017 8186 gene locus_tag LOCUS_11650 gene sucC 7017 8186 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958199.1 protein_id gnl|my_center|LOCUS_11650 8186 9070 gene locus_tag LOCUS_11660 gene sucD 8186 9070 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946282.1 protein_id gnl|my_center|LOCUS_11660 9223 10845 gene locus_tag LOCUS_11670 9223 10845 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039823.1 protein_id gnl|my_center|LOCUS_11670 <11648 10863 gene locus_tag LOCUS_11680 <11648 10863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769279.1:outer membrane protein assembly factor BamD >Feature sequence077 193 417 gene locus_tag LOCUS_11690 193 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 434 838 gene locus_tag LOCUS_11700 434 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 882 1646 gene locus_tag LOCUS_11710 882 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1668 2405 gene locus_tag LOCUS_11720 1668 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2408 3022 gene locus_tag LOCUS_11730 gene yscL 2408 3022 CDS product SctL family type III secretion system stator protein YscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117643.1 protein_id gnl|my_center|LOCUS_11730 3192 3641 gene locus_tag LOCUS_11740 3192 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 3662 6010 gene locus_tag LOCUS_11750 3662 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 6003 6557 gene locus_tag LOCUS_11760 6003 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 6557 6952 gene locus_tag LOCUS_11770 6557 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 6992 7447 gene locus_tag LOCUS_11780 6992 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 7454 8719 gene locus_tag LOCUS_11790 7454 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 9817 8825 gene locus_tag LOCUS_11800 9817 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 10880 9855 gene locus_tag LOCUS_11810 10880 9855 CDS product phenylacetaldoxime dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266125.1 protein_id gnl|my_center|LOCUS_11810 <11520 11019 gene locus_tag LOCUS_11820 <11520 11019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266126.1:carbon-nitrogen hydrolase family protein >Feature sequence078 19 3528 gene locus_tag LOCUS_11830 gene smc 19 3528 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_11830 3547 5556 gene locus_tag LOCUS_11840 gene ligA 3547 5556 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705145.1 protein_id gnl|my_center|LOCUS_11840 5733 6158 gene locus_tag LOCUS_11850 5733 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 7753 6173 gene locus_tag LOCUS_11860 gene nadB 7753 6173 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764756.1 protein_id gnl|my_center|LOCUS_11860 8082 8660 gene locus_tag LOCUS_11870 gene rpoE 8082 8660 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_11870 8666 9220 gene locus_tag LOCUS_11880 8666 9220 CDS product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704744.1 protein_id gnl|my_center|LOCUS_11880 9217 10716 gene locus_tag LOCUS_11890 gene mucD 9217 10716 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_11890 11207 10782 gene locus_tag LOCUS_11900 gene hicB 11207 10782 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270286.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence079 1077 58 gene locus_tag LOCUS_11910 1077 58 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083076.1 protein_id gnl|my_center|LOCUS_11910 1923 1081 gene locus_tag LOCUS_11920 1923 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_11920 4216 2132 gene locus_tag LOCUS_11930 gene pnp 4216 2132 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037640.1 protein_id gnl|my_center|LOCUS_11930 4673 4404 gene locus_tag LOCUS_11940 gene rpsO 4673 4404 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185828.1 protein_id gnl|my_center|LOCUS_11940 5666 4752 gene locus_tag LOCUS_11950 gene truB 5666 4752 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958222.1 protein_id gnl|my_center|LOCUS_11950 6056 5700 gene locus_tag LOCUS_11960 gene rbfA 6056 5700 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404518.1 protein_id gnl|my_center|LOCUS_11960 8646 6061 gene locus_tag LOCUS_11970 8646 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 8065 8207 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10164 8653 gene locus_tag LOCUS_11980 gene nusA 10164 8653 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_11980 10697 10227 gene locus_tag LOCUS_11990 gene rimP 10697 10227 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_11990 10922 10846 gene locus_tag LOCUS_t00090 10922 10846 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence080 <1 1167 gene locus_tag LOCUS_12000 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957631.1:pyridoxal phosphate-dependent aminotransferase 1248 1463 gene locus_tag LOCUS_12010 1248 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1480 1555 gene locus_tag LOCUS_t00100 1480 1555 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1870 2427 gene locus_tag LOCUS_12020 1870 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2432 2845 gene locus_tag LOCUS_12030 2432 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4119 4556 gene locus_tag LOCUS_12040 4119 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 5752 4712 gene locus_tag LOCUS_12050 5752 4712 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035313.1 protein_id gnl|my_center|LOCUS_12050 6901 6026 gene locus_tag LOCUS_12060 gene galU 6901 6026 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525207.1 protein_id gnl|my_center|LOCUS_12060 8812 6932 gene locus_tag LOCUS_12070 8812 6932 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946701.1 protein_id gnl|my_center|LOCUS_12070 9454 8891 gene locus_tag LOCUS_12080 9454 8891 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236728.1 protein_id gnl|my_center|LOCUS_12080 10220 9438 gene locus_tag LOCUS_12090 10220 9438 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261051.1 protein_id gnl|my_center|LOCUS_12090 11114 10332 gene locus_tag LOCUS_12100 11114 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence081 1365 211 gene locus_tag LOCUS_12110 1365 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2102 1362 gene locus_tag LOCUS_12120 2102 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 4178 2367 gene locus_tag LOCUS_12130 gene dnaG 4178 2367 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098776.1 protein_id gnl|my_center|LOCUS_12130 4742 4293 gene locus_tag LOCUS_12140 4742 4293 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_12140 4984 4769 gene locus_tag LOCUS_12150 gene rpsU 4984 4769 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551877.1 protein_id gnl|my_center|LOCUS_12150 5144 6142 gene locus_tag LOCUS_12160 gene tsaD 5144 6142 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098775.1 protein_id gnl|my_center|LOCUS_12160 6823 6230 gene locus_tag LOCUS_12170 gene plsY 6823 6230 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217581.1 protein_id gnl|my_center|LOCUS_12170 7158 7514 gene locus_tag LOCUS_12180 gene folB 7158 7514 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_12180 7516 8013 gene locus_tag LOCUS_12190 gene folK 7516 8013 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_12190 8019 9254 gene locus_tag LOCUS_12200 8019 9254 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_12200 9227 10045 gene locus_tag LOCUS_12210 9227 10045 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_12210 10096 10884 gene locus_tag LOCUS_12220 10096 10884 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145723262.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence082 762 25 gene locus_tag LOCUS_12230 gene rluB 762 25 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706718.1 protein_id gnl|my_center|LOCUS_12230 1510 848 gene locus_tag LOCUS_12240 gene scpB 1510 848 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404130.1 protein_id gnl|my_center|LOCUS_12240 2313 1507 gene locus_tag LOCUS_12250 2313 1507 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396554.1 protein_id gnl|my_center|LOCUS_12250 3517 2306 gene locus_tag LOCUS_12260 3517 2306 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_12260 4233 3610 gene locus_tag LOCUS_12270 4233 3610 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011215625.1 protein_id gnl|my_center|LOCUS_12270 4271 4834 gene locus_tag LOCUS_12280 4271 4834 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957880.1 protein_id gnl|my_center|LOCUS_12280 4896 5183 gene locus_tag LOCUS_12290 4896 5183 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199503.1 protein_id gnl|my_center|LOCUS_12290 5219 6010 gene locus_tag LOCUS_12300 5219 6010 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947788.1 protein_id gnl|my_center|LOCUS_12300 6800 6141 gene locus_tag LOCUS_12310 6800 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 <11251 6917 gene locus_tag LOCUS_12320 <11251 6917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940952.1:Calx-beta domain-containing protein >Feature sequence083 121 1677 gene locus_tag LOCUS_12330 121 1677 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076961.1 protein_id gnl|my_center|LOCUS_12330 1720 2907 gene locus_tag LOCUS_12340 1720 2907 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_12340 2930 4009 gene locus_tag LOCUS_12350 2930 4009 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_12350 6648 4063 gene locus_tag LOCUS_12360 6648 4063 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104454.1 protein_id gnl|my_center|LOCUS_12360 7787 6681 gene locus_tag LOCUS_12370 7787 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 7947 10481 gene locus_tag LOCUS_12380 7947 10481 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence084 1348 35 gene locus_tag LOCUS_12390 gene opmH 1348 35 CDS product efflux transporter outer membrane subunit OpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_12390 1684 1367 gene locus_tag LOCUS_12400 1684 1367 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_12400 1756 3660 gene locus_tag LOCUS_12410 gene thiC 1756 3660 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193963.1 protein_id gnl|my_center|LOCUS_12410 3738 6359 gene locus_tag LOCUS_12420 3738 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 7378 6332 gene locus_tag LOCUS_12430 7378 6332 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257894.1 protein_id gnl|my_center|LOCUS_12430 8284 7472 gene locus_tag LOCUS_12440 8284 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 9108 8284 gene locus_tag LOCUS_12450 9108 8284 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_12450 9218 9973 gene locus_tag LOCUS_12460 gene fabG 9218 9973 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_12460 11077 10025 gene locus_tag LOCUS_12470 11077 10025 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence085 2283 193 gene locus_tag LOCUS_12480 gene lcrD 2283 193 CDS product SctV family type III secretion system export apparatus subunit LcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117635.1 protein_id gnl|my_center|LOCUS_12480 2630 2280 gene locus_tag LOCUS_12490 2630 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 3007 2627 gene locus_tag LOCUS_12500 3007 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 3370 3047 gene locus_tag LOCUS_12510 3370 3047 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871778.1 protein_id gnl|my_center|LOCUS_12510 3760 3374 gene locus_tag LOCUS_12520 3760 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4892 3753 gene locus_tag LOCUS_12530 4892 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 6191 4935 gene locus_tag LOCUS_12540 6191 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 6382 6870 gene locus_tag LOCUS_12550 6382 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 6936 9428 gene locus_tag LOCUS_12560 6936 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 9464 10063 gene locus_tag LOCUS_12570 9464 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787384.1 protein_id gnl|my_center|LOCUS_12570 10302 10637 gene locus_tag LOCUS_12580 10302 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence086 1252 8 gene locus_tag LOCUS_12590 1252 8 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_12590 2940 1351 gene locus_tag LOCUS_12600 gene serA 2940 1351 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256188.1 protein_id gnl|my_center|LOCUS_12600 4324 2987 gene locus_tag LOCUS_12610 gene glmM 4324 2987 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948482.1 protein_id gnl|my_center|LOCUS_12610 6259 4337 gene locus_tag LOCUS_12620 gene ftsH 6259 4337 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443940.1 protein_id gnl|my_center|LOCUS_12620 6889 6290 gene locus_tag LOCUS_12630 gene rlmE 6889 6290 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071426.1 protein_id gnl|my_center|LOCUS_12630 7463 6984 gene locus_tag LOCUS_12640 gene greA 7463 6984 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 protein_id gnl|my_center|LOCUS_12640 10681 7460 gene locus_tag LOCUS_12650 gene carB 10681 7460 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243709.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence087 494 922 gene locus_tag LOCUS_12660 494 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 939 1940 gene locus_tag LOCUS_12670 939 1940 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967225.1 protein_id gnl|my_center|LOCUS_12670 2154 5201 gene locus_tag LOCUS_12680 2154 5201 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583653.1 protein_id gnl|my_center|LOCUS_12680 5242 7266 gene locus_tag LOCUS_12690 5242 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 7263 7751 gene locus_tag LOCUS_12700 7263 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 7755 10913 gene locus_tag LOCUS_12710 7755 10913 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence088 1832 2716 gene locus_tag LOCUS_12720 1832 2716 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_12720 2804 3190 gene locus_tag LOCUS_12730 2804 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3187 4959 gene locus_tag LOCUS_12740 3187 4959 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_12740 4960 5913 gene locus_tag LOCUS_12750 4960 5913 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728485.1 protein_id gnl|my_center|LOCUS_12750 6004 6963 gene locus_tag LOCUS_12760 gene cmoB 6004 6963 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405349.1 protein_id gnl|my_center|LOCUS_12760 7054 7713 gene locus_tag LOCUS_12770 7054 7713 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_12770 7937 7728 gene locus_tag LOCUS_12780 7937 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 7837 9102 gene locus_tag LOCUS_12790 7837 9102 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_12790 10574 9189 gene locus_tag LOCUS_12800 gene trpE 10574 9189 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence089 1672 779 gene locus_tag LOCUS_12810 1672 779 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 protein_id gnl|my_center|LOCUS_12810 3502 1826 gene locus_tag LOCUS_12820 3502 1826 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_12820 6274 3572 gene locus_tag LOCUS_12830 6274 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7774 6467 gene locus_tag LOCUS_12840 gene pepP 7774 6467 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_12840 7836 8132 gene locus_tag LOCUS_12850 7836 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 8129 8428 gene locus_tag LOCUS_12860 8129 8428 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_12860 10276 8711 gene locus_tag LOCUS_12870 gene ilvA 10276 8711 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082739.1 protein_id gnl|my_center|LOCUS_12870 10281 10937 gene locus_tag LOCUS_12880 gene rpiA 10281 10937 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269261.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence090 178 1518 gene locus_tag LOCUS_12890 178 1518 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_12890 1602 2897 gene locus_tag LOCUS_12900 1602 2897 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_12900 2901 3497 gene locus_tag LOCUS_12910 gene rsmD 2901 3497 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704347.1 protein_id gnl|my_center|LOCUS_12910 3463 3945 gene locus_tag LOCUS_12920 gene coaD 3463 3945 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348749.1 protein_id gnl|my_center|LOCUS_12920 4699 5157 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5743 6537 gene locus_tag LOCUS_12930 5743 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6541 8730 gene locus_tag LOCUS_12940 6541 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 8761 8949 gene locus_tag LOCUS_12950 8761 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 9784 8969 gene locus_tag LOCUS_12960 gene mutM 9784 8969 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372546.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence091 219 1391 gene locus_tag LOCUS_12970 219 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2261 1497 gene locus_tag LOCUS_12980 2261 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3754 2729 gene locus_tag LOCUS_12990 3754 2729 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967225.1 protein_id gnl|my_center|LOCUS_12990 3988 3797 gene locus_tag LOCUS_13000 3988 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 4345 4599 gene locus_tag LOCUS_13010 4345 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 4574 4975 gene locus_tag LOCUS_13020 4574 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 4968 5810 gene locus_tag LOCUS_13030 4968 5810 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_13030 5810 6493 gene locus_tag LOCUS_13040 5810 6493 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859012.1 protein_id gnl|my_center|LOCUS_13040 6550 7674 gene locus_tag LOCUS_13050 6550 7674 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_13050 7825 8850 gene locus_tag LOCUS_13060 7825 8850 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_13060 8852 9745 gene locus_tag LOCUS_13070 8852 9745 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_13070 9768 10709 gene locus_tag LOCUS_13080 9768 10709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence092 136 960 gene locus_tag LOCUS_13090 136 960 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385665.1 protein_id gnl|my_center|LOCUS_13090 1244 3295 gene locus_tag LOCUS_13100 1244 3295 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538146.1 protein_id gnl|my_center|LOCUS_13100 3296 5026 gene locus_tag LOCUS_13110 3296 5026 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_13110 5023 7209 gene locus_tag LOCUS_13120 5023 7209 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140331.1 protein_id gnl|my_center|LOCUS_13120 7297 8568 gene locus_tag LOCUS_13130 7297 8568 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227356.1 protein_id gnl|my_center|LOCUS_13130 8682 8978 gene locus_tag LOCUS_13140 8682 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 8993 9292 gene locus_tag LOCUS_13150 8993 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 10382 9312 gene locus_tag LOCUS_13160 10382 9312 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence093 121 306 gene locus_tag LOCUS_13170 gene rpmF 121 306 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947121.1 protein_id gnl|my_center|LOCUS_13170 339 1361 gene locus_tag LOCUS_13180 gene plsX 339 1361 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_13180 1373 2329 gene locus_tag LOCUS_13190 1373 2329 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_13190 2578 3534 gene locus_tag LOCUS_13200 gene fabD 2578 3534 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097121.1 protein_id gnl|my_center|LOCUS_13200 3552 4313 gene locus_tag LOCUS_13210 gene fabG 3552 4313 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947125.1 protein_id gnl|my_center|LOCUS_13210 4531 4767 gene locus_tag LOCUS_13220 gene acpP 4531 4767 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_13220 4851 6089 gene locus_tag LOCUS_13230 gene fabF 4851 6089 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072710.1 protein_id gnl|my_center|LOCUS_13230 6292 6023 gene locus_tag LOCUS_13240 6292 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 6185 6937 gene locus_tag LOCUS_13250 gene pabC 6185 6937 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_13250 6937 7977 gene locus_tag LOCUS_13260 gene mltG 6937 7977 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_13260 7974 8600 gene locus_tag LOCUS_13270 gene tmk 7974 8600 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267153.1 protein_id gnl|my_center|LOCUS_13270 8623 9609 gene locus_tag LOCUS_13280 8623 9609 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_13280 9642 10442 gene locus_tag LOCUS_13290 9642 10442 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444530.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence094 513 833 gene locus_tag LOCUS_13300 513 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 974 3133 gene locus_tag LOCUS_13310 974 3133 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470621.1 protein_id gnl|my_center|LOCUS_13310 3224 3943 gene locus_tag LOCUS_13320 3224 3943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_13320 3940 5364 gene locus_tag LOCUS_13330 3940 5364 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919393.1 protein_id gnl|my_center|LOCUS_13330 5361 6749 gene locus_tag LOCUS_13340 5361 6749 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928739.1 protein_id gnl|my_center|LOCUS_13340 7312 6824 gene locus_tag LOCUS_13350 7312 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 8631 7456 gene locus_tag LOCUS_13360 gene proB 8631 7456 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_13360 9728 8691 gene locus_tag LOCUS_13370 gene cgtA 9728 8691 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957543.1 protein_id gnl|my_center|LOCUS_13370 9982 9725 gene locus_tag LOCUS_13380 gene rpmA 9982 9725 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 protein_id gnl|my_center|LOCUS_13380 10369 10055 gene locus_tag LOCUS_13390 gene rplU 10369 10055 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417305.1 protein_id gnl|my_center|LOCUS_13390 10513 10438 gene locus_tag LOCUS_t00110 10513 10438 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence095 2357 1743 gene locus_tag LOCUS_13400 gene leuD 2357 1743 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_13400 3820 2411 gene locus_tag LOCUS_13410 gene leuC 3820 2411 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535740.1 protein_id gnl|my_center|LOCUS_13410 3876 5333 gene locus_tag LOCUS_13420 3876 5333 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_13420 5348 7999 gene locus_tag LOCUS_13430 5348 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 8772 7993 gene locus_tag LOCUS_13440 8772 7993 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192376.1 protein_id gnl|my_center|LOCUS_13440 9689 8769 gene locus_tag LOCUS_13450 9689 8769 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810478.1 protein_id gnl|my_center|LOCUS_13450 9830 10360 gene locus_tag LOCUS_13460 9830 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence096 295 501 gene locus_tag LOCUS_13470 295 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 947 872 gene locus_tag LOCUS_t00120 947 872 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1130 2413 gene locus_tag LOCUS_13480 gene pcnB 1130 2413 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222090.1 protein_id gnl|my_center|LOCUS_13480 2488 2991 gene locus_tag LOCUS_13490 gene folK 2488 2991 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771454.1 protein_id gnl|my_center|LOCUS_13490 2999 3796 gene locus_tag LOCUS_13500 gene panB 2999 3796 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_13500 3804 4724 gene locus_tag LOCUS_13510 gene panC 3804 4724 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109313.1 protein_id gnl|my_center|LOCUS_13510 4933 6033 gene locus_tag LOCUS_13520 4933 6033 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815218.1 protein_id gnl|my_center|LOCUS_13520 6087 6845 gene locus_tag LOCUS_13530 6087 6845 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_13530 6850 7560 gene locus_tag LOCUS_13540 gene cmoA 6850 7560 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365981.1 protein_id gnl|my_center|LOCUS_13540 7790 7608 gene locus_tag LOCUS_13550 7790 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 8577 8813 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence097 2643 1 gene locus_tag LOCUS_13560 2643 1 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_13560 3536 2655 gene locus_tag LOCUS_13570 gene map 3536 2655 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_13570 3606 4970 gene locus_tag LOCUS_13580 3606 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 5056 5949 gene locus_tag LOCUS_13590 gene tsf 5056 5949 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_13590 5957 6682 gene locus_tag LOCUS_13600 gene pyrH 5957 6682 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_13600 6699 7256 gene locus_tag LOCUS_13610 gene frr 6699 7256 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958191.1 protein_id gnl|my_center|LOCUS_13610 7253 8014 gene locus_tag LOCUS_13620 gene uppS 7253 8014 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_13620 8121 8987 gene locus_tag LOCUS_13630 8121 8987 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036560.1 protein_id gnl|my_center|LOCUS_13630 8984 10195 gene locus_tag LOCUS_13640 gene ispC 8984 10195 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266975.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence098 2261 165 gene locus_tag LOCUS_13650 2261 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 4761 2308 gene locus_tag LOCUS_13660 4761 2308 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969822.1 protein_id gnl|my_center|LOCUS_13660 6012 4804 gene locus_tag LOCUS_13670 gene gabD 6012 4804 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367662.1 protein_id gnl|my_center|LOCUS_13670 6793 6314 gene locus_tag LOCUS_13680 6793 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 7012 7611 gene locus_tag LOCUS_13690 7012 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 10002 7798 gene locus_tag LOCUS_13700 10002 7798 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence099 1702 395 gene locus_tag LOCUS_13710 1702 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2676 1699 gene locus_tag LOCUS_13720 gene xcpX 2676 1699 CDS product GspK family T2SS minor pseudopilin variant XcpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103524.1 protein_id gnl|my_center|LOCUS_13720 3338 2673 gene locus_tag LOCUS_13730 gene xcpW 3338 2673 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_13730 3739 3338 gene locus_tag LOCUS_13740 gene gspI 3739 3338 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204165.1 protein_id gnl|my_center|LOCUS_13740 4316 3714 gene locus_tag LOCUS_13750 4316 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4796 4353 gene locus_tag LOCUS_13760 gene xcpT 4796 4353 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_13760 6007 4796 gene locus_tag LOCUS_13770 gene xcpS 6007 4796 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_13770 7573 6035 gene locus_tag LOCUS_13780 gene xcpR 7573 6035 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_13780 9675 7579 gene locus_tag LOCUS_13790 gene gspD 9675 7579 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106682.1 protein_id gnl|my_center|LOCUS_13790 7676 7759 gene locus_tag LOCUS_t00130 7676 7759 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10279 9806 gene locus_tag LOCUS_13800 10279 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence100 1280 1546 gene locus_tag LOCUS_13810 1280 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4811 1764 gene locus_tag LOCUS_13820 4811 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 7197 4822 gene locus_tag LOCUS_13830 7197 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 8417 7197 gene locus_tag LOCUS_13840 8417 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 9725 8475 gene locus_tag LOCUS_13850 9725 8475 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_13850 10099 9764 gene locus_tag LOCUS_13860 10099 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence101 1235 1867 gene locus_tag LOCUS_13870 1235 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1851 2540 gene locus_tag LOCUS_13880 1851 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3083 2562 gene locus_tag LOCUS_13890 3083 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3639 3217 gene locus_tag LOCUS_13900 3639 3217 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017671.1 protein_id gnl|my_center|LOCUS_13900 5173 3647 gene locus_tag LOCUS_13910 5173 3647 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206668.1 protein_id gnl|my_center|LOCUS_13910 6182 5175 gene locus_tag LOCUS_13920 6182 5175 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104786.1 protein_id gnl|my_center|LOCUS_13920 7234 6254 gene locus_tag LOCUS_13930 7234 6254 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112998.1 protein_id gnl|my_center|LOCUS_13930 7480 10044 gene locus_tag LOCUS_13940 7480 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 8433 8557 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence102 207 1964 gene locus_tag LOCUS_13950 207 1964 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970104.1 protein_id gnl|my_center|LOCUS_13950 1967 3010 gene locus_tag LOCUS_13960 1967 3010 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020964298.1 protein_id gnl|my_center|LOCUS_13960 3144 4733 gene locus_tag LOCUS_13970 3144 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 4744 6582 gene locus_tag LOCUS_13980 4744 6582 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970714.1 protein_id gnl|my_center|LOCUS_13980 6572 8206 gene locus_tag LOCUS_13990 6572 8206 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461499.1 protein_id gnl|my_center|LOCUS_13990 8243 9175 gene locus_tag LOCUS_14000 gene oppB 8243 9175 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816417.1 protein_id gnl|my_center|LOCUS_14000 9168 10016 gene locus_tag LOCUS_14010 9168 10016 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence103 33 1202 gene locus_tag LOCUS_14020 33 1202 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_14020 2835 1279 gene locus_tag LOCUS_14030 2835 1279 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_14030 3373 2885 gene locus_tag LOCUS_14040 3373 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090222.1 protein_id gnl|my_center|LOCUS_14040 4045 3464 gene locus_tag LOCUS_14050 4045 3464 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970715.1 protein_id gnl|my_center|LOCUS_14050 4515 4111 gene locus_tag LOCUS_14060 4515 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 4588 5079 gene locus_tag LOCUS_14070 4588 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 5368 6261 gene locus_tag LOCUS_14080 5368 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 6655 6461 gene locus_tag LOCUS_14090 6655 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 7335 7637 gene locus_tag LOCUS_14100 7335 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 7609 8064 gene locus_tag LOCUS_14110 7609 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 8948 8121 gene locus_tag LOCUS_14120 8948 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 10012 8945 gene locus_tag LOCUS_14130 10012 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence104 3181 116 gene locus_tag LOCUS_14140 3181 116 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_14140 4863 3181 gene locus_tag LOCUS_14150 4863 3181 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_14150 6224 4860 gene locus_tag LOCUS_14160 6224 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202946090.1 protein_id gnl|my_center|LOCUS_14160 6540 6259 gene locus_tag LOCUS_14170 6540 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 8545 6719 gene locus_tag LOCUS_14180 8545 6719 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 protein_id gnl|my_center|LOCUS_14180 9910 8765 gene locus_tag LOCUS_14190 9910 8765 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence105 2270 1191 gene locus_tag LOCUS_14200 gene aroB 2270 1191 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_14200 2865 2290 gene locus_tag LOCUS_14210 gene aroK 2865 2290 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095833.1 protein_id gnl|my_center|LOCUS_14210 2962 5394 gene locus_tag LOCUS_14220 2962 5394 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266375.1 protein_id gnl|my_center|LOCUS_14220 5431 7425 gene locus_tag LOCUS_14230 5431 7425 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958461.1 protein_id gnl|my_center|LOCUS_14230 8021 7434 gene locus_tag LOCUS_14240 8021 7434 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_14240 8763 8032 gene locus_tag LOCUS_14250 8763 8032 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727914.1 protein_id gnl|my_center|LOCUS_14250 9662 8790 gene locus_tag LOCUS_14260 9662 8790 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705863.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence106 503 39 gene locus_tag LOCUS_14270 503 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 714 2789 gene locus_tag LOCUS_14280 gene shc 714 2789 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387823.1 protein_id gnl|my_center|LOCUS_14280 2814 3731 gene locus_tag LOCUS_14290 2814 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 3743 5512 gene locus_tag LOCUS_14300 3743 5512 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_14300 6268 5573 gene locus_tag LOCUS_14310 6268 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 6315 6593 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8091 7006 gene locus_tag LOCUS_14320 8091 7006 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188282.1 protein_id gnl|my_center|LOCUS_14320 9314 8088 gene locus_tag LOCUS_14330 9314 8088 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089071.1 protein_id gnl|my_center|LOCUS_14330 9450 9959 gene locus_tag LOCUS_14340 9450 9959 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103096.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence107 62 340 gene locus_tag LOCUS_14350 62 340 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_14350 312 491 gene locus_tag LOCUS_14360 312 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1172 483 gene locus_tag LOCUS_14370 1172 483 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861855.1 protein_id gnl|my_center|LOCUS_14370 1845 1321 gene locus_tag LOCUS_14380 gene bcp 1845 1321 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_14380 2010 2624 gene locus_tag LOCUS_14390 2010 2624 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227517.1 protein_id gnl|my_center|LOCUS_14390 2811 3101 gene locus_tag LOCUS_14400 2811 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 3321 5978 gene locus_tag LOCUS_14410 gene aceE 3321 5978 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444499.1 protein_id gnl|my_center|LOCUS_14410 5975 7369 gene locus_tag LOCUS_14420 gene aceF 5975 7369 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 protein_id gnl|my_center|LOCUS_14420 7663 7376 gene locus_tag LOCUS_14430 7663 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 7675 8889 gene locus_tag LOCUS_14440 7675 8889 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_14440 9830 9057 gene locus_tag LOCUS_14450 9830 9057 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence108 <1 1071 gene locus_tag LOCUS_14460 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003097262.1:DNA polymerase III subunit beta 1162 2238 gene locus_tag LOCUS_14470 gene recF 1162 2238 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097265.1 protein_id gnl|my_center|LOCUS_14470 2295 2558 gene locus_tag LOCUS_14480 2295 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3826 2762 gene locus_tag LOCUS_14490 gene bamC 3826 2762 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 protein_id gnl|my_center|LOCUS_14490 4845 3949 gene locus_tag LOCUS_14500 gene dapA 4845 3949 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_14500 5046 5573 gene locus_tag LOCUS_14510 5046 5573 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_14510 5691 6173 gene locus_tag LOCUS_14520 5691 6173 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317382.1 protein_id gnl|my_center|LOCUS_14520 7283 6219 gene locus_tag LOCUS_14530 7283 6219 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457764.1 protein_id gnl|my_center|LOCUS_14530 7479 8132 gene locus_tag LOCUS_14540 7479 8132 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204230.1 protein_id gnl|my_center|LOCUS_14540 7706 7730 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8129 9151 gene locus_tag LOCUS_14550 8129 9151 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence109 1445 267 gene locus_tag LOCUS_14560 gene lptG 1445 267 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707420.1 protein_id gnl|my_center|LOCUS_14560 2557 1442 gene locus_tag LOCUS_14570 gene lptF 2557 1442 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_14570 2629 4128 gene locus_tag LOCUS_14580 gene pepA 2629 4128 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261202.1 protein_id gnl|my_center|LOCUS_14580 4226 4624 gene locus_tag LOCUS_14590 4226 4624 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995970.1 protein_id gnl|my_center|LOCUS_14590 4617 7421 gene locus_tag LOCUS_14600 4617 7421 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946456.1 protein_id gnl|my_center|LOCUS_14600 7423 8136 gene locus_tag LOCUS_14610 gene cysE 7423 8136 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072274.1 protein_id gnl|my_center|LOCUS_14610 8355 8188 gene locus_tag LOCUS_14620 8355 8188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 8813 8352 gene locus_tag LOCUS_14630 8813 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 9030 8848 gene locus_tag LOCUS_14640 9030 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 9799 9035 gene locus_tag LOCUS_14650 9799 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence110 1326 88 gene locus_tag LOCUS_14660 1326 88 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946719.1 protein_id gnl|my_center|LOCUS_14660 4448 1413 gene locus_tag LOCUS_14670 4448 1413 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082358.1 protein_id gnl|my_center|LOCUS_14670 4944 6368 gene locus_tag LOCUS_14680 gene lpdA 4944 6368 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957594.1 protein_id gnl|my_center|LOCUS_14680 8944 6494 gene locus_tag LOCUS_14690 8944 6494 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_14690 9303 9088 gene locus_tag LOCUS_14700 9303 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence111 348 974 gene locus_tag LOCUS_14710 348 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 980 1948 gene locus_tag LOCUS_14720 gene dprA 980 1948 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 protein_id gnl|my_center|LOCUS_14720 2893 1979 gene locus_tag LOCUS_14730 2893 1979 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_14730 3546 2893 gene locus_tag LOCUS_14740 3546 2893 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101302.1 protein_id gnl|my_center|LOCUS_14740 5183 3660 gene locus_tag LOCUS_14750 5183 3660 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_14750 6862 5333 gene locus_tag LOCUS_14760 6862 5333 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 protein_id gnl|my_center|LOCUS_14760 8081 6894 gene locus_tag LOCUS_14770 8081 6894 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 protein_id gnl|my_center|LOCUS_14770 8231 9553 gene locus_tag LOCUS_14780 gene rlmD 8231 9553 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947185.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence112 190 1134 gene locus_tag LOCUS_14790 190 1134 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 protein_id gnl|my_center|LOCUS_14790 1145 2167 gene locus_tag LOCUS_14800 gene kdsD 1145 2167 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134758.1 protein_id gnl|my_center|LOCUS_14800 2171 2725 gene locus_tag LOCUS_14810 2171 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 3138 3224 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3283 4008 gene locus_tag LOCUS_14820 gene lptB 3283 4008 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_14820 4021 5481 gene locus_tag LOCUS_14830 4021 5481 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_14830 5513 5806 gene locus_tag LOCUS_14840 gene hpf 5513 5806 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_14840 5840 6286 gene locus_tag LOCUS_14850 gene ptsN 5840 6286 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222750.1 protein_id gnl|my_center|LOCUS_14850 6294 6563 gene locus_tag LOCUS_14860 6294 6563 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218178.1 protein_id gnl|my_center|LOCUS_14860 6560 8290 gene locus_tag LOCUS_14870 gene ptsP 6560 8290 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence113 1808 1966 gene locus_tag LOCUS_14880 1808 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2071 4347 gene locus_tag LOCUS_14890 2071 4347 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 protein_id gnl|my_center|LOCUS_14890 4415 5266 gene locus_tag LOCUS_14900 4415 5266 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_14900 5276 6367 gene locus_tag LOCUS_14910 5276 6367 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_14910 6372 7166 gene locus_tag LOCUS_14920 6372 7166 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050725350.1 protein_id gnl|my_center|LOCUS_14920 7555 7867 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8770 8075 gene locus_tag LOCUS_14930 8770 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 8782 9390 gene locus_tag LOCUS_14940 8782 9390 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence114 35 1738 gene locus_tag LOCUS_14950 35 1738 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531269.1 protein_id gnl|my_center|LOCUS_14950 1998 3338 gene locus_tag LOCUS_14960 1998 3338 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_14960 3382 4554 gene locus_tag LOCUS_14970 3382 4554 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957591.1 protein_id gnl|my_center|LOCUS_14970 4667 5266 gene locus_tag LOCUS_14980 4667 5266 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198059.1 protein_id gnl|my_center|LOCUS_14980 5281 6612 gene locus_tag LOCUS_14990 gene dinF 5281 6612 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113593407.1 protein_id gnl|my_center|LOCUS_14990 6836 7354 gene locus_tag LOCUS_15000 gene moaB 6836 7354 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617455.1 protein_id gnl|my_center|LOCUS_15000 7453 8328 gene locus_tag LOCUS_15010 7453 8328 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_15010 8792 8511 gene locus_tag LOCUS_15020 8792 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 9405 9040 gene locus_tag LOCUS_15030 9405 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence115 137 1387 gene locus_tag LOCUS_15040 137 1387 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_15040 1406 2665 gene locus_tag LOCUS_15050 1406 2665 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_15050 2658 3359 gene locus_tag LOCUS_15060 gene lolD 2658 3359 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263326.1 protein_id gnl|my_center|LOCUS_15060 3413 5929 gene locus_tag LOCUS_15070 3413 5929 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063648.1 protein_id gnl|my_center|LOCUS_15070 5979 7445 gene locus_tag LOCUS_15080 5979 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 7465 8892 gene locus_tag LOCUS_15090 7465 8892 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_15090 8954 9250 gene locus_tag LOCUS_15100 8954 9250 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314681.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence116 2219 150 gene locus_tag LOCUS_15110 gene ppk1 2219 150 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 protein_id gnl|my_center|LOCUS_15110 3063 2353 gene locus_tag LOCUS_15120 gene phoU 3063 2353 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096661.1 protein_id gnl|my_center|LOCUS_15120 4133 3261 gene locus_tag LOCUS_15130 gene pstB 4133 3261 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401255.1 protein_id gnl|my_center|LOCUS_15130 5800 4130 gene locus_tag LOCUS_15140 gene pstA 5800 4130 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_15140 8070 5797 gene locus_tag LOCUS_15150 8070 5797 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768357.1 protein_id gnl|my_center|LOCUS_15150 9070 8105 gene locus_tag LOCUS_15160 gene pstS 9070 8105 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence117 231 737 gene locus_tag LOCUS_15170 231 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2669 765 gene locus_tag LOCUS_15180 gene ppiD 2669 765 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817666.1 protein_id gnl|my_center|LOCUS_15180 2809 2732 gene locus_tag LOCUS_t00140 2809 2732 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2894 2819 gene locus_tag LOCUS_t00150 2894 2819 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3281 3066 gene locus_tag LOCUS_15190 3281 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 4234 3449 gene locus_tag LOCUS_15200 4234 3449 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400448.1 protein_id gnl|my_center|LOCUS_15200 5226 4231 gene locus_tag LOCUS_15210 gene birA 5226 4231 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262797.1 protein_id gnl|my_center|LOCUS_15210 6076 5219 gene locus_tag LOCUS_15220 6076 5219 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 protein_id gnl|my_center|LOCUS_15220 6332 7057 gene locus_tag LOCUS_15230 6332 7057 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895583.1 protein_id gnl|my_center|LOCUS_15230 8051 7077 gene locus_tag LOCUS_15240 gene cysB 8051 7077 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_15240 8243 9028 gene locus_tag LOCUS_15250 8243 9028 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence118 3 1637 gene locus_tag LOCUS_15260 3 1637 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262417.1 protein_id gnl|my_center|LOCUS_15260 1643 1765 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1800 3941 gene locus_tag LOCUS_15270 1800 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 6044 4251 gene locus_tag LOCUS_15280 6044 4251 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719727.1 protein_id gnl|my_center|LOCUS_15280 6156 6413 gene locus_tag LOCUS_15290 gene rpsP 6156 6413 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023081.1 protein_id gnl|my_center|LOCUS_15290 6419 6976 gene locus_tag LOCUS_15300 gene rimM 6419 6976 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098350.1 protein_id gnl|my_center|LOCUS_15300 7026 7766 gene locus_tag LOCUS_15310 gene trmD 7026 7766 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393426.1 protein_id gnl|my_center|LOCUS_15310 7824 8180 gene locus_tag LOCUS_15320 gene rplS 7824 8180 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946144.1 protein_id gnl|my_center|LOCUS_15320 8191 9075 gene locus_tag LOCUS_15330 gene xerD 8191 9075 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209933.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence119 1178 186 gene locus_tag LOCUS_15340 1178 186 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_15340 1717 1175 gene locus_tag LOCUS_15350 1717 1175 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_15350 2625 1714 gene locus_tag LOCUS_15360 2625 1714 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_15360 3429 2635 gene locus_tag LOCUS_15370 3429 2635 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929880.1 protein_id gnl|my_center|LOCUS_15370 5709 3466 gene locus_tag LOCUS_15380 5709 3466 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_15380 7060 5819 gene locus_tag LOCUS_15390 gene kynU 7060 5819 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114854.1 protein_id gnl|my_center|LOCUS_15390 7164 8078 gene locus_tag LOCUS_15400 7164 8078 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225700.1 protein_id gnl|my_center|LOCUS_15400 8075 8956 gene locus_tag LOCUS_15410 gene prmB 8075 8956 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence120 <1 2622 gene locus_tag LOCUS_15420 <1 2622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104263.1:autotransporter domain-containing protein 2937 2677 gene locus_tag LOCUS_15430 2937 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 4042 2978 gene locus_tag LOCUS_15440 4042 2978 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184633.1 protein_id gnl|my_center|LOCUS_15440 5168 4071 gene locus_tag LOCUS_15450 5168 4071 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921427.1 protein_id gnl|my_center|LOCUS_15450 5209 5458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5542 5853 gene locus_tag LOCUS_15460 5542 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 7403 5862 gene locus_tag LOCUS_15470 7403 5862 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054402.1 protein_id gnl|my_center|LOCUS_15470 8545 7493 gene locus_tag LOCUS_15480 gene aroG 8545 7493 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_15480 8908 8552 gene locus_tag LOCUS_15490 8908 8552 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140931.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence121 380 1288 gene locus_tag LOCUS_15500 380 1288 CDS product methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532031.1 protein_id gnl|my_center|LOCUS_15500 1420 1345 gene locus_tag LOCUS_t00160 1420 1345 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2392 1550 gene locus_tag LOCUS_15510 2392 1550 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532045.1 protein_id gnl|my_center|LOCUS_15510 2429 3296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3609 3391 gene locus_tag LOCUS_15520 3609 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3651 4112 gene locus_tag LOCUS_15530 3651 4112 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869225.1 protein_id gnl|my_center|LOCUS_15530 4132 5982 gene locus_tag LOCUS_15540 4132 5982 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869226.1 protein_id gnl|my_center|LOCUS_15540 6016 7281 gene locus_tag LOCUS_15550 6016 7281 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812847.1 protein_id gnl|my_center|LOCUS_15550 7278 7529 gene locus_tag LOCUS_15560 7278 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 7576 7782 gene locus_tag LOCUS_15570 7576 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 7846 7998 gene locus_tag LOCUS_15580 7846 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 8065 8343 gene locus_tag LOCUS_15590 8065 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 8377 8562 gene locus_tag LOCUS_15600 8377 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence122 731 2311 gene locus_tag LOCUS_15610 731 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 3461 2415 gene locus_tag LOCUS_15620 3461 2415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_15620 5031 3454 gene locus_tag LOCUS_15630 5031 3454 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_15630 6271 5282 gene locus_tag LOCUS_15640 6271 5282 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_15640 6627 8726 gene locus_tag LOCUS_15650 gene piuA 6627 8726 CDS product TonB-dependent siderophore receptor PiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_15650 8883 8710 gene locus_tag LOCUS_15660 8883 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence123 63 3386 gene locus_tag LOCUS_15670 63 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3383 4240 gene locus_tag LOCUS_15680 3383 4240 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223811.1 protein_id gnl|my_center|LOCUS_15680 4337 5941 gene locus_tag LOCUS_15690 4337 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 6851 5901 gene locus_tag LOCUS_15700 gene gshB 6851 5901 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316740.1 protein_id gnl|my_center|LOCUS_15700 6900 7853 gene locus_tag LOCUS_15710 gene hemC 6900 7853 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 protein_id gnl|my_center|LOCUS_15710 7918 8694 gene locus_tag LOCUS_15720 7918 8694 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958636.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence124 <1 2718 gene locus_tag LOCUS_15730 <1 2718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880782.1:sulfur reductase subunit SreA 2715 3416 gene locus_tag LOCUS_15740 2715 3416 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902581.1 protein_id gnl|my_center|LOCUS_15740 3413 3565 gene locus_tag LOCUS_15750 3413 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3572 4462 gene locus_tag LOCUS_15760 3572 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 6016 4475 gene locus_tag LOCUS_15770 6016 4475 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767323.1 protein_id gnl|my_center|LOCUS_15770 8347 6095 gene locus_tag LOCUS_15780 8347 6095 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence125 809 171 gene locus_tag LOCUS_15790 gene grpE 809 171 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313642.1 protein_id gnl|my_center|LOCUS_15790 1916 858 gene locus_tag LOCUS_15800 gene hrcA 1916 858 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_15800 2041 2907 gene locus_tag LOCUS_15810 2041 2907 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409651.1 protein_id gnl|my_center|LOCUS_15810 2946 4610 gene locus_tag LOCUS_15820 gene recN 2946 4610 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113905.1 protein_id gnl|my_center|LOCUS_15820 5212 4607 gene locus_tag LOCUS_15830 gene cobO 5212 4607 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894344.1 protein_id gnl|my_center|LOCUS_15830 7211 5382 gene locus_tag LOCUS_15840 gene btuB 7211 5382 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence126 2 658 gene locus_tag LOCUS_15850 2 658 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311274.1 protein_id gnl|my_center|LOCUS_15850 1424 672 gene locus_tag LOCUS_15860 1424 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 5491 2057 gene locus_tag LOCUS_15870 gene mfd 5491 2057 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_15870 5928 5647 gene locus_tag LOCUS_15880 5928 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 6220 5939 gene locus_tag LOCUS_15890 6220 5939 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 protein_id gnl|my_center|LOCUS_15890 7934 6252 gene locus_tag LOCUS_15900 gene rpsA 7934 6252 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_15900 <8669 7972 gene locus_tag LOCUS_15910 <8669 7972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072382.1:(d)CMP kinase >Feature sequence127 75 275 gene locus_tag LOCUS_15920 75 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 304 1263 gene locus_tag LOCUS_15930 304 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1308 2258 gene locus_tag LOCUS_15940 gene pip 1308 2258 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_15940 2259 3086 gene locus_tag LOCUS_15950 gene folP 2259 3086 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_15950 4232 3123 gene locus_tag LOCUS_15960 gene pqqE 4232 3123 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269165.1 protein_id gnl|my_center|LOCUS_15960 4512 4249 gene locus_tag LOCUS_15970 gene pqqD 4512 4249 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088542.1 protein_id gnl|my_center|LOCUS_15970 5243 4509 gene locus_tag LOCUS_15980 gene pqqC 5243 4509 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111679.1 protein_id gnl|my_center|LOCUS_15980 5507 6958 gene locus_tag LOCUS_15990 5507 6958 CDS product DUF6513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532040.1 protein_id gnl|my_center|LOCUS_15990 6955 7506 gene locus_tag LOCUS_16000 6955 7506 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532039.1 protein_id gnl|my_center|LOCUS_16000 7520 8236 gene locus_tag LOCUS_16010 7520 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence128 1135 155 gene locus_tag LOCUS_16020 1135 155 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035906.1 protein_id gnl|my_center|LOCUS_16020 1767 1141 gene locus_tag LOCUS_16030 1767 1141 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339194.1 protein_id gnl|my_center|LOCUS_16030 2677 1757 gene locus_tag LOCUS_16040 2677 1757 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974641.1 protein_id gnl|my_center|LOCUS_16040 3363 2707 gene locus_tag LOCUS_16050 3363 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3784 3350 gene locus_tag LOCUS_16060 3784 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 5248 4022 gene locus_tag LOCUS_16070 5248 4022 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 protein_id gnl|my_center|LOCUS_16070 7034 5256 gene locus_tag LOCUS_16080 gene gspE 7034 5256 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_16080 7609 7031 gene locus_tag LOCUS_16090 7609 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 <8583 7606 gene locus_tag LOCUS_16100 <8583 7606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035907.1:PilN domain-containing protein >Feature sequence129 931 23 gene locus_tag LOCUS_16110 931 23 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_16110 1561 1052 gene locus_tag LOCUS_16120 1561 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3281 1974 gene locus_tag LOCUS_16130 3281 1974 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038438.1 protein_id gnl|my_center|LOCUS_16130 3631 3332 gene locus_tag LOCUS_16140 3631 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 4725 3631 gene locus_tag LOCUS_16150 gene tgt 4725 3631 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100607.1 protein_id gnl|my_center|LOCUS_16150 5825 4758 gene locus_tag LOCUS_16160 gene queA 5825 4758 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073010.1 protein_id gnl|my_center|LOCUS_16160 5880 5966 gene locus_tag LOCUS_t00170 5880 5966 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8261 6141 gene locus_tag LOCUS_16170 8261 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 8513 8367 gene locus_tag LOCUS_16180 8513 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence130 992 2791 gene locus_tag LOCUS_16190 992 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2995 4263 gene locus_tag LOCUS_16200 2995 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4297 5790 gene locus_tag LOCUS_16210 4297 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 5911 7452 gene locus_tag LOCUS_16220 5911 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 7578 8423 gene locus_tag LOCUS_16230 7578 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence131 1088 165 gene locus_tag LOCUS_16240 1088 165 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030811.1 protein_id gnl|my_center|LOCUS_16240 1464 1129 gene locus_tag LOCUS_16250 1464 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2528 1464 gene locus_tag LOCUS_16260 2528 1464 CDS product phenol 2-monooxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206216.1 protein_id gnl|my_center|LOCUS_16260 2901 2539 gene locus_tag LOCUS_16270 2901 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4462 2936 gene locus_tag LOCUS_16280 4462 2936 CDS product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 protein_id gnl|my_center|LOCUS_16280 4753 4481 gene locus_tag LOCUS_16290 4753 4481 CDS product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049448.1 protein_id gnl|my_center|LOCUS_16290 5755 4760 gene locus_tag LOCUS_16300 5755 4760 CDS product aromatic/alkene monooxygenase hydroxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206218.1 protein_id gnl|my_center|LOCUS_16300 6023 5766 gene locus_tag LOCUS_16310 6023 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 6245 7069 gene locus_tag LOCUS_16320 6245 7069 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 protein_id gnl|my_center|LOCUS_16320 7145 8437 gene locus_tag LOCUS_16330 7145 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence132 883 77 gene locus_tag LOCUS_16340 883 77 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200872.1 protein_id gnl|my_center|LOCUS_16340 1429 989 gene locus_tag LOCUS_16350 1429 989 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975662.1 protein_id gnl|my_center|LOCUS_16350 3500 1443 gene locus_tag LOCUS_16360 3500 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 5435 3627 gene locus_tag LOCUS_16370 5435 3627 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_16370 8233 5495 gene locus_tag LOCUS_16380 8233 5495 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265674.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence133 186 617 gene locus_tag LOCUS_16390 gene gspG 186 617 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_16390 826 1278 gene locus_tag LOCUS_16400 826 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1319 1660 gene locus_tag LOCUS_16410 1319 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1677 2312 gene locus_tag LOCUS_16420 1677 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2263 3246 gene locus_tag LOCUS_16430 2263 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 3230 3718 gene locus_tag LOCUS_16440 3230 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 3703 3939 gene locus_tag LOCUS_16450 3703 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 3936 4508 gene locus_tag LOCUS_16460 3936 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 4514 5008 gene locus_tag LOCUS_16470 4514 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 5023 6753 gene locus_tag LOCUS_16480 gene gspE 5023 6753 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_16480 6848 7090 gene locus_tag LOCUS_16490 6848 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 7090 7314 gene locus_tag LOCUS_16500 7090 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 7950 7573 gene locus_tag LOCUS_16510 7950 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence134 2416 2117 gene locus_tag LOCUS_16520 2416 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 6018 2722 gene locus_tag LOCUS_16530 6018 2722 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_16530 <8430 6285 gene locus_tag LOCUS_16540 <8430 6285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265961.1:TonB-dependent receptor >Feature sequence135 2621 72 gene locus_tag LOCUS_16550 2621 72 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206901.1 protein_id gnl|my_center|LOCUS_16550 4896 2632 gene locus_tag LOCUS_16560 4896 2632 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_16560 6153 5110 gene locus_tag LOCUS_16570 6153 5110 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921521.1 protein_id gnl|my_center|LOCUS_16570 6323 6751 gene locus_tag LOCUS_16580 6323 6751 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 protein_id gnl|my_center|LOCUS_16580 8155 6722 gene locus_tag LOCUS_16590 gene iaaH 8155 6722 CDS product indoleacetamide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921522.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence136 2004 586 gene locus_tag LOCUS_16600 2004 586 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931299.1 protein_id gnl|my_center|LOCUS_16600 2231 2007 gene locus_tag LOCUS_16610 2231 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16610 3780 2266 gene locus_tag LOCUS_16620 3780 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16620 5879 3789 gene locus_tag LOCUS_16630 5879 3789 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089915.1 protein_id gnl|my_center|LOCUS_16630 6688 5891 gene locus_tag LOCUS_16640 6688 5891 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969871.1 protein_id gnl|my_center|LOCUS_16640 7526 6693 gene locus_tag LOCUS_16650 7526 6693 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_16650 8110 7676 gene locus_tag LOCUS_16660 8110 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence137 922 23 gene locus_tag LOCUS_16670 922 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2240 1365 gene locus_tag LOCUS_16680 2240 1365 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_16680 3067 2285 gene locus_tag LOCUS_16690 3067 2285 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_16690 3832 3197 gene locus_tag LOCUS_16700 gene rsmG 3832 3197 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377883.1 protein_id gnl|my_center|LOCUS_16700 5125 3875 gene locus_tag LOCUS_16710 5125 3875 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_16710 5308 5496 gene locus_tag LOCUS_16720 5308 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 7451 5571 gene locus_tag LOCUS_16730 gene mnmG 7451 5571 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114649.1 protein_id gnl|my_center|LOCUS_16730 7913 7497 gene locus_tag LOCUS_16740 7913 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence138 <1 682 gene locus_tag LOCUS_16750 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931644.1:imidazole glycerol phosphate synthase subunit HisH 897 766 gene locus_tag LOCUS_16760 897 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1081 1491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1752 2447 gene locus_tag LOCUS_16770 1752 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 4310 2751 gene locus_tag LOCUS_16780 gene purH 4310 2751 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207145.1 protein_id gnl|my_center|LOCUS_16780 4579 4307 gene locus_tag LOCUS_16790 gene fis 4579 4307 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121116.1 protein_id gnl|my_center|LOCUS_16790 5609 4758 gene locus_tag LOCUS_16800 5609 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 6967 5624 gene locus_tag LOCUS_16810 gene accC 6967 5624 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884888.1 protein_id gnl|my_center|LOCUS_16810 6993 7045 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7609 7136 gene locus_tag LOCUS_16820 gene accB 7609 7136 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110495.1 protein_id gnl|my_center|LOCUS_16820 8059 7619 gene locus_tag LOCUS_16830 gene aroQ 8059 7619 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035767.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence139 1076 189 gene locus_tag LOCUS_16840 1076 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1354 2490 gene locus_tag LOCUS_16850 1354 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2753 6214 gene locus_tag LOCUS_16860 2753 6214 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388876.1 protein_id gnl|my_center|LOCUS_16860 6492 6238 gene locus_tag LOCUS_16870 6492 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 6840 6529 gene locus_tag LOCUS_16880 6840 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence140 498 220 gene locus_tag LOCUS_16890 498 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 664 1608 gene locus_tag LOCUS_16900 664 1608 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727553.1 protein_id gnl|my_center|LOCUS_16900 2076 4205 gene locus_tag LOCUS_16910 2076 4205 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073633.1 protein_id gnl|my_center|LOCUS_16910 4446 5420 gene locus_tag LOCUS_16920 4446 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 5469 5654 gene locus_tag LOCUS_16930 5469 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 5754 7985 gene locus_tag LOCUS_16940 5754 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence141 1 657 gene locus_tag LOCUS_16950 gene argB 1 657 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544977.1 protein_id gnl|my_center|LOCUS_16950 1489 650 gene locus_tag LOCUS_16960 1489 650 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_16960 1606 2409 gene locus_tag LOCUS_16970 gene hpaH 1606 2409 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095451.1 protein_id gnl|my_center|LOCUS_16970 2633 3415 gene locus_tag LOCUS_16980 gene hpaI 2633 3415 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889550.1 protein_id gnl|my_center|LOCUS_16980 3396 4145 gene locus_tag LOCUS_16990 3396 4145 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889485.1 protein_id gnl|my_center|LOCUS_16990 4142 4915 gene locus_tag LOCUS_17000 4142 4915 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009485356.1 protein_id gnl|my_center|LOCUS_17000 4915 7413 gene locus_tag LOCUS_17010 4915 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 6396 6556 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7416 7814 gene locus_tag LOCUS_17020 7416 7814 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101265.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence142 158 424 gene locus_tag LOCUS_17030 158 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 436 1575 gene locus_tag LOCUS_17040 gene pdxB 436 1575 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112396.1 protein_id gnl|my_center|LOCUS_17040 1572 2177 gene locus_tag LOCUS_17050 gene purN 1572 2177 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020374.1 protein_id gnl|my_center|LOCUS_17050 2486 2304 gene locus_tag LOCUS_17060 2486 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2960 2487 gene locus_tag LOCUS_17070 2960 2487 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_17070 3008 5494 gene locus_tag LOCUS_17080 3008 5494 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_17080 5655 6290 gene locus_tag LOCUS_17090 5655 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 6311 6565 gene locus_tag LOCUS_17100 6311 6565 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_17100 6651 7910 gene locus_tag LOCUS_17110 gene murA 6651 7910 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence143 1380 64 gene locus_tag LOCUS_17120 gene deoA 1380 64 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707412.1 protein_id gnl|my_center|LOCUS_17120 1515 3227 gene locus_tag LOCUS_17130 1515 3227 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_17130 3233 4777 gene locus_tag LOCUS_17140 3233 4777 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093938.1 protein_id gnl|my_center|LOCUS_17140 4833 5597 gene locus_tag LOCUS_17150 4833 5597 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_17150 6958 5618 gene locus_tag LOCUS_17160 6958 5618 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_17160 <7878 7230 gene locus_tag LOCUS_17170 <7878 7230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002119684.1:2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase >Feature sequence144 1460 588 gene locus_tag LOCUS_17180 gene metF 1460 588 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_17180 2974 1559 gene locus_tag LOCUS_17190 gene ahcY 2974 1559 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038714.1 protein_id gnl|my_center|LOCUS_17190 5417 3102 gene locus_tag LOCUS_17200 5417 3102 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639902.1 protein_id gnl|my_center|LOCUS_17200 7138 5558 gene locus_tag LOCUS_17210 7138 5558 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926625.1 protein_id gnl|my_center|LOCUS_17210 <7848 7284 gene locus_tag LOCUS_17220 <7848 7284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210266672.1:DEAD/DEAH box helicase >Feature sequence145 <1 1475 gene locus_tag LOCUS_17230 <1 1475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090275.1:FAD-linked oxidase C-terminal domain-containing protein 1573 2799 gene locus_tag LOCUS_17240 gene glcE 1573 2799 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577785.1 protein_id gnl|my_center|LOCUS_17240 2802 4070 gene locus_tag LOCUS_17250 gene glcF 2802 4070 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090272.1 protein_id gnl|my_center|LOCUS_17250 4162 4076 gene locus_tag LOCUS_t00180 4162 4076 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4287 4214 gene locus_tag LOCUS_t00190 4287 4214 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4426 4351 gene locus_tag LOCUS_t00200 4426 4351 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4485 4522 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5077 4523 gene locus_tag LOCUS_17260 gene pgsA 5077 4523 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737927.1 protein_id gnl|my_center|LOCUS_17260 5736 5083 gene locus_tag LOCUS_17270 5736 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 5769 6508 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <7789 7085 gene locus_tag LOCUS_17280 <7789 7085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968430.1:TonB-dependent receptor >Feature sequence146 <1 1128 gene locus_tag LOCUS_17290 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185886.1:quinolinate synthase NadA 1395 1547 gene locus_tag LOCUS_17300 1395 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1579 2490 gene locus_tag LOCUS_17310 1579 2490 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188032.1 protein_id gnl|my_center|LOCUS_17310 2617 3363 gene locus_tag LOCUS_17320 2617 3363 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072407.1 protein_id gnl|my_center|LOCUS_17320 3366 3887 gene locus_tag LOCUS_17330 gene ruvC 3366 3887 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_17330 3888 4128 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4132 4635 gene locus_tag LOCUS_17340 gene ruvA 4132 4635 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211199.1 protein_id gnl|my_center|LOCUS_17340 4659 5729 gene locus_tag LOCUS_17350 gene ruvB 4659 5729 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707371.1 protein_id gnl|my_center|LOCUS_17350 5760 6434 gene locus_tag LOCUS_17360 gene tolQ 5760 6434 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 protein_id gnl|my_center|LOCUS_17360 6466 6915 gene locus_tag LOCUS_17370 gene tolR 6466 6915 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence147 125 418 gene locus_tag LOCUS_17380 125 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 622 4986 gene locus_tag LOCUS_17390 622 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 5101 5850 gene locus_tag LOCUS_17400 5101 5850 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982194.1 protein_id gnl|my_center|LOCUS_17400 5852 6796 gene locus_tag LOCUS_17410 5852 6796 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence148 3303 2173 gene locus_tag LOCUS_17420 3303 2173 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_17420 4793 3303 gene locus_tag LOCUS_17430 4793 3303 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972706.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence149 3046 767 gene locus_tag LOCUS_17440 3046 767 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_17440 3189 4178 gene locus_tag LOCUS_17450 3189 4178 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463394.1 protein_id gnl|my_center|LOCUS_17450 5021 4098 gene locus_tag LOCUS_17460 5021 4098 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_17460 5415 5032 gene locus_tag LOCUS_17470 gene apaG 5415 5032 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186878.1 protein_id gnl|my_center|LOCUS_17470 7001 5499 gene locus_tag LOCUS_17480 7001 5499 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_17480 7346 7074 gene locus_tag LOCUS_17490 7346 7074 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958608.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence150 916 2058 gene locus_tag LOCUS_17500 916 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2134 2688 gene locus_tag LOCUS_17510 gene hslV 2134 2688 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_17510 2688 4064 gene locus_tag LOCUS_17520 gene hslU 2688 4064 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293370.1 protein_id gnl|my_center|LOCUS_17520 4070 4414 gene locus_tag LOCUS_17530 4070 4414 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_17530 4539 5273 gene locus_tag LOCUS_17540 gene ubiE 4539 5273 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224024.1 protein_id gnl|my_center|LOCUS_17540 5299 5895 gene locus_tag LOCUS_17550 5299 5895 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368846.1 protein_id gnl|my_center|LOCUS_17550 5883 7541 gene locus_tag LOCUS_17560 gene ubiB 5883 7541 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958605.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence151 210 392 gene locus_tag LOCUS_17570 210 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 408 1592 gene locus_tag LOCUS_17580 408 1592 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_17580 3018 1735 gene locus_tag LOCUS_17590 3018 1735 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_17590 4190 3015 gene locus_tag LOCUS_17600 4190 3015 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 protein_id gnl|my_center|LOCUS_17600 4394 4209 gene locus_tag LOCUS_17610 4394 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 5290 4424 gene locus_tag LOCUS_17620 gene hflC 5290 4424 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763025.1 protein_id gnl|my_center|LOCUS_17620 6447 5287 gene locus_tag LOCUS_17630 gene hflK 6447 5287 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_17630 7594 6497 gene locus_tag LOCUS_17640 gene hflX 7594 6497 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704865.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence152 <1 732 gene locus_tag LOCUS_17650 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167121746.1:Fic family protein 742 3945 gene locus_tag LOCUS_17660 742 3945 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_17660 4108 3908 gene locus_tag LOCUS_17670 4108 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4103 5113 gene locus_tag LOCUS_17680 4103 5113 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 protein_id gnl|my_center|LOCUS_17680 5179 5826 gene locus_tag LOCUS_17690 gene maiA 5179 5826 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522863.1 protein_id gnl|my_center|LOCUS_17690 5839 6540 gene locus_tag LOCUS_17700 5839 6540 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 protein_id gnl|my_center|LOCUS_17700 6552 7208 gene locus_tag LOCUS_17710 6552 7208 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104565.1 protein_id gnl|my_center|LOCUS_17710 7352 7564 gene locus_tag LOCUS_17720 7352 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence153 264 977 gene locus_tag LOCUS_17730 264 977 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_17730 1059 2360 gene locus_tag LOCUS_17740 1059 2360 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739890.1 protein_id gnl|my_center|LOCUS_17740 2405 2743 gene locus_tag LOCUS_17750 gene glnK 2405 2743 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_17750 2834 3643 gene locus_tag LOCUS_17760 gene aroE 2834 3643 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 protein_id gnl|my_center|LOCUS_17760 5029 3716 gene locus_tag LOCUS_17770 5029 3716 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_17770 5631 5026 gene locus_tag LOCUS_17780 5631 5026 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence154 25 1377 gene locus_tag LOCUS_17790 gene gorA 25 1377 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463388.1 protein_id gnl|my_center|LOCUS_17790 2304 1426 gene locus_tag LOCUS_17800 2304 1426 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_17800 2456 3214 gene locus_tag LOCUS_17810 gene modA 2456 3214 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_17810 3195 3863 gene locus_tag LOCUS_17820 gene modB 3195 3863 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 protein_id gnl|my_center|LOCUS_17820 3863 4972 gene locus_tag LOCUS_17830 3863 4972 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 protein_id gnl|my_center|LOCUS_17830 6650 4920 gene locus_tag LOCUS_17840 6650 4920 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568003.1 protein_id gnl|my_center|LOCUS_17840 6865 7293 gene locus_tag LOCUS_17850 6865 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence155 2173 53 gene locus_tag LOCUS_17860 2173 53 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064349.1 protein_id gnl|my_center|LOCUS_17860 2375 2302 gene locus_tag LOCUS_t00210 2375 2302 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2489 3148 gene locus_tag LOCUS_17870 gene npdG 2489 3148 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_17870 3181 3822 gene locus_tag LOCUS_17880 3181 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4629 3838 gene locus_tag LOCUS_17890 4629 3838 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010657.1 protein_id gnl|my_center|LOCUS_17890 5944 4640 gene locus_tag LOCUS_17900 5944 4640 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267749.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence156 2214 136 gene locus_tag LOCUS_17910 2214 136 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074214.1 protein_id gnl|my_center|LOCUS_17910 5096 2211 gene locus_tag LOCUS_17920 5096 2211 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265669.1 protein_id gnl|my_center|LOCUS_17920 5142 5246 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7224 5464 gene locus_tag LOCUS_17930 gene aspS 7224 5464 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123218.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence157 142 414 gene locus_tag LOCUS_17940 142 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 514 3138 gene locus_tag LOCUS_17950 gene leuS 514 3138 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_17950 3245 3763 gene locus_tag LOCUS_17960 3245 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 3824 4891 gene locus_tag LOCUS_17970 gene holA 3824 4891 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_17970 4899 6155 gene locus_tag LOCUS_17980 4899 6155 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_17980 6203 6847 gene locus_tag LOCUS_17990 gene nadD 6203 6847 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence158 1464 652 gene locus_tag LOCUS_18000 1464 652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455010.1 protein_id gnl|my_center|LOCUS_18000 2738 1581 gene locus_tag LOCUS_18010 2738 1581 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_18010 3756 2920 gene locus_tag LOCUS_18020 3756 2920 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669547.1 protein_id gnl|my_center|LOCUS_18020 3882 4107 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4155 4652 gene locus_tag LOCUS_18030 4155 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 4734 4946 gene locus_tag LOCUS_18040 4734 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 5401 6363 gene locus_tag LOCUS_18050 5401 6363 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence159 149 1288 gene locus_tag LOCUS_18060 gene coxB 149 1288 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 protein_id gnl|my_center|LOCUS_18060 1330 2931 gene locus_tag LOCUS_18070 gene ctaD 1330 2931 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074203.1 protein_id gnl|my_center|LOCUS_18070 2941 3072 gene locus_tag LOCUS_18080 2941 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3078 3620 gene locus_tag LOCUS_18090 3078 3620 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_18090 3643 4557 gene locus_tag LOCUS_18100 3643 4557 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_18100 4905 4633 gene locus_tag LOCUS_18110 4905 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 5017 5772 gene locus_tag LOCUS_18120 5017 5772 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946158.1 protein_id gnl|my_center|LOCUS_18120 5762 6808 gene locus_tag LOCUS_18130 gene queG 5762 6808 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence160 356 727 gene locus_tag LOCUS_18140 356 727 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957854.1 protein_id gnl|my_center|LOCUS_18140 1937 996 gene locus_tag LOCUS_18150 gene rpoS 1937 996 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314325.1 protein_id gnl|my_center|LOCUS_18150 2809 1961 gene locus_tag LOCUS_18160 2809 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 3475 2816 gene locus_tag LOCUS_18170 3475 2816 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_18170 4287 3526 gene locus_tag LOCUS_18180 gene surE 4287 3526 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770587.1 protein_id gnl|my_center|LOCUS_18180 5198 4290 gene locus_tag LOCUS_18190 gene argF 5198 4290 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 protein_id gnl|my_center|LOCUS_18190 6372 5200 gene locus_tag LOCUS_18200 6372 5200 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039570.1 protein_id gnl|my_center|LOCUS_18200 7070 6477 gene locus_tag LOCUS_18210 7070 6477 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence161 1176 409 gene locus_tag LOCUS_18220 1176 409 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 protein_id gnl|my_center|LOCUS_18220 1322 2500 gene locus_tag LOCUS_18230 1322 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2506 2868 gene locus_tag LOCUS_18240 2506 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2865 4922 gene locus_tag LOCUS_18250 2865 4922 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258127.1 protein_id gnl|my_center|LOCUS_18250 4929 6779 gene locus_tag LOCUS_18260 4929 6779 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258126.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence162 <1 525 gene locus_tag LOCUS_18270 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071945.1:MotA/TolQ/ExbB proton channel family protein 554 1135 gene locus_tag LOCUS_18280 554 1135 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_18280 1202 1603 gene locus_tag LOCUS_18290 1202 1603 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_18290 1613 2242 gene locus_tag LOCUS_18300 1613 2242 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533089.1 protein_id gnl|my_center|LOCUS_18300 2345 3685 gene locus_tag LOCUS_18310 2345 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 3704 5368 gene locus_tag LOCUS_18320 3704 5368 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102932.1 protein_id gnl|my_center|LOCUS_18320 6439 5501 gene locus_tag LOCUS_18330 6439 5501 CDS product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966742.1 protein_id gnl|my_center|LOCUS_18330 6730 6957 gene locus_tag LOCUS_18340 6730 6957 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810411.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence163 <1 1252 gene locus_tag LOCUS_18350 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209167.1:McrC family protein 1650 1279 gene locus_tag LOCUS_18360 1650 1279 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704672.1 protein_id gnl|my_center|LOCUS_18360 1848 2099 gene locus_tag LOCUS_18370 1848 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2171 2587 gene locus_tag LOCUS_18380 2171 2587 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249840.1 protein_id gnl|my_center|LOCUS_18380 2602 3495 gene locus_tag LOCUS_18390 2602 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3492 6959 gene locus_tag LOCUS_18400 3492 6959 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153439724.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence164 3 269 gene locus_tag LOCUS_18410 3 269 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_18410 296 631 gene locus_tag LOCUS_18420 296 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 639 2054 gene locus_tag LOCUS_18430 gene argH 639 2054 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_18430 2102 5077 gene locus_tag LOCUS_18440 2102 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 5074 5655 gene locus_tag LOCUS_18450 5074 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 5655 6701 gene locus_tag LOCUS_18460 gene mutY 5655 6701 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148958.1 protein_id gnl|my_center|LOCUS_18460 6742 7014 gene locus_tag LOCUS_18470 6742 7014 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947644.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence165 138 1244 gene locus_tag LOCUS_18480 138 1244 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_18480 1251 1796 gene locus_tag LOCUS_18490 1251 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 6836 1965 gene locus_tag LOCUS_18500 6836 1965 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202675.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence166 89 1186 gene locus_tag LOCUS_18510 89 1186 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920254.1 protein_id gnl|my_center|LOCUS_18510 2403 1303 gene locus_tag LOCUS_18520 gene phnW 2403 1303 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112368.1 protein_id gnl|my_center|LOCUS_18520 2513 3289 gene locus_tag LOCUS_18530 2513 3289 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965766.1 protein_id gnl|my_center|LOCUS_18530 3286 4353 gene locus_tag LOCUS_18540 gene mtnA 3286 4353 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948892.1 protein_id gnl|my_center|LOCUS_18540 4454 4528 gene locus_tag LOCUS_t00220 4454 4528 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4598 5551 gene locus_tag LOCUS_18550 4598 5551 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099281.1 protein_id gnl|my_center|LOCUS_18550 5562 6218 gene locus_tag LOCUS_18560 5562 6218 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770208.1 protein_id gnl|my_center|LOCUS_18560 6235 6834 gene locus_tag LOCUS_18570 gene pth 6235 6834 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence167 156 1694 gene locus_tag LOCUS_18580 gene rng 156 1694 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_18580 1708 5688 gene locus_tag LOCUS_18590 1708 5688 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947481.1 protein_id gnl|my_center|LOCUS_18590 5691 6785 gene locus_tag LOCUS_18600 gene mnmA 5691 6785 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097080.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence168 224 1234 gene locus_tag LOCUS_18610 224 1234 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532735.1 protein_id gnl|my_center|LOCUS_18610 1363 2649 gene locus_tag LOCUS_18620 1363 2649 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_18620 2766 4070 gene locus_tag LOCUS_18630 2766 4070 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_18630 4095 5684 gene locus_tag LOCUS_18640 4095 5684 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957831.1 protein_id gnl|my_center|LOCUS_18640 5687 6814 gene locus_tag LOCUS_18650 5687 6814 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967037.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence169 740 1804 gene locus_tag LOCUS_18660 gene hpxD 740 1804 CDS product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097237.1 protein_id gnl|my_center|LOCUS_18660 1810 2793 gene locus_tag LOCUS_18670 1810 2793 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979027.1 protein_id gnl|my_center|LOCUS_18670 3014 5281 gene locus_tag LOCUS_18680 3014 5281 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_18680 5285 6418 gene locus_tag LOCUS_18690 5285 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 6451 6663 gene locus_tag LOCUS_18700 6451 6663 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence170 78 968 gene locus_tag LOCUS_18710 78 968 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815026.1 protein_id gnl|my_center|LOCUS_18710 2127 1024 gene locus_tag LOCUS_18720 2127 1024 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384416.1 protein_id gnl|my_center|LOCUS_18720 2329 3048 gene locus_tag LOCUS_18730 2329 3048 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_18730 3045 3710 gene locus_tag LOCUS_18740 gene gph 3045 3710 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_18740 3798 4622 gene locus_tag LOCUS_18750 gene hpnD 3798 4622 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930256.1 protein_id gnl|my_center|LOCUS_18750 5748 4714 gene locus_tag LOCUS_18760 5748 4714 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522340.1 protein_id gnl|my_center|LOCUS_18760 5884 6516 gene locus_tag LOCUS_18770 gene gmk 5884 6516 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence171 697 356 gene locus_tag LOCUS_18780 697 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1047 2540 gene locus_tag LOCUS_18790 1047 2540 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_18790 2537 3289 gene locus_tag LOCUS_18800 2537 3289 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 protein_id gnl|my_center|LOCUS_18800 3407 3601 gene locus_tag LOCUS_18810 3407 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 3706 3631 gene locus_tag LOCUS_t00230 3706 3631 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3982 3906 gene locus_tag LOCUS_t00240 3982 3906 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4166 4090 gene locus_tag LOCUS_t00250 4166 4090 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4300 4224 gene locus_tag LOCUS_t00260 4300 4224 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5743 4355 gene locus_tag LOCUS_18820 gene cysS 5743 4355 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225718.1 protein_id gnl|my_center|LOCUS_18820 5797 6534 gene locus_tag LOCUS_18830 gene lpxH 5797 6534 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706567.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence172 1498 89 gene locus_tag LOCUS_18840 1498 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 3037 1604 gene locus_tag LOCUS_18850 3037 1604 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031772.1 protein_id gnl|my_center|LOCUS_18850 4195 3098 gene locus_tag LOCUS_18860 4195 3098 CDS product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532992.1 protein_id gnl|my_center|LOCUS_18860 5044 4298 gene locus_tag LOCUS_18870 5044 4298 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112528.1 protein_id gnl|my_center|LOCUS_18870 6323 5499 gene locus_tag LOCUS_18880 6323 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence173 1355 141 gene locus_tag LOCUS_18890 gene tsgA 1355 141 CDS product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874486.1 protein_id gnl|my_center|LOCUS_18890 2017 1352 gene locus_tag LOCUS_18900 gene rutR 2017 1352 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191700.1 protein_id gnl|my_center|LOCUS_18900 2134 3057 gene locus_tag LOCUS_18910 2134 3057 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_18910 3113 4558 gene locus_tag LOCUS_18920 gene hydA 3113 4558 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099919.1 protein_id gnl|my_center|LOCUS_18920 4555 6081 gene locus_tag LOCUS_18930 4555 6081 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389417.1 protein_id gnl|my_center|LOCUS_18930 6273 6518 gene locus_tag LOCUS_18940 6273 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence174 35 1027 gene locus_tag LOCUS_18950 35 1027 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_18950 1020 3545 gene locus_tag LOCUS_18960 1020 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 3580 4128 gene locus_tag LOCUS_18970 3580 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 5093 4347 gene locus_tag LOCUS_18980 5093 4347 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112528.1 protein_id gnl|my_center|LOCUS_18980 5458 5102 gene locus_tag LOCUS_18990 5458 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence175 216 1016 gene locus_tag LOCUS_19000 gene hisN 216 1016 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384990.1 protein_id gnl|my_center|LOCUS_19000 1300 1785 gene locus_tag LOCUS_19010 1300 1785 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_19010 1839 2906 gene locus_tag LOCUS_19020 1839 2906 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_19020 2903 6064 gene locus_tag LOCUS_19030 2903 6064 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence176 1179 1697 gene locus_tag LOCUS_19040 1179 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1705 2424 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2530 3696 gene locus_tag LOCUS_19050 2530 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 3902 5959 gene locus_tag LOCUS_19060 gene paaZ 3902 5959 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705614.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence177 772 89 gene locus_tag LOCUS_19070 772 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1172 939 gene locus_tag LOCUS_19080 1172 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 1215 1466 gene locus_tag LOCUS_19090 1215 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1466 1759 gene locus_tag LOCUS_19100 1466 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1956 2186 gene locus_tag LOCUS_19110 1956 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2186 3727 gene locus_tag LOCUS_19120 2186 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence178 83 2491 gene locus_tag LOCUS_19130 83 2491 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_19130 3780 2581 gene locus_tag LOCUS_19140 3780 2581 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_19140 4100 5029 gene locus_tag LOCUS_19150 4100 5029 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence179 2743 404 gene locus_tag LOCUS_19160 2743 404 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446507.1 protein_id gnl|my_center|LOCUS_19160 4023 2740 gene locus_tag LOCUS_19170 4023 2740 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_19170 4631 4149 gene locus_tag LOCUS_19180 4631 4149 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 protein_id gnl|my_center|LOCUS_19180 <6238 4628 gene locus_tag LOCUS_19190 <6238 4628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093598.1:acyl-CoA synthetase >Feature sequence180 <1 861 gene locus_tag LOCUS_19200 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_082827560.1:triphosphoribosyl-dephospho-CoA synthase 945 1457 gene locus_tag LOCUS_19210 gene fae 945 1457 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532036.1 protein_id gnl|my_center|LOCUS_19210 2205 1510 gene locus_tag LOCUS_19220 2205 1510 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827384.1 protein_id gnl|my_center|LOCUS_19220 2200 3276 gene locus_tag LOCUS_19230 2200 3276 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532038.1 protein_id gnl|my_center|LOCUS_19230 3320 4672 gene locus_tag LOCUS_19240 gene pabB 3320 4672 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816166.1 protein_id gnl|my_center|LOCUS_19240 4673 5272 gene locus_tag LOCUS_19250 4673 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 5478 5978 gene locus_tag LOCUS_19260 5478 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence181 175 354 gene locus_tag LOCUS_19270 175 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1793 351 gene locus_tag LOCUS_19280 1793 351 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_19280 3491 1812 gene locus_tag LOCUS_19290 gene ilvD 3491 1812 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922486.1 protein_id gnl|my_center|LOCUS_19290 3542 4690 gene locus_tag LOCUS_19300 gene argE 3542 4690 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419049.1 protein_id gnl|my_center|LOCUS_19300 4683 6014 gene locus_tag LOCUS_19310 gene argA 4683 6014 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173274.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence182 274 504 gene locus_tag LOCUS_19320 274 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 494 1000 gene locus_tag LOCUS_19330 494 1000 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653660.1 protein_id gnl|my_center|LOCUS_19330 1362 3080 gene locus_tag LOCUS_19340 gene cas1 1362 3080 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_19340 3085 3375 gene locus_tag LOCUS_19350 gene cas2 3085 3375 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940736.1 protein_id gnl|my_center|LOCUS_19350 3580 4280 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaattccgcagcatcgatgctgcggcctcattgaagg 4354 5076 gene locus_tag LOCUS_19360 4354 5076 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_19360 5132 5338 gene locus_tag LOCUS_19370 5132 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 5951 5403 gene locus_tag LOCUS_19380 5951 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence183 3292 461 gene locus_tag LOCUS_19390 gene ileS 3292 461 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073365.1 protein_id gnl|my_center|LOCUS_19390 4293 3334 gene locus_tag LOCUS_19400 gene ribF 4293 3334 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704642.1 protein_id gnl|my_center|LOCUS_19400 5882 4341 gene locus_tag LOCUS_19410 gene murJ 5882 4341 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957545.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence184 1404 193 gene locus_tag LOCUS_19420 gene nhaA 1404 193 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071545.1 protein_id gnl|my_center|LOCUS_19420 1811 1488 gene locus_tag LOCUS_19430 1811 1488 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947640.1 protein_id gnl|my_center|LOCUS_19430 4392 1846 gene locus_tag LOCUS_19440 gene mutS 4392 1846 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957974.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence185 3799 2513 gene locus_tag LOCUS_19450 gene clpX 3799 2513 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301524.1 protein_id gnl|my_center|LOCUS_19450 4474 3842 gene locus_tag LOCUS_19460 gene clpP 4474 3842 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 protein_id gnl|my_center|LOCUS_19460 5790 4471 gene locus_tag LOCUS_19470 gene tig 5790 4471 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087920.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence186 1191 904 gene locus_tag LOCUS_19480 1191 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1500 1222 gene locus_tag LOCUS_19490 1500 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2770 1952 gene locus_tag LOCUS_19500 2770 1952 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057978.1 protein_id gnl|my_center|LOCUS_19500 3341 2805 gene locus_tag LOCUS_19510 3341 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19510 3764 3381 gene locus_tag LOCUS_19520 3764 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19520 5239 3761 gene locus_tag LOCUS_19530 5239 3761 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939561.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence187 <1 627 gene locus_tag LOCUS_19540 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035896.1:DsbC family protein 1336 698 gene locus_tag LOCUS_19550 1336 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1475 2953 gene locus_tag LOCUS_19560 gene hldE 1475 2953 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736892.1 protein_id gnl|my_center|LOCUS_19560 2950 3924 gene locus_tag LOCUS_19570 gene rfaD 2950 3924 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821513.1 protein_id gnl|my_center|LOCUS_19570 3940 3953 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3969 5300 gene locus_tag LOCUS_19580 gene waaA 3969 5300 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957353.1 protein_id gnl|my_center|LOCUS_19580 5398 5769 gene locus_tag LOCUS_19590 5398 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence188 1896 1276 gene locus_tag LOCUS_19600 gene thiE 1896 1276 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038371.1 protein_id gnl|my_center|LOCUS_19600 2695 1925 gene locus_tag LOCUS_19610 2695 1925 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105183.1 protein_id gnl|my_center|LOCUS_19610 3122 2697 gene locus_tag LOCUS_19620 3122 2697 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958512.1 protein_id gnl|my_center|LOCUS_19620 3696 3142 gene locus_tag LOCUS_19630 3696 3142 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 protein_id gnl|my_center|LOCUS_19630 3775 5103 gene locus_tag LOCUS_19640 3775 5103 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965985.1 protein_id gnl|my_center|LOCUS_19640 5582 5136 gene locus_tag LOCUS_19650 gene dksA 5582 5136 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence189 1231 1476 gene locus_tag LOCUS_19660 1231 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1473 1907 gene locus_tag LOCUS_19670 1473 1907 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403837.1 protein_id gnl|my_center|LOCUS_19670 1965 3170 gene locus_tag LOCUS_19680 1965 3170 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_19680 3702 3223 gene locus_tag LOCUS_19690 3702 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 <5715 3775 gene locus_tag LOCUS_19700 <5715 3775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038412.1:sodium-translocating pyrophosphatase >Feature sequence190 909 2972 gene locus_tag LOCUS_19710 909 2972 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_19710 2995 4170 gene locus_tag LOCUS_19720 2995 4170 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence191 <1 604 gene locus_tag LOCUS_19730 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706087.1:glutathione S-transferase family protein 629 2074 gene locus_tag LOCUS_19740 629 2074 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_19740 2075 3004 gene locus_tag LOCUS_19750 2075 3004 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325200.1 protein_id gnl|my_center|LOCUS_19750 3740 2994 gene locus_tag LOCUS_19760 3740 2994 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 protein_id gnl|my_center|LOCUS_19760 <5682 3985 gene locus_tag LOCUS_19770 <5682 3985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968692.1:type I restriction endonuclease subunit R >Feature sequence192 261 46 gene locus_tag LOCUS_19780 261 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1206 292 gene locus_tag LOCUS_19790 gene secF 1206 292 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 protein_id gnl|my_center|LOCUS_19790 3069 1210 gene locus_tag LOCUS_19800 gene secD 3069 1210 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 protein_id gnl|my_center|LOCUS_19800 3397 3071 gene locus_tag LOCUS_19810 gene yajC 3397 3071 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552468.1 protein_id gnl|my_center|LOCUS_19810 4039 3635 gene locus_tag LOCUS_19820 gene msrB 4039 3635 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943090.1 protein_id gnl|my_center|LOCUS_19820 5485 4082 gene locus_tag LOCUS_19830 gene mltF 5485 4082 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455996.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence193 87 581 gene locus_tag LOCUS_19840 87 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1150 1788 gene locus_tag LOCUS_19850 1150 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1992 2252 gene locus_tag LOCUS_19860 1992 2252 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074406.1 protein_id gnl|my_center|LOCUS_19860 2488 2682 gene locus_tag LOCUS_19870 2488 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2733 4565 gene locus_tag LOCUS_19880 2733 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 4556 5050 gene locus_tag LOCUS_19890 4556 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 5087 5326 gene locus_tag LOCUS_19900 5087 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence194 175 987 gene locus_tag LOCUS_19910 175 987 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927833.1 protein_id gnl|my_center|LOCUS_19910 1067 1327 gene locus_tag LOCUS_19920 1067 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1328 1819 gene locus_tag LOCUS_19930 1328 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1809 1997 gene locus_tag LOCUS_19940 1809 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2384 2163 gene locus_tag LOCUS_19950 2384 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2560 4233 gene locus_tag LOCUS_19960 2560 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 4226 5398 gene locus_tag LOCUS_19970 4226 5398 CDS product DUF1864 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074060.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence195 115 2697 gene locus_tag LOCUS_19980 115 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2809 5304 gene locus_tag LOCUS_19990 2809 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence196 947 1945 gene locus_tag LOCUS_20000 947 1945 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 protein_id gnl|my_center|LOCUS_20000 1957 2943 gene locus_tag LOCUS_20010 1957 2943 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037380904.1 protein_id gnl|my_center|LOCUS_20010 2940 3182 gene locus_tag LOCUS_20020 2940 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 3188 4876 gene locus_tag LOCUS_20030 gene atsA 3188 4876 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 protein_id gnl|my_center|LOCUS_20030 5473 5009 gene locus_tag LOCUS_20040 5473 5009 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476513.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence197 128 2380 gene locus_tag LOCUS_20050 128 2380 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265751.1 protein_id gnl|my_center|LOCUS_20050 3680 2445 gene locus_tag LOCUS_20060 3680 2445 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946287.1 protein_id gnl|my_center|LOCUS_20060 5385 3700 gene locus_tag LOCUS_20070 5385 3700 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205212.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence198 868 23 gene locus_tag LOCUS_20080 868 23 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084517.1 protein_id gnl|my_center|LOCUS_20080 1070 861 gene locus_tag LOCUS_20090 gene thiS 1070 861 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_20090 1143 1216 gene locus_tag LOCUS_t00270 1143 1216 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3942 1279 gene locus_tag LOCUS_20100 gene ppdK 3942 1279 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921479.1 protein_id gnl|my_center|LOCUS_20100 <5421 3950 gene locus_tag LOCUS_20110 <5421 3950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706120.1:bifunctional 2-methylcitrate dehydratase/aconitate hydratase >Feature sequence199 302 901 gene locus_tag LOCUS_20120 302 901 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188272.1 protein_id gnl|my_center|LOCUS_20120 898 1887 gene locus_tag LOCUS_20130 898 1887 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_20130 1918 3480 gene locus_tag LOCUS_20140 1918 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2676 2687 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3496 4401 gene locus_tag LOCUS_20150 3496 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence200 <1 724 gene locus_tag LOCUS_20160 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810982.1:HAD family hydrolase 2873 771 gene locus_tag LOCUS_20170 2873 771 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460118.1 protein_id gnl|my_center|LOCUS_20170 2876 2952 gene locus_tag LOCUS_t00280 2876 2952 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3131 5362 gene locus_tag LOCUS_20180 3131 5362 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence201 104 499 gene locus_tag LOCUS_20190 104 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 499 960 gene locus_tag LOCUS_20200 499 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 957 3341 gene locus_tag LOCUS_20210 957 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20210 4645 3467 gene locus_tag LOCUS_20220 4645 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 5208 4657 gene locus_tag LOCUS_20230 gene pal 5208 4657 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038133.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence202 582 815 gene locus_tag LOCUS_20240 gene moaD 582 815 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090205.1 protein_id gnl|my_center|LOCUS_20240 828 1277 gene locus_tag LOCUS_20250 gene moaE 828 1277 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_20250 1336 2265 gene locus_tag LOCUS_20260 gene pqqB 1336 2265 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038060.1 protein_id gnl|my_center|LOCUS_20260 2806 2552 gene locus_tag LOCUS_20270 2806 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2822 4441 gene locus_tag LOCUS_20280 2822 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence203 71 1051 gene locus_tag LOCUS_20290 71 1051 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088828.1 protein_id gnl|my_center|LOCUS_20290 1699 1079 gene locus_tag LOCUS_20300 gene cysC 1699 1079 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 protein_id gnl|my_center|LOCUS_20300 3706 1808 gene locus_tag LOCUS_20310 3706 1808 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_20310 5079 3859 gene locus_tag LOCUS_20320 gene ahcY 5079 3859 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence204 1362 268 gene locus_tag LOCUS_20330 1362 268 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721245.1 protein_id gnl|my_center|LOCUS_20330 2918 1371 gene locus_tag LOCUS_20340 2918 1371 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972706.1 protein_id gnl|my_center|LOCUS_20340 5092 2996 gene locus_tag LOCUS_20350 5092 2996 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044346855.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence205 1997 4777 gene locus_tag LOCUS_20360 1997 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4782 5234 gene locus_tag LOCUS_20370 4782 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence206 347 4498 gene locus_tag LOCUS_20380 347 4498 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence207 411 91 gene locus_tag LOCUS_20390 411 91 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_20390 1536 553 gene locus_tag LOCUS_20400 1536 553 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196428.1 protein_id gnl|my_center|LOCUS_20400 1932 1600 gene locus_tag LOCUS_20410 1932 1600 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_20410 2437 2267 gene locus_tag LOCUS_20420 2437 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2738 2361 gene locus_tag LOCUS_20430 2738 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 3005 2811 gene locus_tag LOCUS_20440 3005 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 4071 3076 gene locus_tag LOCUS_20450 4071 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence208 7 951 gene locus_tag LOCUS_20460 gene ilvE 7 951 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_20460 948 1145 gene locus_tag LOCUS_20470 948 1145 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_20470 1247 3373 gene locus_tag LOCUS_20480 1247 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2197 2254 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3401 4390 gene locus_tag LOCUS_20490 3401 4390 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence209 266 1684 gene locus_tag LOCUS_20500 266 1684 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214414.1 protein_id gnl|my_center|LOCUS_20500 3037 1676 gene locus_tag LOCUS_20510 3037 1676 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_20510 3186 4814 gene locus_tag LOCUS_20520 3186 4814 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085749.1 protein_id gnl|my_center|LOCUS_20520 4817 5083 gene locus_tag LOCUS_20530 4817 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence210 <1 1042 gene locus_tag LOCUS_20540 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225121.1:HAD family hydrolase 1070 2596 gene locus_tag LOCUS_20550 1070 2596 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530132.1 protein_id gnl|my_center|LOCUS_20550 4069 2576 gene locus_tag LOCUS_20560 4069 2576 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098271.1 protein_id gnl|my_center|LOCUS_20560 <5231 4130 gene locus_tag LOCUS_20570 <5231 4130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339450.1:FAD-dependent oxidoreductase >Feature sequence211 178 1326 gene locus_tag LOCUS_20580 178 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 1323 2525 gene locus_tag LOCUS_20590 1323 2525 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 protein_id gnl|my_center|LOCUS_20590 3428 2553 gene locus_tag LOCUS_20600 3428 2553 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence212 1608 241 gene locus_tag LOCUS_20610 gene guaD 1608 241 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263785.1 protein_id gnl|my_center|LOCUS_20610 1696 1771 gene locus_tag LOCUS_t00290 1696 1771 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2937 1906 gene locus_tag LOCUS_20620 2937 1906 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392294.1 protein_id gnl|my_center|LOCUS_20620 4245 2962 gene locus_tag LOCUS_20630 4245 2962 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004110720.1 protein_id gnl|my_center|LOCUS_20630 5060 4254 gene locus_tag LOCUS_20640 5060 4254 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113029.1 protein_id gnl|my_center|LOCUS_20640 >Feature sequence213 1007 24 gene locus_tag LOCUS_20650 gene gpsA 1007 24 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070467.1 protein_id gnl|my_center|LOCUS_20650 1519 1031 gene locus_tag LOCUS_20660 gene secB 1519 1031 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772050.1 protein_id gnl|my_center|LOCUS_20660 2035 1535 gene locus_tag LOCUS_20670 2035 1535 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397172.1 protein_id gnl|my_center|LOCUS_20670 2137 2319 gene locus_tag LOCUS_20680 2137 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 2376 3938 gene locus_tag LOCUS_20690 gene gpmI 2376 3938 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence214 76 495 gene locus_tag LOCUS_20700 76 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 1777 569 gene locus_tag LOCUS_20710 1777 569 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_20710 4354 1781 gene locus_tag LOCUS_20720 4354 1781 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942827.1 protein_id gnl|my_center|LOCUS_20720 5046 4366 gene locus_tag LOCUS_20730 5046 4366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256391.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence215 215 1519 gene locus_tag LOCUS_20740 gene kynU 215 1519 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_20740 1632 2213 gene locus_tag LOCUS_20750 1632 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 2239 3747 gene locus_tag LOCUS_20760 2239 3747 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_20760 3744 4580 gene locus_tag LOCUS_20770 3744 4580 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence216 25 1077 gene locus_tag LOCUS_20780 25 1077 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_20780 1086 1922 gene locus_tag LOCUS_20790 1086 1922 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201854.1 protein_id gnl|my_center|LOCUS_20790 1948 2256 gene locus_tag LOCUS_20800 1948 2256 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266256.1 protein_id gnl|my_center|LOCUS_20800 2290 3483 gene locus_tag LOCUS_20810 2290 3483 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200876.1 protein_id gnl|my_center|LOCUS_20810 3514 4242 gene locus_tag LOCUS_20820 3514 4242 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338043.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence217 4034 330 gene locus_tag LOCUS_20830 gene metH 4034 330 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_20830 4249 5004 gene locus_tag LOCUS_20840 4249 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence218 1038 154 gene locus_tag LOCUS_20850 1038 154 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258385.1 protein_id gnl|my_center|LOCUS_20850 1357 1127 gene locus_tag LOCUS_20860 1357 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 3591 1558 gene locus_tag LOCUS_20870 3591 1558 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973075.1 protein_id gnl|my_center|LOCUS_20870 4461 3604 gene locus_tag LOCUS_20880 4461 3604 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence219 2015 1005 gene locus_tag LOCUS_20890 2015 1005 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_20890 3346 2108 gene locus_tag LOCUS_20900 3346 2108 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_20900 4652 3561 gene locus_tag LOCUS_20910 gene ychF 4652 3561 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence220 3207 184 gene locus_tag LOCUS_20920 3207 184 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242997.1 protein_id gnl|my_center|LOCUS_20920 3702 3211 gene locus_tag LOCUS_20930 gene cutC 3702 3211 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_20930 4591 3695 gene locus_tag LOCUS_20940 gene cutB 4591 3695 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence221 1636 3159 gene locus_tag LOCUS_20950 1636 3159 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 protein_id gnl|my_center|LOCUS_20950 3219 3905 gene locus_tag LOCUS_20960 3219 3905 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729502.1 protein_id gnl|my_center|LOCUS_20960 3988 4167 gene locus_tag LOCUS_20970 3988 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 <4795 4229 gene locus_tag LOCUS_20980 <4795 4229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005616969.1:GTP cyclohydrolase I FolE >Feature sequence222 647 96 gene locus_tag LOCUS_20990 647 96 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097300.1 protein_id gnl|my_center|LOCUS_20990 1173 667 gene locus_tag LOCUS_21000 gene purE 1173 667 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_21000 3584 1188 gene locus_tag LOCUS_21010 gene topA 3584 1188 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958589.1 protein_id gnl|my_center|LOCUS_21010 4735 3608 gene locus_tag LOCUS_21020 gene dprA 4735 3608 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958587.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence223 3228 1069 gene locus_tag LOCUS_21030 gene uvrD 3228 1069 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211475.1 protein_id gnl|my_center|LOCUS_21030 3375 4700 gene locus_tag LOCUS_21040 gene pmbA 3375 4700 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence224 93 1418 gene locus_tag LOCUS_21050 93 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1602 2018 gene locus_tag LOCUS_21060 1602 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2039 2887 gene locus_tag LOCUS_21070 2039 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2950 3696 gene locus_tag LOCUS_21080 2950 3696 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_21080 3693 4529 gene locus_tag LOCUS_21090 3693 4529 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence225 327 1532 gene locus_tag LOCUS_21100 327 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 3735 3478 gene locus_tag LOCUS_21110 3735 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 4090 3824 gene locus_tag LOCUS_21120 4090 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 4497 4087 gene locus_tag LOCUS_21130 4497 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence226 294 1262 gene locus_tag LOCUS_21140 294 1262 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_21140 1476 3356 gene locus_tag LOCUS_21150 gene dxs 1476 3356 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071704.1 protein_id gnl|my_center|LOCUS_21150 4527 3376 gene locus_tag LOCUS_21160 gene aepY 4527 3376 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530031.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence227 1467 76 gene locus_tag LOCUS_21170 gene ffh 1467 76 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092645.1 protein_id gnl|my_center|LOCUS_21170 1736 2539 gene locus_tag LOCUS_21180 1736 2539 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_21180 2627 3907 gene locus_tag LOCUS_21190 2627 3907 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence228 178 1323 gene locus_tag LOCUS_21200 178 1323 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_21200 2299 1358 gene locus_tag LOCUS_21210 2299 1358 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_21210 2909 2607 gene locus_tag LOCUS_21220 2909 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3706 3143 gene locus_tag LOCUS_21230 3706 3143 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383033.1 protein_id gnl|my_center|LOCUS_21230 4158 3706 gene locus_tag LOCUS_21240 4158 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence229 3544 2486 gene locus_tag LOCUS_21250 3544 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 4110 3541 gene locus_tag LOCUS_21260 4110 3541 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626366.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence230 1186 92 gene locus_tag LOCUS_21270 gene zapE 1186 92 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 protein_id gnl|my_center|LOCUS_21270 1429 1187 gene locus_tag LOCUS_21280 1429 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2296 1532 gene locus_tag LOCUS_21290 gene rlmB 2296 1532 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209161.1 protein_id gnl|my_center|LOCUS_21290 4459 2309 gene locus_tag LOCUS_21300 gene rnr 4459 2309 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105236.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence231 1368 169 gene locus_tag LOCUS_21310 1368 169 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855665.1 protein_id gnl|my_center|LOCUS_21310 2927 1368 gene locus_tag LOCUS_21320 2927 1368 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_21320 3979 3044 gene locus_tag LOCUS_21330 gene thiL 3979 3044 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_21330 4433 3984 gene locus_tag LOCUS_21340 gene nusB 4433 3984 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035937.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence232 <1 798 gene locus_tag LOCUS_21350 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259452.1:coenzyme F420-0:L-glutamate ligase 884 1822 gene locus_tag LOCUS_21360 gene cofD 884 1822 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_21360 2652 1831 gene locus_tag LOCUS_21370 2652 1831 CDS product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141101.1 protein_id gnl|my_center|LOCUS_21370 3611 2649 gene locus_tag LOCUS_21380 3611 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640162.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence233 576 779 gene locus_tag LOCUS_21390 576 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 776 1450 gene locus_tag LOCUS_21400 gene deoC 776 1450 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356166.1 protein_id gnl|my_center|LOCUS_21400 2176 1469 gene locus_tag LOCUS_21410 gene deoD 2176 1469 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166923.1 protein_id gnl|my_center|LOCUS_21410 3410 2184 gene locus_tag LOCUS_21420 3410 2184 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456066.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence234 184 1455 gene locus_tag LOCUS_21430 184 1455 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250764.1 protein_id gnl|my_center|LOCUS_21430 2487 1756 gene locus_tag LOCUS_21440 2487 1756 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081162185.1 protein_id gnl|my_center|LOCUS_21440 3673 2516 gene locus_tag LOCUS_21450 3673 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence235 <1 855 gene locus_tag LOCUS_21460 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061087.1:formylmethanofuran dehydrogenase subunit B 994 2658 gene locus_tag LOCUS_21470 994 2658 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922276.1 protein_id gnl|my_center|LOCUS_21470 2655 3551 gene locus_tag LOCUS_21480 gene fhcD 2655 3551 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532026.1 protein_id gnl|my_center|LOCUS_21480 3548 4360 gene locus_tag LOCUS_21490 3548 4360 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532025.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence236 1476 2054 gene locus_tag LOCUS_21500 1476 2054 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222279.1 protein_id gnl|my_center|LOCUS_21500 2054 2872 gene locus_tag LOCUS_21510 gene djlA 2054 2872 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence237 2878 1118 gene locus_tag LOCUS_21520 gene aceK 2878 1118 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038861.1 protein_id gnl|my_center|LOCUS_21520 4203 2905 gene locus_tag LOCUS_21530 gene icd 4203 2905 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence238 73 1080 gene locus_tag LOCUS_21540 73 1080 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_21540 2400 1090 gene locus_tag LOCUS_21550 2400 1090 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035603.1 protein_id gnl|my_center|LOCUS_21550 2488 3015 gene locus_tag LOCUS_21560 2488 3015 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687524.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence239 725 228 gene locus_tag LOCUS_21570 725 228 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525332.1 protein_id gnl|my_center|LOCUS_21570 1091 741 gene locus_tag LOCUS_21580 1091 741 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967765.1 protein_id gnl|my_center|LOCUS_21580 1388 1397 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2040 1780 gene locus_tag LOCUS_21590 2040 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2746 2540 gene locus_tag LOCUS_21600 2746 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 4161 3217 gene locus_tag LOCUS_21610 4161 3217 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence240 876 319 gene locus_tag LOCUS_21620 876 319 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391429.1 protein_id gnl|my_center|LOCUS_21620 971 896 gene locus_tag LOCUS_t00300 971 896 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2493 1111 gene locus_tag LOCUS_21630 gene der 2493 1111 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882245.1 protein_id gnl|my_center|LOCUS_21630 3711 2494 gene locus_tag LOCUS_21640 gene bamB 3711 2494 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428301.1 protein_id gnl|my_center|LOCUS_21640 4359 3727 gene locus_tag LOCUS_21650 4359 3727 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 protein_id gnl|my_center|LOCUS_21650 >Feature sequence241 202 447 gene locus_tag LOCUS_21660 202 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 431 886 gene locus_tag LOCUS_21670 431 886 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142603.1 protein_id gnl|my_center|LOCUS_21670 889 3960 gene locus_tag LOCUS_21680 889 3960 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence242 89 565 gene locus_tag LOCUS_21690 89 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532976.1 protein_id gnl|my_center|LOCUS_21690 2978 732 gene locus_tag LOCUS_21700 2978 732 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265751.1 protein_id gnl|my_center|LOCUS_21700 4069 3086 gene locus_tag LOCUS_21710 4069 3086 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994093.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence243 927 2216 gene locus_tag LOCUS_21720 927 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 3247 2381 gene locus_tag LOCUS_21730 3247 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3836 3447 gene locus_tag LOCUS_21740 3836 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence244 123 566 gene locus_tag LOCUS_21750 123 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 717 642 gene locus_tag LOCUS_t00310 717 642 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 805 730 gene locus_tag LOCUS_t00320 805 730 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2405 981 gene locus_tag LOCUS_21760 gene gltX 2405 981 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815864.1 protein_id gnl|my_center|LOCUS_21760 3957 2413 gene locus_tag LOCUS_21770 3957 2413 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114595.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence245 763 269 gene locus_tag LOCUS_21780 763 269 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_21780 893 1837 gene locus_tag LOCUS_21790 gene ispB 893 1837 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261094.1 protein_id gnl|my_center|LOCUS_21790 1879 1955 gene locus_tag LOCUS_t00330 1879 1955 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2031 4040 gene locus_tag LOCUS_21800 2031 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence246 822 37 gene locus_tag LOCUS_21810 822 37 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 protein_id gnl|my_center|LOCUS_21810 1849 941 gene locus_tag LOCUS_21820 gene cysM 1849 941 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_21820 2307 1867 gene locus_tag LOCUS_21830 gene rimI 2307 1867 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_21830 3097 2318 gene locus_tag LOCUS_21840 3097 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 <4084 3139 gene locus_tag LOCUS_21850 <4084 3139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522419.1:2-isopropylmalate synthase >Feature sequence247 <1 776 gene locus_tag LOCUS_21860 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249661.1:DUF364 domain-containing protein 1007 771 gene locus_tag LOCUS_21870 1007 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 1423 1166 gene locus_tag LOCUS_21880 1423 1166 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002804328.1 protein_id gnl|my_center|LOCUS_21880 2694 1639 gene locus_tag LOCUS_21890 2694 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3383 3652 gene locus_tag LOCUS_21900 3383 3652 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_21900 3661 3900 gene locus_tag LOCUS_21910 3661 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence248 1971 418 gene locus_tag LOCUS_21920 1971 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 3476 2115 gene locus_tag LOCUS_21930 3476 2115 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence249 1689 442 gene locus_tag LOCUS_21940 1689 442 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_21940 1887 2855 gene locus_tag LOCUS_21950 gene fabK 1887 2855 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938889.1 protein_id gnl|my_center|LOCUS_21950 2906 3769 gene locus_tag LOCUS_21960 2906 3769 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence250 6 1136 gene locus_tag LOCUS_21970 gene dnaJ 6 1136 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377482.1 protein_id gnl|my_center|LOCUS_21970 1308 2075 gene locus_tag LOCUS_21980 gene dapB 1308 2075 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706537.1 protein_id gnl|my_center|LOCUS_21980 2078 2557 gene locus_tag LOCUS_21990 2078 2557 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 protein_id gnl|my_center|LOCUS_21990 2814 3812 gene locus_tag LOCUS_22000 2814 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence251 1091 174 gene locus_tag LOCUS_22010 1091 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 3789 1405 gene locus_tag LOCUS_22020 3789 1405 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038151.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence252 190 1074 gene locus_tag LOCUS_22030 190 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 1343 2524 gene locus_tag LOCUS_22040 1343 2524 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_22040 <3955 2750 gene locus_tag LOCUS_22050 <3955 2750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226231.1:beta-galactosidase >Feature sequence253 34 2325 gene locus_tag LOCUS_22060 34 2325 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_22060 3833 2541 gene locus_tag LOCUS_22070 3833 2541 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence254 2264 129 gene locus_tag LOCUS_22080 2264 129 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731555.1 protein_id gnl|my_center|LOCUS_22080 2470 3039 gene locus_tag LOCUS_22090 2470 3039 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975053.1 protein_id gnl|my_center|LOCUS_22090 3069 3299 gene locus_tag LOCUS_22100 3069 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence255 1144 929 gene locus_tag LOCUS_22110 1144 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 1224 1409 gene locus_tag LOCUS_22120 1224 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 2833 1652 gene locus_tag LOCUS_22130 2833 1652 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_22130 3188 2886 gene locus_tag LOCUS_22140 3188 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 3519 3268 gene locus_tag LOCUS_22150 3519 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence256 122 2914 gene locus_tag LOCUS_22160 122 2914 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_22160 2911 3570 gene locus_tag LOCUS_22170 2911 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence257 1975 1478 gene locus_tag LOCUS_22180 1975 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2126 3103 gene locus_tag LOCUS_22190 2126 3103 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071169.1 protein_id gnl|my_center|LOCUS_22190 3048 3641 gene locus_tag LOCUS_22200 3048 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence258 <1 1523 gene locus_tag LOCUS_22210 <1 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071650.1:N-6 DNA methylase 1542 2498 gene locus_tag LOCUS_22220 1542 2498 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_22220 2509 3726 gene locus_tag LOCUS_22230 2509 3726 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708457.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence259 104 790 gene locus_tag LOCUS_22240 gene deoC 104 790 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436656.1 protein_id gnl|my_center|LOCUS_22240 1541 834 gene locus_tag LOCUS_22250 gene deoD 1541 834 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224877.1 protein_id gnl|my_center|LOCUS_22250 2775 1549 gene locus_tag LOCUS_22260 2775 1549 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456066.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence260 45 443 gene locus_tag LOCUS_22270 45 443 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196360.1 protein_id gnl|my_center|LOCUS_22270 495 2210 gene locus_tag LOCUS_22280 495 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2278 2838 gene locus_tag LOCUS_22290 2278 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2831 3439 gene locus_tag LOCUS_22300 2831 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence261 706 35 gene locus_tag LOCUS_22310 706 35 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029005.1 protein_id gnl|my_center|LOCUS_22310 1334 660 gene locus_tag LOCUS_22320 1334 660 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939178.1 protein_id gnl|my_center|LOCUS_22320 1434 1510 gene locus_tag LOCUS_t00340 1434 1510 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1867 1562 gene locus_tag LOCUS_22330 1867 1562 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390589.1 protein_id gnl|my_center|LOCUS_22330 2157 1867 gene locus_tag LOCUS_22340 2157 1867 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390588.1 protein_id gnl|my_center|LOCUS_22340 2691 2344 gene locus_tag LOCUS_22350 2691 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence262 290 559 gene locus_tag LOCUS_22360 290 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1642 593 gene locus_tag LOCUS_22370 gene hpxD 1642 593 CDS product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705426.1 protein_id gnl|my_center|LOCUS_22370 2612 1644 gene locus_tag LOCUS_22380 gene hpxD 2612 1644 CDS product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705426.1 protein_id gnl|my_center|LOCUS_22380 2734 3564 gene locus_tag LOCUS_22390 2734 3564 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968115.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence263 24 707 gene locus_tag LOCUS_22400 24 707 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_22400 831 1664 gene locus_tag LOCUS_22410 gene proC 831 1664 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_22410 1667 2248 gene locus_tag LOCUS_22420 1667 2248 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_22420 2326 2769 gene locus_tag LOCUS_22430 2326 2769 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233674.1 protein_id gnl|my_center|LOCUS_22430 3579 2809 gene locus_tag LOCUS_22440 3579 2809 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence264 874 8 gene locus_tag LOCUS_22450 874 8 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818697.1 protein_id gnl|my_center|LOCUS_22450 940 2418 gene locus_tag LOCUS_22460 940 2418 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083889.1 protein_id gnl|my_center|LOCUS_22460 <3583 2433 gene locus_tag LOCUS_22470 <3583 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005614782.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence265 2459 189 gene locus_tag LOCUS_22480 2459 189 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036896.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence266 67 573 gene locus_tag LOCUS_22490 67 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 624 1493 gene locus_tag LOCUS_22500 624 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 1593 2408 gene locus_tag LOCUS_22510 1593 2408 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_22510 2389 3168 gene locus_tag LOCUS_22520 2389 3168 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387878.1 protein_id gnl|my_center|LOCUS_22520 3155 3274 gene locus_tag LOCUS_22530 3155 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence267 1766 1506 gene locus_tag LOCUS_22540 1766 1506 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986881.1 protein_id gnl|my_center|LOCUS_22540 2801 1830 gene locus_tag LOCUS_22550 gene rbsR 2801 1830 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104051.1 protein_id gnl|my_center|LOCUS_22550 3043 3276 gene locus_tag LOCUS_22560 3043 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence268 1371 103 gene locus_tag LOCUS_22570 1371 103 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812683.1 protein_id gnl|my_center|LOCUS_22570 1950 1423 gene locus_tag LOCUS_22580 1950 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22580 2548 1943 gene locus_tag LOCUS_22590 gene mobA 2548 1943 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 protein_id gnl|my_center|LOCUS_22590 3433 2564 gene locus_tag LOCUS_22600 3433 2564 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074122.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence269 60 815 gene locus_tag LOCUS_22610 gene tpiA 60 815 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071430.1 protein_id gnl|my_center|LOCUS_22610 818 1189 gene locus_tag LOCUS_22620 818 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1223 1308 gene locus_tag LOCUS_t00350 1223 1308 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1897 1334 gene locus_tag LOCUS_22630 1897 1334 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161962652.1 protein_id gnl|my_center|LOCUS_22630 2490 1894 gene locus_tag LOCUS_22640 gene msrQ 2490 1894 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036769.1 protein_id gnl|my_center|LOCUS_22640 <3523 2556 gene locus_tag LOCUS_22650 <3523 2556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920589.1:protein-methionine-sulfoxide reductase catalytic subunit MsrP >Feature sequence270 932 87 gene locus_tag LOCUS_22660 932 87 CDS product quinoprotein dehydrogenase-associated SoxYZ-like carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966743.1 protein_id gnl|my_center|LOCUS_22660 1386 3392 gene locus_tag LOCUS_22670 1386 3392 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975084.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence271 1746 1009 gene locus_tag LOCUS_22680 1746 1009 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_22680 2513 1743 gene locus_tag LOCUS_22690 2513 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence272 2255 1272 gene locus_tag LOCUS_22700 gene rodZ 2255 1272 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370323.1 protein_id gnl|my_center|LOCUS_22700 3397 2309 gene locus_tag LOCUS_22710 3397 2309 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence273 1082 144 gene locus_tag LOCUS_22720 1082 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 1879 1331 gene locus_tag LOCUS_22730 1879 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2122 2601 gene locus_tag LOCUS_22740 2122 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2777 3082 gene locus_tag LOCUS_22750 2777 3082 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_22750 3098 3334 gene locus_tag LOCUS_22760 3098 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence274 133 1086 gene locus_tag LOCUS_22770 133 1086 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615550.1 protein_id gnl|my_center|LOCUS_22770 1150 2670 gene locus_tag LOCUS_22780 1150 2670 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400583.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence275 133 1086 gene locus_tag LOCUS_22790 133 1086 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615550.1 protein_id gnl|my_center|LOCUS_22790 1151 2668 gene locus_tag LOCUS_22800 1151 2668 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267462.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence276 2678 39 gene locus_tag LOCUS_22810 gene acnA 2678 39 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037030.1 protein_id gnl|my_center|LOCUS_22810 3360 2704 gene locus_tag LOCUS_22820 3360 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence277 650 1801 gene locus_tag LOCUS_22830 650 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 1919 3340 gene locus_tag LOCUS_22840 1919 3340 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399325.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence278 1259 636 gene locus_tag LOCUS_22850 1259 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2292 1288 gene locus_tag LOCUS_22860 2292 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 3374 2289 gene locus_tag LOCUS_22870 3374 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence279 607 2664 gene locus_tag LOCUS_22880 gene prlC 607 2664 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence280 110 1282 gene locus_tag LOCUS_22890 110 1282 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973391.1 protein_id gnl|my_center|LOCUS_22890 1285 2469 gene locus_tag LOCUS_22900 1285 2469 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206835.1 protein_id gnl|my_center|LOCUS_22900 2798 2523 gene locus_tag LOCUS_22910 2798 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence281 701 69 gene locus_tag LOCUS_22920 701 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 874 1623 gene locus_tag LOCUS_22930 874 1623 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188389.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence282 1158 151 gene locus_tag LOCUS_22940 1158 151 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_22940 2469 1216 gene locus_tag LOCUS_22950 2469 1216 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416640.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence283 1035 4 gene locus_tag LOCUS_22960 1035 4 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_22960 1125 1919 gene locus_tag LOCUS_22970 gene lgt 1125 1919 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_22970 1916 2710 gene locus_tag LOCUS_22980 1916 2710 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110588.1 protein_id gnl|my_center|LOCUS_22980 2793 3284 gene locus_tag LOCUS_22990 2793 3284 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008593045.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence284 651 430 gene locus_tag LOCUS_23000 651 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2817 760 gene locus_tag LOCUS_23010 2817 760 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_23010 3275 2835 gene locus_tag LOCUS_23020 3275 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence285 3018 1075 gene locus_tag LOCUS_23030 gene tkt 3018 1075 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703141.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence286 1236 94 gene locus_tag LOCUS_23040 gene ribD 1236 94 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035932.1 protein_id gnl|my_center|LOCUS_23040 1742 1236 gene locus_tag LOCUS_23050 gene nrdR 1742 1236 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010675395.1 protein_id gnl|my_center|LOCUS_23050 3068 1815 gene locus_tag LOCUS_23060 3068 1815 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269187.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence287 <1 620 gene locus_tag LOCUS_23070 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005071248.1:ATP phosphoribosyltransferase 667 1962 gene locus_tag LOCUS_23080 gene hisD 667 1962 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_23080 3076 1967 gene locus_tag LOCUS_23090 gene algW 3076 1967 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340656.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence288 <3183 1508 gene locus_tag LOCUS_23100 <3183 1508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198453.1:ATP-dependent helicase >Feature sequence289 1974 1039 gene locus_tag LOCUS_23110 1974 1039 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_23110 <3173 2018 gene locus_tag LOCUS_23120 <3173 2018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088367.1:nucleoside transporter C-terminal domain-containing protein >Feature sequence290 174 1373 gene locus_tag LOCUS_23130 174 1373 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_23130 1485 2987 gene locus_tag LOCUS_23140 1485 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence291 1875 853 gene locus_tag LOCUS_23150 gene trpD 1875 853 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 protein_id gnl|my_center|LOCUS_23150 2456 1875 gene locus_tag LOCUS_23160 2456 1875 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_23160 3096 2527 gene locus_tag LOCUS_23170 gene rpe 3096 2527 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085122.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence292 1105 53 gene locus_tag LOCUS_23180 gene hppD 1105 53 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197900.1 protein_id gnl|my_center|LOCUS_23180 1221 1475 gene locus_tag LOCUS_23190 1221 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 1481 1915 gene locus_tag LOCUS_23200 1481 1915 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_23200 1929 3017 gene locus_tag LOCUS_23210 1929 3017 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence293 <2999 1458 gene locus_tag LOCUS_23220 <2999 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390529.1:indolepyruvate/phenylpyruvate decarboxylase >Feature sequence294 423 1046 gene locus_tag LOCUS_23230 423 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 1129 1731 gene locus_tag LOCUS_23240 gene nthA 1129 1731 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174055.1 protein_id gnl|my_center|LOCUS_23240 1774 2439 gene locus_tag LOCUS_23250 gene nthB 1774 2439 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087268.1 protein_id gnl|my_center|LOCUS_23250 2439 2780 gene locus_tag LOCUS_23260 2439 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence295 299 1231 gene locus_tag LOCUS_23270 gene prfB 299 1231 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23270 1299 2786 gene locus_tag LOCUS_23280 gene lysS 1299 2786 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039707.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence296 <1 2847 gene locus_tag LOCUS_23290 <1 2847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258557.1:helicase-related protein >Feature sequence297 1239 88 gene locus_tag LOCUS_23300 1239 88 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_23300 2738 1368 gene locus_tag LOCUS_23310 2738 1368 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence298 125 520 gene locus_tag LOCUS_23320 125 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1995 673 gene locus_tag LOCUS_23330 gene rsmB 1995 673 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_23330 <2875 1992 gene locus_tag LOCUS_23340 <2875 1992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114642.1:methionyl-tRNA formyltransferase >Feature sequence299 142 447 gene locus_tag LOCUS_23350 142 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 1728 2267 gene locus_tag LOCUS_23360 1728 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence300 353 93 gene locus_tag LOCUS_23370 353 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 751 506 gene locus_tag LOCUS_23380 751 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1017 2111 gene locus_tag LOCUS_23390 1017 2111 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_23390 <2846 2137 gene locus_tag LOCUS_23400 <2846 2137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943338.1:substrate-binding domain-containing protein >Feature sequence301 >Feature sequence302 1756 698 gene locus_tag LOCUS_23410 gene alc 1756 698 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114681.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence303 >Feature sequence304 164 742 gene locus_tag LOCUS_23420 164 742 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_23420 2632 800 gene locus_tag LOCUS_23430 gene glmS 2632 800 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817475.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence305 743 1678 gene locus_tag LOCUS_23440 gene hemF 743 1678 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence306 59 73 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1170 283 gene locus_tag LOCUS_23450 1170 283 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_23450 1318 2475 gene locus_tag LOCUS_23460 gene metK 1318 2475 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence307 775 347 gene locus_tag LOCUS_23470 775 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1035 1394 gene locus_tag LOCUS_23480 1035 1394 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence308 1658 921 gene locus_tag LOCUS_23490 1658 921 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071944.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence309 1203 127 gene locus_tag LOCUS_23500 1203 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1705 1379 gene locus_tag LOCUS_23510 1705 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2163 1708 gene locus_tag LOCUS_23520 2163 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence310 <1 1268 gene locus_tag LOCUS_23530 <1 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704180.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC >Feature sequence311 68 1933 gene locus_tag LOCUS_23540 gene rpoD 68 1933 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 protein_id gnl|my_center|LOCUS_23540 2031 2246 gene locus_tag LOCUS_23550 2031 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2256 2332 gene locus_tag LOCUS_t00360 2256 2332 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence312 1436 309 gene locus_tag LOCUS_23560 gene dauA 1436 309 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113780.1 protein_id gnl|my_center|LOCUS_23560 1553 2257 gene locus_tag LOCUS_23570 1553 2257 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence313 <1 838 gene locus_tag LOCUS_23580 <1 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259191.1:Dam family site-specific DNA-(adenine-N6)-methyltransferase 857 1099 gene locus_tag LOCUS_23590 857 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1166 2314 gene locus_tag LOCUS_23600 1166 2314 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence314 1 318 gene locus_tag LOCUS_23610 gene grxD 1 318 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 protein_id gnl|my_center|LOCUS_23610 1038 361 gene locus_tag LOCUS_23620 gene dnaQ 1038 361 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444532.1 protein_id gnl|my_center|LOCUS_23620 1529 1068 gene locus_tag LOCUS_23630 gene rnhA 1529 1068 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_23630 2334 1546 gene locus_tag LOCUS_23640 2334 1546 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801254.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence315 402 106 gene locus_tag LOCUS_23650 402 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 889 563 gene locus_tag LOCUS_23660 889 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2322 1027 gene locus_tag LOCUS_23670 gene gshA 2322 1027 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence316 <1 750 gene locus_tag LOCUS_23680 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064312.1:phosphoglycerate kinase 751 2184 gene locus_tag LOCUS_23690 gene pyk 751 2184 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958436.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence317 120 353 gene locus_tag LOCUS_23700 120 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 776 979 gene locus_tag LOCUS_23710 776 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 1153 1377 gene locus_tag LOCUS_23720 1153 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 1796 2086 gene locus_tag LOCUS_23730 1796 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence318 820 50 gene locus_tag LOCUS_23740 820 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1676 810 gene locus_tag LOCUS_23750 1676 810 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966732.1 protein_id gnl|my_center|LOCUS_23750 2186 1716 gene locus_tag LOCUS_23760 2186 1716 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525383.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence319 1863 1483 gene locus_tag LOCUS_23770 1863 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence320 85 1428 gene locus_tag LOCUS_23780 85 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 1415 1933 gene locus_tag LOCUS_23790 1415 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence321 2167 206 gene locus_tag LOCUS_23800 gene dnaK 2167 206 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence322 <1 904 gene locus_tag LOCUS_23810 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089804.1:MBL fold metallo-hydrolase 1022 1597 gene locus_tag LOCUS_23820 1022 1597 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence323 1400 942 gene locus_tag LOCUS_23830 gene mraZ 1400 942 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103101.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence324 <1 997 gene locus_tag LOCUS_23840 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003128930.1:signal recognition particle-docking protein FtsY 1252 2103 gene locus_tag LOCUS_23850 gene rpoH 1252 2103 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013101924.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence325 282 1592 gene locus_tag LOCUS_23860 282 1592 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_23860 1677 1994 gene locus_tag LOCUS_23870 1677 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence326 1986 97 gene locus_tag LOCUS_23880 gene gspD 1986 97 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533584.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence327 1139 324 gene locus_tag LOCUS_23890 1139 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2052 1147 gene locus_tag LOCUS_23900 2052 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence328 314 502 gene locus_tag LOCUS_23910 314 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 592 1941 gene locus_tag LOCUS_23920 gene amt 592 1941 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383316.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence329 177 1679 gene locus_tag LOCUS_23930 177 1679 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083030.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence330 400 2 gene locus_tag LOCUS_23940 gene vapC 400 2 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 protein_id gnl|my_center|LOCUS_23940 630 400 gene locus_tag LOCUS_23950 gene vapB 630 400 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380366.1 protein_id gnl|my_center|LOCUS_23950 829 1518 gene locus_tag LOCUS_23960 829 1518 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence331 <1 608 gene locus_tag LOCUS_23970 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770759.1:enoyl-ACP reductase FabI 617 1828 gene locus_tag LOCUS_23980 617 1828 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence332 1601 228 gene locus_tag LOCUS_23990 1601 228 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218121790.1 protein_id gnl|my_center|LOCUS_23990